| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Amgen Inc., Seattle, WA 98101
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
expression levels, to
a switch in chemokine receptor expression that affected their
migration, to IFN- and IL-12 secretion, and to the acquisition of
priming capacities for both CD4+ and CD8+
OVA-specific TCR-transgenic naive T cells. Thus, the in vitro
generation of murine pDCs may serve as a useful tool to further
investigate pDC biology as well as the potential role of these cells in
viral immunity and other settings. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In humans, two main DC subsets have been characterized:
CD14-CD11c+ DCs and
lineage-negative
CD11c-IL3R+ DCs. These
latter cells, also called plasmacytoid pre-DCs (pDCs), natural
IFN-producing cells, or DC2s, are capable of differentiating into DCs
when cultured in IL-3 and CD40 ligand (CD40L)-containing medium. They
gain T cell stimulatory capacity (Ref. 3 and reviewed in
Ref. 4) but do not produce large amounts of IL-12 when
cultured in the presence of IL-3 and CD40L. Depending upon
microenvironment, culture conditions, or T cell/APC ratios
(5), human pDCs can induce Th1- and/or Th2-type responses
or the generation of IL-10-producing CD8+ T
suppressor cells (Refs. 6, 7, 8, 9 and reviewed in Ref.
10).
A predominant feature of pDCs when stimulated with viruses
(9) or with oligodeoxynucleotides containing certain CpG
motifs (CpG) (Ref. 11 and reviewed in Ref.
12) appears to be their capacity to secrete large amounts
of IFN-, which can synergize with other proinflammatory cytokines to
activate innate and adaptive immune effector cells
(13, 14, 15). Human circulating pDCs express L-selectin
(CD62L) and multiple chemokine receptors, including CXCR3, CXCR4, and
CCR7, and are thought to enter inflamed lymph nodes (LN) directly from
the blood upon stimulation, via high endothelial venules (9, 16).
The identification of murine IFN--producing DCs has recently been
reported by different groups (17, 18, 19, 20, 21). These cells are
found in the spleen, BM, and LN of naive animals, and their number can
be increased by the in vivo administration of Flt3 ligand (FL) or FL
and GM-CSF (19). Murine pDCs have been reported as
Ly6C+B220+CD11cintCD11b-
cells expressing lower levels of costimulatory molecules and MHC class
II than those of "classical" DCs. Expression of CD8, CD80 and
CD86, and MHC class II is increased after activation with viruses, CpG,
or IFN-. Stimulation also induces T cell stimulatory capacity.
Our laboratory has previously described an FL-dependent, in vitro culture system allowing the generation of two murine DC subsets (CD11c+CD11b+ and CD11c+CD11bint) from BM precursors (22). The present study extends these findings by further defining a third subset of BM-derived DCs showing similar phenotypic characteristics as in vitro (23) and in vivo murine pDCs (17, 18, 19, 20, 21). In addition, in this study, we report for the first time changes occurring upon stimulation in the chemotactic migration of these cells toward different chemokines and show their T cell-priming capacities for both naive CD4+ and CD8+ T cells. Finally, we emphasize the in vivo role of FL for the generation and/or differentiation of murine pDCs by reporting their strong reduction in FL-deficient (FL-KO) mice.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female C57BL/6 (B6) and BALB/c mice (8–12 wk of age) were obtained from Taconic Farms (Germantown, NY). FL-KO mice, maintained on a C57BL/6 background, were described previously (24) and bred at Amgen (Seattle, WA). OT-II TCR-transgenic (-Tg) mice specific for chicken OVA peptide 323–339 (OT-IIp) in the context of I-Ab (25) and OT-I TCR-Tg mice specific for chicken OVA peptide 357–364 (OT-Ip) in the context of H-2Kb (26) were bred at Amgen. All mice were housed under specific pathogen-free conditions and according to federal guidelines.
DC cultures
BM cells were isolated by flushing femurs with PBS supplemented with 2% heat-inactivated FBS (Life Technologies, Grand Island, NY). The BM cells were resuspended in Tris-ammonium chloride at room temperature for 1 min to lyse RBC. The cells were then resuspended in culture medium consisting of McCoy’s medium supplemented with essential and nonessential amino acids, 1 mmol/L sodium pyruvate, 2.5 mmol/L HEPES buffer (pH 7.4), vitamins, 5.5 x 10-5 mol/L 2-ME, 100 U/ml penicillin, 100 µg/ml streptomycin, 0.3 mg/ml L-glutamine (PSG), and 10% FBS (all medium reagents from Life Technologies).
BM cells were cultured as previously described (22) for the time indicated in the figures at 1 x 106 cells/ml, in tissue culture flasks (Falcon; BD Biosciences, Mountain View, CA) or in 24-well plates (Costar Corning, Cambridge, MA) in culture medium supplemented with 200 ng/ml recombinant human FL (Chinese hamster ovary cell-derived), 20 ng/ml murine IL-3, and/or 20 ng/ml murine GM-CSF (all from Amgen). Cultures were incubated at 37°C in a humidified atmosphere containing 10% CO2. Cells were harvested at different times from the cultures by vigorous pipetting and removal of nonadherent cells. To recover adherent cells, Versene 1:5000 (Life Technologies) was added after two washes and cells were incubated for 10 min at 37°C. The cells were then pooled with the nonadherent fraction.
In vitro activation of the DCs from FL-supplemented cultures was
accomplished by the addition of different stimulation mixtures
including 2 µg/ml phosphorothioate-modified oligodeoxynucleotides
containing CpG motifs 1826 (TCCATGACGTTCCTGACGTT) (Sigma-Genosys, The
Woodlands, TX), 5 µg/ml CD40L trimer (Amgen), 20 ng/ml recombinant
murine GM-CSF, 20 µg/ml Staphylococcus aureus Cowan I
bacteria (SAC; Pansorbin; Calbiochem-Novabiochem, San Diego,
CA), 10 µg/ml Poly I:C (Sigma-Aldrich, St. Louis, MO), 100 ng/ml LPS
(Sigma-Aldrich), 20 ng/ml IFN-
(BD PharMingen, San Diego, CA), or
HSV-1 (strain F, multiplicity of infection of 10; ATCC VR-33;
American Type Culture Collection, Manassas, VA) for 16–24 h unless
otherwise noted in figures.
Analysis of spleen DCs
Splenic DCs were purified following a previously described protocol (27). Briefly, spleens were digested with 200 U/ml collagenase (Life Technologies) in HBSS with Ca2+ and Mg2+ for 30 min at 37°C. The spleens were then mashed and further dissociated in Ca2+-free medium in the presence of 10 mmol/L EDTA. The cells were then resuspended in Tris-ammonium chloride at room temperature for 1 min to lyse RBC, resuspended in FACS buffer (see Flow cytometry below), and counted.
Flow cytometry
Before incubation with mAbs, the cells were blocked at 4°C for 20 min in FACS buffer (PBS containing 2% FBS, 2% normal rat serum, 2% normal hamster serum, 2% normal mouse serum, 10 µg/ml CD16/CD32 (2.4G2) anti-FcR mAb (BD PharMingen), and 0.02% sodium azide (Sigma-Aldrich)).
All mAbs were purchased from BD PharMingen except where noted. In
addition to isotypes controls, the following mAbs (clone name given in
parentheses) were used: CD3
(145-2C11), CD4 (GK1.5), CD8
(53-6.7), CD11b (M1/70), CD11c (HL3), CD19 (1D3), CD40 (HM40-3),
CD45R/B220 (RA3-6B2), CD62L (MEL-14), CD80 (16-10A1), CD86 (GL-1),
CD123 (IL3Ra) (5B11), H-2Kb (AF6-88.5),
IAb (AF6-120.1), Gr-1 (RB6-8C5), Ly6c (AL-21),
and Pan-NK (DX5). PE-conjugated F4/80 (CI:A3-1) was purchased from
Caltag (Burlingame, CA). Biotinylated DEC-205 (NLDC145; Accurate
Chemical and Scientific, Westbury, NY) binding was detected with
streptavidin-PE (BD PharMingen). Propidium iodide (BD PharMingen) at 2
µg/ml was added in the last wash to exclude dead cells from analysis.
Flow cytometric analyses were performed on a FACSCalibur with
CellQuest software (both BD Biosciences).
Cell sorting
Cells were sorted by flow cytometry using either a FACSVantage cell sorter (BD Biosciences) or a MoFlo cell sorter (Cytomation, Fort Collins, CO). Cells were stained in FACS buffer (without azide) with anti-CD11c-PE, -B220-APC, and -CD11b-FITC mAbs and sorted into CD11c+CD11b+B220- and CD11c+CD11b-B220+ populations (purity >95%).
Cytologic assays
Harvested cells were centrifuged at room temperature onto slides at 30,000–40,000 cells/slide, at 500 rpm for 5 min. Slides were air-dried and stained with Diff-Quik (Dade Behring, Newark, NJ) for morphological analysis. Phase-contrast observations of cultures were made by means of an inverted microscope (Leica, Bannockburn, IL) at x400 magnification.
Chemotaxis assay
Purified CD11c+CD11b+B220- and CD11c+CD11b-B220+ cells were resuspended in RPMI 1640 without Phenol Red and 10% FBS added. Calcein-AM dye (Molecular Probes, Eugene, OR) was added to a final concentration of 5 µg/ml. Cells were then incubated at 37°C for 30–40 min. Unincorporated calcein dye was washed out three times by centrifugation in PBS plus 0.1% BSA.
Recombinant mouse macrophage-inflammatory protein (MIP)-1/CC
chemokine ligand (CCL)3, MIP-1
/CCL4, RANTES/CCL5,
MIP-3/CCL19, and secondary lymphoid-tissue chemokine/CCL21
(all R&D Systems, Minneapolis, MN) were diluted in PBS 0.1% BSA at a
final concentration of 100 ng/ml and were added according to
manufacturer’s instructions to the bottom wells (30 µl) of
Neuroprobe ChemoTX 96-well plates #101-3 (NeuroProbe, Gaithersburg,
MD). Pore size was 3 µm, and well diameter was 3.2 mm. Labeled cells
were resuspended in RPMI 1640 10% FBS and added (2 x
104 cells in 25 µl) to the top filter sites of
the ChemoTX system. The plates were then incubated at 37° and 5%
CO2 for 60 min. After incubation, the cell
droplets on the top of the plate were washed off thoroughly with
PBS/0.1% BSA four to five times. Excess liquid was removed from the
top of the filter. The plates were read on a Molecular Devices
(Sunnyvale, CA) Gemini Spectramax XS reader at excitation 490
nm/emission 528 nm, with a cutoff of 515 nm. Values were
expressed as mean fluorescent count fold increase by calculating as
follows: experimental fluorescent counts/spontaneous fluorescent
counts.
Measurement of CD8+ and CD4+ T cell priming capacities by BM-derived DCs in vitro
DCs from C57BL/6 mice were generated, sorted, and activated in
vitro overnight as described above. DCs were incubated overnight with
0.5 mg/ml OVA-protein (Albumin, Chicken Egg, 5X Crystalline;
Calbiochem-Novabiochem). Naive CD8+ or
CD4+ T cells were enriched from spleen and
peripheral LNs of OVA-specific TCR-Tg OT-I or OT-II mice, respectively,
by immunomagnetic cell separation using negative selection with the
StemSep Enrichment mixture kits for CD8+ or
CD4+ T cells (StemCell Technologies, Vancouver,
British Columbia, Canada). The percentage of enriched T cells
expressing Tg TCR was determined by flow cytometry (>90%), using
anti-CD4-PE or anti-CD8-PE and anti-V2-FITC mAb (BD
PharMingen).
For proliferation and cytokine production assays, naive T cells at 5 x 104 cells/well were seeded into 96-U-well plates (Costar Corning, Cambridge) and cultured with varying numbers of protein-pulsed BM-derived DCs in 200 µl of IMDM (Life Technologies) plus additives per well. Cultures were maintained for 72 h at 37°C. The proliferation was assayed by pulsing the cells with 0.5 µCi of [3H]thymidine overnight and harvesting them the next day.
At 72 h, culture supernatants were collected and tested in
triplicate for IFN- by ELISA (BD PharMingen) or for IL-2, IL-4,
IL-10, IFN-, and TNF- by Luminex using the Beadlyte Mouse
MultiCytokine Standard 1 kit (Upstate, Charlottesville, VA), according
to manufacturer’s instructions.
For cytotoxic assays, naive OT-I CD8+ T cells were stimulated in vitro as described above with varying numbers of protein-pulsed BM-derived DCs. After 72 h, 1 x 104 syngeneic (H-2b) C1498 target cells, which were pulsed for 1 h at 37°C with or without 1 µM OT-Ip in the presence of radioactive chromium (51Cr) in IMDM, were added in a total volume of 200 µl to the OT-I culture. After 4 h of incubation at 37°C, 25 µl of supernatant was removed and added to Lumaplate-96 plates (Packard Instrument, Meriden, CT), and radioactivity was counted on a Topcount counter (Packard Instrument). Spontaneous and total release were determined by adding culture medium or detergent, respectively, to target cells. The percentage of specific 51Cr release was calculated as follows: (experimental release - spontaneous release)/(total release - spontaneous release) x 100.
In vitro IFN-, IL-10, and IL-12 production assay
DCs from naive mice were generated, sorted, and activated in
vitro overnight as described above. Supernatants were then collected
and assayed by ELISA for murine IL-10 and IL-12p70 (BD PharMingen) and
IFN- (PBL Biomedical Laboratories, New Brunswick, NJ) according to
the manufacturer’s instructions. The limits of detection for IL-10,
IL-12p70, and IFN- were 10, 40, and 20 pg/ml, respectively.
TaqMan real-time PCR
In vitro-derived DCs were sorted by flow cytometry. Total RNA was purified with QIAshredder and Rneasy Mini spin column kits (Qiagen, Valencia, CA) and treated with DNase (Ambion, Austin, TX) as recommended by the manufacturers. Single-stranded cDNA synthesis was conducted on total RNA using TaqMan reverse transcription kits (Applied Biosystems, Foster City, CA) with random hexamer primers.
Mouse gene-specific primers and probe sets for TaqMan PCR were
designed using Primer Express software (Applied Biosystems)
with additional manual adjustments to minimize oligonucleotide hairpin
loops, homo- or hetero-dimerization, and amplicon size. Test
gene primer and FAM-labeled probe sets were optimized for
concentration, amplification efficiency, and faithful coamplification
with one or more housekeeper gene primer and VIC-labeled probe
sets—the latter including -actin, GAPDH, hypoxanthine
phosphoribosyltransferase, and porphobilinogen deaminase.
Real-time quantitative PCR were set up in 96-well plates using the
above reagents and TaqMan master mix, as recommended by the
manufacturer and as indicated by the optimization data, and were run on
7700 ABI thermal cyclers (Applied Biosystems). Real-time data were
acquired and analyzed using Sequence Detection System software (Applied
Biosystems) with manual adjustment of baseline and threshold
parameters. Relative expression levels were determined using cycle
threshold values and the 2-
Ct method to
adjust for coamplified housekeeper gene levels, 2-fold
amplification/cycle rates, and the reference expression level of
control samples (28).
The sequences for primers and probe sets were as follows: muTLR2up, GCC ACC ATT TCC ACG GAC T; muTLR2tqf, CAC GCC CAC ATC ATT CTC AGG TAC CA; muTLR2low, GCT TCC TCT TGG CCT GGA G; muTLR3up, CCC AGC TCG ATC TTT CCT ACA; muTLR3tqf, ACA ACC TCC ATG ATG TCG GCA ACG; muTLR3low, GCT TGG GAG ATA GGA GAA GGA A; muTLR4up, ACT GGG TGA GAA ATG AGC TGG T; muTLR4tqf, AAT TTA GAA GAA GGA GTG CCC CGC TTT CAC; muTLR4low, GAA TAA AGT CTC TGT AGT GAA GGC AGA; muTLR7up, CCA AAA ATG GGC TCA AAT CTT; muTLR7tqf, TCT TTT GGG ACA GAC TCC AGT TAC TGA AGC AT; muTLR7low, GCT GAG GTC CAA AAT TTC CAA; muTLR9up, GTA CTT GAT GTG GGT GGG AAT TG; muTLR9tqf, TGC GAC CAT GCC CCC AAT CCC; muTLR9low, AGG GAC TTT TGG CCA CAT TCT AT; muCCR5up, CCA TGC AGG CAA CAG AGA CT; muCCR5tqf, CTT GGA ATG ACA CAC TGC TGC CTA AAC C; muCCR5low, TCC AAC AAA GGC ATA GAT GAC AG; muCCR7up, TG CTG CGT CAA CCC TTT CT; muCCR7tqf, ATG CCT TCA TCG GCG TCA AGT TCC; and muCCR7low, AGT CCT TGA AGA GCT TGA AGA GGT.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our laboratory recently reported that multiple subsets of murine
DCs can be generated from FL-supplemented BM culture (22).
We examined these cultures for the possible generation of
CD11c+B220+ pDCs. BM cells
from naive mice were prepared and cultured at high density (1 x
106 cells/ml) in the presence or absence of FL,
GM-CSF, and IL-3. Cells were analyzed periodically over a 15-day period
to determine their expansion and phenotype by flow cytometry. Fig. 1
A shows the appearance over
time of BM-derived CD11c+ cells expressing or not
expressing B220 under different conditions. Our data show that addition
of FL only was sufficient for the in vitro generation of
CD11c+B220+ cells from BM
precursors, confirming recently published data from another group
(23) using a similar in vitro culture system.
|
B, freshly isolated BM cells
analyzed ex vivo contained <2% of
CD11c+B220+ cells. Culture
in FL-containing medium induced the generation of
CD11c+B220+ and
CD11c+B220- DC subsets.
After 9 days of culture, at the peak of the culture, 15–20% of the
cells were
CD11c+CD11b-B220+
(Fig. 1, B and C) whereas the remaining
CD11c+B220- population
could be subdivided into CD11bhigh and
CD11bint as previously reported
(22). Between days 9 and 15, total
CD11c+CD11b+B220-
and
CD11c+CD11b-B220+
numbers dropped rapidly. On a percentage basis,
CD11c+CD11b-B220+
cells disappeared more rapidly than
CD11c+CD11b+B220-
cells, arguing in favor of a possible shorter survival in culture for
CD11c+CD11b-B220+
cells.
When BM-cells were cultured in the presence of GM-CSF alone,
"classical"
CD11c+B220- but not
CD11c+B220+ DCs were
rapidly generated (Fig. 1, A and C). The total
CD11c+B220- cell number
dropped after 5 days due to overgrowth in the culture. GM-CSF
antagonized the effect of FL on pDC generation when both cytokines were
mixed in the same culture medium (Fig. 1, A and
C). Blocking GM-CSF by adding a neutralizing dose of
anti-murine GM-CSF in the FL-containing culture did not modify the
generation of either
CD11c+B220- or
CD11c+B220+ cells (data not
shown).
Finally, IL-3 had no effect on the generation of
CD11c+B220- and
CD11c+B220+ DCs (Fig. 1A).
FL is necessary for the optimal generation of CD11c+B220+ DCs in vivo
Because FL was shown to be a potent inducer of
CD11c+B220+ cells in vitro,
we examined its role in vivo. Total spleen cells from FL-KO
(24) and wild-type mice were stained with anti-CD11c,
-B220 and -CD19 mAbs and the percentages (Fig. 2A) and total numbers (Fig. 2B) of
CD11c+B220- and
CD11c+B220+ were determined
by electronically gating on CD19- cells to
exclude B cells. A dramatic reduction in the percentages and numbers of
both splenic CD11c+B220-
and CD11c+B220+ DCs was
observed in FL-KO mice compared with those of wild-type animals with a
four- and seven-time reduction in numbers, respectively.
|
Morphologic differences distinguish
CD11c+B220+ from
CD11c+B220- DCs. Fig. 3A shows cytospin cover
glasses of both BM-derived DC types. Whereas
CD11c+B220- DCs showed the
classical stellate DC morphology,
CD11c+B220+ cells appeared
rounder and had a smooth surface with few dendrites and diffuse nuclei,
an appearance similar to that of freshly isolated murine and human pDCs
(3, 20, 21).
|
B shows that
CD11c+B220+ cells did not
express T, B, and NK cell markers (e.g., CD3, CD4, CD8, CD19, and
DX5) and showed an immature APC phenotype based upon little to no
expression on most
CD11c+B220+ DCs of MHC
class II (IAb) and costimulatory molecules CD40,
CD80, and CD86. CD11c+B220+
cells were positively stained for MHC class I
(H-2Kb), CD62L, and Ly6C, whereas CD11b and F4/80
were not expressed. GR-1 (also called Ly6G), which was previously used
to characterize murine pDCs (19, 20, 21), was expressed by a
fraction of CD11c+B220+
cells. Interestingly, IL-3R (CD123) could not be detected on the
surface of murine BM-derived
CD11c+B220+ cells whereas
it was shown to be expressed by human pDCs (3). BM-derived CD11c+B220+ DCs display a different pattern of Toll-like receptor (TLR) expression than CD11c+B220- DCs
TLR are pattern-recognition receptors implicated in the
recognition of pathogen structures and may link innate and adaptive
immunity (reviewed in Ref. 12).
CD11c+B220- and
CD11c+B220+ DCs were sorted
by flow cytometry after 9 days of culture in FL-containing medium,
total RNA was extracted, treated with DNase, and single-stranded cDNA
synthesis was conducted. The expression of TLR2, TLR3, TLR4, TLR7, and
TLR9 was measured by real-time TaqMan PCR. Nonoverlapping patterns of
expression were observed for the different TLR tested (Fig. 4A). "Classical"
CD11c+B220- BM-derived DCs
preferentially expressed TRL2, TLR3, and TLR4, whereas the expression
of TLR7 and TLR9 was stronger in
CD11c+B220+ cells.
|
expression, and secrete high levels of IFN-
and low levels of IL-12p70
After 9 days of culture in FL-containing medium, total cells were
recovered, purified according to CD11c and B220 vs CD11b expression by
flow cytometry
(CD11c+CD11b+B220-
vs
CD11c+CD11b-B220-,
purity > 95%) and cultured with or without different stimulatory
reagents for 24 h. Cell culture supernatants were harvested and
tested for the production of IFN-, IL-12p70, and IL-10 by ELISA
(Fig. 4B). CpG, SAC, and HSV-1 alone, as well as the CpG
plus CD40L plus GM-CSF mixture, each induced secretion of high levels
of IFN- (>500 pg/ml/105 cells) by
CD11c+B220+ DCs.
"Classical"
CD11c+B220- DCs, when
activated with CpG plus CD40L plus GM-CSF produced 
10-fold more
IL-12p70 than did
CD11c+B220+ DCs (3000
pg/ml/105 cells ± 420 vs 270
pg/ml/105 cells ± 62, respectively).
Finally, CpG alone was the strongest IL-10 secretion inducer (>50
pg/ml) for both
CD11c+B220- and
CD11c+B220+ subsets.
Cell phenotype after in vitro stimulation was assessed by flow
cytometry. Of the 11 stimulatory conditions we tested, the CpG plus
CD40L plus GM-CSF mixture was the strongest activator for pDCs, based
upon CD4, CD8, MHC class II (IAb), CD80, CD86,
and DEC-205 levels of expression. Indeed, as shown in Fig. 4C, a significant up-regulation of CD8, CD80, CD86, and
IAb molecules was observed among
CD11c+B220+ cells whereas
CD4 and DEC-205 were slightly up-regulated. In comparison,
CD11c+B220- cells
underwent a spontaneous maturation after reculture in vitro in the
absence of activation. The levels of CD80, CD86,
IAb, and DEC-205 were further up-regulated by CpG
plus CD40L plus GM-CSF on these cells, whereas CD4 and CD8
expression were only slightly up-regulated.
BM-derived DCs and migratory capacities in vitro
A key characteristic of DCs appears to be their capacity to migrate from the blood to peripheral tissues and, upon stimulation, to the draining LN where they can activate naive Ag-specific T cells. This migration is driven by different chemokines interacting with chemokine receptors that are differently expressed by DCs, relative to subset and maturation stage. Immature DCs were shown to express receptors such as CCR1, CCR2, CCR5, and CCR6, which are specific for inflammatory chemokines, whereas maturation down-regulates these receptors and up-regulates the expression of CCR7 (29, 30, 31).
We compared CD11c+B220- and CD11c+B220+ DCs for CCR5 and CCR7 mRNA expression and for their attraction toward different chemokines in an in vitro chemotaxis assay. Three different DC maturation stages were analyzed. Immature DCs were harvested after the 9-day culture period, sorted by flow cytometry, and analyzed directly (9-day condition). After flow cytometry sorting, weak and full maturation were induced by cultivating CD11c+B220- and CD11c+B220+ DCs in FL-containing medium in the absence or presence of CpG plus CD40L plus GM-CSF (24 h, no stimulation, and 24 h, plus stimulation, respectively).
Freshly isolated immature
CD11c+B220- and
CD11c+B220+ DCs showed
similar levels of CCR5 mRNA expression (Fig. 5A), whereas CCR5 expression
was slighty reduced after overnight culture with CpG plus CD40L plus
GM-CSF. CCR7 mRNA expression was low in both immature subsets (9-day
condition) but was dramatically augmented in
CD11c+B220- DCs after
reculture in vitro in the absence of stimulation. Activation with CpG
plus CD40L plus GM-CSF increased CCR7 mRNA expression in
CD11c+B220+ DCs.
|
),
CCL4 (MIP-1), and CCL5 (RANTES), three putative CCR5 ligands
(32). Immature
CD11c+B220+ DCs were
strongly mobilized by these three chemokines, whereas the
CD11c+B220- fraction
showed mobilization only toward CCL3 (Fig. 5B). After
overnight culture in the absence of stimulation, CCL3-, CCL4- and
CCL5-driven migration was barely detectable with
CD11c+B220- DCs, but still
evident with CD11c+B220+
DCs. This condition was also sufficient to induce the migration of
CD11c+B220- cells toward
CCR7 ligands (CCL19 (MIP-3) and CCL21 (6Ckine)) but insufficient for
CD11c+B220+ DCs. However,
overnight activation with CpG plus CD40L plus GM-CSF induced CCL19- and
CCL21-mediated migration by the
CD11c+B220+ subset and
increased CCL21-mediated
CD11c+B220- DC migration,
accompanied by a lack in mobilization toward CCL3, CCL4, and
CCL5. T cell stimulatory capacities of BM-derived CD11c+B220+ DCs
Another key characteristic of dendritic cells is their ability to prime naive T cells. We analyzed the in vitro T cell stimulatory capacity of both BM-derived CD11c+B220- and CD11c+B220+ DC subsets in two different syngeneic model systems involving either OVA-specific TCR-Tg CD4+ (OT-II) or OVA-specific TCR-Tg CD8+ (OT-I) naive T cells.
Without any prior activation in vitro, OVA-protein-pulsed
CD11c+B220+ pDCs were poor
naive OT-II CD4+ T cell stimulators, in terms of
proliferation and cytokine secretion, relative to
CD11c+B220- DCs (Fig. 6). However, in vitro activation with CpG
plus CD40L plus GM-CSF increased the ability of BM-derived
CD11c+B220+ cells to
stimulate naive OT-II CD4+ T cells, although to
lower levels than those obtained with the
CD11c+B220- counterpart.
The same effect was observed when the two DC subsets were pulsed with
the immunodominant OVA-peptide (data not shown).
|
, and TNF-
secretion (Fig. 6). As expected, unstimulated
CD11c+B220+ DCs did not
induce strong cytokine secretion by CD4+ T cells,
reflecting the weak T cell stimulation observed at the level of
proliferation. However, after pDC stimulation with CpG plus CD40L plus
GM-CSF, a significant increase in cytokine secretion was observed. No
clear Th1 or Th2 bias was induced, because both Th1-related (IFN-)
and Th2-related (IL-4) cytokines were secreted. IL-10 was produced when
activated CD11c+B220- or
CD11c+B220+ DCs were used
as APCs for naive CD4+ T cell priming.
Intracellular detection by flow cytometry of this cytokine confirmed
its production by activated CD4+ T cells (data
not shown).
Fig. 7 shows the priming capacity of
BM-derived DCs for naive CD8+ T cells. OT-I
CD8+ T cells cultured with unstimulated
CD11c+B220+ DCs previously
incubated with OVA protein were poorly activated and proliferated
weakly. In addition, these T cells inefficiently killed syngeneic
(H-2b) peptide-pulsed C1498 target cells in a
cytotoxic assay, and IFN- secretion remained under detectable levels
(Fig. 7, middle and lower panels). However,
stimulation of CD11c+B220+
DCs with CpG plus CD40L plus GM-CSF was efficient for the induction of
cell proliferation, specific cytoxicity, and IFN- secretion, to
levels comparable to those observed when
CD11c+B220- cells were
used as APCs.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-12 secretion, and to the acquisition of
CD4+ and CD8+ T
cell-priming capacities. Finally, we also report that pDC generation
was regulated in vivo by FL, because FL-KO mice showed a major
reduction in splenic pDC numbers. FL played a crucial role in the generation of CD11c+B220+ pDCs from BM progenitors. This confirms recent data, reported during the writing of this article, in a related culture system (23), as well as data showing the in vitro generation in FL-containing medium of human pDCs from CD34+ human fetal tissues and cord blood progenitors (33). By contrast, GM-CSF, which was efficient in generating "classical" DCs in vitro, had a strong negative effect on pDC generation. GM-CSF could even antagonize the effect of FL, because no CD11c+B220+ DCs were generated when both cytokines were mixed in the same culture medium. Although this shows that FL, as the sole exogenous factor, is sufficient to drive DC generation, we cannot exclude the contribution of other endogenous factors in conjunction with FL in this system.
We also compared the absolute numbers of
CD11c+B220+ cells in FL-KO
and wild-type mice (see Fig. 2). FL-KO mice had reduced total DC
numbers (24) including pDCs compared with wild-type
counterparts, showing for the first time the major role played by this
growth factor in vivo for constitutive pDC generation and/or expansion.
In vivo administration of FL strongly increased the total number of
murine splenic pDCs (P. Brawand and T. De Smedt, data not shown; Ref.
19), in accordance with results obtained in the human
system (34, 35). Thus, we conclude that pDC generation,
differentiation, and/or survival are regulated by FL in vivo.
The in vitro generation of multiple DC subsets in the same culture from
BM precursors raises the question of whether these subtypes are
independent DC lineages or whether they do represent different stages
of development of the same lineage. Over the past several years,
splenic DCs in the mouse have been classified as "lymphoid" and
"myeloid" based upon the expression of CD8
(CD8+ and CD8-,
respectively) (for review, see Ref. 36). This concept has
been challenged by two recent reports demonstrating that both subsets
can be generated from a single lymphoid- or myeloid-committed precursor
population, supporting the concept that they do not represent separate
DC lineages (37, 38). In addition, highly purified splenic
CD8- DCs, injected i.v. and traced in vivo
acquired the phenotypic characteristics of
CD8+ DCs (39). In this study, we
report that stimulation of BM-derived
CD11c+B220+ DCs with CpG
plus CD40L plus GM-CSF induced CD8 up-regulation but not that of
DEC-205, another marker for CD8+ splenic DCs,
as opposed to CD11c+B220-
cells. CD8 up-regulation was also reported for ex vivo murine pDCs
after in vitro activation (20). A possible explanation
could be that, like "classical" DCs (40), pDCs do not
express CD8 constitutively, but acquire the phenotypic
characteristics of CD8+ DCs during
differentiation and/or under specific environmental conditions.
Although CD8 expression does not seem to play a role in
"classical" CD8+ DCs function
(41), it remains to be addressed whether the acquisition
of CD8 expression is important for pDC function.
Despite the questions concerning a possible common origin between
"classical" DCs and pDCs, BM-derived
CD11c+B220- and
CD11c+B220+ cells exhibited
different patterns of TLR expression. We found that
CD11c+B220- BM-derived DCs
preferentially expressed TLR2, TLR3, and TLR4, confirming results
reported for human myeloid DCs (Refs. 11, 42 , and
43 and reviewed in Ref. 12). In contrast, the
expression of these three TLRs was lower in BM-derived (Fig. 4A) and in freshly isolated splenic (data not shown)
CD11c+B220+ pDCs. TLR4 was
reported to be expressed by LPS-responding DCs (44) and
its low expression in BM-derived pDCs might explain why these cells
were insensitive to LPS in our stimulation experiments (Fig. 4A). Like human pDCs (reviewed in Ref. 12),
murine BM-derived (Fig. 4A) as well as freshly isolated
(data not shown)
CD11c+B220+ pDCs expressed
high levels of TLR7 and TLR9, which were recently shown to be involved
in the recognition of some viral compounds and CpG motifs found in
bacterial DNA, respectively (45, 46). This could explain
why BM-derived CD11c+B220+
pDCs, like ex vivo
CD11c+B220+ DCs (19, 20), were efficiently activated by viruses and CpG motifs. TLR7
and/or TLR9 triggering and signaling might be an important pathway
inducing pDCs to secrete high amounts of IFN- that would fight viral
or bacterial infections (reviewed in Ref. 47). In
addition, IFN- secretion might also stimulate DCs in an autocrine
manner to induce their maturation (48).
HSV-1 and CpG alone induced low levels of IL-12p70 by both
CD11c+B220- and
CD11c+B220+ DCs as recently
reported by Gilliet et al. (23). However, the combination
of CpG plus CD40L plus GM-CSF induced the secretion of high levels of
IL-12p70 by CD11c+B220-
DCs whereas IL-12p70 production remained low for
CD11c+B220+ pDCs (Fig. 4A). The same observation was made when freshly isolated
splenic CD11c+B220- and
CD11c+B220+ DCs were
stimulated under identical conditions (data not shown). This is in
accordance with results obtained by Schulz et al. (49) who
showed that optimal production of bioactive IL-12 by classical DCs is
initiated by innate signals but is amplified by T cell-derived
signals.
DCs are characterized by the ability to migrate and to prime naive T cells (reviewed in Refs. 1 and 2). During maturation, DCs lose the ability to capture Ag but gain the capacity to present Ag. Human circulating pDCs express L-selectin (CD62L) and are thought to enter inflamed LNs directly from the blood upon stimulation, via high endothelial venules (9). Interestingly, L-selectin-deficient (Sell-/-) mice were shown to have a marked paucity of pDCs in the LN (21). In addition to CD62L-mediated migration, chemokines might play important roles in mobilizing pDCs, either at the site of infection or in the LN to activate T cells. Thus, we analyzed the migratory capacities of BM-derived DCs using an in vitro chemotaxis assay and also looked at the mRNA level of two key chemokine receptors whose expression is regulated during maturation. CD11c+B220+ DCs, in an immature state, were strongly mobilized by inflammatory chemokines such as CCL3, CCL4, and CCL5, supporting the argument that immature pDCs can migrate into sites of inflammation. In this study, we also describe that CD11c+B220+ DCs in culture for 24 additional hours in the absence of stimulation remained more immature in terms of chemokine responsiveness than CD11c+B220- DCs. This difference between the two subsets could be due to a higher activation threshold that would not allow CD11c+B220+ DC responses under these conditions. These cells maintained the capacity to migrate toward CCL3, CCL4, and CCL5, whereas CD11c+B220- DCs lost CCL3-mediated, but gained CCR7-mediated, mobilization. However, after maturation with CpG plus CD40L plus GM-CSF, both subsets became responsive to CCL19 and CCL21, both ligands of CCR7, a chemokine receptor preferentially expressed by mature DCs (30, 32). In the absence of activation, blood pDCs might preferentially migrate toward sites of infection or inflammation, where inflammatory chemokines are found in higher concentration. Of note, two recent reports described the accumulation of human pDCs in peripheral sites such as the skin in cutaneous lupus erythematosus lesions (50) and the nasal mucosa in airway allergy (51). However, upon activation, pDCs might shut down CCR5 responsiveness and be attracted to the LN by CCR7 ligands.
Our in vitro T cell-priming data revealed that pDCs were poor
stimulators of both CD4+ and
CD8+ TCR-Tg T cells (Figs. 6 and 7) and had to be
strongly activated to induce proliferation, cytotoxicity, and Th1 and
Th2 cytokine secretion by naive T cells. It has been proposed that, in
the absence of maturation, DCs can induce tolerance (52)
or the differentiation of naive self-reactive T cells toward
IL-10-producing, CD4+ (53, 54), or
CD8+ (55) T cells with regulatory
properties. Human pDCs, when cultured in presence of IL-3 and CD40L,
also induce regulation through the generation of IL-10-producing
CD8+ T suppressor cells (8). Thus,
it would be of interest to determine whether unstimulated murine pDCs
play a role in this phenomenon, as reported recently by Martin et al.
(56), and therefore serve as targets in therapeutic
settings.
Finally, stimulation levels of naive CD8+ T cells
by activated CD11c+B220-
or CD11c+B220+ DCs were
similar for proliferation, cytotoxicity, and IFN- secretion (Fig. 7). However, naive CD4+ T cells were always
stimulated in a more efficient way by activated
CD11c+B220- DCs than by
CD11c+B220+ pDCs (Fig. 6).
IFN- secretion by pDCs might be responsible for this difference.
Indeed, IFN- was shown to play a major role in the proliferation and
survival of CD8+ T cells (13, 14, 15)
and might thus bring CD8+ T cell stimulation to
levels similar to those induced by "classical" DCs. Blocking
IFN- signaling pathway by adjunction of an anti-IFN- mAb or
by using type I IFNR (IFNAR)-deficient mice (57) might
help to solve this issue.
In this report, we have described an in vitro culture system allowing the generation from BM progenitors of immature murine CD11c+B220+ pDCs and compared these cells phenotypically and functionally to classical CD11c+B220- DCs. This system might thus be useful for the generation of high cell numbers of multiple DC subsets including pDCs that would allow us to understand their biology in vivo.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviations used in this paper: DC, dendritic cell; CpG, oligodeoxynucleotides containing certain CpG motifs; FL, Flt3 ligand; FL-KO, FL-deficient; BM, bone marrow; LN, lymph node; pDC, plasmacytoid pre-DC; TLR, Toll-like receptor; CD40L, CD40 ligand; SAC, Staphylococcus aureus Cowan I bacteria; MIP, macrophage-inflammatory protein; CCL, CC chemokine ligand; Tg, transgenic.
Received for publication June 26, 2002. Accepted for publication October 8, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 into syngeneic mice. Cancer Res. 58:5795.+ and CD8- dendritic cells. Eur. J. Immunol. 31:3403.[Medline]
, and IFN- by mouse dendritic cell subsets. J. Immunol. 166:5448.- and -chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol. 76:34.[Medline]
+ and CD8- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587., MIP-3, and secondary lymphoid organ chemokine. J. Exp. Med. 191:1381.-producing predendritic cell (Pre-DC)2 from human CD34+ hematopoietic stem cells. J. Exp. Med. 192:1785.-positive dendritic cells from a common myeloid progenitor. Science 290:2152.- and CD8+ dendritic cells are generated from CD4low lymphoid-committed precursors. Blood 96:2511.+ dendritic cells originate from the CD8- dendritic cell subset by a maturation process involving CD8, DEC-205, and CD24 up-regulation. Blood 99:999.-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am. J. Pathol. 159:237.+B220+ dendritic cells endowed with type 1 interferon production capacity and tolerogenic potential. Blood 100:383. production by a dendritic cell subset in the absence of feedback signaling in vivo. J. Exp. Med. 195:507.This article has been cited by other articles:
|
|
 |
|
  C. Ding, Y. Cai, J. Marroquin, S. T. Ildstad, and J. Yan Plasmacytoid Dendritic Cells Regulate Autoreactive B Cell Activation via Soluble Factors and in a Cell-to-Cell Contact Manner J. Immunol., December 1, 2009; 183(11): 7140 - 7149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Flores, D. D. Desai, M. Downie, B. Liang, M. P. Reilly, S. E. McKenzie, and R. Clynes Dominant Expression of the Inhibitory Fc{gamma}RIIB Prevents Antigen Presentation by Murine Plasmacytoid Dendritic Cells J. Immunol., December 1, 2009; 183(11): 7129 - 7139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Shao, T. O. Makinde, H. S. McGee, X. Wang, and D. K. Agrawal Fms-Like Tyrosine Kinase 3 Ligand Regulates Migratory Pattern and Antigen Uptake of Lung Dendritic Cell Subsets in a Murine Model of Allergic Airway Inflammation J. Immunol., December 1, 2009; 183(11): 7531 - 7538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Siegemund, A. Hartl, H. von Buttlar, F. Dautel, R. Raue, M. A. Freudenberg, G. Fejer, M. Buttner, G. Kohler, C. J. Kirschning, et al. Conventional Bone Marrow-Derived Dendritic Cells Contribute to Toll-Like Receptor-Independent Production of Alpha/Beta Interferon in Response to Inactivated Parapoxvirus Ovis J. Virol., September 15, 2009; 83(18): 9411 - 9422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kool, M. van Nimwegen, M. A. M. Willart, F. Muskens, L. Boon, J. J. Smit, A. Coyle, B. E. Clausen, H. C. Hoogsteden, B. N. Lambrecht, et al. An Anti-Inflammatory Role for Plasmacytoid Dendritic Cells in Allergic Airway Inflammation J. Immunol., July 15, 2009; 183(2): 1074 - 1082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Dunne, B. Moran, R. C. Cummins, and K. H. G. Mills CD11c+CD8{alpha}+ Dendritic Cells Promote Protective Immunity to Respiratory Infection with Bordetella pertussis J. Immunol., July 1, 2009; 183(1): 400 - 410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ahmed, L. M. Mitchell, S. Puckett, K. L. Brzoza-Lewis, D. S. Lyles, and E. M. Hiltbold Vesicular Stomatitis Virus M Protein Mutant Stimulates Maturation of Toll-Like Receptor 7 (TLR7)-Positive Dendritic Cells through TLR-Dependent and -Independent Mechanisms J. Virol., April 1, 2009; 83(7): 2962 - 2975. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Banovic, K. A. Markey, R. D. Kuns, S. D. Olver, N. C. Raffelt, A. L. Don, M. A. Degli-Esposti, C. R. Engwerda, K. P. A. MacDonald, and G. R. Hill Graft-versus-Host Disease Prevents the Maturation of Plasmacytoid Dendritic Cells J. Immunol., January 15, 2009; 182(2): 912 - 920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mittelbrunn, G. M. del Hoyo, M. Lopez-Bravo, N. B. Martin-Cofreces, A. Scholer, S. Hugues, L. Fetler, S. Amigorena, C. Ardavin, and F. Sanchez-Madrid Imaging of plasmacytoid dendritic cell interactions with T cells Blood, January 1, 2009; 113(1): 75 - 84. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Mouries, G. Moron, G. Schlecht, N. Escriou, G. Dadaglio, and C. Leclerc Plasmacytoid dendritic cells efficiently cross-prime naive T cells in vivo after TLR activation Blood, November 1, 2008; 112(9): 3713 - 3722. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-C. Sheng, M. Kalkanidis, D. S. Pouniotis, M. D. Wright, G. A. Pietersz, and V. Apostolopoulos The Adjuvanticity of a Mannosylated Antigen Reveals TLR4 Functionality Essential for Subset Specialization and Functional Maturation of Mouse Dendritic Cells J. Immunol., August 15, 2008; 181(4): 2455 - 2464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Rezzoug, Y. Huang, M. K. Tanner, M. Wysoczynski, C. L. Schanie, P. M. Chilton, M. Z. Ratajczak, I. J. Fugier-Vivier, and S. T. Ildstad TNF-{alpha} Is Critical to Facilitate Hemopoietic Stem Cell Engraftment and Function J. Immunol., January 1, 2008; 180(1): 49 - 57. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Fancke, M. Suter, H. Hochrein, and M. O'Keeffe M-CSF: a novel plasmacytoid and conventional dendritic cell poietin Blood, January 1, 2008; 111(1): 150 - 159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kohara, Y. Omatsu, T. Sugiyama, M. Noda, N. Fujii, and T. Nagasawa Development of plasmacytoid dendritic cells in bone marrow stromal cell niches requires CXCL12-CXCR4 chemokine signaling Blood, December 15, 2007; 110(13): 4153 - 4160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Blasius, W. Barchet, M. Cella, and M. Colonna Development and function of murine B220+CD11c+NK1.1+ cells identify them as a subset of NK cells J. Exp. Med., October 29, 2007; 204(11): 2561 - 2568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Weslow-Schmidt, N. A. Jewell, S. E. Mertz, J. P. Simas, J. E. Durbin, and E. Flano Type I Interferon Inhibition and Dendritic Cell Activation during Gammaherpesvirus Respiratory Infection J. Virol., September 15, 2007; 81(18): 9778 - 9789. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. C. Gray, J. Kuchtey, and C. V. Harding CpG-B ODNs potently induce low levels of IFN-{alpha}{beta} and induce IFN-{alpha}{beta}-dependent MHC-I cross-presentation in DCs as effectively as CpG-A and CpG-C ODNs J. Leukoc. Biol., April 1, 2007; 81(4): 1075 - 1085. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Lou, C. Liu, G. J. Kim, Y.-J. Liu, P. Hwu, and G. Wang Plasmacytoid Dendritic Cells Synergize with Myeloid Dendritic Cells in the Induction of Antigen-Specific Antitumor Immune Responses J. Immunol., February 1, 2007; 178(3): 1534 - 1541. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Yrlid, V. Cerovic, S. Milling, C. D. Jenkins, J. Zhang, P. R. Crocker, L. S. Klavinskis, and G. G. MacPherson Plasmacytoid Dendritic Cells Do Not Migrate in Intestinal or Hepatic Lymph J. Immunol., November 1, 2006; 177(9): 6115 - 6121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Martinez del Hoyo, M. Lopez-Bravo, P. Metharom, C. Ardavin, and P. Aucouturier Prion Protein Expression by Mouse Dendritic Cells Is Restricted to the Nonplasmacytoid Subsets and Correlates with the Maturation State J. Immunol., November 1, 2006; 177(9): 6137 - 6142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wang, N. Peters, and J. Schwarze Plasmacytoid Dendritic Cells Limit Viral Replication, Pulmonary Inflammation, and Airway Hyperresponsiveness in Respiratory Syncytial Virus Infection J. Immunol., November 1, 2006; 177(9): 6263 - 6270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ahmed, K. L. Brzoza, and E. M. Hiltbold Matrix Protein Mutant of Vesicular Stomatitis Virus Stimulates Maturation of Myeloid Dendritic Cells J. Virol., March 1, 2006; 80(5): 2194 - 2205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Walzer, M. Dalod, S. H. Robbins, L. Zitvogel, and E. Vivier Natural-killer cells and dendritic cells: "l'union fait la force" Blood, October 1, 2005; 106(7): 2252 - 2258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kuchtey, P. J. Chefalo, R. C. Gray, L. Ramachandra, and C. V. Harding Enhancement of Dendritic Cell Antigen Cross-Presentation by CpG DNA Involves Type I IFN and Stabilization of Class I MHC mRNA J. Immunol., August 15, 2005; 175(4): 2244 - 2251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. S. Angelov, M. Tomkowiak, A. Marcais, Y. Leverrier, and J. Marvel Flt3 Ligand-Generated Murine Plasmacytoid and Conventional Dendritic Cells Differ in Their Capacity to Prime Naive CD8 T Cells and to Generate Memory Cells In Vivo J. Immunol., July 1, 2005; 175(1): 189 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Walzer, L. Galibert, and T. De Smedt Dendritic cell function in mice lacking Plexin C1 Int. Immunol., July 1, 2005; 17(7): 943 - 950. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Naik, A. I. Proietto, N. S. Wilson, A. Dakic, P. Schnorrer, M. Fuchsberger, M. H. Lahoud, M. O'Keeffe, Q.-x. Shao, W.-f. Chen, et al. Cutting Edge: Generation of Splenic CD8+ and CD8- Dendritic Cell Equivalents in Fms-Like Tyrosine Kinase 3 Ligand Bone Marrow Cultures J. Immunol., June 1, 2005; 174(11): 6592 - 6597. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. J. J. Hegmans, A. Hemmes, J. G. Aerts, H. C. Hoogsteden, and B. N. Lambrecht Immunotherapy of Murine Malignant Mesothelioma Using Tumor Lysate-pulsed Dendritic Cells Am. J. Respir. Crit. Care Med., May 15, 2005; 171(10): 1168 - 1177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Toyama-Sorimachi, Y. Omatsu, A. Onoda, Y. Tsujimura, T. Iyoda, A. Kikuchi-Maki, H. Sorimachi, T. Dohi, S. Taki, K. Inaba, et al. Inhibitory NK Receptor Ly49Q Is Expressed on Subsets of Dendritic Cells in a Cellular Maturation- and Cytokine Stimulation-Dependent Manner J. Immunol., April 15, 2005; 174(8): 4621 - 4629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Tamura, P. Tailor, K. Yamaoka, H. J. Kong, H. Tsujimura, J. J. O'Shea, H. Singh, and K. Ozato IFN Regulatory Factor-4 and -8 Govern Dendritic Cell Subset Development and Their Functional Diversity J. Immunol., March 1, 2005; 174(5): 2573 - 2581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. J. Fugier-Vivier, F. Rezzoug, Y. Huang, A. J. Graul-Layman, C. L. Schanie, H. Xu, P. M. Chilton, and S. T. Ildstad Plasmacytoid precursor dendritic cells facilitate allogeneic hematopoietic stem cell engraftment J. Exp. Med., February 7, 2005; 201(3): 373 - 383. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. K. Yee, Y. Yao, Q. Xu, B. McCarthy, D. Sun-Lin, M. Tone, H. Waldmann, and C.-H. Chang Enhanced Production of IL-10 by Dendritic Cells Deficient in CIITA J. Immunol., February 1, 2005; 174(3): 1222 - 1229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. McKenna, A.-S. Beignon, and N. Bhardwaj Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity J. Virol., January 1, 2005; 79(1): 17 - 27. [Full Text] [PDF]
|
|
|
|
|
|
C. B. Lopez, B. Moltedo, L. Alexopoulou, L. Bonifaz, R. A. Flavell, and T. M. Moran TLR-Independent Induction of Dendritic Cell Maturation and Adaptive Immunity by Negative-Strand RNA Viruses J. Immunol., December 1, 2004; 173(11): 6882 - 6889. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Mellor, P. Chandler, B. Baban, A. M. Hansen, B. Marshall, J. Pihkala, H. Waldmann, S. Cobbold, E. Adams, and D. H. Munn Specific subsets of murine dendritic cells acquire potent T cell regulatory functions following CTLA4-mediated induction of indoleamine 2,3 dioxygenase Int. Immunol., October 1, 2004; 16(10): 1391 - 1401. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hochrein, B. Schlatter, M. O'Keeffe, C. Wagner, F. Schmitz, M. Schiemann, S. Bauer, M. Suter, and H. Wagner Herpes simplex virus type-1 induces IFN-{alpha} production via Toll-like receptor 9-dependent and -independent pathways PNAS, August 3, 2004; 101(31): 11416 - 11421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Suzuki, K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo, K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, et al. From the Cover: Critical roles of interferon regulatory factor 4 in CD11bhighCD8{alpha}- dendritic cell development PNAS, June 15, 2004; 101(24): 8981 - 8986. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Wang, A. Castellaneta, A. De Creus, W. J. Shufesky, A. E. Morelli, and A. W. Thomson Heart, but Not Skin, Allografts from Donors Lacking Flt3 Ligand Exhibit Markedly Prolonged Survival Time J. Immunol., May 15, 2004; 172(10): 5924 - 5930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Franchini, H. Hefti, S. Vollstedt, B. Glanzmann, M. Riesen, M. Ackermann, P. Chaplin, K. Shortman, and M. Suter Dendritic Cells from Mice Neonatally Vaccinated with Modified Vaccinia Virus Ankara Transfer Resistance against Herpes Simplex Virus Type I to Naive One-Week-Old Mice J. Immunol., May 15, 2004; 172(10): 6304 - 6312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bjorck Dendritic Cells Exposed to Herpes Simplex Virus In Vivo Do Not Produce IFN-{alpha} after Rechallenge with Virus In Vitro and Exhibit Decreased T Cell Alloreactivity J. Immunol., May 1, 2004; 172(9): 5396 - 5404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Pichyangkul, K. Yongvanitchit, U. Kum-arb, H. Hemmi, S. Akira, A. M. Krieg, D. G. Heppner, V. A. Stewart, H. Hasegawa, S. Looareesuwan, et al. Malaria Blood Stage Parasites Activate Human Plasmacytoid Dendritic Cells and Murine Dendritic Cells through a Toll-Like Receptor 9-Dependent Pathway J. Immunol., April 15, 2004; 172(8): 4926 - 4933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Salio, M. J. Palmowski, A. Atzberger, I. F. Hermans, and V. Cerundolo CpG-matured Murine Plasmacytoid Dendritic Cells Are Capable of In Vivo Priming of Functional CD8 T Cell Responses to Endogenous but Not Exogenous Antigens J. Exp. Med., February 17, 2004; 199(4): 567 - 579. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Asselin-Paturel, G. Brizard, J.-J. Pin, F. Briere, and G. Trinchieri Mouse Strain Differences in Plasmacytoid Dendritic Cell Frequency and Function Revealed by a Novel Monoclonal Antibody J. Immunol., December 15, 2003; 171(12): 6466 - 6477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Schneeberger, P. Luhrs, R. Kutil, P. Steinlein, H. Schild, W. Schmidt, and G. Stingl Granulocyte-Macrophage Colony-Stimulating Factor-Based Melanoma Cell Vaccines Immunize Syngeneic and Allogeneic Recipients via Host Dendritic Cells J. Immunol., November 15, 2003; 171(10): 5180 - 5187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lund, A. Sato, S. Akira, R. Medzhitov, and A. Iwasaki Toll-like Receptor 9-mediated Recognition of Herpes Simplex Virus-2 by Plasmacytoid Dendritic Cells J. Exp. Med., August 4, 2003; 198(3): 513 - 520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D'Amico and L. Wu The Early Progenitors of Mouse Dendritic Cells and Plasmacytoid Predendritic Cells Are within the Bone Marrow Hemopoietic Precursors Expressing Flt3 J. Exp. Med., July 21, 2003; 198(2): 293 - 303. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
)
and CD11c+B220+ (
) total cell numbers in
spleen cells from wild-type control and FL-KO mice. The data represent
the mean ± SD of three individual mice and are representative of
three similar experiments.
, •) DCs from C57BL/6 mice
were pulsed in vitro for 24 h with 0.5 mg/ml OVA (OVA-protein) and
simultaneously activated (