The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
The Journal of Immunology, 2002, 169: 6530-6538.
Copyright © 2002 by The American Association of Immunologists

Inhibition of TGF{beta}1 by Anti-TGF{beta}1 Antibody or Lisinopril Reduces Thyroid Fibrosis in Granulomatous Experimental Autoimmune Thyroiditis1

Kemin Chen*, Yongzhong Wei*, Gordon C. Sharp* and Helen Braley-Mullen2,*,{dagger},{ddagger}

Departments of * Internal Medicine and {dagger} Molecular Microbiology and Immunology, University of Missouri School of Medicine, and {ddagger} Veteran Affairs Research Service, Columbia, MO 65212


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, a murine model of granulomatous experimental autoimmune thyroiditis (G-EAT) was used to determine the role of TGF{beta}1 in fibrosis initiated by an autoimmune inflammatory response. The fibrotic process was evaluated by staining thyroid tissue for collagen, {alpha}-smooth muscle actin, TGF{beta}1, and angiotensin-converting enzyme (ACE), and measuring serum thyroxine in mice given anti-TGF{beta}1 or the ACE inhibitor lisinopril. The role of particular inflammatory cells in fibrosis was tested by depletion experiments, and the cytokine profile in thyroids was examined by RT-PCR. Neutralization of TGF{beta}1 by anti-TGF{beta}1 or lisinopril resulted in less collagen deposition and less accumulation of myofibroblasts, and levels of active TGF{beta}1 and ACE were reduced in thyroids of treated mice compared with those of untreated controls. Other profibrotic molecules, such as platelet-derived growth factor, monocyte chemotactic protein-1, and IL-13, were also reduced in thyroids of anti-TGF{beta}1- and lisinopril-treated mice compared with those of controls. Confocal microscopy showed that CD4+ T cells and macrophages expressed TGF{beta}1. Fibrosis was reduced by injection of anti-CD4 mAb on day 12, when G-EAT was very severe (4–5+). Together, these results suggest a critical role for TGF{beta}1 in fibrosis initiated by autoimmune-induced inflammation. Autoreactive CD4+ T cells may contribute to thyroid fibrosis through production of TGF{beta}1. This G-EAT model provides a new model to study how fibrosis associated with autoimmune damage can be inhibited.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mouse thyroglobulin (MTg)3-sensitized spleen cells activated in vitro with MTg and IL-12 induce a very severe, destructive granulomatous form of experimental autoimmune thyroiditis (G-EAT) in recipient mice with proliferation of thyrocytes, infiltration of the thyroid by lymphocytes and histiocytes, extensive neutrophils, fibrin deposition, and necrosis (1). The most extensively destroyed thyroids ultimately become fibrotic and atrophic (1, 2, 3).

TGF{beta}s are members of a family of polypeptides, which mediate a broad spectrum of biological activities important in embryogenesis, tissue repair, cell growth, and immune regulation (4, 5, 6, 7). TGF{beta} is implicated in various models of fibrosis (2, 4), and it also regulates autoimmune diseases (5, 6, 7). Fibrosis can be a severe consequence of some autoimmune diseases (2, 8, 9, 10, 11, 12, 13, 14). Pulmonary fibrosis can be associated with rheumatoid arthritis in some patients (8, 9, 10), and fibrosis can occur in patients with scleroderma, Wegener’s granulomatosis, giant cell arteritis, and Riedel’s thyroiditis (11, 12, 13). However, the mechanisms involved in development of fibrosis, when the initiating event is an autoimmune inflammatory response, remain poorly understood.

The regulation of inflammatory cytokines is central to the pathogenesis of autoimmune diseases as well as fibrosis (4, 6, 7, 8). Immunocompetent cells, especially lymphocytes and macrophages, are probably the main source of these cytokines, and production of various cytokines and chemokines by CD4+ T cells plays a crucial role in regulation of autoimmune diseases. However, the role of autoreactive CD4+ T cells and other inflammatory cells in the development of fibrosis is not well understood. CD4+ T cells may contribute to fibrosis by producing or regulating profibrotic or antifibrotic molecules. Some cytokines and chemokines, such as IL-4, IL-13, and monocyte chemotactic protein (MCP)-1, are important profibrotic molecules (15, 16, 17, 18, 19) and may mediate fibrosis by promoting production of TGF{beta}1 (17). In G-EAT, various inflammatory cells infiltrate the thyroid, and CD4+ T cells are the primary effector cells, producing both Th1 and Th2 cytokines (3, 20, 21). The role of particular subsets of thyroid-infiltrating inflammatory cells in the development of fibrosis is unknown.

Our previous results showed that TGF{beta}1 protein expression colocalized with myofibroblasts (myofb) and macrophages in areas of collagen deposition in G-EAT thyroids (2), suggesting TGF{beta}1 may contribute to thyroid fibrosis in G-EAT. Targeting TGF{beta}1 has been an effective strategy for treatment of fibrosis in other models (8). However, because TGF{beta}1 negatively regulates some autoimmune diseases (6, 7, 22), it is important to determine the effect of blocking TGF{beta}1 on fibrosis that occurs as a result of autoimmune inflammation. Angiotensin (ANG)-converting enzyme (ACE) inhibitors (ACEI), designed primarily to limit vasoconstriction, can have potent antifibrotic effects due to their ability to block the link between ANGII and TGF{beta}1 (14, 23, 24, 25). Blocking ANGII by ACEI inhibited fibrosis of the kidney and heart (14, 24, 25, 26), but it is not known whether this will also reduce fibrosis resulting from an autoimmune inflammatory response. The results of this study show that inhibition of TGF{beta}1 using anti-TGF{beta}1 or the ACEI lisinopril reduces thyroid fibrosis but has no effect on G-EAT severity scores at the peak of disease, demonstrating a direct role for TGF{beta}1 in thyroid fibrosis. An important role for CD4+ T cells in thyroid fibrosis was demonstrated by showing that anti-CD4 mAb, given under conditions that did not affect G-EAT severity scores at the peak of disease, inhibited fibrosis. A role for other inflammatory cells was inferred by assessing the localization of specific cells in relation to areas of collagen deposition in fibrotic thyroids. Moreover, comparison of cytokine profiles in thyroids of control and anti-TGF{beta}-treated mice suggests that interactions between TGF{beta}1 and other cytokines may be important in modifying the effects of TGF{beta}1 on fibrosis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

DBA/1 mice were bred in our animal facilities at the University of Missouri. Both male and female mice (6–10 wk old) were used for these experiments.

Induction of G-EAT

Donor DBA/1 mice were immunized twice with 150 µg MTg and 15 µg LPS (E. coli 0111:B4; Sigma-Aldrich, St. Louis, MO) i.v. at 10-day intervals (1, 20). Seven days after the second injection of MTg and LPS, donor spleen cells were cultured at 107 cells/ml in RPMI 1640 containing 25 mM HEPES buffer (Cell and Immunobiology Core Facility, University of Missouri), 5% FCS (Atlanta Biologicals, Norcross, GA), 2 mM glutamine, MEM vitamin solution, nonessential amino acids, 1 mM sodium pyruvate, and 5 x 10-5 M 2-ME. Cells were cultured with 25 µg/ml MTg and 5 ng/ml IL-12 (PeproTech, Rocky Hill, NJ) as previously described (1). After 72 h, cells were harvested and washed, and 3.5 x 107 cells were injected i.v. into irradiated (500-rad) recipient mice. Recipient thyroids were evaluated for experimental autoimmune thyroiditis severity 17–21 days later, the time of maximal severity of G-EAT in this adoptive transfer model (1, 2, 20), or 35–60 days following cell transfer when fibrosis is maximal (2).

