The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudinot, P.
Right arrow Articles by Benmansour, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudinot, P.
Right arrow Articles by Benmansour, A.
Right arrowPubmed/NCBI databases
*Protein*UniGene
The Journal of Immunology, 2002, 169: 6244-6252.
Copyright © 2002 by The American Association of Immunologists

Primary Structure and Complementarity-Determining Region (CDR) 3 Spectratyping of Rainbow Trout TCR{beta} Transcripts Identify Ten V{beta} Families with V{beta}6 Displaying Unusual CDR2 and Differently Spliced Forms1

Pierre Boudinot, Samira Boubekeur2 and Abdenour Benmansour3

Institut National de la Recherche Agronomique, Unité de Virologie et Immunologie Moléculaires, Jouy-en-Josas, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
VDJ rearrangement at the teleost TCR{beta} locus leads to a highly diverse repertoire of junctions for each V{beta}J{beta} combination. From a rainbow trout 5' RACE library of TCR{beta} transcripts, 47 clones encompassing a full V{beta}-D{beta}-J{beta}-C{beta} sequence were selected and analyzed. A similarity analysis of the sequences evidenced 10 V{beta} families, of which 6 were not previously described. Immunoscope and sequence analysis of the V{beta}-D{beta}-J{beta} junctions of the new families confirmed that they create a polyclonal and diverse repertoire. Multiple alignments showed that rainbow trout V{beta}s possess most of the conserved residues typical of V{beta} segments. However, this study revealed a high complementarity-determining region 2 (CDR2) and CDR1 length diversity among rainbow trout V{beta} families, suggesting that the spatial orientation of the TCR could fluctuate in the TCR/peptide/MHC complex, depending on the V{beta} expressed. Among the new V{beta} families, V{beta}6 displayed the strongest deviance from typical hypervariable CDR1 and CDR2 loops, with an unusually short CDR2. Moreover, the V{beta}6 sequence is overall divergent from typical V{beta} sequence, raising the question of its functional relevance. Immunoscope experiments identified a V{beta}6-J{beta}3 junction, which was amplified during the response against viral hemorrhagic septicemia virus, a fish rhabdovirus. V{beta}6 seems therefore to be expressed functionally in a selected TCR. However, the shorter V{beta}6 transcripts produced through an alternative splicing lack the C', C'', D, and E strands of the V{beta} domain and are probably nonfunctional.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
T cell receptor, the Ag recognition molecule expressed by the T lymphocytes, is a member of the Ig superfamily. It is a heterodimer, composed of an {alpha} (or a {gamma})- and a {beta} (or a {delta})-chain, each containing a V and a C domain. The Ag specificity of TCR is determined by sequences corresponding to three hypervariable regions of the V domain, the complementarity-determining regions (CDR).4 The diversity of TCR{alpha}{beta} is generated by the assembly of germline-encoded segments: V, J, and for {beta}-chains D segments. A huge additional diversity derives from the addition and deletion of nucleotides at the junctions between V, D, and J segments. TCR genes, loci, and recombination mechanisms and control have been characterized in detail in humans and mice (reviewed in Ref. 1). TCR{alpha}{beta} recognizes the Ag presented as a peptide by the class I and II MHC molecules. This recognition mediates cytotoxic and Th cell responses.

TCR genes were identified in the different lineages of Gnathostoma (2). In the fish, TCR{beta} genes were first described in the rainbow trout (Oncorhynchus mykiss) (3) and in the horned shark (Heterodontus francisci) (4). TCR genes {alpha}, {beta}, {gamma}, and {delta} were finally identified in the skate (Raja eglanteria), a Chondrychthian, suggesting that all Gnathostoma should express both {alpha}{beta} and {gamma}{delta} TCR (5). Complete TCR{beta} sequences are now available for several species of teleosts: in Atlantic salmon (Salmo salar) (6), channel catfish (Ictalurus punctatus) (7), Atlantic cod (Gadus morhua) (8), damselfish (Stegastes partitus) (GenBank AF324813-824), and Japanese flounder (Paralichthys olivaceus) (GenBank AF053407-443). In rainbow trout, four different V{beta} families were described (3, 9, 10). In all these species, the sequence of {beta}-chains showed typical V and C1 domains (as defined in 11) with key residues conserved, suggesting that the general three-dimensional structure of this protein was conserved from fish to mammals (12). Phylogenetic studies showed that TCR{beta} sequences are conserved in mammals (13, 14), but no close similarity was observed between fish and mammalian V{beta} sequences. In teleosts, T cell-dependent responses were suggested by the presence of TCR genes, and by the structure of the MHC locus and by the polymorphism of class I and class II molecules (15, 16, 17). However, a functional T cell response has been directly proved in only a limited number of species. A clear allospecific response was described using catfish Ig- cells or catfish T cell lines, showing that fish lymphocytes can display CTL-like activity (18, 19). A specific cell-mediated lysis of virus-infected target cells by primed leukocytes has also been obtained in the cloned goldfish (20). However, in this case, the cells involved in the cytotoxicity had not been unambiguously identified as {alpha}{beta} T cells. More recently, TCR{beta} Immunoscope methodology (21) was used to study the rainbow trout T cell response to a viral infection. Spectratyping of CDR3 revealed that the rainbow trout naive T cell repertoire is polyclonal and highly diverse. Primary and secondary infection with viral hemorrhagic septicemia virus (VHSV) dramatically skewed the repertoire, and the profiles were reminiscent of the public and private virus-specific T cell responses observed in mammals (22).

In this work, we used a 5' RACE strategy and Immunoscope analysis to obtain further insight into the V{beta} segments expressed in rainbow trout, and to perform a global survey of the diversity of V{beta}-D{beta}-J{beta} junctions. Ten V{beta} families (V{beta}1–10) were identified from TCR{beta} transcripts. A comparative study of their primary structure with V{beta} sequences from other vertebrates revealed that V{beta}6 had unusual characteristics.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fish and leukocyte preparation

Rainbow trout were raised in the fish facilities of Institut National de la Recherche Agronomique (INRA, Jouy-en-Josas, France). The so-called INRA synthetic strain was used throughout, except for infection experiments. It results from successive introductions between 1976 and 1983 of several domestic populations from the United States and France, which were pooled and then maintained as a single population by random mating during four to five generations. For the study of the V{beta}6 response to the VHSV, rainbow trout heterozygous clones (22) were used. Trout were sacrificed by overexposure to 2-phenoxyethanol diluted 1/1000. The entire spleen was removed aseptically. Leukocytes from the kidney tissue of a single fish were isolated by centrifugation through a Ficoll gradient (lymphocyte separation medium, d = 1.077; Eurobio, Les Ullis, France), and used for RNA preparation.

RNA isolation and construction of the 5' RACE library

The 5' RACE was performed using the SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA), according to the instructions of the manufacturer. Total RNA was extracted from spleen and head kidney leukocytes with the TRIzol reagent (Life Technologies, Cergy-Pontoise, France), and treated with DNase (Boehringer Mannheim, Indianapolis, IN) to remove any remaining genomic DNA. The treated RNA was used to generate full-length cDNAs. The 5' RACE PCR were performed with a C{beta}-specific primer (C{beta}-RACE: ACACACACTAGGGTCTTCTT) and the universal primers from Clontech. PCR products obtained were purified with Sephacryl S-400 columns (Pharmacia, Peapack, NJ) and cloned into pCR2.1 vector (TOPO TA cloning system; Invitrogen, San Diego, CA).

Screening of the 5' RACE cDNA library

The clones corresponding to J{beta}4-C{beta} transcripts were identified by PCR using two primers chosen in the genomic region upstream of the J{beta}4 segment (J4C-forward, AGGGAGTTGGTTTGATTCATGTTTG; J4C-reverse, ACATCGTTTTCCTCCTCTTCCAAAA, giving a 172-bp PCR product). This set of primers specifically amplifies cDNA to J{beta}4-C{beta} sterile transcripts. Bacteria from the colony on the plate were added to the PCR mix. The amplification was performed in the following conditions: 10 min, 94°C; then 30 cycles of 1 min, 94°C; 1 min, 60°C; 2 min, 72°C; then 5 min, 72°C. Colonies that gave PCR product of the expected size were rejected. Colonies giving no PCR product were elected for further analysis. Selected colonies were grown overnight in Luria-Bertani/ampicillin broth, and the plasmid purified with a plasmid miniprep spin kit (Nucleospin; Macherey-Nagel, Durin, Germany). Purified plasmids were subjected to automated sequencing with direct and reverse universal primers.

Immunoscope analysis

The Immunoscope methodology developed for mice or humans (21, 23) was adapted for rainbow trout, using primers specific for trout V{beta}, J{beta}, and C{beta} sequences (22). V{beta} family-specific primers were designed for new rainbow trout V{beta} families described in this work. We chose the primers in framework region to avoid cross-hybridization between the different V{beta} families. J{beta} and C{beta} primers have been described previously (22), and they were designed to be specific of J{beta}1–9 segments except for J{beta}4, because J{beta}2 and J{beta}4 sequences are almost similar. A J{beta}2–4 primer was designed in a region similar in J{beta}2 and J{beta}4 to amplify both kinds of rearrangement with the same efficiency. Primers used were indicated in Table IGo. Immunoscope analysis was performed essentially as described previously (22, 23). Briefly, a first PCR was performed using V{beta}- and C{beta}-specific primers, which amplify sequences with a given V{beta}, but with different CDR3. In a second step, V{beta}-C{beta} PCR products were subjected to runoff reactions with different fluorescent C- or J-specific primers. Runoff products were loaded on a polyacrylamide sequencing gel, and size was separated on an ABI-373 automated sequencer (PerkinElmer, Wellesley, MA). CDR3 length distributions were analyzed using the Immunoscope software, as described previously (21). Repertoire editing and comparisons were performed using the ISEApeaks software (24).


View this table:
[in this window]
[in a new window]
 
Table 1. Primers for rainbow trout immunoscope analysis

 
Immunization and virus challenge

The attenuated 25-111 variant of strain 07-71 of VHSV was used to infect fish through i.m. injection of 1–5 x 105 PFU/trout. This infection usually leads to a good protection against a subsequent lethal infection. Four weeks later, fish received a second injection of variant 25-111 (75 x 106 PFU/trout).

Sequence analysis

The Genetic Computer Group package (Madison, WI) was used for sequence assembly. BLAST and FASTA analysis was performed using programs at the National Center for Biotechnology Information and European Molecular Biology Laboratory websites (http://www.ncbi.nlm.nih.gov/blast/, and http://www2.ebi.ac.uk/fasta3/). When useful, different BLOSUM matrices were used, as indicated in the tables. Kabat numbering was used for sequence description in the text and figures, and CDR3 was considered between residues 96 and 106. Immunogenetics database numbering is also provided for all of rainbow trout V{beta} families in Fig. 1Go.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 1. Amino acid sequences from 10 rainbow trout V{beta} families. V{beta}1, 2, and 3 sequences correspond to GenBank U18123, -4, and -5, respectively. Gaps (noted -) were introduced in the beginning of CDR1 and CDR2 to allow numbering. Above the alignment, + indicates the amino acids, which are important for the three-dimensional structure in the mouse, and present in all rainbow trout V{beta} (? is indicated when the conservation is partial)./, Indicates the amino acids, which are important for the three-dimensional structure in the mouse, and not conserved in rainbow trout. *, Indicates a position conserved among rainbow trout V{beta}, but with a residue different from that of Chothia’s list. The positions of highly variable regions (HVR) and of {beta} strands known for mammalian V{beta}s are marked above the alignment. The numbering following Kabat, and IMGT systems are given just above and just below the aligned V{beta} sequences, respectively. The positions of framework region (FR) and CDR following the IMGT definitions are also indicated below the IMGT numbering.

 
Nucleotide sequence accession numbers

The sequences of rainbow trout V{beta}s have been deposited in GenBank database: accession numbers AY135385 (V{beta}4), AY135386 (V{beta}5), AY135387 (V{beta}6), AY135388 (V{beta}6, splicing variant), AY135389 (V{beta}7), AY135390 (V{beta}8), AY135391 (V{beta}9), and AY135392 (V{beta}10).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of new rainbow trout V{beta} families

To better characterize the rainbow trout V{beta} family composition, we used the 5' RACE methodology to extend V{beta} sequences in the 5' direction starting from a C{beta}-specific primer (C{beta}-RACE). Unlike PCR-based methods using specific or degenerate V{beta} primers, the 5' RACE strategy should normally reveal any transcript encompassing a C{beta} segment. To take into account the putative genetic diversity of domestic trout populations, we used fish from the so-called INRA synthetic strain, which was generated from successive introductions of several domestic populations from the United States and France, pooled, and maintained by random mating. Spleen and head kidney leukocyte RNA was prepared from three naive rainbow trout, and pooled. cDNA was then prepared from pooled RNA and used as a template for the 5' RACE experiment. A cDNA library was constructed by cloning the 5' RACE PCR product into pCR2.1. A first set of 48 random clones was sequenced to analyze the composition of the library. The 5' RACE library contained three different species of TCR transcripts: completely rearranged V{beta}-D{beta}-J{beta}-C{beta} transcripts (11 clones), sterile D{beta}-J{beta}-C{beta} (11 clones), and sterile J{beta}-C{beta} (26 clones), spliced but not rearranged transcripts. Most of the sterile J{beta}-C{beta} clones (24 of 26) expressed the J{beta}4 segment, which is proximal to the D{beta} segment. These sterile J{beta}4-C{beta} transcripts included a genomic sequence localized upstream of J{beta}4. We therefore designed primers specific to this region, which were used to test bacterial colonies of the 5' RACE library by PCR amplification. Colonies giving a PCR product were excluded from subsequent sequence analysis. Most of 5' RACE clones subsequently subjected to sequencing therefore corresponded to D{beta}-J{beta}-C{beta} or V{beta}-D{beta}-J{beta}-C{beta} transcripts. Finally, we obtained a collection of 47 V{beta}-D{beta}-J{beta}-C{beta} sequences expressing a complete V{beta} segment.

Pairwise similarity analysis was performed for all V{beta} nucleotide sequences using the Bestfit command of the GCG package. We used a 70% overall nucleotide sequence identity to order the sequences into 10 families. Four were already described (V{beta}1–4), and six were considered new families (V{beta}5–10). V{beta}1 (12 clones), V{beta}2 (11 clones), and V{beta}3 (9 clones) were the most frequent. V{beta}6, V{beta}7, and V{beta}8 were each represented by 3, 5, and 3 clones, respectively. V{beta}4, V{beta}5, V{beta}9, and V{beta}10 were found only once. The 5' RACE PCR protocol should not affect the relative frequencies of the different V{beta} segments; thus, these proportions should reflect the actual frequencies of V{beta} segments in the available T cell repertoire.

Characteristics of rainbow trout V{beta}

Amino acid sequences of rainbow trout V{beta}s were subjected to multiple alignment using ClustalW and manual adjustment. The V domain typical strands and CDR regions were then identified (Fig. 1Go). Conserved positions included C23, M(I,V)XWY-R(Q,K)-Q(R,K)37, and G/A-X-Y-F/Y-CA93 (Kabat numbering). We also analyzed the multiple alignment in reference to the list of 29 key residues conserved in mouse and human V{beta} sequences established by Chothia et al. (25). Fig. 1Go shows that 14 residues from this list are strictly conserved in rainbow trout. In addition, Q6 and P8 residues are present in V{beta}1, 2, 3, 4, 5, 9, and 10. In V{beta}7, Q and P were present at positions 5 and 7, respectively. In V{beta}8, they are at positions 7 and 9, respectively. In V{beta}6, there is Q at position 5, but P7 is replaced by L. Thus, 16 of 29 key residues were globally conserved in all rainbow trout V{beta}. V{beta} canonical features were therefore present in rainbow trout sequences.

It is interesting to note that the C23-W34 region, which contains the CDR1 domain, displayed a large range of length variation. It contains from 12 to 15 aa, compared with 11–12 aa in mice and humans. Similarly, the length of the W34-C92 region, which contains the CDR2 region, varied from 52 to 63 aa compared with 56–59 residues in humans. This part of the V domain is particularly short in three rainbow trout V{beta} families, 52 residues for V{beta}6, 54 for V{beta}9, and 55 for V{beta}2.

V{beta}6 has unusual primary structure features

V{beta}6 displays the most remarkable primary structure features. V{beta}6 segment has C23-W34 and W34-C92 regions of 15 and 52 residues, respectively, i.e., the longest CDR1 and the shortest CDR2 among rainbow trout V{beta}s. Residues corresponding to the C'' strand are absent from V{beta}6, and the CDR2 hypervariable loop should be much less protruding toward the peptide/MHC complex than for the other V{beta}s. Another striking feature of the V{beta}6 segment is that the CDR2 (residues 49–57) is highly charged and hydrophilic: 8 or 9 charged residues of 13 (ratio, 0.69:0.61, depending on the clone) instead of 3–6 of 15–24 residues (ratio, 0.18:0.33) in the other rainbow trout V{beta} segment.

To search for sequences similar to the rainbow trout V{beta} segments and especially to V{beta}6, we compared nucleotide and protein sequences to the vertebrate section of GenBank using the BLASTP program (Table IIGo). Rainbow trout V{beta}1 had >68% identity with V{beta}1 from Stegastes, which was close to the family cutoff. V{beta}2, V{beta}7, V{beta}8, and the group including V{beta}3–5 and V{beta}10 had significant sequence similarity with other V{beta}s from different species of vertebrates. By contrast, the best hit for trout V{beta}6 was a VH sequence from human Ig with an E value of 9.107. No hit with any V{beta} sequence was obtained for E value < 3.104, suggesting that V{beta}6 was divergent from other known V{beta} sequences. The charged stretch between positions 49 and 57 does not explain completely this result, because blast searches with the 1–34 region led to the same dichotomy between V{beta}6 and the other rainbow trout V{beta} segments. A FASTAX search in EMBLALL identified a Tetrodon nigroviridis genomic sequence with a highly significant sequence similarity to V{beta}6. Conceptual translation of the Tetrodon sequence revealed a V gene of the Ig superfamily, which displays 45% (41 of 92) identity with V{beta}6. In addition to sequence similarity, CDR1 and CDR2 regions have the same length in both sequences (Fig. 2GoA), suggesting that these genes may share the same origin. Noteworthy, the V domain of the nurse shark Ag receptor (NAR), an Ig-like dimer receptor (26, 27, 28), has a short W34-C92 region (48 residues) (Fig. 2GoA), indicating that a V domain with a short CDR2 region is expressed in a rearranging Ag receptor. In addition, a blastp search for sequences similar to the CDR2-containing K49-G88 region of V{beta}6 mainly retrieved NAR sequences. However, most of the identical residues were localized in positions in which amino acids with definite properties are conserved in many Ig V domains, suggesting this similarity pattern probably occurred by chance. Moreover, to the difference of NAR, which has no conserved interdomain residues, V{beta}6 has 5 of 6 typical interdomain residues (as defined in 25), indicating it probably interacts with a V{alpha} domain.


View this table:
[in this window]
[in a new window]
 
Table 2. Sequences similar to rainbow trout V{beta}s as detected by BLASTP program: close relatives and mammalian homologs

 


View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. Unusual characteristics of the V{beta}6 segment. A, V{beta}6 primary structure compared with a NAR (28 ), with the V{beta}6 homologue from T. nigroviridis (AL184010) (Teni), and with rainbow trout V{beta}3 (gb U18124) used as a reference (VB3). An example of CDR3 and G strand was reported from V{beta}6 and NAR V. Only strands A–F are shown for the unrearranged genomic sequence from T. nigroviridis, and for the reference. Gaps have been introduced as in Fig. 1Go to improve the alignment, and noted -. B, Alignment of the nucleotidic sequences of spliced (VB6s) and unspliced (VB6) form of V{beta}6 in TCR{beta} transcripts. Consensus splicing acceptor and donor motifs are indicated above the alignment in bold characters, and the corresponding nucleotides in the V{beta}6 sequence are in italic. C, Distribution of the J{beta} segments rearranged to V{beta}6 among spliced (black boxes) and nonspliced (gray boxes) TCR{beta} transcripts. The distribution of J{beta} segments among all 5' RACE V{beta}-D{beta}-J{beta}-C{beta} clones is reported in stripped boxes. D, Multiple alignment of amino acid sequences of complete V{beta}6 (VB6), spliced V{beta}6 (VB6s), complete NKP30 (NKP30), and spliced NKP30 (NKP30s). The regions deleted by alternative splicing in VB6s and NKP30s sequences are indicated by =.

 
V{beta}6 has an unusual splicing pattern

Among three V{beta}6 clones found in the 5' RACE collection, the clone BN62 lacked a region corresponding to C'-C''-D-E strands. Alignment of long and short forms of V{beta}6 cDNA showed that sequences were otherwise 100% similar, and that the deletion was bordered by putative splicing signals (Fig. 2GoB). This suggested that these two forms could be produced from the same gene by alternative splicing. To verify that the clone BN62 was not an artifact, we designed a V{beta}6-specific primer (VB6) to amplify and clone a representative set of V{beta}6 rearrangements from naive spleen cDNA. PCR with VB6/C{beta}-specific (CB) primers produced two bands, corresponding to short and long forms of the transcript. These products were cloned, and several clones were sequenced. We obtained only V{beta}6-containing rearrangements (24 of 24), showing that amplification was specific of the V{beta}6 segment (Table IIIGo). Sequence analysis also confirmed that V{beta}6 was used as a regular V{beta} segment in rearrangements with several J{beta}, producing junctions of diverse length and composition. A significant number of clones (9 of 24) corresponded to the short form, and showed exactly the same deleted region as in clone BN62. The clones corresponding to the deleted V{beta}6 had rearrangements with different J{beta} segments, ruling out the possibility that the BN62 primary structure was a PCR-mediated artifact. The analysis of the VB6-CB clones also shows that V{beta}6 rearranged more frequently to J{beta}3 and J{beta}4 segments, compared with the J{beta} usage we observed in the whole collection of V{beta}-D{beta}-J{beta}-C{beta} clones (Fig. 2GoC). There was no difference of J{beta} usage between short and long forms of the V{beta}6 transcripts.


View this table:
[in this window]
[in a new window]
 
Table 3. Distribution of V{beta}-J{beta} combinations identified among cloned VB-CB PCR products

 
New V{beta} families show CDR3 length diversity

In the TCR binding with the MHC-peptide complex, CDR3 contributes mainly to binding with the antigenic peptide. Consequently, this region should reflect the vast diversity of the TCR recognition site. To assess systematically the CDR3 length diversity of new TCR{beta} transcripts, we performed Immunoscope experiments with each V{beta}1–10-specific primer. We used V{beta}1–4-specific primers, as described previously (22), and the V{beta}6-specific primer defined above. We designed additional primers to amplify specifically all the new V{beta} families (VB5, 7–10). To verify their specificity, PCR amplifications were performed using each of the VB primers in combination with CB. PCR products were cloned, and several clones were sequenced for each VB-CB combination. The V{beta} region was identified in each clone, and compared with the reference. This analysis established that the amplification using VB5, VB7, VB8, VB9, and VB10 was specific to the corresponding V{beta} family (Table IIIGo). We compiled and analyzed 99 V{beta}-D{beta}-J{beta} junctions sequenced in this study to get an overview of TCR{beta} rearrangements. Structural characteristics of junctions involving the new V{beta}s were not significantly different from what had been reported previously (12, 22). Neither new J{beta}, nor new D{beta} segments were identified. Segments J{beta}1–9 and J{beta}11 were retrieved with different frequencies, but we did not identify the elusive J{beta}10 segment (10).

For Immunoscope analysis, spleen cDNA was synthesized from naive rainbow trout, and subjected to PCR amplification using VB primers and a C{beta}-specific primer (CB2). Each VB-CB PCR product was then subjected to runoff reaction with an internal C{beta}-specific fluorescent primer (CB1). We obtained profiles of 5–8 peaks, each peak corresponding to a pool of TCR transcripts with a given CDR3 length (Fig. 3Go). The peaks were separated by three nucleotide intervals, corresponding to the size of in-frame transcripts. A bell-shaped distribution of peaks was observed for all V{beta}s, demonstrating that the T cell populations expressing new V{beta}s were also polyclonal and diverse in naive fish. The VB6-CB PCR product gave two gaussian profiles, corresponding to the long and short forms of V{beta}6 transcripts. As this experiment represents a global survey of CDR3 length profile for each V{beta}, it confirmed that both short and long V{beta}6 transcripts had highly diverse junctions, distributed in typical bell-shaped spectratypes. In addition, the V{beta}6 profiles suggested that spectratypes were generally identical for the short and long transcript in a given fish (compare the slight differences between fish 1 and 2, which were reproduced in short and long form). V{beta}6 profiles displayed less C{beta} runoff peaks than the profiles observed for other V{beta} segments. This distribution is probably linked to the biased J{beta} usage in V{beta}6 transcripts, because J{beta} segments have different lengths (47–53 bp) (10). Interestingly, J{beta}3 and J{beta}4 segments are both 50 bp long, and the corresponding bell-shaped profiles are centered on the same average length. The bias toward J{beta}3 and J{beta}4 usage in V{beta}6 TCR transcripts should therefore restrict the apparent diversity of corresponding C{beta} runoff products, and mask lateral peaks due to rearrangements with other J{beta} segments.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3. Bell-shaped profiles of CDR3 length distribution for all V{beta} families. Spleen leukocytes of two naive rainbow trout were amplified using V{beta}1–10 and C{beta}2 primer, and PCR products were subjected to runoff using the fluorescent C{beta}1 primer. After separation of the runoff reactions with an automatic sequencer, the fluorescent profiles were analyzed with the Immunoscope software. Each profile represents the CDR3 length diversity of a given V{beta} family. Fragment length is on the x-axis, and fluorescence intensity is on the y-axis. V{beta} family is indicated on the top.

 
V{beta}6 participates in the specific response to viral infection

The V{beta}6 transcripts had typical CDR3 length diversity in naive rainbow trout (3–10 residues). However, the atypical primary structure of the V{beta}6 domain raised the question of its expression at the protein level as part of a TCR. To address this question, we investigated whether V{beta}6-expressing T cells were involved in the specific response against a viral infection, and thus subjected to Ag positive selection. To avoid the effects of fish genetic diversity on T cell responses, we used rainbow trout with identical genetic background. Rainbow trout from clone EQ2 were infected with the 25-111 nonvirulent mutant of VHSV, and were given a second injection of the same virus 27 days after primary infection. VB6 and CB2 primers were used to amplify spleen cDNAs from trout sacrificed on days 42 and 48. VB6-CB PCR products were subjected to runoff reaction with J{beta}-specific primers. The different segments were resolved on a sequencing gel and analyzed with the Immunoscope software. Typical Immunoscope results for all J{beta} are shown in Fig. 4Go. The V{beta}6-J{beta}3 profile was strongly altered in one infected individual (infected trout 2), but it was not significantly affected in the other infected fish. This bias most probably corresponded to a private specific response against the virus. In contrast, the V{beta}6-J{beta}8 profiles from the two infected fish were consistently different from the control. These profiles suggested that expansion of specific V{beta}6-J{beta}8 clones corresponded to a weak public response against the virus.



View larger version (72K):
[in this window]
[in a new window]
 
FIGURE 4. CDR3 length distribution of V{beta}6-D{beta}-J{beta} rearrangements in infected and naive rainbow trout. Two individuals from the same clone were infected with the 25-111 attenuated variant of the VHSV on days 1 and 27. Typical Immunoscope analysis of V{beta}6 junctions from spleen leukocytes of a naive fish from the same clone is given as a control. Spleen leukocytes were analyzed 14 days (Infected 1) or 20 days (Infected 2) after the secondary infection. cDNA were amplified using primers V{beta}6 and C{beta}, and PCR products were subjected to runoff reactions with fluorescent J{beta}1–9 primers. After separation using an automatic sequencer, profiles corresponding to short, spliced V{beta}6 transcripts (shV{beta}6) or to nonspliced V{beta}6 transcripts (V{beta}6) were analyzed using the Immunoscope software. Fragment length is on the x-axis, and fluorescence intensity is on the y-axis.

 
To ascertain that profile modifications were produced by clonal expansion of V{beta}6 T cells, we further analyzed V{beta}6-J{beta}3 and V{beta}6-J{beta}8 profiles from infected trout 2. V{beta}6-J{beta}3 and V{beta}6-J{beta}8 rearrangements were amplified from spleen cDNA, and the PCR products were cloned. Several clones were picked at random, and sequenced (Fig. 5Go). The junction CAANDPAF was found in 4 of 14 V{beta}6-J{beta}3 rearrangements, and corresponded to the size of the expanded peak observed in the Immunoscope profile (3 aa). T cell expansion was less evident for V{beta}6-J{beta}8, as only one junction (CDR3 8 aa) was found twice. Nonetheless, these results strongly suggested that specific V{beta}6-expressing T cells were selected in the context of a secondary response to a virus. V{beta}6 must therefore be expressed in a TCR at the cell surface, and its structural peculiarities could participate in the diversity of the available T cell repertoire. Similar Immunoscope profiles were systematically observed with spliced and unspliced transcripts for a given V{beta}-J{beta} combination. In addition, the V{beta}6-J{beta}3-expanded junction CAANDPAF was found in both spliced (1) and unspliced (3) transcripts. These results therefore suggest that each V{beta}6-expressing T cell produced both spliced and unspliced transcripts, of which at least one form is expressed at the cell surface and drives T cell selection.



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 5. CDR3 sequences of the V{beta}6J{beta}3 and V{beta}6J{beta}8 rearrangements from VHSV-infected fish. Spleen cDNA from infected fish 2 was amplified using V{beta}6/J{beta}3 or V{beta}6/J{beta}8 primers. PCR product was purified and cloned, and clones picked at random were sequenced. Nucleotide and amino acid sequence of the in-frame junctions were sorted according to their CDR3 length. Junctions from alternatively spliced V{beta}6 transcripts are noted {Delta}. Underlined nucleotides correspond to the D{beta} sequence. Boldfaced nucleotides are not encoded in the germline, and most probably represent N nucleotides. Bold, italicized nucleotides are compatible with P addition mechanism. An asterisk indicates the out-of-frame junctions.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In a previous study, we have analyzed the modifications of four V{beta} families of the rainbow trout during viral infection. To allow for further insight into the diversity of the rainbow trout T cell repertoire, we have explored in the present work the characteristics of TCR{beta} transcripts expressed in the spleen of naive fish. A rainbow trout C{beta}-anchored cDNA library was constructed using a 5' RACE strategy, and a total of 47 V{beta}-D{beta}-J{beta}-C{beta} clones were identified. A total of 32 coded for V{beta}1–4 segments already described, and 15 showed undescribed V{beta} sequences, which were grouped into 6 new V{beta} families. This diversity was not surprising in cold blood vertebrates, because 9 and 10 V{beta} families were reported from the axolotl and from the frog Xenopus, respectively (29, 30). Taken together, our results are consistent with the current view that vertebrate V{beta}s are organized in many families, each composed of one or several members (12). Rainbow trout V{beta}1–3 families were confirmed to contain several members (22 , and this study). In addition, V{beta}7 and V{beta}8 contain at least three and two different sequences, respectively. However, the diversity observed in rainbow trout V{beta} families could represent different genes or different alleles. This issue could only be resolved with the complete sequencing of the rainbow trout TCR{beta} locus.

Although many fish V{beta} sequences became recently available, we could not find in other fish species any sequence that could be assigned to a rainbow trout V{beta} family. By comparison, members of the same V{beta} family are often found in different species of mammals (14, 31). This difference could simply reflect the longer evolutionary distance separating the branches of teleost species compared with those in mammals. Similarly, it has been reported that the genetic distance among V{beta} families was greater in the axolotl than in mammals (29).

Most of the key residues involved in the correct folding of V{beta} domain, as defined by Chothia et al. (25), were globally conserved in rainbow trout V{beta}s. Therefore, rainbow trout V{beta} sequences should comply with the general three-dimensional structure of the TCR{alpha}{beta} described in mammals, which is probably mandatory for the expression of a TCR at the cell membrane. This was further confirmed through systematic Immunoscope studies, which de facto probe the functionality of the TCR in T cell selection. Indeed, all the new rainbow trout V{beta} families showed typical bell-shaped CDR3 length distribution, proving they were able to generate functional and diverse rearrangements. Residues conserved in rainbow trout were mainly localized in strands AA'BC and F, while the sequences of the strands C'C''DE showed more variability in length and sequence. Indeed, the length of the W34-C92 region, which contains the CDR2 region, varied from 52 to 63 aa, compared with 56–59 residues in humans.

We failed to identify key residues typical of CDR1 or CDR2 mammalian canonical structures, as defined by Al-Lazikani et al. (32). Although the residues at the positions defining the CDR1 mammalian canonical structures were different in rainbow trout, these residues were strikingly conserved among the 10 rainbow trout V{beta} families (Table IVGo). On the contrary, the positions defining the CDR2 canonical structures in humans and mice were not conserved among rainbow trout V{beta} families. These observations suggest that in rainbow trout V{beta}s, the CDR1 loop is more structurally constrained than the CDR2.


View this table:
[in this window]
[in a new window]
 
Table 4. Residue distribution found in rainbow trout V{beta} sequences at the key positions defining canonical structures of CDR1 and 2 in {beta}-chains of mammalian TCR (as described in Ref. 34 )

 
In humans and mice, crystallographic studies of several TCR/peptide/MHC complexes identified contacts between CDR regions of the TCR {alpha}- and {beta}-chains with the MHC molecule. They revealed that the TCR contacts the MHC molecule mainly through CDR1 and CDR2, while CDR3 is more centered on the peptide (33, 34, 35). If rainbow trout V{beta} comply with the same general structure, it is therefore likely that the diversity of CDR2 will affect the interaction between the TCR {beta}-chain and the MHC molecules. Interestingly, rainbow trout MHC class I molecules possess unique features. UAB (rainbow trout classical class I) alleles are much more divergent among each other than in primates (mean difference 23.8% between alleles, compared with 5.4% among HLA-B) (17). In addition, {beta}2-microglobulin genes are also highly diverse in rainbow trout (36). Thus, the diversity of CDR2 length provides an additional level of diversity to teleost T cell repertoire, which probably corresponds to a higher variability of TCR/peptide/MHC interactions.

Among rainbow trout V{beta} families, V{beta}6 was clearly divergent from typical TCR V{beta} sequences known through vertebrates. Concerning the predicted properties of this V{beta} domain, the CDR2 region was short, highly charged, and hydrophilic. In fact, V{beta}6 had not only the shortest CDR2, but also the longest CDR1, suggesting that CDR1 and CDR2 length may be interdependent. Interestingly, in the shark Heterodontus, the V{beta}7 family has also the longest CDR1 (14 residues in C23-W34 instead of 12–13) and the shortest CDR2 (54 residues in W34-C92). Unlike for the other rainbow trout V{beta} sequences, comparison of V{beta}6 with databases failed to detect high similarity (E value < 1e-08) with known V domains of the Ig superfamily. The most similar sequences were not even TCR V domains, but VH Ig domains. However, V{beta}6 was expressed in typical V{beta}-D{beta}-J{beta}-C{beta} transcripts and rearranged with various J{beta}s, leading to a diverse repertoire of junctions. In this context, it was interesting to note that NAR has a very short CDR2 region and is functionally expressed. In such V domains, a short CDR2 would connect the two {beta}-sheets more like in Ig C1 domains.

Because rainbow trout V{beta}6 had peculiar features, the question of the expression of V{beta}6 in a functional TCR was raised. We therefore focused an Immunoscope analysis on this particular V{beta} family in the context of the T cell response against VHSV. As observed for the other V{beta} segments (22 for V{beta}1–4, and data not shown for V{beta}5, V{beta}7–10), this experiment identified several V{beta}6 responses against the virus. T cells expressing V{beta}6 rearrangements have been therefore subjected to Ag-driven amplification, indicating V{beta}6 should be expressed at the protein level. V{beta}6 appeared as two forms of transcripts with sequence characteristics indicative of alternative splicing within the V domain. Approximately one-third (10 of 27 in naive trout) of V{beta}6-J{beta}-C{beta} transcripts lacked 35 residues corresponding to strands C', C'', D, and to a part of the E strand. To our knowledge, V{beta} transcript with such characteristics has never been described and may have no functional relevance. Because we never found a modification of the Immunoscope CDR3 length profile restricted to the short form of V{beta}6 transcript, we have no evidence that the short form of V{beta}6 was expressed at the protein level. However, short forms of transcripts due to alternative splicing within a V domain have been already described for another gene of the Ig superfamily, NKP30 (37) (see Fig. 2GoD). It is interesting to note that the region lacking in NKP30 variant roughly corresponds to the same region that was lacking in clone BN62, although it is shorter. Furthermore, both NKP30 and V{beta}6 have long CDR1 regions: C23-W34 region of 16 and 15 residues, respectively. By comparison, this region has 12 of 13 residues in other rainbow trout V{beta}, and 11 of 12 residues in human V{beta} sequences. It raised the question of the existence of a truncated structure of Ig V domain, which the short forms of NKP30 and V{beta}6 may adopt. Intriguingly, the truncation may be compatible with the current three-dimensional model of V{beta} domain because the ends of the E and C strands are in close proximity. However, it is probably not safe to use the Ig V domain model to predict the structure of such truncated sequences. Besides, there is no published evidence of the protein expression of the NKP30 short form. We therefore favor the idea that spliced V{beta}6 transcripts are byproducts made in each V{beta}6+ T cell due to the presence of functional splicing signal in the V{beta}6 sequence.

Although V{beta}6 is basically a TCR{beta} segment, its primary structure looks rather like a chimere of features from various types of receptors from the Ig superfamily. The early evolution of Igs and TCRs is still poorly known, but the description of segments with new features suggests that the repertoire of Ag receptors, and the constraints shaping their evolution, may be more complex than previously believed.


    Acknowledgments
 
We thank A. Colette, A. Six, and P.-A. Cazenave for expert advice, and for providing the ISEApeaks software. B. Buteau, F. Coulpier, and the staff of the experimental fish facilities are also acknowledged for their excellent technical assistance. Clonal fish were provided by M. Dorson and E. Quillet. We thank J. Kanellopoulos for helpful discussions, and L. Du Pasquier for many suggestions, and for comments on the manuscript.


    Footnotes
 
1 This work was supported by the Institut National de la Recherche Agronomique and European Community Project FAIR 98-4026. Back

2 Current address: Département de Biologie Cellulaire, Institut Cochin de Génétique Moléculaire, 22 rue Méchain, 75014 Paris, France. Back

3 Address correspondence and reprint requests to Dr. Abdenour Benmansour, Institut National de la Recherche Agronomique, Unité de Virologie et Immunologie Moléculaires, 78352 Jouy-en-Josas cedex, France. E-mail address: abdenour{at}jouy.inra.fr Back

4 Abbreviations used in this paper: CDR, complementarity-determining region; CB, C{beta}-specific primer; NAR, nurse shark Ag receptor; VB, V{beta}-specific primer; VHSV, viral hemorrhagic septicemia virus. Back

Received for publication July 25, 2002. Accepted for publication September 24, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Davis, M. M., Y. H. Chien. 1999. T-cell antigen receptors. W. Paul, ed. Fundamental Immunology 341. Lippincott-Raven, Philadelphia.
  2. Du Pasquier, L., M. Flajnik. 1999. Evolution of the vertebrate immune system. W. Paul, ed. Fundamental Immunology 605. Lippincott-Raven, Philadelphia.
  3. Partula, S., J. S. Fellah, A. de Guerra, J. Charlemagne. 1994. Characterization of cDNA of T-cell receptor {beta} chain in rainbow trout. C. R. Acad. Sci. Ser. III 317:765.[Medline]
  4. Rast, J. P., G. W. Litman. 1994. T-cell receptor gene homologs are present in the most primitive jawed vertebrates. Proc. Natl. Acad. Sci. USA 91:9248.[Abstract/Free Full Text]
  5. Rast, J. P., M. K. Anderson, S. J. Strong, C. Luer, R. T. Litman, G. W. Litman. 1997. {alpha}, {beta}, {gamma}, and {delta} T cell antigen receptor genes arose early in vertebrate phylogeny. Immunity 6:1.[Medline]
  6. Hordvik, I., A. L. Jacob, J. Charlemagne, C. Endresen. 1996. Cloning of T-cell antigen receptor {beta} chain cDNAs from Atlantic salmon (Salmo salar). Immunogenetics 45:9.[Medline]
  7. Wilson, M. R., H. Zhou, E. Bengten, L. W. Clem, T. B. Stuge, G. W. Warr, N. W. Miller. 1998. T-cell receptors in channel catfish: structure and expression of TCR {alpha} and {beta} genes. Mol. Immunol. 35:545.[Medline]
  8. Wermenstam, N. E., L. Pilstrom. 2001. T-cell antigen receptors in Atlantic cod (Gadus morhua l.): structure, organization and expression of TCR {alpha} and {beta} genes. Dev. Comp. Immunol. 25:117.[Medline]
  9. Partula, S., A. de Guerra, J. S. Fellah, J. Charlemagne. 1995. Structure and diversity of the T cell antigen receptor {beta}-chain in a teleost fish. J. Immunol. 155:699.[Abstract]
  10. De Guerra, A., J. Charlemagne. 1997. Genomic organization of the TCR {beta}-chain diversity (D{beta}) and joining (J{beta}) segments in the rainbow trout: presence of many repeated sequences. Mol. Immunol. 34:653.[Medline]
  11. Williams, A. F., A. N. Barclay. 1988. The immunoglobulin superfamily: domains for cell surface recognition. Annu. Rev. Immunol. 6:381.[Medline]
  12. Charlemagne, J., J. S. Fellah, A. De Guerra, F. Kerfourn, S. Partula. 1998. T-cell receptors in ectothermic vertebrates. Immunol. Rev. 166:87.[Medline]
  13. Wilson, R. K., E. Lai, P. Concannon, R. K. Barth, L. E. Hood. 1988. Structure, organization and polymorphism of murine and human T-cell receptor {alpha} and {beta} chain gene families. Immunol. Rev. 101:149.[Medline]
  14. Tanaka, A., N. Ishiguro, M. Shinagawa. 1990. Sequence and diversity of bovine T-cell receptor {beta}-chain genes. Immunogenetics 32:263.[Medline]
  15. McConnell, T. J., U. B. Godwin, B. J. Cuthbertson. 1998. Expressed major histocompatibility complex class II loci in fishes. Immunol. Rev. 166:294.[Medline]
  16. Hansen, J. D., P. Strassburger, G. H. Thorgaard, W. P. Young, L. Du Pasquier. 1999. Expression, linkage, and polymorphism of MHC-related genes in rainbow trout, Oncorhynchus mykiss. J. Immunol. 163:774.[Abstract/Free Full Text]
  17. Shum, B. P., L. Guethlein, L. R. Flodin, M. A. Adkison, R. P. Hedrick, R. B. Nehring, R. J. Stet, C. Secombes, P. Parham. 2001. Modes of salmonid MHC class I and II evolution differ from the primate paradigm. J. Immunol. 166:3297.[Abstract/Free Full Text]
  18. Miller, N. W., A. Deuter, L. W. Clem. 1986. Phylogeny of lymphocyte heterogeneity: the cellular requirements for the mixed leukocyte reaction with channel catfish. Immunology 59:123.[Medline]
  19. Stuge, T. B., M. R. Wilson, H. Zhou, K. S. Barker, E. Bengten, G. Chinchar, N. W. Miller, L. W. Clem. 2000. Development and analysis of various clonal alloantigen-dependent cytotoxic cell lines from channel catfish. J. Immunol. 164:2971.[Abstract/Free Full Text]
  20. Somamoto, T., T. Nakanishi, N. Okamoto. 2000. Specific cell-mediated cytotoxicity against a virus-infected syngeneic cell line in isogeneic ginbuna crucian carp. Dev. Comp. Immunol. 24:633.[Medline]
  21. Pannetier, C., J. Even, P. Kourilsky. 1995. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol. Today 16:176.[Medline]
  22. Boudinot, P., S. Boubekeur, A. Benmansour. 2001. Rhabdovirus infection induces public and private T cell responses in teleost fish. J. Immunol. 167:6202.[Abstract/Free Full Text]
  23. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor {beta} chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.[Abstract/Free Full Text]
  24. Collette, A., A. Six. 2002. ISEApeaks: an Excel platform for GeneScan and Immunoscope data retrieval, management and analysis. Bioinformatics 18:329.[Abstract/Free Full Text]
  25. Chothia, C., D. R. Boswell, A. M. Lesk. 1988. The outline structure of the T-cell {alpha}{beta} receptor. EMBO J. 7:3745.[Medline]
  26. Greenberg, A. S., A. L. Hughes, J. Guo, D. Avila, E. C. McKinney, M. F. Flajnik. 1996. A novel "chimeric" antibody class in cartilaginous fish: IgM may not be the primordial immunoglobulin. Eur. J. Immunol. 26:1123.[Medline]
  27. Diaz, M., A. S. Greenberg, M. F. Flajnik. 1998. Somatic hypermutation of the new antigen receptor gene (NAR) in the nurse shark does not generate the repertoire: possible role in antigen-driven reactions in the absence of germinal centers. Proc. Natl. Acad. Sci. USA 95:14343.[Abstract/Free Full Text]
  28. Roux, K. H., A. S. Greenberg, L. Greene, L. Strelets, D. Avila, E. C. McKinney, M. F. Flajnik. 1998. Structural analysis of the nurse shark (new) antigen receptor (NAR): molecular convergence of NAR and unusual mammalian immunoglobulins. Proc. Natl. Acad. Sci. USA 95:11804.[Abstract/Free Full Text]
  29. Fellah, J. S., F. Kerfourn, J. Charlemagne. 1994. Evolution of T cell receptor genes: extensive diversity of V{beta} families in the Mexican axolotl. J. Immunol. 153:4539.[Abstract]
  30. Chretien, I., A. Marcuz, J. Fellah, J. Charlemagne, L. Du Pasquier. 1997. The T cell receptor {beta} genes of Xenopus. Eur. J. Immunol. 27:763.[Medline]
  31. Marche, P. N., T. J. Kindt. 1986. Two distinct T-cell receptor {alpha}-chain transcripts in a rabbit T-cell line: implications for allelic exclusion in T cells. Proc. Natl. Acad. Sci. USA 83:2190.[Abstract/Free Full Text]
  32. Al-Lazikani, B., A. M. Lesk, C. Chothia. 2000. Canonical structures for the hypervariable regions of T cell {alpha}{beta} receptors. J. Mol. Biol. 295:979.[Medline]
  33. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, D. C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134.[Medline]
  34. Garcia, K. C., M. Degano, R. L. Stanfield, A. Brunmark, M. R. Jackson, P. A. Peterson, L. Teyton, I. A. Wilson. 1996. An {alpha}{beta} T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.[Abstract/Free Full Text]
  35. Reinherz, E. L., K. Tan, L. Tang, P. Kern, J. Liu, Y. Xiong, R. E. Hussey, A. Smolyar, B. Hare, R. Zhang, et al 1999. The crystal structure of a T cell receptor in complex with peptide and MHC class II. Science 286:1913.[Abstract/Free Full Text]
  36. Shum, B. P., K. Azumi, S. Zhang, S. R. Kehrer, R. L. Raison, H. W. Detrich, P. Parham. 1996. Unexpected {beta}2-microglobulin sequence diversity in individual rainbow trout. Proc. Natl. Acad. Sci. USA 93:2779.[Abstract/Free Full Text]
  37. Neville, M. J., R. D. Campbell. 1999. A new member of the Ig superfamily and a V-ATPase G subunit are among the predicted products of novel genes close to the TNF locus in the human MHC. J. Immunol. 162:4745.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
D. Bernard, A. Six, L. Rigottier-Gois, S. Messiaen, S. Chilmonczyk, E. Quillet, P. Boudinot, and A. Benmansour
Phenotypic and Functional Similarity of Gut Intraepithelial and Systemic T Cells in a Teleost Fish
J. Immunol., April 1, 2006; 176(7): 3942 - 3949.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudinot, P.
Right arrow Articles by Benmansour, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudinot, P.
Right arrow Articles by Benmansour, A.
Right arrowPubmed/NCBI databases
*Protein*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS