| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 by Anti-TGF1 Antibody or Lisinopril Reduces Thyroid Fibrosis in Granulomatous Experimental Autoimmune Thyroiditis1
,
Departments of
* Internal Medicine and
Molecular Microbiology and Immunology, University of Missouri School of Medicine, and
Veteran Affairs Research Service, Columbia, MO 65212
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 in fibrosis initiated by an autoimmune inflammatory response.
The fibrotic process was evaluated by staining thyroid tissue for
collagen, 
-smooth muscle actin, TGF1, and angiotensin-converting
enzyme (ACE), and measuring serum thyroxine in mice given
anti-TGF1 or the ACE inhibitor lisinopril. The role of
particular inflammatory cells in fibrosis was tested by depletion
experiments, and the cytokine profile in thyroids was examined by
RT-PCR. Neutralization of TGF1 by anti-TGF1 or lisinopril
resulted in less collagen deposition and less accumulation of
myofibroblasts, and levels of active TGF1 and ACE were reduced in
thyroids of treated mice compared with those of untreated controls.
Other profibrotic molecules, such as platelet-derived growth factor,
monocyte chemotactic protein-1, and IL-13, were also reduced in
thyroids of anti-TGF1- and lisinopril-treated mice compared with
those of controls. Confocal microscopy showed that CD4+ T
cells and macrophages expressed TGF1. Fibrosis was reduced by
injection of anti-CD4 mAb on day 12, when G-EAT was very severe
(4–5+). Together, these results suggest a critical role for
TGF1 in fibrosis initiated by autoimmune-induced inflammation.
Autoreactive CD4+ T cells may contribute to thyroid
fibrosis through production of TGF1. This G-EAT model provides a new
model to study how fibrosis associated with autoimmune damage can be
inhibited. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TGFs are members of a family of polypeptides, which mediate a broad
spectrum of biological activities important in embryogenesis, tissue
repair, cell growth, and immune regulation (4, 5, 6, 7). TGF
is implicated in various models of fibrosis (2, 4), and it
also regulates autoimmune diseases (5, 6, 7). Fibrosis can be
a severe consequence of some autoimmune diseases (2, 8, 9, 10, 11, 12, 13, 14). Pulmonary fibrosis can be associated with rheumatoid
arthritis in some patients (8, 9, 10), and fibrosis can occur
in patients with scleroderma, Wegener’s granulomatosis, giant cell
arteritis, and Riedel’s thyroiditis (11, 12, 13). However,
the mechanisms involved in development of fibrosis, when the initiating
event is an autoimmune inflammatory response, remain poorly
understood.
The regulation of inflammatory cytokines is central to the pathogenesis
of autoimmune diseases as well as fibrosis (4, 6, 7, 8).
Immunocompetent cells, especially lymphocytes and macrophages, are
probably the main source of these cytokines, and production of various
cytokines and chemokines by CD4+ T cells plays a
crucial role in regulation of autoimmune diseases. However, the role of
autoreactive CD4+ T cells and other inflammatory
cells in the development of fibrosis is not well understood.
CD4+ T cells may contribute to fibrosis by
producing or regulating profibrotic or antifibrotic molecules. Some
cytokines and chemokines, such as IL-4, IL-13, and monocyte chemotactic
protein (MCP)-1, are important profibrotic molecules
(15, 16, 17, 18, 19) and may mediate fibrosis by promoting production
of TGF1 (17). In G-EAT, various inflammatory cells
infiltrate the thyroid, and CD4+ T cells are the
primary effector cells, producing both Th1 and Th2 cytokines (3, 20, 21). The role of particular subsets of thyroid-infiltrating
inflammatory cells in the development of fibrosis is unknown.
Our previous results showed that TGF1 protein expression colocalized
with myofibroblasts (myofb) and macrophages in areas of collagen
deposition in G-EAT thyroids (2), suggesting TGF1 may
contribute to thyroid fibrosis in G-EAT. Targeting TGF1 has been an
effective strategy for treatment of fibrosis in other models
(8). However, because TGF1 negatively regulates some
autoimmune diseases (6, 7, 22), it is important to
determine the effect of blocking TGF1 on fibrosis that occurs as a
result of autoimmune inflammation. Angiotensin (ANG)-converting enzyme
(ACE) inhibitors (ACEI), designed primarily to limit vasoconstriction,
can have potent antifibrotic effects due to their ability to block the
link between ANGII and TGF1 (14, 23, 24, 25). Blocking
ANGII by ACEI inhibited fibrosis of the kidney and heart (14, 24, 25, 26), but it is not known whether this will also reduce
fibrosis resulting from an autoimmune inflammatory response. The
results of this study show that inhibition of TGF1 using
anti-TGF1 or the ACEI lisinopril reduces thyroid fibrosis but
has no effect on G-EAT severity scores at the peak of disease,
demonstrating a direct role for TGF1 in thyroid fibrosis. An
important role for CD4+ T cells in thyroid
fibrosis was demonstrated by showing that anti-CD4 mAb, given under
conditions that did not affect G-EAT severity scores at the peak of
disease, inhibited fibrosis. A role for other inflammatory cells was
inferred by assessing the localization of specific cells in relation to
areas of collagen deposition in fibrotic thyroids. Moreover, comparison
of cytokine profiles in thyroids of control and anti-TGF-treated
mice suggests that interactions between TGF1 and other cytokines may
be important in modifying the effects of TGF1 on fibrosis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
DBA/1 mice were bred in our animal facilities at the University of Missouri. Both male and female mice (6–10 wk old) were used for these experiments.
Induction of G-EAT
Donor DBA/1 mice were immunized twice with 150 µg MTg and 15 µg LPS (E. coli 0111:B4; Sigma-Aldrich, St. Louis, MO) i.v. at 10-day intervals (1, 20). Seven days after the second injection of MTg and LPS, donor spleen cells were cultured at 107 cells/ml in RPMI 1640 containing 25 mM HEPES buffer (Cell and Immunobiology Core Facility, University of Missouri), 5% FCS (Atlanta Biologicals, Norcross, GA), 2 mM glutamine, MEM vitamin solution, nonessential amino acids, 1 mM sodium pyruvate, and 5 x 10-5 M 2-ME. Cells were cultured with 25 µg/ml MTg and 5 ng/ml IL-12 (PeproTech, Rocky Hill, NJ) as previously described (1). After 72 h, cells were harvested and washed, and 3.5 x 107 cells were injected i.v. into irradiated (500-rad) recipient mice. Recipient thyroids were evaluated for experimental autoimmune thyroiditis severity 17–21 days later, the time of maximal severity of G-EAT in this adoptive transfer model (1, 2, 20), or 35–60 days following cell transfer when fibrosis is maximal (2).
Anti-TGF1 and lisinopril treatment
Mice were given 250 µg anti-TGF1 mAb 1D11.16.8 (mouse
IgG1) (ATCC HB 9849; American Type Culture Collection, Manassas, VA)
every 4 days beginning 4 days after cell transfer and continuing
throughout the experiment. Preliminary results indicated that thyroid
lesions in recipient mice given normal mouse IgG according to the same
injection schedule were indistinguishable from those of control
recipient mice not given IgG. Therefore, in the experiments shown here,
the control recipient mice received in vitro activated donor
splenocytes but were not given mouse Ig. The ACEI lisinopril
(Sigma-Aldrich) was used at a concentration of 60 mg/L administered in
the drinking water beginning on the day of cell transfer and continuing
throughout the experiment. The water was changed two to three times per
wk. Preliminary experiments indicated that each mouse consumed 
5 ml
water/day; therefore, the amount of lisinopril ingested per day was
0.3 mg/mouse.
Evaluation of G-EAT histopathology
Thyroids were removed at various times after cell transfer, and one lobe of each thyroid was fixed in formalin. For histologic analysis, tissues were embedded in paraffin, sectioned (7 µm), and stained with H&E. Thyroids were scored quantitatively for G-EAT severity, using a scale of 0–5+ according to previously established criteria (1, 20). Measurements of thyroiditis were as follows: 1+, an infiltrate of at least 125 cells in one or several foci; 2+, 10–20 foci of cellular infiltration involving up to 25% of the gland; 3+, infiltration of 25–50% of the gland; 4+, >50% of the gland is destroyed; and 5+, virtually complete destruction of the gland, with few or no remaining follicles. Thyroid lesions were also evaluated qualitatively. DBA/1 mice typically develop very severe (4–5+) G-EAT (2). Fourteen to 21 days after cell transfer, thyroids had extensive granulomatous changes with follicular cell proliferation, multinucleated giant cells, large numbers of histiocytes, and numerous lymphocytes and neutrophils. There were also microabscess formation, necrosis, and fibrin deposition. The inflammation in thyroids with 4–5+ severity scores characteristically extended beyond the thyroid to involve adjacent connective tissue and muscle. By days 35–60, thyroids of most untreated mice were very small and atrophic, with fewer inflammatory cells, extensive collagen deposition, and virtually no remaining follicles. For qualitative evaluation of collagen deposition and fibrosis, thyroid sections were stained using Masson’s Trichrome (Histoscientific Research Labs, Manassas, VA). All slides were evaluated separately by at least two of the investigators, one of whom had no knowledge of the experimental treatments. Differences in interpretation were very rare.
Immunohistochemistry
Tissue sections were deparaffinized in xylene, rehydrated
through sequential ethanol, and rinsed in PBS. The immunohistochemical
methods used immunoperoxidase staining as previously described
(2), and the intensity of immunostaining was graded
semiquantitatively. Staining of TGF1 and -smooth muscle actin
(-SMA) was performed as previously described (2). ACE
staining was performed on paraffin sections, and microwave irradiation
was used for Ag retrieval as previously described (2).
Sections were incubated overnight with anti-ACE mAb (ATCC HB 8191;
American Type Culture Collection) followed by incubation with
biotin-conjugated goat anti-mouse IgM (Jackson ImmunoResearch
Laboratories, West Grove, PA) for 30 min; color was visualized by VIP
(very intense purple) chromogen (Vector Laboratories, Burlingame, CA).
Infiltration of neutrophils and macrophages in G-EAT thyroids was
detected on cryosections using rat mAb against neutrophils (RB6-8C5;
provided by Dr. R. Coffman, DNAX, Palo Alto, CA) or macrophages (F4/80;
both American Type Culture Collection). Sections were blocked in
1% BSA for 30 min, washed with PBS, and endogenous peroxidase activity
was quenched with 0.3% hydrogen peroxide in PBS for 30 min. This and
all subsequent washes were in PBS (0.1 M, pH 7.6). TGF1,
neutrophils, and macrophages were visualized by diaminobenzidine, and
-SMA by VIP. Sections were counterstained with hematoxylin. Negative
controls were performed using nonimmune mouse, rat, or chicken Ig at a
protein concentration equivalent to the respective secondary Abs. These
controls were always negative. All immunostaining was performed with
tissue sections from three to four individual animals per group from at
least three separate experiments. Results shown are representative of
all animals tested, and representative areas of each slide are
shown.
Confocal laser-scanning double-immunofluorescence microscopy
To detect the differential expression of TGF1 by
CD4+ T cells during development of thyroid
fibrosis, dual-color immunofluorescence and confocal laser-scanning
microscopy were done using established markers for CD4 and macrophages.
Thyroid frozen sections were fixed with methanol (4°C for 5 min) and
then in acetone (4°C for 5 min) and 2% paraformaldehyde for 15 min.
Sections were then washed with PBS and blocked with 0.5% casein
diluted in PBS. Sections were incubated with chicken anti-TGF1
Ab (diluted 1/200) for 1 h at room temperature, and
visualized with Alexa 488 conjugated anti-chicken secondary Ab
(1/500; Molecular Probes, Eugene, OR). For CD4+ T
cell and macrophage staining, slides were incubated with monoclonal rat
IgG anti-CD4 (YTS191) or anti-macrophage (F4/80) for 30 min,
followed by incubation with biotin-conjugated anti-rat secondary Ab
(1/500) for 30 min, and visualized by streptavidin-conjugated Alexa 568
(Molecular Probes) for 30 min. Slides were stored at 4°C in the dark
until observation. Preparations were observed with a Bio-Rad (Hercules,
CA) Radiance 2000 confocal system coupled to an Olympus (Melville, NY)
IX70 inverted microscope.
Serum thyroxine (T4) assay
Serum T4 levels were determined using a T4 enzyme immunoassay kit (Biotecx Labs, Houston, TX) according to the manufacturer’s instructions. Results are expressed as micrograms of T4 per deciliter of serum. These kits were recently reoptimized for detection of T4 in human serum, so the values reported here tend to be lower than those reported in our previous study (2). Using the current kits, values for normal mouse serum range from 4 to 6 µg T4/dl of serum, and any values >3 are considered normal.
RT-PCR
Thyroid lobes from individual mice were removed at different
times after adoptive transfer, and one lobe was stored at -80°C
before processing. Frozen thyroids were homogenized in TRIzol; RNA was
extracted and reverse transcribed, and RT-PCR was done as previously
described (21). To determine the relative initial amounts
of target cDNA, each cDNA sample was serially diluted 1/5, 1/25, and
1/125, and amplified with cytokine-specific primers (21).
Hypoxanthine phosphoribosyltransferase (HPRT) was
used as a housekeeping gene to verify that the same amount of RNA was
amplified. The PCR products were electrophoresed in 2% agarose gel,
visualized by UV light after staining with ethidium bromide, and
normalized between samples relative to levels of HPRT using
an IS-1000 Digital Imaging System (Life Sciences, St. Louis, MO). Most
cytokine gene primers used in this study have been described previously
(21). Primer sequences were as follows: ACE, sense,
AGGAAGAGCAGCAGCCACTG, and antisense, GTCAGCTTCATCATCCAGTT;
platelet-derived growth factor (PDGF), sense, TCTCCCCATTCGCAGGAAGAG,
and antisense, TTGGCCACCTTGACACTGCG; MCP-1, sense,
TCCATGCAGGTCCCTGTCATGCTT, and antisense,
CTAGTTCACTGTCACACTGGTC; and TGFRI, sense, CGTGCTGACATCTATGCAAT,
and antisense, AGCTGCTCCATTGGCATAC.
Statistical analysis
Experiments in Tables I
and III were repeated four to five times
with similar results. Results in Fig. 3 were repeated three times, and
statistical analysis was performed using an unpaired two-tailed
Student’s t test. Values with p < 0.05
were considered significant and are designated by an asterisk in the
figure.
|
|
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 by anti-TGF1 and the ACEI
lisinopril on the development of thyroid fibrosis in G-EAT
Severe G-EAT induced by effector cells activated in the presence
of MTg and IL-12 is followed by fibrosis and atrophy of the thyroid
(1, 2). Our previous study (2) suggested an
important role for TGF1 in the development of thyroid fibrosis.
Because ANGII is a potent inducer of TGF1 (14, 23), we
asked whether the ACEI lisinopril or anti-TGF1 Ab could inhibit
thyroid fibrosis when given to recipient mice. Control recipient mice
given no treatment or normal mouse Ig always had very severe (4–5+)
G-EAT 14–19 days after cell transfer in
these and many other experiments (Table I
; Fig. 1A; and data not shown).
Thyroids were enlarged (7–10 times larger than thyroids from normal
mice), with extensive neutrophil infiltration and extension of
inflammation beyond the gland to involve adjacent connective tissue and
muscle (Fig. 1A). G-EAT severity at day 14 or 19 was
unaffected by treatment with lisinopril or anti-TGF. Collagen
deposition (fibrosis) as determined by Trichrome staining was primarily
around the periphery of the gland at this time (Fig. 1A),
and this was usually reduced in thyroids of anti-TGF- or
lisinopril-treated mice (Tables I and II). Serum
T4 levels in both control and treated mice were
normal or slightly below normal at days 14–19 (Table I, lines 1–3, 7,
and 8). Thyroids of most control mice had extensive fibrosis and
atrophy at day 35 (data not shown), and atrophy and fibrosis further
increased by days 45–60 (Table I, lines 4 and 9, and Table II). Thyroids were very small and
atrophic (Table I and Fig. 1B), less than half the size of a
normal thyroid and had extensive collagen deposition both within the
gland and around the periphery of the gland by Trichrome staining (Fig. 1, B, E, and G; and Tables I and II).
An occasional control mouse (5–10% of all mice studied) had less
severe disease and no fibrosis at days 45–55 (e.g., Table I, line 9),
which was probably the result of poor i.v. injection of cells. These
mice also presumably had less severe disease at days 19–21, and they
always had normal serum T4 levels. Although
thyroids of most mice given anti-TGF1 or ACEI treatment also had
some fibrosis at day 35, fibrosis and atrophy were consistently reduced
compared with those of controls at day 35 (Fig. 1F and data
not shown). By days 45–60, when fibrosis and atrophy further increased
in thyroids of most control mice, fibrosis in thyroids of
anti-TGF or lisinopril-treated mice was further reduced. The
thyroids generally had minimal collagen deposition at days 55–60, most
thyroids were normal in size (not atrophic), and thyroid follicles were
beginning to regenerate (Fig. 1, C, D, and
H; and Table II). Serum T4 levels were
low in all control mice with severity scores of 4–5+ at days 35–60,
but were higher in most treated mice in Table I and in other
experiments (not shown). In the results shown in Table I, all treated
mice with low serum T4 levels at days 45–55 had
severity scores of 3–5+ with some fibrosis but little or no
atrophy. In other experiments, administration of both anti-TGF1 and
lisinopril did not increase the antifibrotic effects compared with
those observed with either treatment alone (data not shown).
|
|
1 inhibitors on the
expression of TGF1, myofbs, and ACE in the thyroids. As expected,
TGF protein expression was high (Fig. 1I), and there were
numerous myofbs (Fig. 1M) in thyroids of control mice at
days 17–19. TGF protein (Fig. 1K) and myofbs (Fig. 1O) persisted through day 60. Thyroids of anti-TGF-1-
(Fig. 1, J and L; and Table II) and lisinopril-
(Table II) treated mice had much lower expression of TGF-1 protein
at both day 19 and day 60. There were also fewer myofbs at days 17–19
(Fig. 1N) and essentially no myofbs at day 35 or day 60
(Table II and Fig. 1P). ACE was highly expressed at day 19
in thyroids of control mice and was restricted to areas containing
myofbs (Fig. 1Q) and granulomatous areas (Fig. 1R), but ACE was not expressed in areas with extensive
neutrophil infiltration (Fig. 1S). ACE expression was
reduced at day 19 (Fig. 1T) and day 60 (Table II) in
thyroids of anti-TGF1- or lisinopril-treated mice compared
with those of controls, probably due to the reduced myofbs
and macrophages. Inflammatory cells involved in development of thyroid fibrosis in G-EAT
The inflammatory cells infiltrating the thyroid at days 14–21
included CD4+ and CD8+ T
cells, macrophages, plasma cells, myofbs, histiocytes, giant cells, and
many neutrophils. Several types of inflammatory cells in G-EAT thyroids
have the potential to produce TGF1, and all can express the high
affinity TGF1R. To begin to address the potential role of various
inflammatory cells in thyroid fibrosis, the infiltration of
inflammatory cells in the thyroid was monitored over time by
immunohistochemical staining. CD4+ T cells were
the first cells detected in the thyroid, as early as day 3 after cell
transfer. This was followed several days later, usually by days 7–8,
by infiltration of CD8+ T cells, neutrophils, and
macrophages (data not shown). Neutrophil infiltration was maximal at
days 14–21. At day 14, neutrophils were predominantly located at the
periphery of the thyroid (Fig. 2A), in the same location as
myofbs and collagen (Fig. 1, A and M). At days
19–21, large groups of neutrophils accumulated inside the thyroid
(Fig. 2B), and the aggregated neutrophils were surrounded by
macrophages (Fig. 2E). The general pattern and extent of
neutrophil infiltration was similar in thyroids of both control and
treated mice, and few neutrophils persisted in thyroids examined at day
35 or later in any groups (data not shown). (Higher power views of the
cells in Fig. 2, A and B, are shown in Fig. 2, C and D.)
|
E), and many macrophages persisted, particularly in
thyroids of control mice, through day 60 (Fig. 2F).
Macrophages could promote fibrosis by producing ACE and TGF1
(26), and macrophages were shown to produce TGF1 in
thyroids that progress to fibrosis (2).
Because CD4+ T cells are the primary effector
cells for G-EAT (20), it was of interest to determine
whether CD4+ T cells were necessary for the
development of fibrosis. Injection of anti-CD4 mAb 2 days after
cell transfer almost completely prevented development of G-EAT (data
not shown). However, if a single injection of anti-CD4 mAb was
given 12 days after cell transfer, when G-EAT severity scores were
4–5+, G-EAT severity at days 19–20 was only minimally reduced (Table III). However, fibrosis was markedly
reduced at days 40–60 (Table III), most thyroids were not atrophic,
and thyroid follicles were beginning to regenerate (not shown). In
addition, serum T4 levels were higher at days
40–60 in most anti-CD4-treated mice compared with those of
controls (Table III). These results indicate that
CD4+T cells, the primary effector cells for G-EAT
(20), were also important for development of thyroid
fibrosis. A single injection of anti-CD4 given 12 days after cell
transfer resulted in nearly complete depletion of
CD4+ T cells in the spleen for 10–14 days, but
CD4+ T cells were only partially reduced in the
thyroids (data not shown). When thyroids were removed 40–60 days after
cell transfer, CD4+ T cells were not reduced in
either spleens or thyroids (data not shown).
CD8+ T cells play an important role in G-EAT resolution and are also predominant infiltrating cells in G-EAT thyroids (27). Severe G-EAT develops in mice in which CD8+ T cells are depleted, and our previous studies have shown that fibrosis in CD8-depleted mice is comparable to that in controls at days 35–50 (28). Thus, CD8+ T cells are not required for development of fibrosis.
TGF1 is produced by CD4+ T cells and
macrophages in the thyroid during development of fibrosis
The mechanism by which CD4+ T cells might
promote thyroid fibrosis could be due to their ability to produce
TGF1. Confocal microscopy analysis of thyroids that ultimately
developed fibrosis showed that some CD4+ T cells
expressed TGF1 as early as day 7, and many
CD4+ T cells were strongly TGF1 positive at
day 10 (data not shown). At day 19, TGF1 expression in thyroids
further increased, and TGF1+ cells included
CD4+ T cells, as well as
non-CD4+ T cells (Fig. 2G). A few
CD4+ T cells still expressed TGF1 at day 35
(Fig. 2H). Many macrophages were also TGF1 positive at
both day 19 and day 35 (Fig. 2, I and J). Taken
together, these results indicate that CD4+ T
cells produce TGF1 primarily from days 10 to 19, while macrophages
were predominant producers of TGF1 at day 19 and also at day 35,
when fibrosis was extensive. As a potent chemotactic factor for many
inflammatory cells (5, 29, 30, 31), TGF1 secreted by early
infiltrating CD4+ T cells may attract other
inflammatory cells to the thyroid, thus promoting further production of
TGF1 (32, 33). TGF1 expression in G-EAT thyroids at
day 19 was reduced after anti-CD4 treatment (data not shown),
consistent with the idea that CD4+ T cells may
produce some of the TGF1 in G-EAT thyroids.
Cytokine mRNA expression in thyroids of control and
anti-TGF-treated mice
The action of TGF1 is dependent not only on the cell type and
its state of differentiation but also on the cytokine milieu in an
inflammatory site (5, 6, 8). Expression of cytokine mRNA
in thyroids of mice with or without anti-TGF1 or ACEI treatment
was examined by RT-PCR. Administration of anti-TGF1 prevented
the overexpression of TGF1 mRNA, and inhibited ACE gene expression
at day 19 (Fig. 3A). Because
PDGF and MCP-1 are important in many models of fibrosis
(34, 35, 36), their gene expression was also examined. Both
PDGF and MCP-1 were highly expressed in thyroids of control mice at day
19, and PDGF remained relatively high at day 35 (Fig. 1B).
Their expression was significantly decreased at day 19 in thyroids of
anti-TGF1-treated mice, and PDGF was also decreased at day 35.
Expression of IFN-
was increased in the thyroids of
anti-TGF1-treated mice (Fig. 3C), which may suggest
antagonism between TGF1 and IFN- (6, 32). The effect
of TGF1 on the synthesis and deposition of extracellular matrix are
mediated by the type I receptor (TGFRI) (4). However,
expression of TGFRI was not decreased in thyroids of
anti-TGF1-treated mice (Fig. 3C), suggesting the
reduction in fibrosis in anti-TGF1-treated mice was mainly due
to neutralization of TGF1. Recently, IL-4 and IL-13 have been
identified as key mediators of tissue fibrosis (8, 15, 16, 17), and expression of both cytokines was significantly
higher in thyroids of control mice compared with those of
anti-TGF1-treated mice at day 19, but not at day 35 (Fig. 3D). Similar results were obtained with RT-PCR analysis of
thyroids of mice given lisinopril (data not shown). Taken together,
reduction of fibrosis by anti-TGF1 or ACEI was accompanied
by reduction of several profibrotic molecules in the thyroid,
suggesting that TGF1 is an important cytokine in development of
fibrosis as demonstrated by others (4, 37).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The current results demonstrate that inhibition of TGF1 by
anti-TGF1 Ab or ACEI can reduce thyroid fibrosis after induction
of G-EAT, indicating that TGF1 has a critical role in fibrosis that
develops as a consequence of an autoimmune inflammatory response.
Blocking the activity of TGF1 by anti-TGF1 or by
adenovirus-mediated local expression of a dominant-negative TGF1R
prevented or reduced fibrosis resulting from nonautoimmune damage to
the liver, lung, and kidneys (4, 37). Our data expand the
concept that TGF1 expression in a particular organ is central to the
development of fibrosis. TGF1 has been reported to have both pro-
and anti-inflammatory effects on autoimmune diseases. TGF1
suppressed experimental autoimmune encephalomyelitis in vivo
(7, 22) but enhanced activation of experimental autoimmune
encephalomyelitis (38), experimental autoimmune
thyroiditis (39), and experimental autoimmune uveitis
effector cells in vitro (40). Arthritis was
promoted by intra-articular injection of TGF1 (41), and
neutralization of TGF1 inhibited development of spontaneous
autoimmune thyroiditis in NOD.H-2h4 mice (42). Despite the
potent immunosuppressive effects of TGF (5, 6, 7),
inhibition of TGF1 by anti-TGF1 or ACEI did not increase
inflammation in G-EAT thyroids. Thyroids of mice given
anti-TGF1 or ACEI had G-EAT severity scores at days 14–19
comparable to those of the controls (Table I), but at days 35–60,
thyroids of anti-TGF1- and ACEI-treated mice were less atrophic
and had many regenerating thyroid follicles and less deposition of
collagen.
Effective inhibition of the fibrotic process by anti-TGF1 and
ACEI treatment was demonstrated both by histologic (H&E as well as
collagen and myofb staining) and functional (serum
T4) criteria. Inhibition of fibrosis was
associated with reduced levels of TGF1 mRNA and protein in G-EAT
thyroids. There was only a transient appearance of myofbs in thyroids
of treated mice at day 19, followed by a decline of inflammatory cells
in thyroids at days 35–60. At days 50–60, thyroids of most
anti-TGF1- and ACEI-treated mice had regenerating follicles with
no myofbs and little collagen deposition, whereas thyroids of control
mice generally had extensive fibrosis and were very small and atrophic
through day 60 (Fig. 1). Serum T4 levels were low
in most control mice at this time, whereas T4
levels were usually higher and often had returned to normal in treated
mice (Tables I and III). The reason serum T4
levels were still below normal in some treated mice even when thyroid
fibrosis and atrophy were clearly reduced may be that some time is
needed for serum T4 levels to return to normal
after thyroid follicles begin to regenerate. Thus,
T4 levels might have been normal if serum had
been obtained several days later.
G-EAT thyroids become fibrotic only when most thyroid follicles are
destroyed (1, 2, 3). The fact that fibrosis develops in the
presence or absence of CD8+ T cells
(28) suggests CD8+ T cells are not
essential for the development of thyroid fibrosis. However,
CD4+ T cells apparently contribute to the
development of thyroid fibrosis because administration of anti-CD4
mAb 12 days after cell transfer, when G-EAT severity was nearly
maximal, effectively inhibited fibrosis (Table III).
CD4+ T cells might promote fibrosis through
regulation and production of TGF1. Production of TGF1 by
CD4+ T cells in the thyroid was noted as early as
day 7, before the infiltration of most other inflammatory cells.
Previous studies have shown that TGF1 can facilitate the migration
of neutrophils and monocytes into tissues (5, 29, 30, 31).
CD4+ T cells were the first cells to accumulate
in the thyroid, and thyroids of anti-CD4-treated mice expressed
less TGF1 (our unpublished observations), even though
CD4+ T cells were not completely depleted from
thyroids. Thus, as primary effector cells, MTg-specific
CD4+ T cells may initially promote infiltration
of neutrophils and monocytes by releasing TGF1 and other chemokines.
Following infiltration of various inflammatory cells, activated
macrophages and myofbs produce high levels of TGF1. The high
expression of TGF1 by CD4+ T cells,
macrophages, and myofbs results in excessive TGF1 production in the
thyroid and in the development of fibrosis. CD4+
T cells may also contribute to fibrosis by producing other profibrotic
cytokines or chemokines such as IL-13 and MCP-1 (15, 16, 43). TGF1 can also activate neutrophils at inflammatory sites
and enhance their survival (30, 31). In G-EAT that
progresses to fibrosis, neutrophil infiltration is initially prominent
at the periphery of the thyroids, where fibrosis typically begins.
Extensive accumulation of neutrophils is observed only when thyroid
destruction is very severe and fibrosis ultimately develops, and
increased neutrophils have been observed in other models of fibrosis
(44, 45). Although neutrophil accumulation in thyroids was
not apparently affected by anti-CD4, anti-TGF, or lisinopril
treatment, we cannot yet rule out a role for neutrophils in the
development of fibrosis. Studies are in progress to determine whether
depletion of neutrophils will reduce thyroid fibrosis in this
model.
The interaction between TGF1 and other cytokines (2, 16, 17, 32, 46, 47) as well as their direct action on fibroblasts
suggests that other cytokines may be able to modify the profibrotic
effects of TGF1 (16, 17). For example, IL-4, IFN-,
TNF-, MCP-1, PDGF, and ACE are all involved in regulation of
inflammation, tissue remodeling, and fibrosis (15, 16, 17, 18, 43, 47). In this study, expression of PDGF mRNA, known to be induced
by TGF1 (46, 47), decreased following anti-TGF1
and ACEI treatment. MCP-1 and IL-13, which have frequently been
implicated in fibrosis (15, 16, 17, 18, 19), were also decreased after
neutralization of TGF1. Reduction of MCP-1 may result from decreased
infiltration of macrophages and T cells (11) and/or
decreased IL-13 production (16). IL-13 is a potent inducer
of MCP-1 in vivo (16), and it promotes fibrosis through
TGF1 signaling (17). Although IL-4 has also been
implicated in fibrosis (8), IL-4 is probably not critical
for thyroid fibrosis because fibrosis develops in
IL-4-/- mice with G-EAT (our unpublished
observations). Because reduced expression of profibrotic cytokines was
accompanied by reduced numbers of myofibs, the activated form of
fibroblasts, TGF1 may interact with other cytokines to modulate
fibroblast behavior (15, 33, 48). This may in turn
regulate production of cytokines and/or chemokines, resulting in a
persistent positive feedback loop between certain cytokines and
fibroblasts.
ACE was highly expressed in G-EAT thyroids at the time of maximal
inflammation, and was localized in areas of collagen deposition. Myofbs
and macrophages may be the major producers of ACE (26).
The ACEI lisinopril decreased TGF1 production in the thyroid and
reduced thyroid fibrosis. ACEI may also reduce MCP-1 induced by ANGII
(49), further interfering with MCP-1-mediated
CD4+ T cell proliferation and cytokine production
(43). These multiple effects may account for the potent
effects of ACEI in inhibiting fibrosis and reducing tissue damage
(14). These data support the notion that inhibition of
TGF1 by ACEI can be a useful treatment for thyroid fibrosis,
consistent with results of others demonstrating its effectiveness for
treatment of fibrosis in other organs (14, 24, 25).
The complex interaction between TGF1 and various cells and mediators
reflects the well-regulated process that should follow termination of
an inflammatory response. This control can be interrupted by an
excessive influx of inflammatory cells and dysregulation of TGF1 and
other cytokines. G-EAT provides a new model to study pathogenic
mechanisms and therapeutic interventions in fibrosis. The knowledge
gained from these studies could have important implications for
understanding specific mechanisms of fibrosis involved in other
autoimmune diseases, in particular those associated with granulomatous
immunopathology, arthritis, vasculitis, and fibrotic sequelae
(8, 9, 10, 12). The ability of ACEI to block TGF1 suggests
they may be clinically useful antifibrotic agents for such
diseases.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Helen Braley-Mullen, Division of Immunology and Rheumatology, Department of Medicine, University of Missouri, M450 Medical Sciences, Columbia, MO 65212. Email address: mullenh{at}health.missouri.edu
3 Abbreviations used in this paper: MTg, mouse thyroglobulin; G-EAT, granulomatous experimental autoimmune thyroiditis; myofb, myofibroblast; ANG, angiotensin; ACE, ANG-converting enzyme; ACEI, ACE inhibitor; T4, thyroxine; PDGF, platelet-derived growth factor; MCP, monocyte chemotactic protein; -SMA, -smooth muscle actin; HPRT, hypoxanthine phosphoribosyltransferase.
Received for publication July 18, 2002. Accepted for publication September 27, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in tissue fibrosis. N. Engl. J. Med. 331:1286.. Annu. Rev. Immunol. 16:137.[Medline]
: receptors, signaling pathways and autoimmunity. Curr. Dir. Autoimmun. 5:62.
-1 (TGF1) in autoimmune disease. J. Autoimmun. 14:23.[Medline]
1 and type IV collagen in the renal tubulointerstitium in experimental diabetes: effects of ACE inhibition. Diabetes 47:414.[Abstract]
1. J. Exp. Med. 194:809.1 on experimental autoimmune diseases in mice. Proc. Natl. Acad. Sci. USA 88:2918. expression in rat glomerular mesangial cells. J. Clin. Invest. 93:2431.
receptors on neutrophils mediate chemotaxis to transforming growth factor-. J. Immunol. 147:1600.[Abstract]
1 (TGF-1) induced neutrophil recruitment to synovial tissues: implications for TGF--driven synovial inflammation and hyperplasia. J. Exp. Med. 173:1121.1. Cell. Mol. Biol. 43:313.
-producing cells from naive CD4+ T cells: IL-4 and IFN- have opposing effects, while TGF- positively regulates its own production. J. Immunol. 160:5719. transforming growth factor signaling prevents liver fibrosis and dysfunction in the rat. Proc. Natl. Acad. Sci. USA 96:2345. enhances the in vivo effector function and memory phenotype of antigen-specific T helper cells in experimental autoimmune encephalomyelitis. J. Immunol. 148:2109.[Abstract]
has contrasting effects in the presence or absence of exogenous interleukin-12 on the in vitro activation of cells that transfer experimental autoimmune thyroiditis. J. Interferon Cytokine Res. 21:971.[Medline]
. J. Exp. Med. 171:231. in development of spontaneous autoimmune thyroiditis in NOD.H-2h4 mice. J. Immunol. 167:7111. involves transactivation by Smads. J. Biol. Chem. 275:16709. increase type IV collagen production in human fetal mesangial cells via a transforming growth factor--dependent mechanism. Nephrol. Dial. Transplant. 15:872.-mediated lung cytokine networking and eosinophil recruitment in pulmonary fibrosis. J. Immunol. 158:954.[Abstract]
B activation and monocyte chemoattractant protein-1 synthesis. J. Immunol. 161:430.This article has been cited by other articles:
|
|
 |
|
  Y. Fang, G. C. Sharp, and H. Braley-Mullen Interleukin-10 Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis Am. J. Pathol., June 1, 2008; 172(6): 1591 - 1602. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Fang, V. G. DeMarco, G. C. Sharp, and H. Braley-Mullen Expression of Transgenic FLIP on Thyroid Epithelial Cells Inhibits Induction and Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis in CBA/J Mice Endocrinology, December 1, 2007; 148(12): 5734 - 5745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Fang, Y. Wei, V. DeMarco, K. Chen, G. C. Sharp, and H. Braley-Mullen Murine FLIP Transgene Expressed on Thyroid Epithelial Cells Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis in DBA/1 Mice Am. J. Pathol., March 1, 2007; 170(3): 875 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 |