Anti-TGF{beta}1 and lisinopril treatment

Mice were given 250 µg anti-TGF{beta}1 mAb 1D11.16.8 (mouse IgG1) (ATCC HB 9849; American Type Culture Collection, Manassas, VA) every 4 days beginning 4 days after cell transfer and continuing throughout the experiment. Preliminary results indicated that thyroid lesions in recipient mice given normal mouse IgG according to the same injection schedule were indistinguishable from those of control recipient mice not given IgG. Therefore, in the experiments shown here, the control recipient mice received in vitro activated donor splenocytes but were not given mouse Ig. The ACEI lisinopril (Sigma-Aldrich) was used at a concentration of 60 mg/L administered in the drinking water beginning on the day of cell transfer and continuing throughout the experiment. The water was changed two to three times per wk. Preliminary experiments indicated that each mouse consumed ~5 ml water/day; therefore, the amount of lisinopril ingested per day was ~0.3 mg/mouse.

Evaluation of G-EAT histopathology

Thyroids were removed at various times after cell transfer, and one lobe of each thyroid was fixed in formalin. For histologic analysis, tissues were embedded in paraffin, sectioned (7 µm), and stained with H&E. Thyroids were scored quantitatively for G-EAT severity, using a scale of 0–5+ according to previously established criteria (1, 20). Measurements of thyroiditis were as follows: 1+, an infiltrate of at least 125 cells in one or several foci; 2+, 10–20 foci of cellular infiltration involving up to 25% of the gland; 3+, infiltration of 25–50% of the gland; 4+, >50% of the gland is destroyed; and 5+, virtually complete destruction of the gland, with few or no remaining follicles. Thyroid lesions were also evaluated qualitatively. DBA/1 mice typically develop very severe (4–5+) G-EAT (2). Fourteen to 21 days after cell transfer, thyroids had extensive granulomatous changes with follicular cell proliferation, multinucleated giant cells, large numbers of histiocytes, and numerous lymphocytes and neutrophils. There were also microabscess formation, necrosis, and fibrin deposition. The inflammation in thyroids with 4–5+ severity scores characteristically extended beyond the thyroid to involve adjacent connective tissue and muscle. By days 35–60, thyroids of most untreated mice were very small and atrophic, with fewer inflammatory cells, extensive collagen deposition, and virtually no remaining follicles. For qualitative evaluation of collagen deposition and fibrosis, thyroid sections were stained using Masson’s Trichrome (Histoscientific Research Labs, Manassas, VA). All slides were evaluated separately by at least two of the investigators, one of whom had no knowledge of the experimental treatments. Differences in interpretation were very rare.

Immunohistochemistry

Tissue sections were deparaffinized in xylene, rehydrated through sequential ethanol, and rinsed in PBS. The immunohistochemical methods used immunoperoxidase staining as previously described (2), and the intensity of immunostaining was graded semiquantitatively. Staining of TGF{beta}1 and {alpha}-smooth muscle actin ({alpha}-SMA) was performed as previously described (2). ACE staining was performed on paraffin sections, and microwave irradiation was used for Ag retrieval as previously described (2). Sections were incubated overnight with anti-ACE mAb (ATCC HB 8191; American Type Culture Collection) followed by incubation with biotin-conjugated goat anti-mouse IgM (Jackson ImmunoResearch Laboratories, West Grove, PA) for 30 min; color was visualized by VIP (very intense purple) chromogen (Vector Laboratories, Burlingame, CA). Infiltration of neutrophils and macrophages in G-EAT thyroids was detected on cryosections using rat mAb against neutrophils (RB6-8C5; provided by Dr. R. Coffman, DNAX, Palo Alto, CA) or macrophages (F4/80; both American Type Culture Collection). Sections were blocked in 1% BSA for 30 min, washed with PBS, and endogenous peroxidase activity was quenched with 0.3% hydrogen peroxide in PBS for 30 min. This and all subsequent washes were in PBS (0.1 M, pH 7.6). TGF{beta}1, neutrophils, and macrophages were visualized by diaminobenzidine, and {alpha}-SMA by VIP. Sections were counterstained with hematoxylin. Negative controls were performed using nonimmune mouse, rat, or chicken Ig at a protein concentration equivalent to the respective secondary Abs. These controls were always negative. All immunostaining was performed with tissue sections from three to four individual animals per group from at least three separate experiments. Results shown are representative of all animals tested, and representative areas of each slide are shown.

Confocal laser-scanning double-immunofluorescence microscopy

To detect the differential expression of TGF{beta}1 by CD4+ T cells during development of thyroid fibrosis, dual-color immunofluorescence and confocal laser-scanning microscopy were done using established markers for CD4 and macrophages. Thyroid frozen sections were fixed with methanol (4°C for 5 min) and then in acetone (4°C for 5 min) and 2% paraformaldehyde for 15 min. Sections were then washed with PBS and blocked with 0.5% casein diluted in PBS. Sections were incubated with chicken anti-TGF{beta}1 Ab (diluted 1/200) for 1 h at room temperature, and visualized with Alexa 488 conjugated anti-chicken secondary Ab (1/500; Molecular Probes, Eugene, OR). For CD4+ T cell and macrophage staining, slides were incubated with monoclonal rat IgG anti-CD4 (YTS191) or anti-macrophage (F4/80) for 30 min, followed by incubation with biotin-conjugated anti-rat secondary Ab (1/500) for 30 min, and visualized by streptavidin-conjugated Alexa 568 (Molecular Probes) for 30 min. Slides were stored at 4°C in the dark until observation. Preparations were observed with a Bio-Rad (Hercules, CA) Radiance 2000 confocal system coupled to an Olympus (Melville, NY) IX70 inverted microscope.

Serum thyroxine (T4) assay

Serum T4 levels were determined using a T4 enzyme immunoassay kit (Biotecx Labs, Houston, TX) according to the manufacturer’s instructions. Results are expressed as micrograms of T4 per deciliter of serum. These kits were recently reoptimized for detection of T4 in human serum, so the values reported here tend to be lower than those reported in our previous study (2). Using the current kits, values for normal mouse serum range from 4 to 6 µg T4/dl of serum, and any values >3 are considered normal.

RT-PCR

Thyroid lobes from individual mice were removed at different times after adoptive transfer, and one lobe was stored at -80°C before processing. Frozen thyroids were homogenized in TRIzol; RNA was extracted and reverse transcribed, and RT-PCR was done as previously described (21). To determine the relative initial amounts of target cDNA, each cDNA sample was serially diluted 1/5, 1/25, and 1/125, and amplified with cytokine-specific primers (21). Hypoxanthine phosphoribosyltransferase (HPRT) was used as a housekeeping gene to verify that the same amount of RNA was amplified. The PCR products were electrophoresed in 2% agarose gel, visualized by UV light after staining with ethidium bromide, and normalized between samples relative to levels of HPRT using an IS-1000 Digital Imaging System (Life Sciences, St. Louis, MO). Most cytokine gene primers used in this study have been described previously (21). Primer sequences were as follows: ACE, sense, AGGAAGAGCAGCAGCCACTG, and antisense, GTCAGCTTCATCATCCAGTT; platelet-derived growth factor (PDGF), sense, TCTCCCCATTCGCAGGAAGAG, and antisense, TTGGCCACCTTGACACTGCG; MCP-1, sense, TCCATGCAGGTCCCTGTCATGCTT, and antisense, CTAGTTCACTGTCACACTGGTC; and TGF{beta}RI, sense, CGTGCTGACATCTATGCAAT, and antisense, AGCTGCTCCATTGGCATAC.

Statistical analysis

Experiments in Tables IGo and IIIGo were repeated four to five times with similar results. Results in Fig. 3Go were repeated three times, and statistical analysis was performed using an unpaired two-tailed Student’s t test. Values with p < 0.05 were considered significant and are designated by an asterisk in the figure.


View this table:
[in this window]
[in a new window]
 
Table 1. Administration of anti-TGF{beta}1 or lisinopril reduces thyroid fibrosis

 

View this table:
[in this window]
[in a new window]
 
Table 3. Inhibition of fibrosis by administration of anti-CD4 to recipient mice

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. Levels of TGF{beta}1 and ACE (A), PDGF and MCP-1 (B), IFN-{gamma} and TGF{beta}RI (C), and IL-4 and IL-13 (D) mRNA transcripts in thyroids of mice with or without anti-TGF{beta}1 treatment 19 or 35 days after cell transfer. At day 19, both control and anti-TGF{beta}1-treated mice had 4–5+ G-EAT severity scores; at day 35, the average G-EAT score was 5+ for controls and 4+ for anti-TGF{beta}1 mice. cDNA was prepared from thyroids of individual mice and amplified as described in Materials and Methods. Bars represent the means of data for thyroids of five individual mice ± SD. Results are expressed as the mean ratio of cytokine densitometric units/HPRT ± SD (x100) and are representative of three independent experiments. A significant difference between anti-TGF{beta}1 treatment or control thyroids is indicated by an asterisk (p < 0.05).

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of inhibition of TGF{beta}1 by anti-TGF{beta}1 and the ACEI lisinopril on the development of thyroid fibrosis in G-EAT

Severe G-EAT induced by effector cells activated in the presence of MTg and IL-12 is followed by fibrosis and atrophy of the thyroid (1, 2). Our previous study (2) suggested an important role for TGF{beta}1 in the development of thyroid fibrosis. Because ANGII is a potent inducer of TGF{beta}1 (14, 23), we asked whether the ACEI lisinopril or anti-TGF{beta}1 Ab could inhibit thyroid fibrosis when given to recipient mice. Control recipient mice given no treatment or normal mouse Ig always had very severe (4–5+) G-EAT 14–19 days after cell transfer in these and many other experiments (Table IGo; Fig. 1GoA; and data not shown). Thyroids were enlarged (7–10 times larger than thyroids from normal mice), with extensive neutrophil infiltration and extension of inflammation beyond the gland to involve adjacent connective tissue and muscle (Fig. 1GoA). G-EAT severity at day 14 or 19 was unaffected by treatment with lisinopril or anti-TGF{beta}. Collagen deposition (fibrosis) as determined by Trichrome staining was primarily around the periphery of the gland at this time (Fig. 1GoA), and this was usually reduced in thyroids of anti-TGF{beta}- or lisinopril-treated mice (Tables IGo and IIGo). Serum T4 levels in both control and treated mice were normal or slightly below normal at days 14–19 (Table IGo, lines 1–3, 7, and 8). Thyroids of most control mice had extensive fibrosis and atrophy at day 35 (data not shown), and atrophy and fibrosis further increased by days 45–60 (Table IGo, lines 4 and 9, and Table IIGo). Thyroids were very small and atrophic (Table IGo and Fig. 1GoB), less than half the size of a normal thyroid and had extensive collagen deposition both within the gland and around the periphery of the gland by Trichrome staining (Fig. 1Go, B, E, and G; and Tables IGo and IIGo). An occasional control mouse (5–10% of all mice studied) had less severe disease and no fibrosis at days 45–55 (e.g., Table IGo, line 9), which was probably the result of poor i.v. injection of cells. These mice also presumably had less severe disease at days 19–21, and they always had normal serum T4 levels. Although thyroids of most mice given anti-TGF{beta}1 or ACEI treatment also had some fibrosis at day 35, fibrosis and atrophy were consistently reduced compared with those of controls at day 35 (Fig. 1GoF and data not shown). By days 45–60, when fibrosis and atrophy further increased in thyroids of most control mice, fibrosis in thyroids of anti-TGF{beta} or lisinopril-treated mice was further reduced. The thyroids generally had minimal collagen deposition at days 55–60, most thyroids were normal in size (not atrophic), and thyroid follicles were beginning to regenerate (Fig. 1Go, C, D, and H; and Table IIGo). Serum T4 levels were low in all control mice with severity scores of 4–5+ at days 35–60, but were higher in most treated mice in Table IGo and in other experiments (not shown). In the results shown in Table IGo, all treated mice with low serum T4 levels at days 45–55 had severity scores of 3–5+ with some fibrosis but little or no atrophy. In other experiments, administration of both anti-TGF{beta}1 and lisinopril did not increase the antifibrotic effects compared with those observed with either treatment alone (data not shown).



View larger version (156K):
[in this window]
[in a new window]
 
FIGURE 1. A–D, Comparison of thyroid size and collagen deposition in thyroids of control and anti-TGF{beta}1- or lisinopril-treated mice. Thyroids with 5+ severity scores at day 18 in control mice are very large, most follicles are destroyed, and collagen (blue) is confined to the periphery of the gland (A). At day 50, thyroids of control mice are very small (atrophic), and collagen (blue) is present both within and around the periphery of the gland (B). In contrast, thyroids of anti-TGF{beta}- (C) or lisinopril- (D) treated mice at day 50 are much larger (not atrophic), minimal collagen is evident within the confines of the gland, and thyroid follicles are beginning to regenerate. E–H, Collagen deposition (blue) was increased at days 35 (E) and 60 (G) in thyroids of controls compared with those of anti-TGF{beta}-treated mice (F and H). I–L and M–P, TGF{beta}1 (brown) (I–L) and {alpha}-SMA which stains myofbs (purple) (M–P) were also increased in thyroids of control (I and M) vs anti-TGF{beta}-treated mice (J and N) at day 19 and day 60 (controls, K and O; and anti-TGF{beta}-treated, L and P). Insets in M and N show a higher power view of myofbs. Q–T, Expression of ACE (reddish purple) at day 19 in thyroids of control (Q–S) or lisinopril-treated mice (T). ACE was highly expressed in thyroids of control mice in areas containing myofb (Q) and in granulomas (R), while ACE was reduced in the granulomas of lisinopril-treated mice (T). Areas in control thyroids where neutrophils were predominant (S) did not express ACE. A representative area on each slide is shown. Magnification: A–D and M–P, x100; E–L and Q–T, x400; and inserts in M and N, x1000.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Summary of expression of TGF{beta}1, collagen, {alpha}-SMA, and ACE in thyroids of control mice or anti-TGF{beta}1- or lisinopril-treated mice

 
We then evaluated the effect of TGF{beta}1 inhibitors on the expression of TGF{beta}1, myofbs, and ACE in the thyroids. As expected, TGF{beta} protein expression was high (Fig. 1GoI), and there were numerous myofbs (Fig. 1GoM) in thyroids of control mice at days 17–19. TGF{beta} protein (Fig. 1GoK) and myofbs (Fig. 1GoO) persisted through day 60. Thyroids of anti-TGF-{beta}1- (Fig. 1Go, J and L; and Table IIGo) and lisinopril- (Table IIGo) treated mice had much lower expression of TGF-{beta}1 protein at both day 19 and day 60. There were also fewer myofbs at days 17–19 (Fig. 1GoN) and essentially no myofbs at day 35 or day 60 (Table IIGo and Fig. 1GoP). ACE was highly expressed at day 19 in thyroids of control mice and was restricted to areas containing myofbs (Fig. 1GoQ) and granulomatous areas (Fig. 1GoR), but ACE was not expressed in areas with extensive neutrophil infiltration (Fig. 1GoS). ACE expression was reduced at day 19 (Fig. 1GoT) and day 60 (Table IIGo) in thyroids of anti-TGF{beta}1- or lisinopril-treated mice compared with those of controls, probably due to the reduced myofbs and macrophages.

Inflammatory cells involved in development of thyroid fibrosis in G-EAT

The inflammatory cells infiltrating the thyroid at days 14–21 included CD4+ and CD8+ T cells, macrophages, plasma cells, myofbs, histiocytes, giant cells, and many neutrophils. Several types of inflammatory cells in G-EAT thyroids have the potential to produce TGF{beta}1, and all can express the high affinity TGF{beta}1R. To begin to address the potential role of various inflammatory cells in thyroid fibrosis, the infiltration of inflammatory cells in the thyroid was monitored over time by immunohistochemical staining. CD4+ T cells were the first cells detected in the thyroid, as early as day 3 after cell transfer. This was followed several days later, usually by days 7–8, by infiltration of CD8+ T cells, neutrophils, and macrophages (data not shown). Neutrophil infiltration was maximal at days 14–21. At day 14, neutrophils were predominantly located at the periphery of the thyroid (Fig. 2GoA), in the same location as myofbs and collagen (Fig. 1Go, A and M). At days 19–21, large groups of neutrophils accumulated inside the thyroid (Fig. 2GoB), and the aggregated neutrophils were surrounded by macrophages (Fig. 2GoE). The general pattern and extent of neutrophil infiltration was similar in thyroids of both control and treated mice, and few neutrophils persisted in thyroids examined at day 35 or later in any groups (data not shown). (Higher power views of the cells in Fig. 2Go, A and B, are shown in Fig. 2Go, C and D.)



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 2. A–D, Representative areas of photomicrographs demonstrating neutrophil staining at day 14 (A and C) and day 19 (B and D) in thyroids of control mice. Neutrophil infiltration is predominantly near the outer edges of the thyroid at day 14 (A), and at day 19, most neutrophils are present in clusters within the thyroid (B). C and D are higher power views of A and B. E and F, Many macrophages are present in thyroids of control mice at day 19 (E), and they persist through day 60 (F). G–J, TGF{beta}1 is produced by CD4+ T cells and macrophages in thyroids of control mice. Dual staining and confocal microscopy demonstrate TGF{beta}1+ cells (green), CD4+ T cells (red), and cells that express both CD4 and TGF{beta}1 (overlay, yellow) at days 19 (G) and 35 (H), and TGF{beta}1+ cells (green), macrophages (red), and cells that express both TGF{beta}1 and macrophage markers (overlay, yellow) at days 19 (I) and 35 (J). Representative areas of each slide are shown. Magnification: A and B, x100; C and D, x1000; E and F: x400; and G–J, x600.

 
Macrophages were also present in thyroids at day 19 (Fig. 2GoE), and many macrophages persisted, particularly in thyroids of control mice, through day 60 (Fig. 2GoF). Macrophages could promote fibrosis by producing ACE and TGF{beta}1 (26), and macrophages were shown to produce TGF{beta}1 in thyroids that progress to fibrosis (2).

Because CD4+ T cells are the primary effector cells for G-EAT (20), it was of interest to determine whether CD4+ T cells were necessary for the development of fibrosis. Injection of anti-CD4 mAb 2 days after cell transfer almost completely prevented development of G-EAT (data not shown). However, if a single injection of anti-CD4 mAb was given 12 days after cell transfer, when G-EAT severity scores were 4–5+, G-EAT severity at days 19–20 was only minimally reduced (Table IIIGo). However, fibrosis was markedly reduced at days 40–60 (Table IIIGo), most thyroids were not atrophic, and thyroid follicles were beginning to regenerate (not shown). In addition, serum T4 levels were higher at days 40–60 in most anti-CD4-treated mice compared with those of controls (Table IIIGo). These results indicate that CD4+T cells, the primary effector cells for G-EAT (20), were also important for development of thyroid fibrosis. A single injection of anti-CD4 given 12 days after cell transfer resulted in nearly complete depletion of CD4+ T cells in the spleen for 10–14 days, but CD4+ T cells were only partially reduced in the thyroids (data not shown). When thyroids were removed 40–60 days after cell transfer, CD4+ T cells were not reduced in either spleens or thyroids (data not shown).

CD8+ T cells play an important role in G-EAT resolution and are also predominant infiltrating cells in G-EAT thyroids (27). Severe G-EAT develops in mice in which CD8+ T cells are depleted, and our previous studies have shown that fibrosis in CD8-depleted mice is comparable to that in controls at days 35–50 (28). Thus, CD8+ T cells are not required for development of fibrosis.

TGF{beta}1 is produced by CD4+ T cells and macrophages in the thyroid during development of fibrosis

The mechanism by which CD4+ T cells might promote thyroid fibrosis could be due to their ability to produce TGF{beta}1. Confocal microscopy analysis of thyroids that ultimately developed fibrosis showed that some CD4+ T cells expressed TGF{beta}1 as early as day 7, and many CD4+ T cells were strongly TGF{beta}1 positive at day 10 (data not shown). At day 19, TGF{beta}1 expression in thyroids further increased, and TGF{beta}1+ cells included CD4+ T cells, as well as non-CD4+ T cells (Fig. 2GoG). A few CD4+ T cells still expressed TGF{beta}1 at day 35 (Fig. 2GoH). Many macrophages were also TGF{beta}1 positive at both day 19 and day 35 (Fig. 2Go, I and J). Taken together, these results indicate that CD4+ T cells produce TGF{beta}1 primarily from days 10 to 19, while macrophages were predominant producers of TGF{beta}1 at day 19 and also at day 35, when fibrosis was extensive. As a potent chemotactic factor for many inflammatory cells (5, 29, 30, 31), TGF{beta}1 secreted by early infiltrating CD4+ T cells may attract other inflammatory cells to the thyroid, thus promoting further production of TGF{beta}1 (32, 33). TGF{beta}1 expression in G-EAT thyroids at day 19 was reduced after anti-CD4 treatment (data not shown), consistent with the idea that CD4+ T cells may produce some of the TGF{beta}1 in G-EAT thyroids.

Cytokine mRNA expression in thyroids of control and anti-TGF{beta}-treated mice

The action of TGF{beta}1 is dependent not only on the cell type and its state of differentiation but also on the cytokine milieu in an inflammatory site (5, 6, 8). Expression of cytokine mRNA in thyroids of mice with or without anti-TGF{beta}1 or ACEI treatment was examined by RT-PCR. Administration of anti-TGF{beta}1 prevented the overexpression of TGF{beta}1 mRNA, and inhibited ACE gene expression at day 19 (Fig. 3GoA). Because PDGF and MCP-1 are important in many models of fibrosis (34, 35, 36), their gene expression was also examined. Both PDGF and MCP-1 were highly expressed in thyroids of control mice at day 19, and PDGF remained relatively high at day 35 (Fig. 1GoB). Their expression was significantly decreased at day 19 in thyroids of anti-TGF{beta}1-treated mice, and PDGF was also decreased at day 35. Expression of IFN-{gamma} was increased in the thyroids of anti-TGF{beta}1-treated mice (Fig. 3GoC), which may suggest antagonism between TGF{beta}1 and IFN-{gamma} (6, 32). The effect of TGF{beta}1 on the synthesis and deposition of extracellular matrix are mediated by the type I receptor (TGF{beta}RI) (4). However, expression of TGF{beta}RI was not decreased in thyroids of anti-TGF{beta}1-treated mice (Fig. 3GoC), suggesting the reduction in fibrosis in anti-TGF{beta}1-treated mice was mainly due to neutralization of TGF{beta}1. Recently, IL-4 and IL-13 have been identified as key mediators of tissue fibrosis (8, 15, 16, 17), and expression of both cytokines was significantly higher in thyroids of control mice compared with those of anti-TGF{beta}1-treated mice at day 19, but not at day 35 (Fig. 3GoD). Similar results were obtained with RT-PCR analysis of thyroids of mice given lisinopril (data not shown). Taken together, reduction of fibrosis by anti-TGF{beta}1 or ACEI was accompanied by reduction of several profibrotic molecules in the thyroid, suggesting that TGF{beta}1 is an important cytokine in development of fibrosis as demonstrated by others (4, 37).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fibrosis can occur in many tissues and organs as a result of various types of damage, and is a major cause of tissue damage and organ failure (4, 8). These studies were designed to address the mechanisms involved in fibrosis that can develop as a consequence of an autoimmune inflammatory response. This adoptive transfer murine model of G-EAT is, to our knowledge, the only well-characterized animal model of autoimmune disease in which a granulomatous inflammatory response that can result in organ fibrosis can be experimentally induced. Granulomatous inflammatory lesions, some of which have fibrotic manifestations, can be a pathologic feature of several human diseases such as Wegener granulomatosis, allergic granulomatosis, giant cell arteritis, rheumatoid arthritis, Riedel thyroiditis, and sarcoidosis (12), and fibrosis is a major pathologic feature of scleroderma (11). Therefore, G-EAT provides a unique model for understanding mechanisms of fibrosis and for experimentally determining how fibrosis initiated by tissue or organ destruction resulting from an autoimmune inflammatory response might be inhibited or controlled.

The current results demonstrate that inhibition of TGF{beta}1 by anti-TGF{beta}1 Ab or ACEI can reduce thyroid fibrosis after induction of G-EAT, indicating that TGF{beta}1 has a critical role in fibrosis that develops as a consequence of an autoimmune inflammatory response. Blocking the activity of TGF{beta}1 by anti-TGF{beta}1 or by adenovirus-mediated local expression of a dominant-negative TGF{beta}1R prevented or reduced fibrosis resulting from nonautoimmune damage to the liver, lung, and kidneys (4, 37). Our data expand the concept that TGF{beta}1 expression in a particular organ is central to the development of fibrosis. TGF{beta}1 has been reported to have both pro- and anti-inflammatory effects on autoimmune diseases. TGF{beta}1 suppressed experimental autoimmune encephalomyelitis in vivo (7, 22) but enhanced activation of experimental autoimmune encephalomyelitis (38), experimental autoimmune thyroiditis (39), and experimental autoimmune uveitis effector cells in vitro (40). Arthritis was promoted by intra-articular injection of TGF{beta}1 (41), and neutralization of TGF{beta}1 inhibited development of spontaneous autoimmune thyroiditis in NOD.H-2h4 mice (42). Despite the potent immunosuppressive effects of TGF{beta} (5, 6, 7), inhibition of TGF{beta}1 by anti-TGF{beta}1 or ACEI did not increase inflammation in G-EAT thyroids. Thyroids of mice given anti-TGF{beta}1 or ACEI had G-EAT severity scores at days 14–19 comparable to those of the controls (Table IGo), but at days 35–60, thyroids of anti-TGF{beta}1- and ACEI-treated mice were less atrophic and had many regenerating thyroid follicles and less deposition of collagen.

Effective inhibition of the fibrotic process by anti-TGF{beta}1 and ACEI treatment was demonstrated both by histologic (H&E as well as collagen and myofb staining) and functional (serum T4) criteria. Inhibition of fibrosis was associated with reduced levels of TGF{beta}1 mRNA and protein in G-EAT thyroids. There was only a transient appearance of myofbs in thyroids of treated mice at day 19, followed by a decline of inflammatory cells in thyroids at days 35–60. At days 50–60, thyroids of most anti-TGF{beta}1- and ACEI-treated mice had regenerating follicles with no myofbs and little collagen deposition, whereas thyroids of control mice generally had extensive fibrosis and were very small and atrophic through day 60 (Fig. 1Go). Serum T4 levels were low in most control mice at this time, whereas T4 levels were usually higher and often had returned to normal in treated mice (Tables IGo and IIIGo). The reason serum T4 levels were still below normal in some treated mice even when thyroid fibrosis and atrophy were clearly reduced may be that some time is needed for serum T4 levels to return to normal after thyroid follicles begin to regenerate. Thus, T4 levels might have been normal if serum had been obtained several days later.

G-EAT thyroids become fibrotic only when most thyroid follicles are destroyed (1, 2, 3). The fact that fibrosis develops in the presence or absence of CD8+ T cells (28) suggests CD8+ T cells are not essential for the development of thyroid fibrosis. However, CD4+ T cells apparently contribute to the development of thyroid fibrosis because administration of anti-CD4 mAb 12 days after cell transfer, when G-EAT severity was nearly maximal, effectively inhibited fibrosis (Table IIIGo). CD4+ T cells might promote fibrosis through regulation and production of TGF{beta}1. Production of TGF{beta}1 by CD4+ T cells in the thyroid was noted as early as day 7, before the infiltration of most other inflammatory cells. Previous studies have shown that TGF{beta}1 can facilitate the migration of neutrophils and monocytes into tissues (5, 29, 30, 31). CD4+ T cells were the first cells to accumulate in the thyroid, and thyroids of anti-CD4-treated mice expressed less TGF{beta}1 (our unpublished observations), even though CD4+ T cells were not completely depleted from thyroids. Thus, as primary effector cells, MTg-specific CD4+ T cells may initially promote infiltration of neutrophils and monocytes by releasing TGF{beta}1 and other chemokines. Following infiltration of various inflammatory cells, activated macrophages and myofbs produce high levels of TGF{beta}1. The high expression of TGF{beta}1 by CD4+ T cells, macrophages, and myofbs results in excessive TGF{beta}1 production in the thyroid and in the development of fibrosis. CD4+ T cells may also contribute to fibrosis by producing other profibrotic cytokines or chemokines such as IL-13 and MCP-1 (15, 16, 43). TGF{beta}1 can also activate neutrophils at inflammatory sites and enhance their survival (30, 31). In G-EAT that progresses to fibrosis, neutrophil infiltration is initially prominent at the periphery of the thyroids, where fibrosis typically begins. Extensive accumulation of neutrophils is observed only when thyroid destruction is very severe and fibrosis ultimately develops, and increased neutrophils have been observed in other models of fibrosis (44, 45). Although neutrophil accumulation in thyroids was not apparently affected by anti-CD4, anti-TGF{beta}, or lisinopril treatment, we cannot yet rule out a role for neutrophils in the development of fibrosis. Studies are in progress to determine whether depletion of neutrophils will reduce thyroid fibrosis in this model.

The interaction between TGF{beta}1 and other cytokines (2, 16, 17, 32, 46, 47) as well as their direct action on fibroblasts suggests that other cytokines may be able to modify the profibrotic effects of TGF{beta}1 (16, 17). For example, IL-4, IFN-{gamma}, TNF-{alpha}, MCP-1, PDGF, and ACE are all involved in regulation of inflammation, tissue remodeling, and fibrosis (15, 16, 17, 18, 43, 47). In this study, expression of PDGF mRNA, known to be induced by TGF{beta}1 (46, 47), decreased following anti-TGF{beta}1 and ACEI treatment. MCP-1 and IL-13, which have frequently been implicated in fibrosis (15, 16, 17, 18, 19), were also decreased after neutralization of TGF{beta}1. Reduction of MCP-1 may result from decreased infiltration of macrophages and T cells (11) and/or decreased IL-13 production (16). IL-13 is a potent inducer of MCP-1 in vivo (16), and it promotes fibrosis through TGF{beta}1 signaling (17). Although IL-4 has also been implicated in fibrosis (8), IL-4 is probably not critical for thyroid fibrosis because fibrosis develops in IL-4-/- mice with G-EAT (our unpublished observations). Because reduced expression of profibrotic cytokines was accompanied by reduced numbers of myofibs, the activated form of fibroblasts, TGF{beta}1 may interact with other cytokines to modulate fibroblast behavior (15, 33, 48). This may in turn regulate production of cytokines and/or chemokines, resulting in a persistent positive feedback loop between certain cytokines and fibroblasts.

ACE was highly expressed in G-EAT thyroids at the time of maximal inflammation, and was localized in areas of collagen deposition. Myofbs and macrophages may be the major producers of ACE (26). The ACEI lisinopril decreased TGF{beta}1 production in the thyroid and reduced thyroid fibrosis. ACEI may also reduce MCP-1 induced by ANGII (49), further interfering with MCP-1-mediated CD4+ T cell proliferation and cytokine production (43). These multiple effects may account for the potent effects of ACEI in inhibiting fibrosis and reducing tissue damage (14). These data support the notion that inhibition of TGF{beta}1 by ACEI can be a useful treatment for thyroid fibrosis, consistent with results of others demonstrating its effectiveness for treatment of fibrosis in other organs (14, 24, 25).

The complex interaction between TGF{beta}1 and various cells and mediators reflects the well-regulated process that should follow termination of an inflammatory response. This control can be interrupted by an excessive influx of inflammatory cells and dysregulation of TGF{beta}1 and other cytokines. G-EAT provides a new model to study pathogenic mechanisms and therapeutic interventions in fibrosis. The knowledge gained from these studies could have important implications for understanding specific mechanisms of fibrosis involved in other autoimmune diseases, in particular those associated with granulomatous immunopathology, arthritis, vasculitis, and fibrotic sequelae (8, 9, 10, 12). The ability of ACEI to block TGF{beta}1 suggests they may be clinically useful antifibrotic agents for such diseases.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant DK35527 and by the University of Missouri Research Board. K.C. was supported by a postdoctoral fellowship from the University of Missouri Molecular Biology Program and by an Arthritis Foundation postdoctoral fellowship Back

2 Address correspondence and reprint requests to Dr. Helen Braley-Mullen, Division of Immunology and Rheumatology, Department of Medicine, University of Missouri, M450 Medical Sciences, Columbia, MO 65212. Email address: mullenh{at}health.missouri.edu Back

3 Abbreviations used in this paper: MTg, mouse thyroglobulin; G-EAT, granulomatous experimental autoimmune thyroiditis; myofb, myofibroblast; ANG, angiotensin; ACE, ANG-converting enzyme; ACEI, ACE inhibitor; T4, thyroxine; PDGF, platelet-derived growth factor; MCP, monocyte chemotactic protein; {alpha}-SMA, {alpha}-smooth muscle actin; HPRT, hypoxanthine phosphoribosyltransferase. Back

Received for publication July 18, 2002. Accepted for publication September 27, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Braley-Mullen, H., G. C. Sharp, H. Tang, K. Chen, M. Kyriakos, J. T. Bickel. 1998. Interleukin-12 promotes activation of effector cells that induce a severe destructive granulomatous form of experimental autoimmune thyroiditis. Am. J. Pathol. 152:1347.[Abstract]
  2. Chen, K., Y. Z. Wei, G. C. Sharp, H. Braley-Mullen. 2000. Characterization of thyroid fibrosis in a murine model of granulomatous experimental autoimmune thyroiditis. J. Leukocyte Biol. 68:828.[Abstract/Free Full Text]
  3. Braley-Mullen, H., G. C. Sharp. 2000. Adoptive transfer murine model of granulomatous experimental autoimmune thyroiditis. Int. Rev. Immunol. 19:535.[Medline]
  4. Border, W. A., N. A. Noble. 1994. Transforming growth factor-{beta} in tissue fibrosis. N. Engl. J. Med. 331:1286.[Free Full Text]
  5. Letterio, J. J., A. B. Roberts. 1998. Regulation of immune responses by TGF-{beta}. Annu. Rev. Immunol. 16:137.[Medline]
  6. Chen, W., S. M. Wahl. 2001. TGF-{beta}: receptors, signaling pathways and autoimmunity. Curr. Dir. Autoimmun. 5:62.
  7. Prud’homme, G. J., C. A. Piccirillo. 2000. The inhibitory effects of transforming growth factor-{beta}-1 (TGF{beta}1) in autoimmune disease. J. Autoimmun. 14:23.[Medline]
  8. Sime, P. J., K. M. O’Reilly. 2001. Fibrosis of the lung and other tissues: new concepts in pathogenesis and treatment. Clin. Immunol. 99:308.[Medline]
  9. Gochuico, B. R.. 2001. Potential pathogenesis and clinical aspects of pulmonary fibrosis associated with rheumatoid arthritis. Am. J. Med. Sci. 321:83.[Medline]
  10. Suzuki, A., Y. Ohosone, M. Obana, S. Mita, Y. Matsuoka, S. Irimajiri, J. Fukuda. 1994. Cause of death in 81 autopsied patients with rheumatoid arthritis. J. Rheumatol. 21:33.[Medline]
  11. Zhang, Y., L. L. McCormick, S. R. Desai, C. Wu, A. C. Gilliam. 2002. Murine sclerodermatous graft-versus-host disease, a model for human scleroderma: cutaneous cytokines, chemokines, and immune cell activation. J. Immunol. 168:3088.[Abstract/Free Full Text]
  12. Fauci, A. S.. 1994. The vasculitis syndromes. K. J. Isselbacher, and E. B. Braunwald, and J. D. Wilson, and J. B. Martin, and A. S. Fauci, and D. L. Kasper, eds. Harrison’s Principles of Internal Medicine 1670. McGraw-Hill, New York.
  13. Geissler, B., T. Wagner, R. Dorn, F. Lindemann. 2001. Extensive sterile abscess in an invasive fibrous thyroiditis (Riedel’s thyroiditis) caused by an occlusive vasculitis. J. Endocrinol. Invest. 24:111.[Medline]
  14. Gilbert, R. E., A. Cox, L. L. Wu, T. J. Allen, U. L. Hulthen, G. Jerums, M. E. Cooper. 1998. Expression of transforming growth factor-{beta}1 and type IV collagen in the renal tubulointerstitium in experimental diabetes: effects of ACE inhibition. Diabetes 47:414.[Abstract]
  15. Fallon, P. G., E. J. Richardson, G. J. McKenzie, A. N. McKenzie. 2000. Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for IL-4 and IL-13: IL-13 is a profibrotic agent. J. Immunol. 164:2585.[Abstract/Free Full Text]
  16. Zhu, Z., B. Ma, T. Zheng, R. J. Homer, C. G. Lee, I. F. Charo, P. Noble, J. A. Elias. 2002. IL-13-induced chemokine responses in the lung: role of CCR2 in the pathogenesis of IL-13-induced inflammation and remodeling. J. Immunol. 168:2953.[Abstract/Free Full Text]
  17. Lee, C. G., R. J. Homer, Z. Zhu, S. Lanone, X. Wang, V. Koteliansky, J. M. Shipley, P. Gotwals, P. Noble, Q. Chen, et al 2001. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor-{beta}1. J. Exp. Med. 194:809.[Abstract/Free Full Text]
  18. Lloyd, C. M., A. W. Minto, M. E. Dorf, A. Proudfoot, T. N. Wells, D. J. Salant, J. C. Gutierrez-Ramos. 1997. RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J. Exp. Med. 185:1371.[Abstract/Free Full Text]
  19. Antoniades, H. N., J. Neville-Golden, T. Galanopoulos, R. L. Kradin, A. J. Valente, D. T. Graves. 1992. Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis. Proc. Natl. Acad. Sci. USA 89:5371.[Abstract/Free Full Text]
  20. Braley-Mullen, H., G. C. Sharp, J. T. Bickel, M. Kyriakos. 1991. Induction of severe granulomatous experimental autoimmune thyroiditis in mice by effector cells activated in the presence of anti-interleukin 2 receptor antibody. J. Exp. Med. 173:899.[Abstract/Free Full Text]
  21. Tang, H., G. C. Sharp, K. Chen, H. Braley-Mullen. 1998. The kinetics of cytokine gene expression in the thyroids of mice developing granulomatous experimental autoimmune thyroiditis. J. Autoimmun. 11:581.[Medline]
  22. Kuruvilla, A., R. Shah, G. Hochwald, H. Liggitt, M. Palladino, G. Thorbecke. 1991. Protective effect of transforming growth factor-{beta}1 on experimental autoimmune diseases in mice. Proc. Natl. Acad. Sci. USA 88:2918.[Abstract/Free Full Text]
  23. Kagami, S., W. A. Border, D. E. Miller, N. A. Noble. 1994. Angiotensin II stimulates extracellular matrix protein synthesis through induction of transforming growth factor-{beta} expression in rat glomerular mesangial cells. J. Clin. Invest. 93:2431.
  24. Border, W. A., N. Noble. 2001. Maximizing hemodynamic-independent effects of angiotensin II antagonists in fibrotic diseases. Semin. Nephrol. 21:563.[Medline]
  25. Pu, Q., E. L. Schiffrin. 2001. Effect of ACE/NEP inhibition on cardiac and vascular collagen in stroke-prone spontaneously hypertensive rats. Am. J. Hypertens. 14:1067.[Medline]
  26. Sun, Y., J. P. Cleutjens, A. A. Diaz-Arias, K. T. Weber. 1994. Cardiac angiotensin converting enzyme and myocardial fibrosis in the rat. Cardiovasc. Res. 28:1423.[Abstract/Free Full Text]
  27. Braley-Mullen, H., R. W. McMurray, G. C. Sharp. 1994. Regulation of the induction and resolution of granulomatous experimental autoimmune thyroiditis in mice by CD8+ T cells. Cell. Immunol. 153:492.[Medline]
  28. Wei, Y., K. Chen, G. C. Sharp, H. Yagita, H. Braley-Mullen. 2001. Expression and regulation of Fas and Fas ligand on thyrocytes and infiltrating cells during induction and resolution of granulomatous experimental autoimmune thyroiditis. J. Immunol. 167:6678.[Abstract/Free Full Text]
  29. Brandes, M. E., U. E. Mai, K. Ohura, S. M. Wahl. 1991. Type I transforming growth factor-{beta} receptors on neutrophils mediate chemotaxis to transforming growth factor-{beta}. J. Immunol. 147:1600.[Abstract]
  30. Fava, R. A., N. J. Olsen, A. E. Postlethwaite, K. N. Broadley, J. M. Davidson, L. B. Nanney, C. Lucas, A. S. Townes. 1991. Transforming growth factor-{beta}1 (TGF-{beta}1) induced neutrophil recruitment to synovial tissues: implications for TGF-{beta}-driven synovial inflammation and hyperplasia. J. Exp. Med. 173:1121.[Abstract/Free Full Text]
  31. Lagraoui, M., L. Gagnon. 1997. Enhancement of human neutrophil survival and activation by TGF-{beta}1. Cell. Mol. Biol. 43:313.
  32. Seder, R. A., T. Marth, M. C. Sieve, W. Strober, J. J. Letterio, A. B. Roberts, B. Kelsall. 1998. Factors involved in the differentiation of TGF-{beta}-producing cells from naive CD4+ T cells: IL-4 and IFN-{gamma} have opposing effects, while TGF-{beta} positively regulates its own production. J. Immunol. 160:5719.[Abstract/Free Full Text]
  33. Kletsas, D., H. Pratsinis, I. Zervolea, P. Handris, E. Sevaslidou, E. Ottaviani, D. Stathakos. 2000. Fibroblast responses to exogenous and autocrine growth factors relevant to tissue repair: the effect of aging. Ann. NY Acad. Sci. 908:155.[Medline]
  34. Nagaoka, I., B. C. Trapnell, R. G. Crystal. 1990. Upregulation of platelet-derived growth factor-A and -B gene expression in alveolar macrophages of individuals with idiopathic pulmonary fibrosis. J. Clin. Invest. 85:2023.
  35. Antoniades, H. N., M. A. Bravo, R. E. Avila, T. Galanopoulos, J. Neville-Golden, M. Maxwell, M. Selman. 1990. Platelet-derived growth factor in idiopathic pulmonary fibrosis. J. Clin. Invest. 86:1055.
  36. Moore, B. B., R. Paine, III, P. J. Christensen, T. A. Moore, S. Sitterding, R. Ngan, C. A. Wilke, W. A. Kuziel, G. B. Toews. 2001. Protection from pulmonary fibrosis in the absence of CCR2 signaling. J. Immunol. 167:4368.[Abstract/Free Full Text]
  37. Qi, Z., N. Atsuchi, A. Ooshima, A. Takeshita, H. Ueno. 1999. Blockade of type {beta} transforming growth factor signaling prevents liver fibrosis and dysfunction in the rat. Proc. Natl. Acad. Sci. USA 96:2345.[Abstract/Free Full Text]
  38. Weinberg, A., R. Whitham, S. Swain, W. Morrison, G. Wyrick, C. Hoy, A. Vandenbark, H. Offner. 1992. Transforming growth factor-{beta} enhances the in vivo effector function and memory phenotype of antigen-specific T helper cells in experimental autoimmune encephalomyelitis. J. Immunol. 148:2109.[Abstract]
  39. Fondal, W., Jr, C. Sampson, G. C. Sharp, H. Braley-Mullen. 2001. Transforming growth factor-{beta} has contrasting effects in the presence or absence of exogenous interleukin-12 on the in vitro activation of cells that transfer experimental autoimmune thyroiditis. J. Interferon Cytokine Res. 21:971.[Medline]
  40. Xu, H., L. V. Rizzo, P. B. Silver, R. R. Caspi. 1997. Uveitogenicity is associated with a Th1-like lymphokine profile: cytokine-dependent modulation of early and committed effector T cells in experimental autoimmune uveitis. Cell. Immunol. 178:69.[Medline]
  41. Allen, J. B., C. L. Manthey, A. R. Hand, K. Ohura, L. Ellingsworth, S. M. Wahl. 1990. Rapid onset synovial inflammation and hyperplasia induced by transforming growth factor-{beta}. J. Exp. Med. 171:231.[Abstract/Free Full Text]
  42. Braley-Mullen, H., K. Chen, Y. Wei, S. Yu. 2001. Role of TGF{beta} in development of spontaneous autoimmune thyroiditis in NOD.H-2h4 mice. J. Immunol. 167:7111.[Abstract/Free Full Text]
  43. Hogaboam, C. M., N. W. Lukacs, S. W. Chensue, R. M. Strieter, S. L. Kunkel. 1998. Monocyte chemoattractant protein-1 synthesis by murine lung fibroblasts modulates CD4+ T cell activation. J. Immunol. 160:4606.[Abstract/Free Full Text]
  44. Pardo, A., R. Barrios, M. Gaxiola, L. Segura-Valdez, G. Carrillo, A. Estrada, M. Mejia, M. Selman. 2000. Increase of lung neutrophils in hypersensitivity pneumonitis is associated with lung fibrosis. Am. J. Respir. Crit. Care Med. 161:1698.[Abstract/Free Full Text]
  45. Schmitt, A., H. Jouault, J. Guichard, F. Wendling, A. Drouin, E. M. Cramer. 2000. Pathologic interaction between megakaryocytes and polymorphonuclear leukocytes in myelofibrosis. Blood 96:1342.[Abstract/Free Full Text]
  46. Taylor, L. M., L. M. Khachigian. 2000. Induction of platelet-derived growth factor B-chain expression by transforming growth factor-{beta} involves transactivation by Smads. J. Biol. Chem. 275:16709.[Abstract/Free Full Text]
  47. Yamabe, H., H. Osawa, M. Kaizuka, S. Tsunoda, K. Shirato, F. Tateyama, K. Okumura. 2000. Platelet-derived growth factor, basic fibroblast growth factor, and interferon-{gamma} increase type IV collagen production in human fetal mesangial cells via a transforming growth factor-{beta}-dependent mechanism. Nephrol. Dial. Transplant. 15:872.[Abstract/Free Full Text]
  48. Zhang, K., M. Gharaee-Kermani, B. McGarry, D. Remick, S. H. Phan. 1997. TNF-{alpha}-mediated lung cytokine networking and eosinophil recruitment in pulmonary fibrosis. J. Immunol. 158:954.[Abstract]
  49. Ruiz-Ortega, M., C. Bustos, M. A. Hernandez-Presa, O. Lorenzo, J. J. Plaza, J. Egido. 1998. Angiotensin II participates in mononuclear cell recruitment in experimental immune complex nephritis through nuclear factor-{kappa}B activation and monocyte chemoattractant protein-1 synthesis. J. Immunol. 161:430.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
Y. Fang, G. C. Sharp, and H. Braley-Mullen
Interleukin-10 Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis
Am. J. Pathol., June 1, 2008; 172(6): 1591 - 1602.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Fang, V. G. DeMarco, G. C. Sharp, and H. Braley-Mullen
Expression of Transgenic FLIP on Thyroid Epithelial Cells Inhibits Induction and Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis in CBA/J Mice
Endocrinology, December 1, 2007; 148(12): 5734 - 5745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Fang, Y. Wei, V. DeMarco, K. Chen, G. C. Sharp, and H. Braley-Mullen
Murine FLIP Transgene Expressed on Thyroid Epithelial Cells Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis in DBA/1 Mice
Am. J. Pathol., March 1, 2007; 170(3): 875 - 887.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Chen, Y. Wei, G. C. Sharp, and H. Braley-Mullen
Decreasing TNF-{alpha} results in less fibrosis and earlier resolution of granulomatous experimental autoimmune thyroiditis
J. Leukoc. Biol., January 1, 2007; 81(1): 306 - 314.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F.-C. Yang, S. Chen, T. Clegg, X. Li, T. Morgan, S. A. Estwick, J. Yuan, W. Khalaf, S. Burgin, J. Travers, et al.
Nf1+/- mast cells induce neurofibroma like phenotypes through secreted TGF-{beta} signaling
Hum. Mol. Genet., August 15, 2006; 15(16): 2421 - 2437.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Chen, Y. Wei, A. Alter, G. C. Sharp, and H. Braley-Mullen
Chemokine expression during development of fibrosis versus resolution in a murine model of granulomatous experimental autoimmune thyroiditis
J. Leukoc. Biol., September 1, 2005; 78(3): 716 - 724.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
V. Jankowski, R. Vanholder, M. van der Giet, L. Henning, M. Tolle, G. Schonfelder, A. Krakow, S. Karadogan, N. Gustavsson, J. Gobom, et al.
Detection of Angiotensin II in Supernatants of Stimulated Mononuclear Leukocytes by Matrix-Assisted Laser Desorption Ionization Time-of-Flight/Time-of-Flight Mass Analysis
Hypertension, September 1, 2005; 46(3): 591 - 597.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Chen, Y. Wei, G. C. Sharp, and H. Braley-Mullen
Balance of proliferation and cell death between thyrocytes and myofibroblasts regulates thyroid fibrosis in granulomatous experimental autoimmune thyroiditis (G-EAT)
J. Leukoc. Biol., February 1, 2005; 77(2): 166 - 172.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Chen, Y. Wei, G. C. Sharp, and H. Braley-Mullen
Mechanisms of Spontaneous Resolution versus Fibrosis in Granulomatous Experimental Autoimmune Thyroiditis
J. Immunol., December 1, 2003; 171(11): 6236 - 6243.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS