HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wen, R. Articles by Wang, D. Search for Related Content PubMed PubMed Citation Articles by Wen, R. Articles by Wang, D.

Phospholipase C2 Is Essential for Specific Functions of FcR and FcR¹

Renren Wen^*, Shiann-Tarng Jou, Yuhong Chen^*,, Angelica Hoffmeyer and Demin Wang^2,*,¶

^* The Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, WI 53226; Department of Pediatrics, National Taiwan University Hospital, Taipei, Taiwan; Institute of Molecular Medicine, Nanjing University, Nanjing, Peoples Republic of China; Department of Pharmacology, Byk Gulden, Konstanz, Germany; and ^¶ Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, WI 53226

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Phospholipase C2 (PLC2) plays a critical role in the functions of the B cell receptor in B cells and of the FcR chain-containing collagen receptor in platelets. Here we report that PLC2 is also expressed in mast cells and monocytes/macrophages and is activated by cross-linking of FcR and FcR. Although PLC2-deficient mice have normal development and numbers of mast cells and monocytes/macrophages, we demonstrate that PLC2 is essential for specific functions of FcR and FcR. While PLC2-deficient mast cells have normal mitogen-activated protein kinase activation and cytokine production at mRNA levels, the mutant cells have impaired FcR-mediated Ca²⁺ flux and inositol 1,4,5-trisphosphate production, degranulation, and cytokine secretion. As a physiological consequence of the effect of PLC2 deficiency, the mutant mice are resistant to IgE-mediated cutaneous inflammatory skin reaction. Macrophages from PLC2-deficient mice have no detectable FcR-mediated Ca²⁺ flux; however, the mutant cells have normal FcR-mediated phagocytosis. Moreover, PLC2 plays a nonredundant role in FcR-mediated inflammatory skin reaction.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Receptors for the Fc portion of Ig (FcR) are members of the Ig receptor superfamily, which also includes TCRs and B cell receptors (BCR).³ FcRs couple humoral and cellular immunity by directing the interaction of Abs with effector cells. These receptors exist for every Ab class and are exemplified by FcR, which binds IgG; FcR, which binds IgA; and FcR, which binds IgE. High affinity FcRs are referred to as FcRI, and low affinity FcRs are referred to as FcRII/III. High affinity FcRs can bind noncomplexed, monomeric Igs, while low affinity FcR bind aggregated Igs or Abs complexed to multivalent Ags (1, 2, 3).

FcRs are widely distributed in hemopoietic cells and mediate a wide array of biological functions (1, 2). FcRI is expressed primarily by mast cells and basophils (3). Cross-linking of the FcRI on mast cells induces the release of granules containing histamine, serotonin, -hexosaminidase, and mast cell-specific proteases, accompanied by transcription and secretion of multiple cytokines, including IL-1 through -6, IL-9, IL-10, IL-13, IL-16, TNF-, TGF-, and GM-CSF, ultimately leading to an allergic reaction (4, 5). FcRs, including FcRI, FcRII, and FcRIII, are widely expressed in most hemopoietic cells, including monocytes/macrophages, neutrophils, NK cells, and platelets (6, 7, 8). These receptors also mediate a wide array of biological functions, including respiratory burst, release of inflammatory mediators and cytokines, endocytosis, Ab-dependent cell cytotoxicity (ADCC), and anaphylaxis (6, 7, 9, 10).

FcRs with immunoreceptor tyrosine-based activation motifs are capable of triggering cell activation. Ab-induced FcR aggregation activates several cytoplasmic protein tyrosine kinases, including Src family kinases, Syk family kinases, and Tec family kinases (11, 12, 13, 14, 15, 16, 17, 18). In turn, the activated tyrosine kinases rapidly phosphorylate many intracellular substrates, leading to activation of multiple signaling pathways, which include phospholipase C (PLC). PLC hydrolyzes phosphatidylinositols to generate diacylglycerol and inositol phosphates, including inositol 1,4,5-trisphosphate (IP₃) (19). The diacylglycerol activates protein kinase C (PKC), while IP₃ mediates the mobilization of Ca²⁺ from internal stores, resulting in a transient intracellular Ca²⁺ ([Ca²⁺]i) flux (19). PLC is activated by FcR in mast cells (20), by FcRIIIA in NK cells (21, 22, 23), and by FcRI or FcRIIA in neutrophils (24) and monocytes (18, 25). The PLC/Ca²⁺/PKC pathway has been shown to be involved in the activation of all types of mitogen-activated protein kinases (MAPK; ERKs, c-Jun N-terminal kinases (JNKs), and p38 MAPKs) (26, 27, 28, 29, 30), although the PKC-independent Grb2/Sos/Raf1 pathway plays a primary role in the activation of MAPKs (27, 31, 32, 33, 34). Activated PKC can promote the activation of ERK1 and ERK2 (26, 27, 28). Calcium and PKC also participate in JNK activation (29, 30). In addition, PKC is required for the maximum activation of p38 MAPK (29, 30, 35). The PLC/Ca²⁺/PKC pathway leads to the activation of transcription factors, including NFAT and Elk-1 (36, 37, 38). Ultimately, activation of the FcR induces phagocytosis, ADCC, respiratory burst, degranulation, production of inflammatory cytokines, and enhanced Ag presentation (1).

Two isoforms of PLC, PLC1 and PLC2, have been identified. The PLC1 isoform is ubiquitously expressed, whereas PLC2 is predominantly expressed in hemopoietic cells (39). The potential physiological role of PLC1 has been approached by the derivation of mice that lack the enzyme. Disruption of the PLC1 gene resulted in embryonic lethality during early to midgestation on approximately embryonic day 9 (40). This early embryonic lethality precludes in vivo analysis of the role of PLC1 in Ig superfamily receptor signaling. However, studies of PLC1-deficient fibroblasts have shown that epidermal growth factor failed to mobilize intracellular Ca²⁺ in the mutant cells, while epidermal growth factor -induced DNA synthesis, cell growth, and cell migration were normal (40). Unlike PLC1, disruption of the PLC2 gene does not lead to embryonic lethality. PLC2-deficient B cells have impaired BCR-mediated signaling, resulting in xid-like immunodeficiency with defective B cell development and function (41). PLC2 is also an essential component of FcR-chain-containing collagen receptor signaling pathways, wherein PLC2 deficiency causes platelet dysfunction and fetal hemorrhage (41). The first characterization of PLC2-deficient mice has shown that PLC2 deficiency correlates with defective FcR-mediated ADCC activity in NK cells and decreased FcR-induced degranulation in mast cells (41). Here we reveal that both PLC1 and PLC2 are involved in FcR signaling in mast cells, and that PLC2 is essential for specific FcR-mediated functions. PLC2 deficiency results in partially impaired FcR-induced Ca²⁺ flux and IP₃ production; decreased FcR-mediated release of serotonin, arachidonic acid, and histamine; and resistance to IgE-mediated inflammatory skin reaction. In addition, we demonstrate that PLC2 plays a nonredundant role in FcR-induced Ca²⁺ flux in monocytes/macrophages and in FcR-mediated inflammatory skin reaction in vivo. Interestingly, PLC2 deficiency did not affect FcR-mediated phagocytosis in monocytes/macrophages.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Immunoprecipitation/Western blotting

Wild-type and PLC2-deficient mast cells (2.5 x 10⁶/ml) were preloaded with mouse anti-TNP IgE (4 µg/ml; C38-2; BD PharMingen, San Diego, CA) overnight and subsequently stimulated with rabbit anti-mouse IgE Ab (10 µg/ml; R35-72; BD PharMingen). After stimulation, cells were lysed on ice and centrifuged to remove debris as previously described (42). The supernatant was incubated with Abs against PLC1 (Santa Cruz Biotechnology, Santa Cruz, CA) or PLC2 (Santa Cruz Biotechnology). Immune complexes were precipitated with protein A-Sepharose, washed three times in lysis buffer, eluted with sample buffer for SDS-PAGE, and transferred to nitrocellulose. Membranes were probed with anti-phosphotyrosine (4G10; Upstate Biotechnology, Lake Placid, NY) or the designated Abs and visualized with an ECL detection system (Amersham Pharmacia Biotech, Arlington Heights, IL).

Calcium fluorometry

Bone marrow-derived mast cells (2 x 10⁶/ml) were incubated with IgE anti-DNP mAb (10 mg/ml; SPE-7; Sigma-Aldrich, St. Louis, MO) in DMEM with 10% FBS on ice for 1 h. Then, Indo-1 (10 µg/ml; Molecular Probes, Eugene, OR) was added to the cells, followed by further incubation at room temperature for 30 min. The cells were washed and stimulated with DNP-human serum albumin (HSA; 100 ng/ml; Sigma). The calcium concentration was determined by flow cytometry.

For macrophages/monocytes, leukocytes were purified from mouse peripheral blood with Polymorphprep (NYCOMED PHARMA, Oslo, Norway) according to the manufacturer. The cells were loaded with Indo-1 (10 µg/ml) at room temperature for 30 min, followed by incubation with anti-FcII/III monoclonal IgG (10 µg/ml; 2.4G2; BD PharMingen) and PE-conjugated anti-Mac-1 Abs (BD PharMingen) on ice for 30 min. The cells were washed and warmed to room temperature, then stimulated with rabbit anti-rat IgG (10 µg/ml; Southern Biotechnology Associates, Birmingham, AL). The calcium concentration was determined by flow cytometry in Mac-1-positive cells.

[Ca²⁺]_i was determined as previously described (43). The maximum ratio (R_max) was determined by adding ionomycin (10 µg/ml) in cells, and the minimum ratio (R_min) was determined following depletion of external Ca²⁺ by 5 mM EGTA. The [Ca²⁺]_i was calculated according to the equation [Ca²⁺]_i = kDa (R - R_min)/(R_max - R)(S_f2/S_b2), where K_d is 230 nM, and S_f2 and S_b2 are the fluorescence intensities at 490 nm of the Ca²⁺-free and Ca²⁺-saturated indicators, respectively.

Measurement of IP₃

FcR-mediated IP₃ induction was measured with the IP₃ radioreceptor assay kit (PerkinElmer, Palo Alto, CA) according to manufacturer’s instructions. Briefly, the bone marrow-derived mast cells were suspended at 1 x 10⁶/ml and incubated with mouse IgE mAb (4 µg/ml) for 12 h. The cells were extensively washed in medium, stimulated with anti-mouse IgE mAb (10 µg/ml) for 0, 2, 5, and 10 min, then collected and subjected to IP₃ radioreceptor assay.

MAPK assay

To examine the activation of ERK1/2, p38, and JNK1/2, wild-type and PLC2-deficient mast cells (3 x 10⁶) were preloaded with mouse anti-TNP IgE overnight and subsequently stimulated with rabbit anti-mouse IgE Ab (10 µg/ml) for 0, 10, and 30 min. Cells were lysed, and cell lysate was immunoprecipitated with anti-ERK1/2, anti-p38, and anti-JNK1/2 (all from Santa Cruz Biotechnology) Abs, and in vitro kinase assays were employed to measure the activation of three MAPKs. Autophosphorylation of ERK1 and ERK2 was measured. The myelin basic protein (MBP) peptide was used as substrate for p38, while the GST-c-Jun peptide was used as substrate for JNK.

Mast cells and degranulation assay

Bone marrow cells from wild-type or mutant mice were cultured in RPMI 1640 medium containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, 25 U/ml rIL-3 (R&D Systems, Minneapolis, MN), and 10% heat-inactivated FBS (HyClone, Logan, UT) for 4–8 wk, with medium replacement every 3–4 days.

For the serotonin release assay, bone marrow-derived mast cells were suspended at 1 x 10⁶/ml and incubated with mouse IgE mAb (4 µg/ml) and 5 µCi/ml [³H]serotonin (NEN, Boston, MA) for 16 h. The cells were extensively washed in medium and then stimulated with anti-mouse IgE mAb (10 µg/ml) for 60 min. [³H]Serotonin released into the supernatant and remaining in the cell pellet was quantitated.

For the arachidonic acid release assay, bone marrow-derived mast cells were suspended at 1 x 10⁶/ml and incubated with mouse IgE mAb (4 µg/ml) for 12 h, followed by incubation with 2.5 µCi/ml [³H]arachidonic acid (PerkinElmer) for 2 h. The cells were extensively washed in medium and then stimulated with anti-mouse IgE mAb (10 µg/ml) for 60 min. [³H]Arachidonic acid released into the supernatant and remaining in the cell pellet was quantitated.

For histamine release, 8- to 10-wk-old PLC2-deficient and wild-type mice were injected i.v. with 2 µg of monoclonal mouse anti-DNP IgE (Sigma-Aldrich) diluted in 200 µl of DMEM. Twenty-four hours later the mice were injected i.v. with 500 µg of DNP-HSA (Sigma-Aldrich) for 2 min. The mice were euthanized, and blood was immediately collected. Serum histamine concentration was determined using a competitive histamine immunoassay kit (Immunotech, Westbrook, ME).

RT-PCR

Mouse anti-TNP IgE-sensitized wild-type and PLC2-deficient mast cells (5 x 10⁵ cells) were stimulated with anti-mouse IgE mAb (10 µg/ml). Total RNA was prepared from cells by RNAzol B (Tel-Test, Inc., Friendswood, TX), and first-strand cDNA was synthesized from total RNA with the GeneAmp RT-PCR kit (PerkinElmer). The specific primers for each individual cytokine and actin are as follows: IL-2 forward, TGGAGCAGCTGTTGATGGACCTAC; IL-2 reverse, AGATGATGCTTTGACAGAAGGCTATC; IL-3 forward, GTGGCCGGGATACCCACCGTTTAAC; IL-3 reverse, TGGCAGCGCAGAGTCATTCGCAGAT; IL-4 forward, GAGATCATCGGCATTTTGAAC; IL-4 reverse, CTTGGACTCATTCATGGTGCA; IL-6 forward, ATGAAGTTCCTCTCTGCAAGAGAC; IL-6 reverse, GTAGCATCCATCATTTCTTTGTAT; TGF- forward, AGACGGAATACAGGGCTTTCGATTC; TGF- reverse, CTTGGGCTTGCGACCCACGTAGTA; IFN- forward, CTTCTTCAGCAACAGCAAGGCGAAA; IFN- reverse, CCCCCAGATACAACCCCGCAATCA; actin forward, ACTCCTATGTGGGTGACGAG; and actin reverse, CAGGTCCAGACGCAGGATGGC. Actin was used as the RNA control.

IgE-mediated inflammatory skin reaction

Eight- to 10-week-old wild-type and PLC2-deficient mice were lightly anesthetized and injected intradermally on the basolateral side with 20 ng/ml of monoclonal mouse anti-DNP IgE (Sigma-Aldrich) diluted in 20 µl of DMEM. DMEM alone was used as the negative control. Twenty-four hours later the mice were injected i.v. with 100 µg of DNP-HSA (Sigma-Aldrich) in 100 µl of PBS with 1% Evans blue dye (Sigma-Aldrich). Sixty minutes later, extravazation was visualized by blue staining of the injection sites at the reverse side of skin sections as an indication for a positive inflammatory skin reaction.

FcR-mediated inflammatory skin reaction

Wild-type and PLC2-deficient mice were injected intradermally on the basolateral side with rabbit IgG anti-OVA or saline in 25 µl. Two hours later, 500 µg of OVA with 1% Evans blue in 100 µl of DMEM was injected i.v. About 30 min later extravazation was visualized by blue staining of the injection sites at the reverse side of skin sections as an indication of a positive inflammatory skin reaction.

Macrophages

Macrophages were obtained through two methods. First, bone marrow cells from wild-type and PLC2-deficient mice were cultured in DMEM containing 2 mM glutamine, 100 U/ml of penicillin, 100 µg/ml of streptomycin, 10% FBS, and 10% L929 cell-conditioned medium as a source of M-CSF. Nonadherent cells were removed 1–2 days later and transferred to a fresh 150-mm plate. Nonadherent cells were removed from this secondary culture 4 days later and discarded. The adherent cultures were used 5–7 days after initial harvest from the mice, when confluence was achieved. Cultures generated via this protocol were almost pure macrophages. Second, macrophages were obtained from thioglycolate-elicited peritoneum. Wild-type and PLC2-deficient mice were injected i.p. with 1 ml of 5% thioglycolate, and peritoneal exudate cells were harvested 3 days later. The cells were suspended in -MEM supplemented with 10% heat-inactivated FCS at 1 x 10⁶ cell/ml. They were plated in 24-well culture plates at 1 ml/well and incubated for 6 h at 37°C in 5% CO₂. The adherent macrophages were obtained after the nonadherent cells were rinsed away with PBS.

FcR-mediated phagocytosis

Thioglycollate-elicited peritoneal wild-type and PLC2-deficient macrophages were cultured on slides and incubated with anti-SRBC IgG2a- or IgG2b-opsonized SRBCs. Nonopsonized SRBCs were used as negative controls. After 1-h culture at 37°C, the slides were washed with water, fixed in 0.25% glutaraldehyde, and photographed. Phagocytosis was quantified by calculating the percentage of phagocytosis (percentage of macrophages containing at least one ingested SRBC) and the phagocytic index (the percentage of phagocytosis times the mean number of phagocytosed SRBC per macrophage) after counting 30–40 macrophages.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
PLC2-deficient mast cells have impaired FcR-induced Ca²⁺ flux, but normal activation of MAPKs

Cross-linking of FcRI on mast cells activates protein tyrosine kinases and induces elevation of [Ca²⁺]_i. Activation of both PLC members, PLC1 and PLC2, is regulated through tyrosine kinases. We first examined the expression pattern of PLC1 and PLC2 in mast cells derived from wild-type mouse bone marrow. PLC1 and PLC2 were immunoprecipitated from mast cell lysates and identified in Western blots by PLC1- or PLC2-specific Abs, respectively. As shown in Fig. 1A, both PLC1 and PLC2 were expressed in wild-type mast cells. Next, we examined whether PLC1 and PLC2 could be activated, indicated by tyrosine phosphorylation, following FcR engagement in the mast cells. The bone marrow-derived mast cells were coated with monoclonal murine IgE and subsequently activated with rabbit anti-mouse IgE Ab. As shown in Fig. 1B, not only were both PLC1 and PLC2 activated by engagement of FcR in wild-type mast cells, but the time courses of activation of the two PLCs were comparable. In addition, PLC2 deficiency had no effect on the expression and activation of PLC1 in PLC2-deficient mast cells (Fig. 1C).

View larger version (47K): [in this window] [in a new window]   FIGURE 1. A, Expression of PLC1 and PLC2 in mast cells. Wild-type mast cells were immunoprecipitated and Western blotted with anti-PLC1 or anti-PLC2 Abs. B, A time course of PLC1 and PLC2 activation by FcR. Wild-type mast cells were preincubated with monoclonal murine IgE, followed by stimulation with anti-IgE mAbs. At the indicated time points the cells were lysed and analyzed for the induction of tyrosine phosphorylation of PLC1 and PLC2 by Western blotting with phosphotyrosine-specific mAb (4G10). C, Activation of PLC1 and PLC2 by FcR in wild-type and PLC2-deficient mast cells. Wild-type (+/+) and PLC2-deficient (-/-) mast cells were preincubated with monoclonal murine IgE, followed by stimulation with anti-IgE mAbs for 2 min. The cells were lysed and analyzed for the induction of tyrosine phosphorylation of PLC1 and PLC2 by Western blotting with phosphotyrosine-specific mAb (4G10). D, Induction of Ca2+ flux by FcR. Wild-type (+/+) and PLC2-deficient (-/-) mast cells were preincubated with monoclonal murine IgE. Induction of [Ca2+]i was measured by flow cytometry following stimulation of Indo-1-labeled, IgE-coated mast cells with anti-IgE. Anti-IgE was added at the time indicated by arrow a. Ionomycin was added at the time indicated by arrow b. The figure shown is representative of three independent analyses. E, FcR-mediated induction of IP3. Wild-type (+/+) and PLC2-deficient (-/-) mast cells were preincubated with monoclonal murine IgE, followed by stimulation with anti-IgE Abs for the indicated times. The cells were collected at the indicated times, and the levels of IP3 were measured using an IP3 assay kit. The figure shown is representative of two independent analyses. F, Level of FcR expression on mast cells. Wild-type (+/+) and PLC2-deficient (-/-) mast cells were preincubated with monoclonal murine IgE or control serum, followed by incubation with rabbit anti-IgE Abs and FITC-conjugated anti-rabbit Abs. The level of FcR expression was measured by flow cytometry. G, Activation of MAPK family members ERK, p38, and JNK by FcR. Wild-type (+/+) and PLC2-deficient (-/-) mast cells were preincubated with monoclonal murine IgE, followed by stimulation with anti-IgE Abs for the indicated times. The cells were lysed, and MAPKs were immunoprecipitated with anti-ERK1/2, anti-p38, and anti-JNK1 Abs. In vitro kinase assays were employed to measure the activation of three MAPKs. Autophosphorylation of ERK1 and ERK2 was measured. The MBP peptide was used as a substrate for p38, while GST-c-Jun peptide was used as a substrate for JNK. The figure shown is representative of three independent analyses.

We next sought to determine whether the reduced magnitude of the Ca²⁺ signal in PLC2-deficient mast cells affected the activation of other signaling events and cellular function. Engagement of the FcR leads to activation of the PLC pathway, which, in turn, can promote and/or enhance activation of all three types of MAPKs, including ERKs, JNKs, and p38 MAPKs (29, 30, 35, 44, 45). Therefore, we evaluated the extent of ERK, JNK, and p38 MAPK activation in PLC2-deficient, relative to wild-type, mast cells in response to FcR cross-linking. As shown in Fig. 1G, PLC2 deficiency had no effect on the activation of any of these three types of MAPKs.

PLC2-deficient mast cells have impaired degranulation, but normal cytokine transcription, after FcR engagement

Engagement of the FcR induces the release of granules and the secretion of multiple cytokines, including IL-1 through -6, IL-9, IL-10, IL-13, IL-16, TNF-, TGF-, GM-CSF, and IFN-, leading to allergic reactions. We examined the ability of PLC2-deficient mast cells to release inflammatory mediators and cytokines after FcR ligation. As illustrated in Fig. 2A, degranulation, as measured by the release of [³H]serotonin, was reduced in PLC2-deficient mast cells. In addition, the FcR-mediated release of arachidonic acid was reduced in PLC2-deficient mast cells (Fig. 2B). However, ionomycin, but not PMA, was able to restore the ability of PLC2-deficient mast cells to release arachidonic acid to the same extent as that of wild-type mast cells (Fig. 2B). Next, we examined the extent of histamine release by mast cells following engagement of FcR in wild-type and PLC2-deficient mice. Wild-type mice showed an increase in the serum concentration of histamine, whereas increases in the serum histamine concentration in PLC2-deficient mice were decreased relative to those in wild-type animals (Fig. 2C). These data demonstrated that Ca²⁺ flux amplitude (Fig. 1D) correlated with the extent of degranulation.

View larger version (42K): [in this window] [in a new window]   FIGURE 2. A, Serotonin release from wild-type (+/+) and PLC2-deficient (-/-) mast cells. Mast cells were preincubated with [3H]serotonin and monoclonal murine IgE. [3H]Serotonin released into the supernatant was quantitated after exposure to anti-IgE Abs. The figure shown is representative of three independent analyses. B, Arachidonic acid release from wild-type (+/+) and PLC2-deficient (-/-) mast cells. Mast cells were preincubated with monoclonal murine IgE, followed by incubation with [3H]Arachidonic acid. [3H]arachidonic acid released into the supernatant was quantitated after exposure to anti-IgE Abs, PMA, or ionomycin. The error bars represent the SD of duplicates in the experiment. The figure shown is representative of three independent analyses. *, For statistical analysis, the amount of arachidonic acid released by wild-type mast cells in a given experiment was assigned a value of 100%, and the amount of arachidonic acid released by PLC2-deficient mast cells was calculated as a percentage of wild-type release for that experiment. Normalized data were then subjected to Student’s t test, which revealed that the PLC2-deficient mast cells released significantly less arachidonic acid (p < 0.01) relative to wild-type mast cells. C, Serum histamine release from wild-type (+/+) and PLC2-deficient (-/-) mice. Mice were sensitized with monoclonal mouse anti-DNP IgE. PBS alone was used as a negative control. Subsequently, the mice were injected i.v. with DNP-HSA. Blood was collected, and the serum histamine concentration was determined. D, Cytokine mRNA transcription induction in wild-type (+/+) and PLC2-deficient (-/-) mast cells. Mast cells were preincubated with monoclonal murine IgE. After exposure to anti-IgE Abs, cells were collected and subjected to RT-PCR analysis for detection of the indicated cytokine expression. The figure shown is representative of two independent analyses. E, FcR-mediated secretion of IL-6 in wild-type (+/+) and PLC2-deficient (-/-) mast cells. Mast cells were preincubated with monoclonal murine IgE. After exposure to anti-IgE Abs, cell supernatant was collected and subjected to ELISA analysis for detection of IL-6 proteins at the indicated time points. The figure shown is representative of two independent analyses. F, Restoration of IL-6 secretion in PLC2-deficient (-/-) mast cells by ionomycin. Mast cells were preincubated with monoclonal murine IgE. After exposure to anti-IgE Abs, PMA, or ionomycin for 2 h, cell supernatants were collected and subjected to ELISA analysis for detection of IL-6 proteins. The figure shown is representative of two independent analyses.

PLC2-deficient mice are resistant to IgE-mediated inflammatory skin reaction

The ability of PLC2-deficient mice to develop an inflammatory skin reaction in response to IgE-mediated activation was examined. In passive inflammatory skin reaction, local extravasation, fibrin deposition, and tissue swelling are induced by local injection of Ag-specific IgE, followed by i.v. antigenic challenge. As shown in Fig. 3, IgE-mediated passive cutaneous anaphylaxis in PLC2-deficient mice was decreased compared with that in wild-type controls. These data demonstrate that PLC2 plays an essential role in the FcR-mediated inflammatory skin reaction.

View larger version (98K): [in this window] [in a new window]   FIGURE 3. IgE-mediated cutaneous inflammatory skin reaction. Wild-type (+/+) and PLC2-deficient (-/-) mice were lightly anesthetized and injected intradermally at the basolateral side with monoclonal mouse anti-DNP IgE. Twenty-four hours later the mice were injected i.v. with DNP-HSA with Evans blue dye. Extravazation was visualized by blue staining at the injection sites on the reverse side of skin sections removed from the sites of intradermal injection (red arrows). The figure shown is representative of samples from six individual mice with similar results.

FcR-induced Ca²⁺ flux in macrophages is dependent upon the presence of PLC2

There are three classes of Fc receptors for IgG in the mouse: the high affinity receptor FcRI, which is capable of binding monomeric IgG, and the two low affinity receptors, FcRII and FcRIII, which bind polymeric IgG. All three classes of FcR are expressed on monocytes/macrophages. We first examined the expression pattern of PLC1 and PLC2 in macrophages. In contrast to mast cells, which express both PLC1 and PLC2, only PLC2 was detected in wild-type, bone marrow-derived macrophages, and neither PLC isoform was detectable in PLC2-deficient, bone marrow-derived macrophages (Fig. 4A). This expression pattern indicates that PLC2 may be the sole PLC isoform available for FcR signaling in macrophages. Engagement of FcRII/III in Mac1⁺ macrophages/monocytes induced only a transient increase in [Ca²⁺]_i, which quickly returned to basal levels (Fig. 4B). As expected, cross-linking of FcRII/III failed to induce any increase in [Ca²⁺]_i in PLC2-deficient Mac1⁺ cells (Fig. 4B). These data demonstrate that Ca²⁺ flux in response to engagement of the FcR in macrophages/monocytes is dependent upon PLC2.

View larger version (19K): [in this window] [in a new window]   FIGURE 4. A, Expression of PLC1 and PLC2 in macrophages. Bone marrow-derived pure wild-type (+/+) and PLC2-deficient (-/-) macrophages were immunoprecipitated and Western blotted with anti-PLC1 or anti-PLC2 Abs, respectively. B, Induction of Ca2+ flux by FcR in wild-type (+/+) and PLC2-deficient (-/-) macrophages. Leukocytes purified from mouse peripheral blood were loaded with Indo-1, followed by incubation with anti-FcII/III monoclonal IgG and PE-conjugated anti-Mac-1 Abs. Induction of Ca2+ flux was measured in Mac-1-positive cells by flow cytometry following stimulation with rabbit anti-rat IgG. Anti-rat IgG was added at the time indicated by arrow a. Ionomycin was added at the time indicated by arrow b. The figure shown is representative of two independent analyses.

FcR-regulated phagocytosis is normal in PLC2-deficient macrophages

One of the important biological responses mediated by the FcR is phagocytosis. FcRI- and FcRII/III-mediated phagocytoses were compared in wild-type and PLC2-deficient macrophages. FcR-mediated phagocytosis was assessed by the ability of thioglycolate-elicited peritoneal macrophages to internalize SRBCs opsonized with IgG. IgG2a-opsonized SRBCs are bound and internalized by the high affinity FcRI, while IgG2b-opsonized SRBCs are bound and internalized by the low affinity FcRII/III. As shown in Fig. 5, macrophages from PLC2-deficient mice internalized either IgG2a-opsonized (percentage of phagocytosis, 91.7 ± 2.9%; phagocytic index, 9.5 ± 1.7) or IgG2b-opsonized (percentage of phagocytosis, 72.5 ± 3.5%; phagocytic index, 2.0 ± 0.3) particles as efficiently as did wild-type macrophages (IgG2a: percentage of phagocytosis, 93.7 ± 3.0%; phagocytic index, 9.7 ± 0.8; IgG2b: percentage of phagocytosis, 80.0 ± 7.0%; phagocytic index, 2.7 ± 0.4). Since PLC2-deficient macrophages fail to express either isoform of PLC (Fig. 4A), we conclude that the PLC pathway is dispensable for FcRI- and FcRII/III-mediated phagocytosis in macrophages.

View larger version (126K): [in this window] [in a new window]   FIGURE 5. FcR-mediated phagocytosis. Thioglycolate-elicited peritoneal macrophages from wild-type (+/+) and PLC2-deficient (-/-) mice were cultured on slides and incubated with SRBC opsonized with anti-SRBC IgG2a- or IgG2b-Abs. Nonopsonized SRBCs were used as negative controls. The slides were washed with water, fixed in 0.25% glutaraldehyde, and photographed. The figure shown is representative of three independent analyses.

PLC2 is essential for FcR-mediated passive inflammatory skin reaction

IgG immune complexes can trigger anaphylaxis via engagement of the FcR on mast cells (59). To assess the role of PLC2 in the FcR-mediated passive inflammatory skin reaction in vivo, wild-type and PLC2-deficient mice were injected intradermally at the basolateral side with rabbit anti-OVA IgG Abs. The extent of inflammatory skin reaction was determined by assessing the degree of extravazation of blue dye on the reverse side of skin sections removed from sites of intradermal injection. As shown in Fig. 6, the FcR-mediated inflammatory skin reaction in PLC2-deficient mice was decreased compared with that in wild-type controls. These data demonstrate that PLC2 plays an essential role in the FcR-mediated inflammatory skin reaction.

View larger version (51K): [in this window] [in a new window]   FIGURE 6. FcR-mediated cutaneous inflammatory skin reaction. Wild-type (+/+) and PLC2-deficient (-/-) mice were injected intradermally at the basolateral side with rabbit IgG anti-OVA, followed by injection of OVA with Evans blue dye. Extravazation was visualized by blue staining at the injection sites on the reverse side of skin sections removed from the sites of intradermal injection (red arrows). The figure shown is representative of samples from five individual mice with similar results.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Although engagement of the FcR activates both PLC1 and PLC2, previous studies have suggested that PLC1, but not PLC2, is the primary contributor to IP₃ production and Ca²⁺ flux in a mast cell line, RBL-2H3 (60). Contrary to current belief, our results clearly demonstrate the important role of PLC2 in FcR signaling and function in primary mast cells. Nonetheless, it is highly possible that PLC1 also plays an essential role in FcR function. One simple model is that an initial spike in [Ca²⁺]_i is required for the release of Ca²⁺ stores from the endoplasmic reticulum via IP₃-gated channels (61). Emptying of these stores then causes the opening of plasma membrane Ca²⁺ channels (store-operated channel (SOC)), allowing ions from outside the cell to maintain an elevated [Ca²⁺]_i (61, 62). A relatively high level of IP₃ is required to empty internal stores sufficiently to open the SOC and generate a sustained flux. Lower levels of IP₃ produce a smaller release phase that generally decays rapidly (61). Therefore, cross-linking of the FcR activates both PLC1 and PLC2, leading to an initial [Ca²⁺]_i spike high enough to open the SOC and generate a sustained flux. The absence of PLC2 reduces the level of IP₃ production by FcR engagement (Fig. 1E), resulting in decreases in both the initial spike and the sustained plateau of [Ca²⁺]_i. Consistent with this model, there is no detectable difference in the activation kinetics of PLC1 and PLC2 by FcR engagement (Fig. 1B). However, it is also possible that PLC1 and PLC2 play unique roles in FcR function. Previous studies have shown that phosphoinositol 3-kinase inhibitor, wortmannin, specifically blocks the activation of PLC1, but not PLC2 (60). The different activation mechanisms of PLC1 and PLC2 indicate that their relative contributions to FcR function may differ. Further studies of PLC1-deficient and PLC1/PLC2 double-deficient mast cells will help to address this issue.

The different effects of PLC2 deficiency on FcR signaling in mast cells and on FcR signaling in macrophages could be due to the different mechanisms by which these two receptors signal. Engagement of the FcR activates both PLC1 and PLC2 as well as sphingosine kinase (63). Sphingosine kinase phosphorylates sphingosine into sphingosine-1-phosphate, which alone is able to trigger a Ca²⁺ response (63). The absence of PLC2 reduces the level of IP₃ production by FcR engagement, leading to decreases in both the initial spike and the sustained plateau of [Ca²⁺]_i. The residual Ca²⁺ induction by FcR engagement in PLC2-deficient mast cells could be due to the activation of PLC1 and/or sphingosine kinase. In contrast, engagement of FcR in monocytes/macrophages only activates PLC2 to produce IP₃. Therefore, PLC2 deficiency totally abrogates FcR-induced Ca²⁺ flux in monocytes/macrophages.

Engagement of FcR activates Src family kinases, Syk family kinases, and Tec family kinases (11, 13, 14, 15, 16, 17, 18). Through adapter proteins linker for activation of T cells (LAT), Src homology 2 domain-containing leukocyte protein-76, and p95^Vav, activated tyrosine kinases, in turn, initiate downstream pathways, including PLC/PKC/Ca²⁺ and MAPKs (ERK, p38, and JNK) (64, 65, 66). It is known that the Grb2/Sos/Raf1 pathway is a potent pathway activating MAPKs (27, 31, 32, 33, 34). Upon receptor ligation, through the adaptor protein Grb2, a Ras guanine nucleotide exchange factor, Sos, is recruited to the membrane, where it activates Ras (67, 68). Activated Ras associates with and activates Raf-1 Ser/Thr kinase, leading to a cascade of kinase activation, which finally activates ERK1 and ERK2 kinases (27, 32, 54). Nonetheless, a number of studies have shown that the PLC/PKC/Ca²⁺ pathway also contributes to the activation of all three MAPKs (ERK, p38, and JNK) (26, 27, 28, 29, 30, 33, 35, 45). However, PLC2 deficiency had no effect on the activation of any of the three MAPKs, suggesting that activation of MAPKs is either independent of PKC/Ca²⁺ signals or insensitive to the decreased amplitude of the PKC/Ca²⁺ signals. Our previous studies, which showed that BCR ligation in PLC2-deficient B cells generates no PKC/Ca²⁺ signals, but activates all three MAPKs (41), support the idea that MAPK activation is independent of PKC/Ca²⁺ signals.

The signals that lead to induction of cytokines are not fully understood. The elevated levels of [Ca²⁺]_i initiate association of Ca²⁺ with calmodulin, which activates the Ca²⁺/calmodulin-dependent phosphatase, calcineurin (38). Calcineurin, in turn, activates the NFAT family of transcription factors (69, 70), which interact with the AP-1 transcription activation complex and cooperatively bind to the composite NFAT/AP-1 site to regulate the expression of multiple genes, including IL-2 (38). PKC also plays an essential role in the induction of cytokines, in that PKC is essential for activation of NF-B (71, 72) and production of IL-2 (72). Whereas the promoters that control the expression of various cytokines are different (55, 56, 57, 58) and may be differentially affected by the amplitude and duration of PKC/Ca²⁺ signals, the transcription of all the cytokines that we examined was not affected by the impaired amplitude of FcR-mediated Ca²⁺ flux observed in PLC2-deficient mast cells. Therefore, the transcription of these cytokines may either be independent of or insensitive to the amplitude and duration of the PKC/Ca²⁺ signal generated upon cross-linking of the FcR in mast cells. To discriminate between these possibilities, it will be necessary to examine FcR-mediated cytokine expression in mast cells that are deficient in both PLC1 and PLC2.

Intracellular signals generated upon cross-linking of FcRs, similar to those initiated by engagement of the FcR, involve activation of Src family and Syk family tyrosine kinases as well as adapter proteins LAT, Src homology 2 domain-containing leukocyte protein-76, and B cell linker protein, and lead to activation of the PLC pathway (15, 25, 73, 74, 75, 76). Among these signal transduction pathway components, Src family kinases, Syk kinase and the adapter protein LAT have all been shown to play critical roles in FcR-regulated phagocytosis (75, 77, 78, 79). In addition, FcR-mediated phagocytosis is via Ca²⁺-dependent and Ca²⁺-independent pathways (80, 81, 82, 83) Moreover, PKC, which is activated by PLC, has been reported to play a role in regulating phagocytosis (83, 84). It was surprising, therefore, that PLC2-deficient macrophages phagocytosed IgG2a (FcRI-dependent) or IgG2b (FcRII/III-dependent) immune complexes normally compared with wild-type macrophages, especially in light of the observation that these mutant macrophages did not express the alternative PLC1 isoform and failed to mobilize Ca²⁺ in response to FcR cross-linking. These data support the idea that the PLC/PKC/Ca²⁺ pathway is not required for FcR-mediated phagocytosis. Nevertheless, our previous studies demonstrated that PLC2 is essential for FcR-containing collagen receptor-mediated release of ATP/ADP and thromboxin A₂ in platelets (41) and is essential for FcR-mediated ADCC activity in NK cells (41). Therefore, PLC2 is essential for certain functions of FcR, but it is dispensable for other functions of these receptors.

Following engagement of FcR and FcR in mast cells, inflammatory mediators, including histamine, serotonin, and -hexosaminidase, are released from granules, leading to allergic reactions (61). Previous studies have demonstrated that activation of PKC and elevation of intracellular Ca²⁺ are sufficient and necessary for the release of these inflammatory mediators from granules (85, 86, 87). By contrast, studies have shown that the MAPKs are not required for the release of these inflammatory mediators, but are involved in the production of arachidonic acid and cytokines (27, 33, 88). Here we demonstrate that PLC2 deficiency partially impaired Ca²⁺ signals following engagement of the FcR in mast cells, resulting in a reduced FcR-mediated release of serotonin, histamine, and arachidonic acid, but had no effect on cytokine transcription. These results support the idea that PKC/Ca²⁺ signals are essential for mast cell degranulation, whereas MAPKs are involved in cytokine production. However, these results also reveal that mast cell degranulation, secretion of cytokines, and resulting allergic reactions are dependent upon and sensitive to the amplitude of PKC/Ca²⁺ signals. Moreover, PLC2 deficiency affects the release of arachidonic acid. One possible explanation is that although the release of arachidonic acid is regulated primarily through MAPK, PKC may transiently influence this release (33).

PLC2-deficient mice were resistant to FcR-mediated cutaneous inflammatory skin reaction. Similarly, PLC2-deficient mice were resistant to FcR-mediated cutaneous inflammatory skin reaction, demonstrating that the PLC/PKC/Ca²⁺ pathway also plays an essential role in the FcR-mediated inflammatory skin reaction. These results identify PLC2 as a possible new therapeutic target for the prevention or treatment of allergic reactions.

	Acknowledgments

 
We thank Debra K Newman for critical review of this manuscript and helpful discussion.

	Footnotes

 
¹ This work was supported by funds from the Blood Research Institute Foundation of The Blood Center of Southeastern Wisconsin.

² Address correspondence and reprint requests to Dr. Demin Wang, The Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, WI 53226. E-mail address: dwang{at}bcsew.edu

³ Abbreviations used in this paper: BCR, B cell receptor; ADCC, Ab-dependent cell cytotoxicity; [Ca²⁺]i, intracellular Ca²⁺; HSA, human serum albumin; IP₃, inositol 1,4,5-trisphosphate; JNK, c-Jun N-terminal kinase; LAT, linker for activation of T cells; MAPK, mitogen-activated protein kinase; MBP, myelin basic protein; PKC, protein kinase C; PLC2, phospholipase C2; SLP76, SH2-domain-containing leukocyte protein of 76 kDa; SOC, store-operated channel; LAT, linker for activation of T cell.

Received for publication February 19, 2002. Accepted for publication October 11, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Ravetch, J. V.. 1997. Fc receptors. Curr. Opin. Immunol. 9:121.[Medline]
2. Ravetch, J. V., R. A. Clynes. 1998. Divergent roles for Fc receptors and complement in vivo. Annu. Rev. Immunol. 16:421.[Medline]
3. Daeron, M.. 1997. Fc receptor biology. Annu. Rev. Immunol. 15:203.[Medline]
4. Serafin, W. E., K. F. Austen. 1987. Mediators of immediate hypersensitivity reactions. N. Engl. J. Med. 317:30.[Medline]
5. Galli, S. J.. 1993. New concepts about the mast cell. N. Engl. J. Med. 328:257.[Free Full Text]
6. Diamond, B., B. R. Bloom, M. D. Scharff. 1978. The Fc receptors of primary and cultured phagocytic cells studied with homogeneous antibodies. J. Immunol. 121:1329.[Abstract/Free Full Text]
7. Weinshank, R. L., A. D. Luster, J. V. Ravetch. 1988. Function and regulation of a murine macrophage-specific IgG Fc receptor, FcR-. J. Exp. Med. 167:1909.[Abstract/Free Full Text]
8. McKenzie, S. E., A. D. Schreiber. 1998. Fc receptors in phagocytes. Curr. Opin. Hematol. 5:16.[Medline]
9. Nathan, C. F., H. W. Murray, Z. A. Cohn. 1980. The macrophage as an effector cell. N. Engl. J. Med. 303:622.[Medline]
10. Takai, T., M. Li, D. Sylvestre, R. Clynes, J. V. Ravetch. 1994. FcR chain deletion results in pleiotrophic effector cell defects. Cell 76:519.[Medline]
11. Eiseman, E., J. B. Bolen. 1992. Engagement of the high-affinity IgE receptor activates src protein-related tyrosine kinases. Nature 355:78.[Medline]
12. Hutchcroft, J. E., R. L. Geahlen, G. G. Deanin, J. M. Oliver. 1992. FcRI-mediated tyrosine phosphorylation and activation of the 72-kDa protein-tyrosine kinase, PTK72, in RBL-2H3 rat tumor mast cells. Proc. Natl. Acad. Sci. USA 89:9107.[Abstract/Free Full Text]
13. Pignata, C., K. V. Prasad, M. J. Robertson, H. Levine, C. E. Rudd, J. Ritz. 1993. FcRIIIA-mediated signaling involves src-family lck in human natural killer cells. J. Immunol. 151:6794.[Abstract]
14. Durden, D. L., H. M. Kim, B. Calore, Y. Liu. 1995. The FcRI receptor signals through the activation of hck and MAP kinase. J. Immunol. 154:4039.[Abstract]
15. Ghazizadeh, S., J. B. Bolen, H. B. Fleit. 1994. Physical and functional association of Src-related protein tyrosine kinases with FcRII in monocytic THP-1 cells. J. Biol. Chem. 269:8878.[Abstract/Free Full Text]
16. Benhamou, M., N. J. Ryba, H. Kihara, H. Nishikata, R. P. Siraganian. 1993. Protein-tyrosine kinase p72^syk in high affinity IgE receptor signaling. Identification as a component of pp72 and association with the receptor chain after receptor aggregation. J. Biol. Chem. 268:23318.[Abstract/Free Full Text]
17. Darby, C., R. L. Geahlen, A. D. Schreiber. 1994. Stimulation of macrophage FcRIIIA activates the receptor-associated protein tyrosine kinase Syk and induces phosphorylation of multiple proteins including p95^Vav and p62/GAP-associated protein. J. Immunol. 152:5429.[Abstract]
18. Kiener, P. A., B. M. Rankin, A. L. Burkhardt, G. L. Schieven, L. K. Gilliland, R. B. Rowley, J. B. Bolen, J. A. Ledbetter. 1993. Cross-linking of Fc receptor I (FcRI) and receptor II (FcRII) on monocytic cells activates a signal transduction pathway common to both Fc receptors that involves the stimulation of p72 Syk protein tyrosine kinase. J. Biol. Chem. 268:24442.[Abstract/Free Full Text]
19. Rhee, S. G., Y. S. Bae. 1997. Regulation of phosphoinositide-specific phospholipase C isozymes. J. Biol. Chem. 272:15045.[Free Full Text]
20. Park, D. J., H. K. Min, S. G. Rhee. 1991. IgE-induced tyrosine phosphorylation of phospholipase C-1 in rat basophilic leukemia cells. J. Biol. Chem. 266:24237.[Abstract/Free Full Text]
21. Liao, F., H. S. Shin, S. G. Rhee. 1993. Cross-linking of FcRIIIA on natural killer cells results in tyrosine phosphorylation of PLC-1 and PLC-2. J. Immunol. 150:2668.[Abstract]
22. Ting, A. T., C. J. Dick, R. A. Schoon, L. M. Karnitz, R. T. Abraham, P. J. Leibson. 1995. Interaction between lck and syk family tyrosine kinases in Fc receptor-initiated activation of natural killer cells. J. Biol. Chem. 270:16415.[Abstract/Free Full Text]
23. Xu, X., A. S. Chong. 1996. Vav in natural killer cells is tyrosine phosphorylated upon cross-linking of FcRIIIA and is constitutively associated with a serine/threonine kinase. Biochem. J. 318:527.
24. Dusi, S., M. Donini, V. Della Bianca, F. Rossi. 1994. Tyrosine phosphorylation of phospholipase C-2 is involved in the activation of phosphoinositide hydrolysis by Fc receptors in human neutrophils. Biochem. Biophys. Res. Commun. 201:1100.[Medline]
25. Bonilla, F. A., R. M. Fujita, V. I. Pivniouk, A. C. Chan, R. S. Geha. 2000. Adapter proteins SLP-76 and BLNK both are expressed by murine macrophages and are linked to signaling via Fc receptors I and II/III. Proc. Natl. Acad. Sci. USA 97:1725.[Abstract/Free Full Text]
26. Chao, T. S., D. A. Foster, U. R. Rapp, M. R. Rosner. 1994. Differential Raf requirement for activation of mitogen-activated protein kinase by growth factors, phorbol esters, and calcium. J. Biol. Chem. 269:7337.[Abstract/Free Full Text]
27. Hirasawa, N., F. Santini, M. A. Beaven. 1995. Activation of the mitogen-activated protein kinase/cytosolic phospholipase A2 pathway in a rat mast cell line: indications of different pathways for release of arachidonic acid and secretory granules. J. Immunol. 154:5391.[Abstract]
28. Roa, M., F. Paumet, J. Le Mao, B. David, U. Blank. 1997. Involvement of the ras-like GTPase rab3d in RBL-2H3 mast cell exocytosis following stimulation via high affinity IgE receptors (FcRI). J. Immunol. 159:2815.[Abstract]
29. Jiang, A., A. Craxton, T. Kurosaki, E. A. Clark. 1998. Different protein tyrosine kinases are required for B cell antigen receptor-mediated activation of extracellular signal-regulated kinase, c-Jun NH2-terminal kinase 1, and p38 mitogen-activated protein kinase. J. Exp. Med. 188:1297.[Abstract/Free Full Text]
30. Hashimoto, A., H. Okada, A. Jiang, M. Kurosaki, S. Greenberg, E. A. Clark, T. Kurosaki. 1998. Involvement of guanosine triphosphatases and phospholipase C-2 in extracellular signal-regulated kinase, c-Jun NH₂-terminal kinase, and p38 mitogen-activated protein kinase activation by the B cell antigen receptor. J. Exp. Med. 188:1287.[Abstract/Free Full Text]
31. Marshall, C. J.. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80:179.[Medline]
32. Hirasawa, N., A. Scharenberg, H. Yamamura, M. A. Beaven, J. P. Kinet. 1995. A requirement for Syk in the activation of the microtubule-associated protein kinase/phospholipase A2 pathway by FcR1 is not shared by a G protein-coupled receptor. J. Biol. Chem. 270:10960.[Abstract/Free Full Text]
33. Zhang, C., N. Hirasawa, M. A. Beaven. 1997. Antigen activation of mitogen-activated protein kinase in mast cells through protein kinase C-dependent and independent pathways. J. Immunol. 158:4968.[Abstract]
34. Kawakami, Y., S. E. Hartman, P. M. Holland, J. A. Cooper, T. Kawakami. 1998. Multiple signaling pathways for the activation of JNK in mast cells: involvement of Bruton’s tyrosine kinase, protein kinase C, and JNK kinases, SEK1 and MKK7. J. Immunol. 161:1795.[Abstract/Free Full Text]
35. Campbell, K. S.. 1999. Signal transduction from the B cell antigen-receptor. Curr. Opin. Immunol. 11:256.[Medline]
36. Healy, J. I., R. E. Dolmetsch, L. A. Timmerman, J. G. Cyster, M. L. Thomas, G. R. Crabtree, R. S. Lewis, C. C. Goodnow. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419.[Medline]
37. Jain, J., P. G. McCaffrey, Z. Miner, T. K. Kerppola, J. N. Lambert, G. L. Verdine, T. Curran, A. Rao. 1993. The T-cell transcription factor NFATp is a substrate for calcineuri