|
|
||||||||
2 Is Essential for Specific Functions of Fc
R and Fc
R1



* The Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, WI 53226;
Department of Pediatrics, National Taiwan University Hospital, Taipei, Taiwan;
Institute of Molecular Medicine, Nanjing University, Nanjing, Peoples Republic of China;
Department of Pharmacology, Byk Gulden, Konstanz, Germany; and
¶ Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, WI 53226
| Abstract |
|---|
|
|
|---|
2 (PLC
2) plays a critical role in the
functions of the B cell receptor in B cells and of the FcR
chain-containing collagen receptor in platelets. Here we report that
PLC
2 is also expressed in mast cells and monocytes/macrophages and
is activated by cross-linking of Fc
R and Fc
R. Although
PLC
2-deficient mice have normal development and numbers of mast
cells and monocytes/macrophages, we demonstrate that PLC
2 is
essential for specific functions of Fc
R and Fc
R. While
PLC
2-deficient mast cells have normal mitogen-activated protein
kinase activation and cytokine production at mRNA levels, the mutant
cells have impaired Fc
R-mediated Ca2+ flux and inositol
1,4,5-trisphosphate production, degranulation, and cytokine secretion.
As a physiological consequence of the effect of PLC
2 deficiency, the
mutant mice are resistant to IgE-mediated cutaneous inflammatory skin
reaction. Macrophages from PLC
2-deficient mice have no detectable
Fc
R-mediated Ca2+ flux; however, the mutant cells have
normal Fc
R-mediated phagocytosis. Moreover, PLC
2 plays a
nonredundant role in Fc
R-mediated inflammatory skin
reaction. | Introduction |
|---|
|
|
|---|
R, which binds IgG; Fc
R, which binds IgA; and
Fc
R, which binds IgE. High affinity FcRs are referred to as FcRI,
and low affinity FcRs are referred to as FcRII/III. High affinity FcRs
can bind noncomplexed, monomeric Igs, while low affinity FcR bind
aggregated Igs or Abs complexed to multivalent Ags
(1, 2, 3).
FcRs are widely distributed in hemopoietic cells and mediate a wide
array of biological functions (1, 2). Fc
RI is expressed
primarily by mast cells and basophils (3). Cross-linking
of the Fc
RI on mast cells induces the release of granules containing
histamine, serotonin,
-hexosaminidase, and mast cell-specific
proteases, accompanied by transcription and secretion of multiple
cytokines, including IL-1 through -6, IL-9, IL-10, IL-13, IL-16,
TNF-
, TGF-
, and GM-CSF, ultimately leading to an allergic
reaction (4, 5). Fc
Rs, including Fc
RI, Fc
RII, and
Fc
RIII, are widely expressed in most hemopoietic cells, including
monocytes/macrophages, neutrophils, NK cells, and platelets
(6, 7, 8). These receptors also mediate a wide array of
biological functions, including respiratory burst, release of
inflammatory mediators and cytokines, endocytosis, Ab-dependent cell
cytotoxicity (ADCC), and anaphylaxis (6, 7, 9, 10).
FcRs with immunoreceptor tyrosine-based activation motifs are capable
of triggering cell activation. Ab-induced FcR aggregation activates
several cytoplasmic protein tyrosine kinases, including Src family
kinases, Syk family kinases, and Tec family kinases
(11, 12, 13, 14, 15, 16, 17, 18). In turn, the activated tyrosine kinases rapidly
phosphorylate many intracellular substrates, leading to activation of
multiple signaling pathways, which include phospholipase C
(PLC
).
PLC
hydrolyzes phosphatidylinositols to generate diacylglycerol and
inositol phosphates, including inositol 1,4,5-trisphosphate
(IP3) (19). The diacylglycerol
activates protein kinase C (PKC), while IP3
mediates the mobilization of Ca2+ from internal
stores, resulting in a transient intracellular
Ca2+ ([Ca2+]i) flux
(19). PLC
is activated by Fc
R in mast cells
(20), by Fc
RIIIA in NK cells (21, 22, 23), and
by Fc
RI or Fc
RIIA in neutrophils (24) and monocytes
(18, 25). The PLC
/Ca2+/PKC
pathway has been shown to be involved in the activation of all types of
mitogen-activated protein kinases (MAPK; ERKs, c-Jun N-terminal kinases
(JNKs), and p38 MAPKs) (26, 27, 28, 29, 30), although the
PKC-independent Grb2/Sos/Raf1 pathway plays a primary role in the
activation of MAPKs (27, 31, 32, 33, 34). Activated PKC can
promote the activation of ERK1 and ERK2 (26, 27, 28). Calcium
and PKC also participate in JNK activation (29, 30). In
addition, PKC is required for the maximum activation of p38 MAPK
(29, 30, 35). The PLC
/Ca2+/PKC
pathway leads to the activation of transcription factors, including
NFAT and Elk-1 (36, 37, 38). Ultimately, activation of
the FcR induces phagocytosis, ADCC, respiratory burst, degranulation,
production of inflammatory cytokines, and enhanced Ag presentation
(1).
Two isoforms of PLC
, PLC
1 and PLC
2, have been identified. The
PLC
1 isoform is ubiquitously expressed, whereas PLC
2 is
predominantly expressed in hemopoietic cells (39). The
potential physiological role of PLC
1 has been approached by the
derivation of mice that lack the enzyme. Disruption of the PLC
1 gene
resulted in embryonic lethality during early to midgestation on
approximately embryonic day 9 (40). This early embryonic
lethality precludes in vivo analysis of the role of PLC
1 in Ig
superfamily receptor signaling. However, studies of PLC
1-deficient
fibroblasts have shown that epidermal growth factor failed to mobilize
intracellular Ca2+ in the mutant cells, while
epidermal growth factor -induced DNA synthesis, cell growth, and cell
migration were normal (40). Unlike PLC
1, disruption of
the PLC
2 gene does not lead to embryonic lethality.
PLC
2-deficient B cells have impaired BCR-mediated signaling,
resulting in xid-like immunodeficiency with defective B cell
development and function (41). PLC
2 is also an
essential component of FcR
-chain-containing collagen receptor
signaling pathways, wherein PLC
2 deficiency causes platelet
dysfunction and fetal hemorrhage (41). The first
characterization of PLC
2-deficient mice has shown that PLC
2
deficiency correlates with defective Fc
R-mediated ADCC activity in
NK cells and decreased Fc
R-induced degranulation in mast cells
(41). Here we reveal that both PLC
1 and PLC
2 are
involved in Fc
R signaling in mast cells, and that PLC
2 is
essential for specific Fc
R-mediated functions. PLC
2 deficiency
results in partially impaired Fc
R-induced Ca2+
flux and IP3 production; decreased
Fc
R-mediated release of serotonin, arachidonic acid, and histamine;
and resistance to IgE-mediated inflammatory skin reaction. In addition,
we demonstrate that PLC
2 plays a nonredundant role in Fc
R-induced
Ca2+ flux in monocytes/macrophages and in
Fc
R-mediated inflammatory skin reaction in vivo. Interestingly,
PLC
2 deficiency did not affect Fc
R-mediated phagocytosis in
monocytes/macrophages.
| Materials and Methods |
|---|
|
|
|---|
Wild-type and PLC
2-deficient mast cells (2.5 x
106/ml) were preloaded with mouse anti-TNP
IgE (4 µg/ml; C38-2; BD PharMingen, San Diego, CA) overnight and
subsequently stimulated with rabbit anti-mouse IgE Ab (10 µg/ml;
R35-72; BD PharMingen). After stimulation, cells were lysed on ice and
centrifuged to remove debris as previously described (42).
The supernatant was incubated with Abs against PLC
1 (Santa Cruz
Biotechnology, Santa Cruz, CA) or PLC
2 (Santa Cruz Biotechnology).
Immune complexes were precipitated with protein A-Sepharose, washed
three times in lysis buffer, eluted with sample buffer for SDS-PAGE,
and transferred to nitrocellulose. Membranes were probed with
anti-phosphotyrosine (4G10; Upstate Biotechnology, Lake Placid, NY)
or the designated Abs and visualized with an ECL detection system
(Amersham Pharmacia Biotech, Arlington Heights, IL).
Calcium fluorometry
Bone marrow-derived mast cells (2 x 106/ml) were incubated with IgE anti-DNP mAb (10 mg/ml; SPE-7; Sigma-Aldrich, St. Louis, MO) in DMEM with 10% FBS on ice for 1 h. Then, Indo-1 (10 µg/ml; Molecular Probes, Eugene, OR) was added to the cells, followed by further incubation at room temperature for 30 min. The cells were washed and stimulated with DNP-human serum albumin (HSA; 100 ng/ml; Sigma). The calcium concentration was determined by flow cytometry.
For macrophages/monocytes, leukocytes were purified from mouse
peripheral blood with Polymorphprep (NYCOMED PHARMA, Oslo, Norway)
according to the manufacturer. The cells were loaded with Indo-1 (10
µg/ml) at room temperature for 30 min, followed by incubation with
anti-Fc
II/III monoclonal IgG (10 µg/ml; 2.4G2; BD PharMingen)
and PE-conjugated anti-Mac-1 Abs (BD PharMingen) on ice for 30 min.
The cells were washed and warmed to room temperature, then stimulated
with rabbit anti-rat IgG (10 µg/ml; Southern Biotechnology
Associates, Birmingham, AL). The calcium concentration was determined
by flow cytometry in Mac-1-positive cells.
[Ca2+]i was determined as previously described (43). The maximum ratio (Rmax) was determined by adding ionomycin (10 µg/ml) in cells, and the minimum ratio (Rmin) was determined following depletion of external Ca2+ by 5 mM EGTA. The [Ca2+]i was calculated according to the equation [Ca2+]i = kDa (R - Rmin)/(Rmax - R)(Sf2/Sb2), where Kd is 230 nM, and Sf2 and Sb2 are the fluorescence intensities at 490 nm of the Ca2+-free and Ca2+-saturated indicators, respectively.
Measurement of IP3
FcR-mediated IP3 induction was measured with the IP3 radioreceptor assay kit (PerkinElmer, Palo Alto, CA) according to manufacturers instructions. Briefly, the bone marrow-derived mast cells were suspended at 1 x 106/ml and incubated with mouse IgE mAb (4 µg/ml) for 12 h. The cells were extensively washed in medium, stimulated with anti-mouse IgE mAb (10 µg/ml) for 0, 2, 5, and 10 min, then collected and subjected to IP3 radioreceptor assay.
MAPK assay
To examine the activation of ERK1/2, p38
, and JNK1/2,
wild-type and PLC
2-deficient mast cells (3 x
106) were preloaded with mouse anti-TNP IgE
overnight and subsequently stimulated with rabbit anti-mouse IgE Ab
(10 µg/ml) for 0, 10, and 30 min. Cells were lysed, and cell lysate
was immunoprecipitated with anti-ERK1/2, anti-p38, and
anti-JNK1/2 (all from Santa Cruz Biotechnology) Abs, and in vitro
kinase assays were employed to measure the activation of three MAPKs.
Autophosphorylation of ERK1 and ERK2 was measured. The myelin basic
protein (MBP) peptide was used as substrate for p38, while the
GST-c-Jun peptide was used as substrate for JNK.
Mast cells and degranulation assay
Bone marrow cells from wild-type or mutant mice were cultured in RPMI 1640 medium containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, 25 U/ml rIL-3 (R&D Systems, Minneapolis, MN), and 10% heat-inactivated FBS (HyClone, Logan, UT) for 48 wk, with medium replacement every 34 days.
For the serotonin release assay, bone marrow-derived mast cells were suspended at 1 x 106/ml and incubated with mouse IgE mAb (4 µg/ml) and 5 µCi/ml [3H]serotonin (NEN, Boston, MA) for 16 h. The cells were extensively washed in medium and then stimulated with anti-mouse IgE mAb (10 µg/ml) for 60 min. [3H]Serotonin released into the supernatant and remaining in the cell pellet was quantitated.
For the arachidonic acid release assay, bone marrow-derived mast cells were suspended at 1 x 106/ml and incubated with mouse IgE mAb (4 µg/ml) for 12 h, followed by incubation with 2.5 µCi/ml [3H]arachidonic acid (PerkinElmer) for 2 h. The cells were extensively washed in medium and then stimulated with anti-mouse IgE mAb (10 µg/ml) for 60 min. [3H]Arachidonic acid released into the supernatant and remaining in the cell pellet was quantitated.
For histamine release, 8- to 10-wk-old PLC
2-deficient and wild-type
mice were injected i.v. with 2 µg of monoclonal mouse anti-DNP
IgE (Sigma-Aldrich) diluted in 200 µl of DMEM. Twenty-four hours
later the mice were injected i.v. with 500 µg of DNP-HSA
(Sigma-Aldrich) for 2 min. The mice were euthanized, and blood was
immediately collected. Serum histamine concentration was determined
using a competitive histamine immunoassay kit (Immunotech,
Westbrook, ME).
RT-PCR
Mouse anti-TNP IgE-sensitized wild-type and
PLC
2-deficient mast cells (5 x 105
cells) were stimulated with anti-mouse IgE mAb (10 µg/ml). Total
RNA was prepared from cells by RNAzol B (Tel-Test, Inc., Friendswood,
TX), and first-strand cDNA was synthesized from total RNA with the
GeneAmp RT-PCR kit (PerkinElmer). The specific primers for each
individual cytokine and actin are as follows: IL-2 forward,
TGGAGCAGCTGTTGATGGACCTAC; IL-2 reverse,
AGATGATGCTTTGACAGAAGGCTATC; IL-3 forward,
GTGGCCGGGATACCCACCGTTTAAC; IL-3 reverse, TGGCAGCGCAGAGTCATTCGCAGAT;
IL-4 forward, GAGATCATCGGCATTTTGAAC; IL-4 reverse,
CTTGGACTCATTCATGGTGCA; IL-6 forward, ATGAAGTTCCTCTCTGCAAGAGAC;
IL-6 reverse, GTAGCATCCATCATTTCTTTGTAT; TGF-
forward,
AGACGGAATACAGGGCTTTCGATTC; TGF-
reverse,
CTTGGGCTTGCGACCCACGTAGTA; IFN-
forward,
CTTCTTCAGCAACAGCAAGGCGAAA; IFN-
reverse,
CCCCCAGATACAACCCCGCAATCA; actin forward, ACTCCTATGTGGGTGACGAG; and
actin reverse, CAGGTCCAGACGCAGGATGGC. Actin was used as the RNA
control.
IgE-mediated inflammatory skin reaction
Eight- to 10-week-old wild-type and PLC
2-deficient mice were
lightly anesthetized and injected intradermally on the basolateral side
with 20 ng/ml of monoclonal mouse anti-DNP IgE (Sigma-Aldrich)
diluted in 20 µl of DMEM. DMEM alone was used as the negative
control. Twenty-four hours later the mice were injected i.v. with 100
µg of DNP-HSA (Sigma-Aldrich) in 100 µl of PBS with 1% Evans blue
dye (Sigma-Aldrich). Sixty minutes later, extravazation was visualized
by blue staining of the injection sites at the reverse side of skin
sections as an indication for a positive inflammatory skin
reaction.
Fc
R-mediated inflammatory skin reaction
Wild-type and PLC
2-deficient mice were injected intradermally
on the basolateral side with rabbit IgG anti-OVA or saline in 25
µl. Two hours later, 500 µg of OVA with 1% Evans blue in 100 µl
of DMEM was injected i.v. About 30 min later extravazation was
visualized by blue staining of the injection sites at the reverse side
of skin sections as an indication of a positive inflammatory skin
reaction.
Macrophages
Macrophages were obtained through two methods. First, bone
marrow cells from wild-type and PLC
2-deficient mice were cultured in
DMEM containing 2 mM glutamine, 100 U/ml of penicillin, 100 µg/ml of
streptomycin, 10% FBS, and 10% L929 cell-conditioned medium as a
source of M-CSF. Nonadherent cells were removed 12 days later and
transferred to a fresh 150-mm plate. Nonadherent cells were removed
from this secondary culture 4 days later and discarded. The adherent
cultures were used 57 days after initial harvest from the mice, when
confluence was achieved. Cultures generated via this protocol were
almost pure macrophages. Second, macrophages were obtained from
thioglycolate-elicited peritoneum. Wild-type and PLC
2-deficient mice
were injected i.p. with 1 ml of 5% thioglycolate, and peritoneal
exudate cells were harvested 3 days later. The cells were suspended in
-MEM supplemented with 10% heat-inactivated FCS at 1 x
106 cell/ml. They were plated in 24-well culture
plates at 1 ml/well and incubated for 6 h at 37°C in 5%
CO2. The adherent macrophages were obtained after
the nonadherent cells were rinsed away with PBS.
Fc
R-mediated phagocytosis
Thioglycollate-elicited peritoneal wild-type and
PLC
2-deficient macrophages were cultured on slides and incubated
with anti-SRBC IgG2a- or IgG2b-opsonized SRBCs. Nonopsonized SRBCs
were used as negative controls. After 1-h culture at 37°C, the slides
were washed with water, fixed in 0.25% glutaraldehyde, and
photographed. Phagocytosis was quantified by calculating the percentage
of phagocytosis (percentage of macrophages containing at least one
ingested SRBC) and the phagocytic index (the percentage of phagocytosis
times the mean number of phagocytosed SRBC per macrophage) after
counting 3040 macrophages.
| Results |
|---|
|
|
|---|
2-deficient mast cells have impaired Fc
R-induced
Ca2+ flux, but normal activation of MAPKs
Cross-linking of Fc
RI on mast cells activates protein tyrosine
kinases and induces elevation of
[Ca2+]i. Activation of both PLC
members, PLC
1 and PLC
2, is regulated through tyrosine kinases. We
first examined the expression pattern of PLC
1 and PLC
2 in mast
cells derived from wild-type mouse bone marrow. PLC
1 and PLC
2
were immunoprecipitated from mast cell lysates and identified in
Western blots by PLC
1- or PLC
2-specific Abs, respectively. As
shown in Fig. 1
A, both PLC
1
and PLC
2 were expressed in wild-type mast cells. Next, we examined
whether PLC
1 and PLC
2 could be activated, indicated by tyrosine
phosphorylation, following Fc
R engagement in the mast cells. The
bone marrow-derived mast cells were coated with monoclonal murine IgE
and subsequently activated with rabbit anti-mouse IgE Ab. As shown
in Fig. 1
B, not only were both PLC
1 and PLC
2 activated
by engagement of Fc
R in wild-type mast cells, but the time courses
of activation of the two PLCs were comparable. In addition, PLC
2
deficiency had no effect on the expression and activation of PLC
1 in
PLC
2-deficient mast cells (Fig. 1
C).
|
R on mast cells led to an initial spike in
[Ca2+]i, followed by a sustained
plateau of intermediate Ca2+ concentration that
slowly decayed to basal levels. As shown in Fig. 1
2-deficient mast cells exhibited an increase in
intracellular Ca2+ concentration following Fc
R
cross-linking, the amplitude of Ca2+ elevation
was decreased compared with that in wild-type cells. These results were
in contrast to the effects of PLC
2 deficiency on BCR signaling,
where cross-linking of the BCR failed to induce any increase in
[Ca2+]i in PLC
2-deficient B
cells (41). Consistent with the decreased
Ca2+ flux, Fc
R-mediated
IP3 induction was also reduced (Fig. 1
R on PLC
2-deficient mast cells, as the level of
Fc
R expression on PLC
2-deficient mast cells was comparable to
that on wild-type mast cells (Fig. 1
We next sought to determine whether the reduced magnitude of the
Ca2+ signal in PLC
2-deficient mast cells
affected the activation of other signaling events and cellular
function. Engagement of the Fc
R leads to activation of the PLC
pathway, which, in turn, can promote and/or enhance activation of all
three types of MAPKs, including ERKs, JNKs, and p38 MAPKs (29, 30, 35, 44, 45). Therefore, we evaluated the extent of ERK, JNK,
and p38 MAPK activation in PLC
2-deficient, relative to wild-type,
mast cells in response to Fc
R cross-linking. As shown in Fig. 1
G, PLC
2 deficiency had no effect on the activation of
any of these three types of MAPKs.
PLC
2-deficient mast cells have impaired degranulation, but
normal cytokine transcription, after Fc
R engagement
Engagement of the Fc
R induces the release of granules and the
secretion of multiple cytokines, including IL-1 through -6, IL-9,
IL-10, IL-13, IL-16, TNF-
, TGF-
, GM-CSF, and IFN-
, leading to
allergic reactions. We examined the ability of PLC
2-deficient mast
cells to release inflammatory mediators and cytokines after Fc
R
ligation. As illustrated in Fig. 2
A, degranulation, as measured
by the release of [3H]serotonin, was reduced in
PLC
2-deficient mast cells. In addition, the Fc
R-mediated release
of arachidonic acid was reduced in PLC
2-deficient mast cells (Fig. 2
B). However, ionomycin, but not PMA, was able to restore
the ability of PLC
2-deficient mast cells to release arachidonic acid
to the same extent as that of wild-type mast cells (Fig. 2
B). Next, we examined the extent of histamine release by
mast cells following engagement of Fc
R in wild-type and
PLC
2-deficient mice. Wild-type mice showed an increase in the serum
concentration of histamine, whereas increases in the serum histamine
concentration in PLC
2-deficient mice were decreased relative to
those in wild-type animals (Fig. 2
C). These data
demonstrated that Ca2+ flux amplitude (Fig. 1
D) correlated with the extent of degranulation.
|
R induces the
production of multiple cytokines. It has been shown that
Fc
R-mediated elevation of
[Ca2+]i is required for cytokine
production at transcriptional levels (46, 47). An increase
in intracellular Ca2+ concentration activates
protein phosphatase calcineurin, leading to nuclear translocation of
the transcription factor NFAT (48, 49). Fc
R-mediated
activation of PKC is involved in the activation of transcriptional
factors Jun/Fos (50, 51), components of the NFAT complex
(49). NFAT regulates the transcription of several cytokine
genes (52, 53). In addition, the
PKC/Ca2+-independent Ras/Raf-1/ERK cascade has
been shown to be involved in Fc
R-mediated induction of the
transcription factors Elk-1 and NFAT (54). Moreover, the
promoters for controlling the expression of different cytokines are
different (55, 56, 57, 58). To determine whether the expression of
different cytokines depends on the PKC/Ca2+
pathway and requires different amplitudes and durations of
Ca2+ elevation, we examined the effect of
impaired Fc
R-mediated elevation of intracellular
Ca2+ in PLC
2-deficient mast cells on the
production of different cytokines. Quantitative RT-PCR was conducted to
determine the induction of different cytokine mRNA transcripts in bone
marrow-derived wild-type and PLC
2-deficient mast cells following
engagement of the Fc
R. Cross-linking of Fc
R induced comparable
levels of cytokine mRNA in PLC
2-deficient and wild-type mast cells
(Fig. 2
R-induced secretion of cytokine
proteins, exemplified by the secretion of IL-6, was decreased in
PLC
2-deficient mast cells (Fig. 2
2-deficient mast cells to secrete IL-6 (Fig. 2
PLC
2-deficient mice are resistant to IgE-mediated inflammatory
skin reaction
The ability of PLC
2-deficient mice to develop an inflammatory
skin reaction in response to IgE-mediated activation was examined. In
passive inflammatory skin reaction, local extravasation, fibrin
deposition, and tissue swelling are induced by local injection of
Ag-specific IgE, followed by i.v. antigenic challenge. As shown in Fig. 3
, IgE-mediated passive cutaneous
anaphylaxis in PLC
2-deficient mice was decreased compared with that
in wild-type controls. These data demonstrate that PLC
2 plays an
essential role in the Fc
R-mediated inflammatory skin reaction.
|
R-induced Ca2+ flux in macrophages is dependent
upon the presence of PLC
2
There are three classes of Fc receptors for IgG in the mouse: the
high affinity receptor Fc
RI, which is capable of binding monomeric
IgG, and the two low affinity receptors, Fc
RII and Fc
RIII, which
bind polymeric IgG. All three classes of Fc
R are expressed on
monocytes/macrophages. We first examined the expression pattern of
PLC
1 and PLC
2 in macrophages. In contrast to mast cells, which
express both PLC
1 and PLC
2, only PLC
2 was detected in
wild-type, bone marrow-derived macrophages, and neither PLC
isoform
was detectable in PLC
2-deficient, bone marrow-derived macrophages
(Fig. 4
A). This expression
pattern indicates that PLC
2 may be the sole PLC
isoform available
for Fc
R signaling in macrophages. Engagement of Fc
RII/III in
Mac1+ macrophages/monocytes induced only a
transient increase in [Ca2+]i,
which quickly returned to basal levels (Fig. 4
B). As
expected, cross-linking of Fc
RII/III failed to induce any increase
in [Ca2+]i in PLC
2-deficient
Mac1+ cells (Fig. 4
B). These data
demonstrate that Ca2+ flux in response to
engagement of the Fc
R in macrophages/monocytes is dependent upon
PLC
2.
|
R-regulated phagocytosis is normal in PLC
2-deficient
macrophages
One of the important biological responses mediated by the Fc
R
is phagocytosis. Fc
RI- and Fc
RII/III-mediated phagocytoses were
compared in wild-type and PLC
2-deficient macrophages.
Fc
R-mediated phagocytosis was assessed by the ability of
thioglycolate-elicited peritoneal macrophages to internalize SRBCs
opsonized with IgG. IgG2a-opsonized SRBCs are bound and internalized by
the high affinity Fc
RI, while IgG2b-opsonized SRBCs are bound and
internalized by the low affinity Fc
RII/III. As shown in Fig. 5
, macrophages from PLC
2-deficient
mice internalized either IgG2a-opsonized (percentage of phagocytosis,
91.7 ± 2.9%; phagocytic index, 9.5 ± 1.7) or
IgG2b-opsonized (percentage of phagocytosis, 72.5 ± 3.5%;
phagocytic index, 2.0 ± 0.3) particles as efficiently as did
wild-type macrophages (IgG2a: percentage of phagocytosis, 93.7 ±
3.0%; phagocytic index, 9.7 ± 0.8; IgG2b: percentage of
phagocytosis, 80.0 ± 7.0%; phagocytic index, 2.7 ± 0.4).
Since PLC
2-deficient macrophages fail to express either isoform of
PLC
(Fig. 4
A), we conclude that the PLC
pathway is
dispensable for Fc
RI- and Fc
RII/III-mediated phagocytosis in
macrophages.
|
2 is essential for Fc
R-mediated passive inflammatory skin
reaction
IgG immune complexes can trigger anaphylaxis via engagement of the
Fc
R on mast cells (59). To assess the role of PLC
2
in the Fc
R-mediated passive inflammatory skin reaction in vivo,
wild-type and PLC
2-deficient mice were injected intradermally at the
basolateral side with rabbit anti-OVA IgG Abs. The extent of
inflammatory skin reaction was determined by assessing the degree of
extravazation of blue dye on the reverse side of skin sections removed
from sites of intradermal injection. As shown in Fig. 6
, the Fc
R-mediated inflammatory skin
reaction in PLC
2-deficient mice was decreased compared with that in
wild-type controls. These data demonstrate that PLC
2 plays an
essential role in the Fc
R-mediated inflammatory skin reaction.
|
| Discussion |
|---|
|
|
|---|
R and Fc
R. However, the relative contributions of PLC
1 and
PLC
2 to generation of Ca2+ and activation of
PKC following engagement of Fc
R or Fc
R are not clear. In
addition, no data have been reported describing the physiological roles
of these signals in the functions of Fc
R and Fc
R. In the present
studies we demonstrate that both PLC
1 and PLC
2 are expressed and
activated by Fc
R in mast cells, while only PLC
2 is expressed and
activated by Fc
R in monocytes/macrophages. Consistent with its
expression and activation patterns, PLC
2 deficiency partially
impaired Fc
R-induced Ca2+ flux in mast cells
and totally abrogated Fc
R-induced Ca2+ flux in
monocytes/macrophages. The impaired signals in PLC
2-deficient mast
cells upon Fc
R engagement had no effect on the activation of all
three types of MAPKs or on the transcription of cytokines, whereas they
markedly reduced Fc
R-mediated serotonin, arachidonic acid, and
histamine release, leading to resistance to IgE-mediated inflammatory
reaction. Surprisingly, although abrogation of
Ca2+ flux in PLC
2-deficient macrophages
dramatically altered the Fc
R-mediated inflammatory reaction, it did
not affect Fc
R-mediated phagocytosis in monocytes/macrophages.
Although engagement of the Fc
R activates both PLC
1 and PLC
2,
previous studies have suggested that PLC
1, but not PLC
2, is the
primary contributor to IP3 production and
Ca2+ flux in a mast cell line, RBL-2H3
(60). Contrary to current belief, our results clearly
demonstrate the important role of PLC
2 in Fc
R signaling and
function in primary mast cells. Nonetheless, it is highly possible that
PLC
1 also plays an essential role in Fc
R function. One simple
model is that an initial spike in
[Ca2+]i is required for the release
of Ca2+ stores from the endoplasmic reticulum via
IP3-gated channels (61). Emptying of
these stores then causes the opening of plasma membrane
Ca2+ channels (store-operated channel (SOC)),
allowing ions from outside the cell to maintain an elevated
[Ca2+]i (61, 62). A
relatively high level of IP3 is required to empty
internal stores sufficiently to open the SOC and generate a sustained
flux. Lower levels of IP3 produce a smaller
release phase that generally decays rapidly (61).
Therefore, cross-linking of the Fc
R activates both PLC
1 and
PLC
2, leading to an initial
[Ca2+]i spike high enough to open
the SOC and generate a sustained flux. The absence of PLC
2 reduces
the level of IP3 production by Fc
R engagement
(Fig. 1
E), resulting in decreases in both the initial spike
and the sustained plateau of
[Ca2+]i. Consistent with this
model, there is no detectable difference in the activation kinetics of
PLC
1 and PLC
2 by Fc
R engagement (Fig. 1
B). However,
it is also possible that PLC
1 and PLC
2 play unique roles in
Fc
R function. Previous studies have shown that phosphoinositol
3-kinase inhibitor, wortmannin, specifically blocks the activation of
PLC
1, but not PLC
2 (60). The different activation
mechanisms of PLC
1 and PLC
2 indicate that their relative
contributions to Fc
R function may differ. Further studies of
PLC
1-deficient and PLC
1/PLC
2 double-deficient mast cells will
help to address this issue.
The different effects of PLC
2 deficiency on Fc
R signaling in mast
cells and on Fc
R signaling in macrophages could be due to the
different mechanisms by which these two receptors signal. Engagement of
the Fc
R activates both PLC
1 and PLC
2 as well as sphingosine
kinase (63). Sphingosine kinase phosphorylates sphingosine
into sphingosine-1-phosphate, which alone is able to trigger a
Ca2+ response (63). The absence of
PLC
2 reduces the level of IP3 production by
Fc
R engagement, leading to decreases in both the initial spike and
the sustained plateau of [Ca2+]i.
The residual Ca2+ induction by Fc
R engagement
in PLC
2-deficient mast cells could be due to the activation of
PLC
1 and/or sphingosine kinase. In contrast, engagement of Fc
R in
monocytes/macrophages only activates PLC
2 to produce
IP3. Therefore, PLC
2 deficiency totally
abrogates Fc
R-induced Ca2+ flux in
monocytes/macrophages.
Engagement of Fc
R activates Src family kinases, Syk family kinases,
and Tec family kinases (11, 13, 14, 15, 16, 17, 18). Through adapter
proteins linker for activation of T cells (LAT), Src homology 2
domain-containing leukocyte protein-76, and p95Vav,
activated tyrosine kinases, in turn, initiate downstream pathways,
including PLC
/PKC/Ca2+ and MAPKs (ERK, p38,
and JNK) (64, 65, 66). It is known that the Grb2/Sos/Raf1
pathway is a potent pathway activating MAPKs (27, 31, 32, 33, 34).
Upon receptor ligation, through the adaptor protein Grb2, a Ras guanine
nucleotide exchange factor, Sos, is recruited to the membrane, where it
activates Ras (67, 68). Activated Ras associates with and
activates Raf-1 Ser/Thr kinase, leading to a cascade of kinase
activation, which finally activates ERK1 and ERK2 kinases (27, 32, 54). Nonetheless, a number of studies have shown that the
PLC
/PKC/Ca2+ pathway also contributes to the
activation of all three MAPKs (ERK, p38, and JNK) (26, 27, 28, 29, 30, 33, 35, 45). However, PLC
2 deficiency had no effect on the
activation of any of the three MAPKs, suggesting that activation of
MAPKs is either independent of PKC/Ca2+ signals
or insensitive to the decreased amplitude of the
PKC/Ca2+ signals. Our previous studies, which
showed that BCR ligation in PLC
2-deficient B cells generates no
PKC/Ca2+ signals, but activates all three MAPKs
(41), support the idea that MAPK activation is independent
of PKC/Ca2+ signals.
The signals that lead to induction of cytokines are not fully
understood. The elevated levels of
[Ca2+]i initiate association of
Ca2+ with calmodulin, which activates the
Ca2+/calmodulin-dependent phosphatase,
calcineurin (38). Calcineurin, in turn, activates the NFAT
family of transcription factors (69, 70), which interact
with the AP-1 transcription activation complex and cooperatively bind
to the composite NFAT/AP-1 site to regulate the expression of multiple
genes, including IL-2 (38). PKC also plays an essential
role in the induction of cytokines, in that PKC is essential for
activation of NF-
B (71, 72) and production of IL-2
(72). Whereas the promoters that control the expression of
various cytokines are different (55, 56, 57, 58) and may be
differentially affected by the amplitude and duration of
PKC/Ca2+ signals, the transcription of all the
cytokines that we examined was not affected by the impaired amplitude
of Fc
R-mediated Ca2+ flux observed in
PLC
2-deficient mast cells. Therefore, the transcription of these
cytokines may either be independent of or insensitive to the amplitude
and duration of the PKC/Ca2+ signal generated
upon cross-linking of the Fc
R in mast cells. To discriminate between
these possibilities, it will be necessary to examine Fc
R-mediated
cytokine expression in mast cells that are deficient in both PLC
1
and PLC
2.
Intracellular signals generated upon cross-linking of Fc
Rs, similar
to those initiated by engagement of the Fc
R, involve activation of
Src family and Syk family tyrosine kinases as well as adapter proteins
LAT, Src homology 2 domain-containing leukocyte protein-76, and B cell
linker protein, and lead to activation of the PLC
pathway
(15, 25, 73, 74, 75, 76). Among these signal transduction pathway
components, Src family kinases, Syk kinase and the adapter protein
LAT have all been shown to play critical roles in
Fc
R-regulated phagocytosis (75, 77, 78, 79). In addition,
FcR-mediated phagocytosis is via Ca2+-dependent
and Ca2+-independent pathways
(80, 81, 82, 83) Moreover, PKC, which is activated by PLC
, has
been reported to play a role in regulating phagocytosis (83, 84). It was surprising, therefore, that PLC
2-deficient
macrophages phagocytosed IgG2a (Fc
RI-dependent) or IgG2b
(Fc
RII/III-dependent) immune complexes normally compared with
wild-type macrophages, especially in light of the observation that
these mutant macrophages did not express the alternative PLC
1
isoform and failed to mobilize Ca2+ in response
to Fc
R cross-linking. These data support the idea that the
PLC
/PKC/Ca2+ pathway is not required for
Fc
R-mediated phagocytosis. Nevertheless, our previous studies
demonstrated that PLC
2 is essential for FcR
-containing collagen
receptor-mediated release of ATP/ADP and thromboxin
A2 in platelets (41) and is
essential for Fc
R-mediated ADCC activity in NK cells
(41). Therefore, PLC
2 is essential for certain
functions of Fc
R, but it is dispensable for other functions of these
receptors.
Following engagement of Fc
R and Fc
R in mast cells, inflammatory
mediators, including histamine, serotonin, and
-hexosaminidase, are
released from granules, leading to allergic reactions
(61). Previous studies have demonstrated that activation
of PKC and elevation of intracellular Ca2+ are
sufficient and necessary for the release of these inflammatory
mediators from granules (85, 86, 87). By contrast, studies
have shown that the MAPKs are not required for the release of these
inflammatory mediators, but are involved in the production of
arachidonic acid and cytokines (27, 33, 88). Here we
demonstrate that PLC
2 deficiency partially impaired
Ca2+ signals following engagement of the Fc
R
in mast cells, resulting in a reduced Fc
R-mediated release of
serotonin, histamine, and arachidonic acid, but had no effect on
cytokine transcription. These results support the idea that
PKC/Ca2+ signals are essential for mast cell
degranulation, whereas MAPKs are involved in cytokine production.
However, these results also reveal that mast cell degranulation,
secretion of cytokines, and resulting allergic reactions are dependent
upon and sensitive to the amplitude of PKC/Ca2+
signals. Moreover, PLC
2 deficiency affects the release of
arachidonic acid. One possible explanation is that although the release
of arachidonic acid is regulated primarily through MAPK, PKC may
transiently influence this release (33).
PLC
2-deficient mice were resistant to Fc
R-mediated cutaneous
inflammatory skin reaction. Similarly, PLC
2-deficient mice were
resistant to Fc
R-mediated cutaneous inflammatory skin reaction,
demonstrating that the PLC
/PKC/Ca2+ pathway
also plays an essential role in the Fc
R-mediated inflammatory skin
reaction. These results identify PLC
2 as a possible new therapeutic
target for the prevention or treatment of allergic reactions.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Demin Wang, The Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, WI 53226. E-mail address: dwang{at}bcsew.edu ![]()
3 Abbreviations used in this paper: BCR, B cell receptor; ADCC, Ab-dependent cell cytotoxicity; [Ca2+]i, intracellular Ca2+; HSA, human serum albumin; IP3, inositol 1,4,5-trisphosphate; JNK, c-Jun N-terminal kinase; LAT, linker for activation of T cells; MAPK, mitogen-activated protein kinase; MBP, myelin basic protein; PKC, protein kinase C; PLC
2, phospholipase C
2; SLP76, SH2-domain-containing leukocyte protein of 76 kDa; SOC, store-operated channel; LAT, linker for activation of T cell. ![]()
Received for publication February 19, 2002. Accepted for publication October 11, 2002.
| References |
|---|
|
|
|---|
R-
. J. Exp. Med. 167:1909.
receptors in phagocytes. Curr. Opin. Hematol. 5:16.[Medline]
chain deletion results in pleiotrophic effector cell defects. Cell 76:519.[Medline]
RI-mediated tyrosine phosphorylation and activation of the 72-kDa protein-tyrosine kinase, PTK72, in RBL-2H3 rat tumor mast cells. Proc. Natl. Acad. Sci. USA 89:9107.
RIIIA-mediated signaling involves src-family lck in human natural killer cells. J. Immunol. 151:6794.[Abstract]
RI receptor signals through the activation of hck and MAP kinase. J. Immunol. 154:4039.[Abstract]
RII in monocytic THP-1 cells. J. Biol. Chem. 269:8878.
chain after receptor aggregation. J. Biol. Chem. 268:23318.
RIIIA activates the receptor-associated protein tyrosine kinase Syk and induces phosphorylation of multiple proteins including p95Vav and p62/GAP-associated protein. J. Immunol. 152:5429.[Abstract]
receptor I (Fc
RI) and receptor II (Fc
RII) on monocytic cells activates a signal transduction pathway common to both Fc receptors that involves the stimulation of p72 Syk protein tyrosine kinase. J. Biol. Chem. 268:24442.
1 in rat basophilic leukemia cells. J. Biol. Chem. 266:24237.
RIIIA on natural killer cells results in tyrosine phosphorylation of PLC-
1 and PLC-
2. J. Immunol. 150:2668.[Abstract]
receptor-initiated activation of natural killer cells. J. Biol. Chem. 270:16415.
RIIIA and is constitutively associated with a serine/threonine kinase. Biochem. J. 318:527.
2 is involved in the activation of phosphoinositide hydrolysis by Fc receptors in human neutrophils. Biochem. Biophys. Res. Commun. 201:1100.[Medline]
receptors I and II/III. Proc. Natl. Acad. Sci. USA 97:1725.
RI). J. Immunol. 159:2815.[Abstract]
2 in extracellular signal-regulated kinase, c-Jun NH2-terminal kinase, and p38 mitogen-activated protein kinase activation by the B cell antigen receptor. J. Exp. Med. 188:1287.
R1 is not shared by a G protein-coupled receptor. J. Biol. Chem. 270:10960.