|
|
||||||||
Transcripts Identify Ten V
Families with V
6 Displaying Unusual CDR2 and Differently Spliced Forms1
Institut National de la Recherche Agronomique, Unité de Virologie et Immunologie Moléculaires, Jouy-en-Josas, France
| Abstract |
|---|
|
|
|---|
locus leads to a highly
diverse repertoire of junctions for each V
J
combination. From a
rainbow trout 5' RACE library of TCR
transcripts, 47 clones
encompassing a full V
-D
-J
-C
sequence were selected and
analyzed. A similarity analysis of the sequences evidenced 10 V
families, of which 6 were not previously described. Immunoscope and
sequence analysis of the V
-D
-J
junctions of the new families
confirmed that they create a polyclonal and diverse repertoire.
Multiple alignments showed that rainbow trout V
s possess most of the
conserved residues typical of V
segments. However, this study
revealed a high complementarity-determining region 2 (CDR2) and CDR1
length diversity among rainbow trout V
families, suggesting that the
spatial orientation of the TCR could fluctuate in the TCR/peptide/MHC
complex, depending on the V
expressed. Among the new V
families,
V
6 displayed the strongest deviance from typical hypervariable CDR1
and CDR2 loops, with an unusually short CDR2. Moreover, the V
6
sequence is overall divergent from typical V
sequence, raising the
question of its functional relevance. Immunoscope experiments
identified a V
6-J
3 junction, which was amplified during the
response against viral hemorrhagic septicemia virus, a fish
rhabdovirus. V
6 seems therefore to be expressed functionally in a
selected TCR. However, the shorter V
6 transcripts produced through
an alternative splicing lack the C', C'', D, and E strands of
the V
domain and are probably nonfunctional. | Introduction |
|---|
|
|
|---|
(or a
)- and a
(or a
)-chain, each containing a V and a C domain.
The Ag specificity of TCR is determined by sequences corresponding to
three hypervariable regions of the V domain, the
complementarity-determining regions
(CDR).4 The diversity
of TCR
is generated by the assembly of germline-encoded segments:
V, J, and for
-chains D segments. A huge additional diversity
derives from the addition and deletion of nucleotides at the junctions
between V, D, and J segments. TCR genes, loci, and recombination
mechanisms and control have been characterized in detail in humans and
mice (reviewed in Ref. 1). TCR
recognizes the Ag
presented as a peptide by the class I and II MHC molecules. This
recognition mediates cytotoxic and Th cell responses.
TCR genes were identified in the different lineages of Gnathostoma
(2). In the fish, TCR
genes were first described in the
rainbow trout (Oncorhynchus mykiss) (3) and in
the horned shark (Heterodontus francisci) (4).
TCR genes
,
,
, and
were finally identified in the skate
(Raja eglanteria), a Chondrychthian, suggesting that all
Gnathostoma should express both 
and 
TCR (5).
Complete TCR
sequences are now available for several species of
teleosts: in Atlantic salmon (Salmo salar) (6),
channel catfish (Ictalurus punctatus) (7),
Atlantic cod (Gadus morhua) (8), damselfish
(Stegastes partitus) (GenBank AF324813-824), and Japanese
flounder (Paralichthys olivaceus) (GenBank AF053407-443). In
rainbow trout, four different V
families were described (3, 9, 10). In all these species, the sequence of
-chains showed
typical V and C1 domains (as defined in 11) with key
residues conserved, suggesting that the general three-dimensional
structure of this protein was conserved from fish to mammals
(12). Phylogenetic studies showed that TCR
sequences
are conserved in mammals (13, 14), but no close similarity
was observed between fish and mammalian V
sequences. In teleosts, T
cell-dependent responses were suggested by the presence of TCR genes,
and by the structure of the MHC locus and by the polymorphism of class
I and class II molecules (15, 16, 17). However, a functional T
cell response has been directly proved in only a limited number of
species. A clear allospecific response was described using catfish
Ig- cells or catfish T cell lines, showing that fish
lymphocytes can display CTL-like activity (18, 19). A
specific cell-mediated lysis of virus-infected target cells by primed
leukocytes has also been obtained in the cloned goldfish
(20). However, in this case, the cells involved in the
cytotoxicity had not been unambiguously identified as 
T cells.
More recently, TCR
Immunoscope methodology (21) was
used to study the rainbow trout T cell response to a viral infection.
Spectratyping of CDR3 revealed that the rainbow trout naive T cell
repertoire is polyclonal and highly diverse. Primary and secondary
infection with viral hemorrhagic septicemia virus (VHSV) dramatically
skewed the repertoire, and the profiles were reminiscent of the public
and private virus-specific T cell responses observed in mammals
(22).
In this work, we used a 5' RACE strategy and Immunoscope analysis to
obtain further insight into the V
segments expressed in rainbow
trout, and to perform a global survey of the diversity of
V
-D
-J
junctions. Ten V
families (V
110) were identified
from TCR
transcripts. A comparative study of their primary structure
with V
sequences from other vertebrates revealed that V
6 had
unusual characteristics.
| Materials and Methods |
|---|
|
|
|---|
Rainbow trout were raised in the fish facilities of Institut
National de la Recherche Agronomique (INRA, Jouy-en-Josas, France). The
so-called INRA synthetic strain was used throughout, except for
infection experiments. It results from successive introductions between
1976 and 1983 of several domestic populations from the United States
and France, which were pooled and then maintained as a single
population by random mating during four to five generations. For the
study of the V
6 response to the VHSV, rainbow trout heterozygous
clones (22) were used. Trout were sacrificed by
overexposure to 2-phenoxyethanol diluted 1/1000. The entire spleen was
removed aseptically. Leukocytes from the kidney tissue of a single fish
were isolated by centrifugation through a Ficoll gradient (lymphocyte
separation medium, d = 1.077; Eurobio, Les Ullis, France), and
used for RNA preparation.
RNA isolation and construction of the 5' RACE library
The 5' RACE was performed using the SMART RACE cDNA
Amplification Kit (Clontech, Palo Alto, CA), according to the
instructions of the manufacturer. Total RNA was extracted from spleen
and head kidney leukocytes with the TRIzol reagent (Life Technologies,
Cergy-Pontoise, France), and treated with DNase (Boehringer
Mannheim, Indianapolis, IN) to remove any remaining genomic DNA. The
treated RNA was used to generate full-length cDNAs. The 5' RACE PCR
were performed with a C
-specific primer (C
-RACE:
ACACACACTAGGGTCTTCTT) and the universal primers from Clontech. PCR
products obtained were purified with Sephacryl S-400 columns
(Pharmacia, Peapack, NJ) and cloned into pCR2.1 vector (TOPO TA cloning
system; Invitrogen, San Diego, CA).
Screening of the 5' RACE cDNA library
The clones corresponding to J
4-C
transcripts were
identified by PCR using two primers chosen in the genomic region
upstream of the J
4 segment (J4C-forward, AGGGAGTTGGTTTGATTCATGTTTG;
J4C-reverse, ACATCGTTTTCCTCCTCTTCCAAAA, giving a 172-bp PCR product).
This set of primers specifically amplifies cDNA to J
4-C
sterile
transcripts. Bacteria from the colony on the plate were added to the
PCR mix. The amplification was performed in the following conditions:
10 min, 94°C; then 30 cycles of 1 min, 94°C; 1 min, 60°C; 2 min,
72°C; then 5 min, 72°C. Colonies that gave PCR product of the
expected size were rejected. Colonies giving no PCR product were
elected for further analysis. Selected colonies were grown overnight in
Luria-Bertani/ampicillin broth, and the plasmid purified with a plasmid
miniprep spin kit (Nucleospin; Macherey-Nagel, Durin, Germany).
Purified plasmids were subjected to automated sequencing with direct
and reverse universal primers.
Immunoscope analysis
The Immunoscope methodology developed for mice or humans
(21, 23) was adapted for rainbow trout, using primers
specific for trout V
, J
, and C
sequences (22).
V
family-specific primers were designed for new rainbow trout V
families described in this work. We chose the primers in framework
region to avoid cross-hybridization between the different V
families. J
and C
primers have been described previously
(22), and they were designed to be specific of J
19
segments except for J
4, because J
2 and J
4 sequences are almost
similar. A J
24 primer was designed in a region similar in J
2
and J
4 to amplify both kinds of rearrangement with the same
efficiency. Primers used were indicated in Table I
. Immunoscope analysis was performed
essentially as described previously (22, 23). Briefly, a
first PCR was performed using V
- and C
-specific primers, which
amplify sequences with a given V
, but with different CDR3. In a
second step, V
-C
PCR products were subjected to runoff reactions
with different fluorescent C- or J-specific primers. Runoff products
were loaded on a polyacrylamide sequencing gel, and size was separated
on an ABI-373 automated sequencer (PerkinElmer, Wellesley, MA). CDR3
length distributions were analyzed using the Immunoscope software, as
described previously (21). Repertoire editing and
comparisons were performed using the ISEApeaks software
(24).
|
The attenuated 25-111 variant of strain 07-71 of VHSV was used to infect fish through i.m. injection of 15 x 105 PFU/trout. This infection usually leads to a good protection against a subsequent lethal infection. Four weeks later, fish received a second injection of variant 25-111 (75 x 106 PFU/trout).
Sequence analysis
The Genetic Computer Group package (Madison, WI) was used
for sequence assembly. BLAST and FASTA analysis was performed
using programs at the National Center for Biotechnology Information and
European Molecular Biology Laboratory websites
(http://www.ncbi.nlm.nih.gov/blast/, and
http://www2.ebi.ac.uk/fasta3/). When useful, different BLOSUM
matrices were used, as indicated in the tables. Kabat numbering was
used for sequence description in the text and figures, and CDR3 was
considered between residues 96 and 106. Immunogenetics database
numbering is also provided for all of rainbow trout V
families in
Fig. 1
.
|
The sequences of rainbow trout V
s have been deposited in
GenBank database: accession numbers AY135385 (V
4), AY135386 (V
5),
AY135387 (V
6), AY135388 (V
6, splicing variant), AY135389 (V
7),
AY135390 (V
8), AY135391 (V
9), and AY135392 (V
10).
| Results |
|---|
|
|
|---|
families
To better characterize the rainbow trout V
family composition,
we used the 5' RACE methodology to extend V
sequences in the 5'
direction starting from a C
-specific primer (C
-RACE). Unlike
PCR-based methods using specific or degenerate V
primers, the 5'
RACE strategy should normally reveal any transcript encompassing a C
segment. To take into account the putative genetic diversity of
domestic trout populations, we used fish from the so-called INRA
synthetic strain, which was generated from successive introductions of
several domestic populations from the United States and France, pooled,
and maintained by random mating. Spleen and head kidney leukocyte RNA
was prepared from three naive rainbow trout, and pooled. cDNA was then
prepared from pooled RNA and used as a template for the 5' RACE
experiment. A cDNA library was constructed by cloning the 5' RACE PCR
product into pCR2.1. A first set of 48 random clones was sequenced to
analyze the composition of the library. The 5' RACE library contained
three different species of TCR transcripts: completely rearranged
V
-D
-J
-C
transcripts (11 clones), sterile D
-J
-C
(11
clones), and sterile J
-C
(26 clones), spliced but not
rearranged transcripts. Most of the sterile J
-C
clones (24 of 26)
expressed the J
4 segment, which is proximal to the D
segment.
These sterile J
4-C
transcripts included a genomic sequence
localized upstream of J
4. We therefore designed primers specific to
this region, which were used to test bacterial colonies of the 5' RACE
library by PCR amplification. Colonies giving a PCR product were
excluded from subsequent sequence analysis. Most of 5' RACE clones
subsequently subjected to sequencing therefore corresponded to
D
-J
-C
or V
-D
-J
-C
transcripts. Finally, we obtained
a collection of 47 V
-D
-J
-C
sequences expressing a complete
V
segment.
Pairwise similarity analysis was performed for all V
nucleotide
sequences using the Bestfit command of the GCG package. We used a 70%
overall nucleotide sequence identity to order the sequences into 10
families. Four were already described (V
14), and six were
considered new families (V
510). V
1 (12 clones), V
2 (11
clones), and V
3 (9 clones) were the most frequent. V
6, V
7, and
V
8 were each represented by 3, 5, and 3 clones, respectively. V
4,
V
5, V
9, and V
10 were found only once. The 5' RACE PCR protocol
should not affect the relative frequencies of the different V
segments; thus, these proportions should reflect the actual frequencies
of V
segments in the available T cell repertoire.
Characteristics of rainbow trout V
Amino acid sequences of rainbow trout V
s were subjected to
multiple alignment using ClustalW and manual adjustment. The V domain
typical strands and CDR regions were then identified (Fig. 1
). Conserved positions included
C23, M(I,V)XWY-R(Q,K)-Q(R,K)37, and
G/A-X-Y-F/Y-CA93 (Kabat numbering). We also analyzed the
multiple alignment in reference to the list of 29 key residues
conserved in mouse and human V
sequences established by Chothia et
al. (25). Fig. 1
shows that 14 residues from this list are
strictly conserved in rainbow trout. In addition,
Q6 and P8 residues are
present in V
1, 2, 3, 4, 5, 9, and 10. In V
7, Q and P were present
at positions 5 and 7, respectively. In V
8, they are at positions 7
and 9, respectively. In V
6, there is Q at position 5, but
P7 is replaced by L. Thus, 16 of 29 key residues
were globally conserved in all rainbow trout V
. V
canonical
features were therefore present in rainbow trout sequences.
It is interesting to note that the
C23-W34 region, which
contains the CDR1 domain, displayed a large range of length variation.
It contains from 12 to 15 aa, compared with 1112 aa in mice and
humans. Similarly, the length of the
W34-C92 region, which
contains the CDR2 region, varied from 52 to 63 aa compared with 5659
residues in humans. This part of the V domain is particularly short in
three rainbow trout V
families, 52 residues for V
6, 54 for V
9,
and 55 for V
2.
V
6 has unusual primary structure features
V
6 displays the most remarkable primary structure features.
V
6 segment has C23-W34
and W34-C92 regions of 15
and 52 residues, respectively, i.e., the longest CDR1 and the shortest
CDR2 among rainbow trout V
s. Residues corresponding to the C''
strand are absent from V
6, and the CDR2 hypervariable loop should be
much less protruding toward the peptide/MHC complex than for the other
V
s. Another striking feature of the V
6 segment is that the CDR2
(residues 4957) is highly charged and hydrophilic: 8 or 9 charged
residues of 13 (ratio, 0.69:0.61, depending on the clone) instead of
36 of 1524 residues (ratio, 0.18:0.33) in the other rainbow trout
V
segment.
To search for sequences similar to the rainbow trout V
segments and
especially to V
6, we compared nucleotide and protein sequences to
the vertebrate section of GenBank using the BLASTP program (Table II
). Rainbow trout V
1 had >68%
identity with V
1 from Stegastes, which was close to the
family cutoff. V
2, V
7, V
8, and the group including V
35
and V
10 had significant sequence similarity with other V
s from
different species of vertebrates. By contrast, the best hit for trout
V
6 was a VH sequence from human Ig with an E
value of 9.107. No hit with any V
sequence was obtained for E value < 3.104,
suggesting that V
6 was divergent from other known V
sequences.
The charged stretch between positions 49 and 57 does not explain
completely this result, because blast searches with the 134 region
led to the same dichotomy between V
6 and the other rainbow trout
V
segments. A FASTAX search in EMBLALL identified a Tetrodon
nigroviridis genomic sequence with a highly significant sequence
similarity to V
6. Conceptual translation of the Tetrodon
sequence revealed a V gene of the Ig superfamily, which displays 45%
(41 of 92) identity with V
6. In addition to sequence similarity,
CDR1 and CDR2 regions have the same length in both sequences (Fig. 2
A), suggesting that these
genes may share the same origin. Noteworthy, the V domain of the nurse
shark Ag receptor (NAR), an Ig-like dimer receptor
(26, 27, 28), has a short
W34-C92 region (48
residues) (Fig. 2
A), indicating that a V domain with a short
CDR2 region is expressed in a rearranging Ag receptor. In addition, a
blastp search for sequences similar to the CDR2-containing
K49-G88 region of V
6
mainly retrieved NAR sequences. However, most of the identical residues
were localized in positions in which amino acids with definite
properties are conserved in many Ig V domains, suggesting this
similarity pattern probably occurred by chance. Moreover, to the
difference of NAR, which has no conserved interdomain residues, V
6
has 5 of 6 typical interdomain residues (as defined in
25), indicating it probably interacts with a V
domain.
|
|
6 has an unusual splicing pattern
Among three V
6 clones found in the 5' RACE collection, the
clone BN62 lacked a region corresponding to C'-C''-D-E strands.
Alignment of long and short forms of V
6 cDNA showed that sequences
were otherwise 100% similar, and that the deletion was bordered by
putative splicing signals (Fig. 2
B). This suggested that
these two forms could be produced from the same gene by alternative
splicing. To verify that the clone BN62 was not an artifact, we
designed a V
6-specific primer (VB6) to amplify and clone a
representative set of V
6 rearrangements from naive spleen cDNA. PCR
with VB6/C
-specific (CB) primers produced two bands, corresponding
to short and long forms of the transcript. These products were cloned,
and several clones were sequenced. We obtained only V
6-containing
rearrangements (24 of 24), showing that amplification was specific of
the V
6 segment (Table III
). Sequence
analysis also confirmed that V
6 was used as a regular V
segment
in rearrangements with several J
, producing junctions of diverse
length and composition. A significant number of clones (9 of 24)
corresponded to the short form, and showed exactly the same deleted
region as in clone BN62. The clones corresponding to the deleted V
6
had rearrangements with different J
segments, ruling out the
possibility that the BN62 primary structure was a PCR-mediated
artifact. The analysis of the VB6-CB clones also shows that V
6
rearranged more frequently to J
3 and J
4 segments, compared with
the J
usage we observed in the whole collection of
V
-D
-J
-C
clones (Fig. 2
C). There was no
difference of J
usage between short and long forms of the V
6
transcripts.
|
families show CDR3 length diversity
In the TCR binding with the MHC-peptide complex, CDR3 contributes
mainly to binding with the antigenic peptide. Consequently, this region
should reflect the vast diversity of the TCR recognition site. To
assess systematically the CDR3 length diversity of new TCR
transcripts, we performed Immunoscope experiments with each
V
110-specific primer. We used V
14-specific primers, as
described previously (22), and the V
6-specific primer
defined above. We designed additional primers to amplify specifically
all the new V
families (VB5, 710). To verify their specificity,
PCR amplifications were performed using each of the VB primers in
combination with CB. PCR products were cloned, and several clones were
sequenced for each VB-CB combination. The V
region was identified in
each clone, and compared with the reference. This analysis established
that the amplification using VB5, VB7, VB8, VB9, and VB10 was specific
to the corresponding V
family (Table III
). We compiled and analyzed
99 V
-D
-J
junctions sequenced in this study to get an overview
of TCR
rearrangements. Structural characteristics of junctions
involving the new V
s were not significantly different from what had
been reported previously (12, 22). Neither new J
, nor
new D
segments were identified. Segments J
19 and J
11 were
retrieved with different frequencies, but we did not identify the
elusive J
10 segment (10).
For Immunoscope analysis, spleen cDNA was synthesized from naive
rainbow trout, and subjected to PCR amplification using VB primers and
a C
-specific primer (CB2). Each VB-CB PCR product was then subjected
to runoff reaction with an internal C
-specific fluorescent primer
(CB1). We obtained profiles of 58 peaks, each peak corresponding to a
pool of TCR transcripts with a given CDR3 length (Fig. 3
). The peaks were separated by three
nucleotide intervals, corresponding to the size of in-frame
transcripts. A bell-shaped distribution of peaks was observed for all
V
s, demonstrating that the T cell populations expressing new V
s
were also polyclonal and diverse in naive fish. The VB6-CB PCR product
gave two gaussian profiles, corresponding to the long and short forms
of V
6 transcripts. As this experiment represents a global survey of
CDR3 length profile for each V
, it confirmed that both short and
long V
6 transcripts had highly diverse junctions, distributed in
typical bell-shaped spectratypes. In addition, the V
6 profiles
suggested that spectratypes were generally identical for the short and
long transcript in a given fish (compare the slight differences between
fish 1 and 2, which were reproduced in short and long form). V
6
profiles displayed less C
runoff peaks than the profiles observed
for other V
segments. This distribution is probably linked to the
biased J
usage in V
6 transcripts, because J
segments have
different lengths (4753 bp) (10). Interestingly, J
3
and J
4 segments are both 50 bp long, and the corresponding
bell-shaped profiles are centered on the same average length. The bias
toward J
3 and J
4 usage in V
6 TCR transcripts should therefore
restrict the apparent diversity of corresponding C
runoff products,
and mask lateral peaks due to rearrangements with other J
segments.
|
6 participates in the specific response to viral infection
The V
6 transcripts had typical CDR3 length diversity in naive
rainbow trout (310 residues). However, the atypical primary structure
of the V
6 domain raised the question of its expression at the
protein level as part of a TCR. To address this question, we
investigated whether V
6-expressing T cells were involved in the
specific response against a viral infection, and thus subjected to Ag
positive selection. To avoid the effects of fish genetic diversity on T
cell responses, we used rainbow trout with identical genetic
background. Rainbow trout from clone EQ2 were infected with the 25-111
nonvirulent mutant of VHSV, and were given a second injection of the
same virus 27 days after primary infection. VB6 and CB2 primers were
used to amplify spleen cDNAs from trout sacrificed on days 42 and 48.
VB6-CB PCR products were subjected to runoff reaction with
J
-specific primers. The different segments were resolved on a
sequencing gel and analyzed with the Immunoscope software. Typical
Immunoscope results for all J
are shown in Fig. 4
. The V
6-J
3 profile was strongly
altered in one infected individual (infected trout 2), but it was not
significantly affected in the other infected fish. This bias most
probably corresponded to a private specific response against the virus.
In contrast, the V
6-J
8 profiles from the two infected fish were
consistently different from the control. These profiles suggested that
expansion of specific V
6-J
8 clones corresponded to a weak public
response against the virus.
|
6 T cells, we further analyzed V
6-J
3 and
V
6-J
8 profiles from infected trout 2. V
6-J
3 and V
6-J
8
rearrangements were amplified from spleen cDNA, and the PCR products
were cloned. Several clones were picked at random, and sequenced (Fig. 5
6-J
3 rearrangements, and corresponded to the size of the
expanded peak observed in the Immunoscope profile (3 aa). T cell
expansion was less evident for V
6-J
8, as only one junction (CDR3
8 aa) was found twice. Nonetheless, these results strongly suggested
that specific V
6-expressing T cells were selected in the context of
a secondary response to a virus. V
6 must therefore be expressed in a
TCR at the cell surface, and its structural peculiarities could
participate in the diversity of the available T cell repertoire.
Similar Immunoscope profiles were systematically observed with spliced
and unspliced transcripts for a given V
-J
combination. In
addition, the V
6-J
3-expanded junction CAANDPAF was found in both
spliced (1) and unspliced (3) transcripts.
These results therefore suggest that each V
6-expressing T cell
produced both spliced and unspliced transcripts, of which at least one
form is expressed at the cell surface and drives T cell selection.
|
| Discussion |
|---|
|
|
|---|
families of the rainbow trout during viral infection. To allow for
further insight into the diversity of the rainbow trout T cell
repertoire, we have explored in the present work the characteristics of
TCR
transcripts expressed in the spleen of naive fish. A rainbow
trout C
-anchored cDNA library was constructed using a 5' RACE
strategy, and a total of 47 V
-D
-J
-C
clones were identified.
A total of 32 coded for V
14 segments already described, and 15
showed undescribed V
sequences, which were grouped into 6 new V
families. This diversity was not surprising in cold blood vertebrates,
because 9 and 10 V
families were reported from the axolotl and from
the frog Xenopus, respectively (29, 30). Taken
together, our results are consistent with the current view that
vertebrate V
s are organized in many families, each composed of one
or several members (12). Rainbow trout V
13 families
were confirmed to contain several members (22 , and this
study). In addition, V
7 and V
8 contain at least three and two
different sequences, respectively. However, the diversity observed in
rainbow trout V
families could represent different genes or
different alleles. This issue could only be resolved with the complete
sequencing of the rainbow trout TCR
locus.
Although many fish V
sequences became recently available, we could
not find in other fish species any sequence that could be assigned to a
rainbow trout V
family. By comparison, members of the same V
family are often found in different species of mammals (14, 31). This difference could simply reflect the longer
evolutionary distance separating the branches of teleost species
compared with those in mammals. Similarly, it has been reported that
the genetic distance among V
families was greater in the axolotl
than in mammals (29).
Most of the key residues involved in the correct folding of V
domain, as defined by Chothia et al. (25), were globally
conserved in rainbow trout V
s. Therefore, rainbow trout V
sequences should comply with the general three-dimensional structure of
the TCR
described in mammals, which is probably mandatory for the
expression of a TCR at the cell membrane. This was further confirmed
through systematic Immunoscope studies, which de facto probe the
functionality of the TCR in T cell selection. Indeed, all the new
rainbow trout V
families showed typical bell-shaped CDR3 length
distribution, proving they were able to generate functional and diverse
rearrangements. Residues conserved in rainbow trout were mainly
localized in strands AA'BC and F, while the sequences of the strands
C'C''DE showed more variability in length and sequence. Indeed, the
length of the W34-C92
region, which contains the CDR2 region, varied from 52 to 63 aa,
compared with 5659 residues in humans.
We failed to identify key residues typical of CDR1 or CDR2 mammalian
canonical structures, as defined by Al-Lazikani et al.
(32). Although the residues at the positions defining the
CDR1 mammalian canonical structures were different in rainbow trout,
these residues were strikingly conserved among the 10 rainbow trout
V
families (Table IV
). On the
contrary, the positions defining the CDR2 canonical structures in
humans and mice were not conserved among rainbow trout V
families.
These observations suggest that in rainbow trout V
s, the CDR1 loop
is more structurally constrained than the CDR2.
|
- and
-chains with the MHC molecule. They revealed that the TCR contacts
the MHC molecule mainly through CDR1 and CDR2, while CDR3 is more
centered on the peptide (33, 34, 35). If rainbow trout V
comply with the same general structure, it is therefore likely that the
diversity of CDR2 will affect the interaction between the TCR
-chain
and the MHC molecules. Interestingly, rainbow trout MHC class I
molecules possess unique features. UAB (rainbow trout classical class
I) alleles are much more divergent among each other than in primates
(mean difference 23.8% between alleles, compared with 5.4% among
HLA-B) (17). In addition,
2-microglobulin genes are also highly diverse
in rainbow trout (36). Thus, the diversity of CDR2 length
provides an additional level of diversity to teleost T cell repertoire,
which probably corresponds to a higher variability of TCR/peptide/MHC
interactions.
Among rainbow trout V
families, V
6 was clearly divergent from
typical TCR V
sequences known through vertebrates. Concerning the
predicted properties of this V
domain, the CDR2 region was short,
highly charged, and hydrophilic. In fact, V
6 had not only the
shortest CDR2, but also the longest CDR1, suggesting that CDR1 and CDR2
length may be interdependent. Interestingly, in the shark
Heterodontus, the V
7 family has also the longest CDR1 (14
residues in C23-W34 instead
of 1213) and the shortest CDR2 (54 residues in
W34-C92). Unlike for the
other rainbow trout V
sequences, comparison of V
6 with databases
failed to detect high similarity (E value < 1e-08) with known V
domains of the Ig superfamily. The most similar sequences were not even
TCR V domains, but VH Ig domains. However, V
6
was expressed in typical V
-D
-J
-C
transcripts and rearranged
with various J
s, leading to a diverse repertoire of junctions. In
this context, it was interesting to note that NAR has a very short CDR2
region and is functionally expressed. In such V domains, a short CDR2
would connect the two
-sheets more like in Ig C1 domains.
Because rainbow trout V
6 had peculiar features, the question of the
expression of V
6 in a functional TCR was raised. We therefore
focused an Immunoscope analysis on this particular V
family in the
context of the T cell response against VHSV. As observed for the other
V
segments (22 for V
14, and data not shown for
V
5, V
710), this experiment identified several V
6 responses
against the virus. T cells expressing V
6 rearrangements have been
therefore subjected to Ag-driven amplification, indicating V
6 should
be expressed at the protein level. V
6 appeared as two forms of
transcripts with sequence characteristics indicative of alternative
splicing within the V domain. Approximately one-third (10 of 27 in
naive trout) of V
6-J
-C
transcripts lacked 35 residues
corresponding to strands C', C'', D, and to a part of the E strand. To
our knowledge, V
transcript with such characteristics has never been
described and may have no functional relevance. Because we never found
a modification of the Immunoscope CDR3 length profile restricted to the
short form of V
6 transcript, we have no evidence that the short form
of V
6 was expressed at the protein level. However, short forms of
transcripts due to alternative splicing within a V domain have been
already described for another gene of the Ig superfamily, NKP30
(37) (see Fig. 2
D). It is interesting to note
that the region lacking in NKP30 variant roughly corresponds to the
same region that was lacking in clone BN62, although it is shorter.
Furthermore, both NKP30 and V
6 have long CDR1 regions:
C23-W34 region of 16 and 15
residues, respectively. By comparison, this region has 12 of 13
residues in other rainbow trout V
, and 11 of 12 residues in human
V
sequences. It raised the question of the existence of a truncated
structure of Ig V domain, which the short forms of NKP30 and V
6 may
adopt. Intriguingly, the truncation may be compatible with the current
three-dimensional model of V
domain because the ends of the E and C
strands are in close proximity. However, it is probably not safe to use
the Ig V domain model to predict the structure of such truncated
sequences. Besides, there is no published evidence of the protein
expression of the NKP30 short form. We therefore favor the idea that
spliced V
6 transcripts are byproducts made in each
V
6+ T cell due to the presence of functional
splicing signal in the V
6 sequence.
Although V
6 is basically a TCR
segment, its primary structure
looks rather like a chimere of features from various types of receptors
from the Ig superfamily. The early evolution of Igs and TCRs is still
poorly known, but the description of segments with new features
suggests that the repertoire of Ag receptors, and the constraints
shaping their evolution, may be more complex than previously
believed.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Département de Biologie Cellulaire, Institut Cochin de Génétique Moléculaire, 22 rue Méchain, 75014 Paris, France. ![]()
3 Address correspondence and reprint requests to Dr. Abdenour Benmansour, Institut National de la Recherche Agronomique, Unité de Virologie et Immunologie Moléculaires, 78352 Jouy-en-Josas cedex, France. E-mail address: abdenour{at}jouy.inra.fr ![]()
4 Abbreviations used in this paper: CDR, complementarity-determining region; CB, C
-specific primer; NAR, nurse shark Ag receptor; VB, V
-specific primer; VHSV, viral hemorrhagic septicemia virus. ![]()
Received for publication July 25, 2002. Accepted for publication September 24, 2002.
| References |
|---|
|
|
|---|
chain in rainbow trout. C. R. Acad. Sci. Ser. III 317:765.[Medline]
,
,
, and
T cell antigen receptor genes arose early in vertebrate phylogeny. Immunity 6:1.[Medline]
chain cDNAs from Atlantic salmon (Salmo salar). Immunogenetics 45:9.[Medline]
and
genes. Mol. Immunol. 35:545.[Medline]
and
genes. Dev. Comp. Immunol. 25:117.[Medline]
-chain in a teleost fish. J. Immunol. 155:699.[Abstract]
-chain diversity (D
) and joining (J
) segments in the rainbow trout: presence of many repeated sequences. Mol. Immunol. 34:653.[Medline]
and
chain gene families. Immunol. Rev. 101:149.[Medline]
-chain genes. Immunogenetics 32:263.[Medline]
chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.
receptor. EMBO J. 7:3745.[Medline]
families in the Mexican axolotl. J. Immunol. 153:4539.[Abstract]
genes of Xenopus. Eur. J. Immunol. 27:763.[Medline]
-chain transcripts in a rabbit T-cell line: implications for allelic exclusion in T cells. Proc. Natl. Acad. Sci. USA 83:2190.
receptors. J. Mol. Biol. 295:979.[Medline]

T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.
2-microglobulin sequence diversity in individual rainbow trout. Proc. Natl. Acad. Sci. USA 93:2779.This article has been cited by other articles:
![]() |
D. Bernard, A. Six, L. Rigottier-Gois, S. Messiaen, S. Chilmonczyk, E. Quillet, P. Boudinot, and A. Benmansour Phenotypic and Functional Similarity of Gut Intraepithelial and Systemic T Cells in a Teleost Fish J. Immunol., April 1, 2006; 176(7): 3942 - 3949. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |