The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tolnay, M.
Right arrow Articles by Tsokos, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tolnay, M.
Right arrow Articles by Tsokos, G. C.
The Journal of Immunology, 2002, 169: 6236-6243.
Copyright © 2002 by The American Association of Immunologists

NF-{kappa}B Regulates the Expression of the Human Complement Receptor 2 Gene1

Mate Tolnay2,*,{dagger}, Lyudmila A. Vereshchagina* and George C. Tsokos*,{dagger}

* Department of Cellular Injury, Walter Reed Army Institute of Research, Silver Spring, MD 20910; and {dagger} Department of Medicine, Uniformed Services University of the Health Sciences, Bethesda, MD 20814


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CR2 is a key regulator of the B cell response to Ag. Here we show that NF-{kappa}B enhances the expression of the human CR2 gene. Promoter truncation, deletion, and mutagenesis studies indicated a functional role for a consensus NF-{kappa}B promoter element, as well as a heterogeneous nuclear ribonucleoprotein D element and an overlapping X box/E box. By supershift analysis, the first two elements bound NF-{kappa}B p50 and p65 and heterogeneous nuclear ribonucleoprotein RNP D, respectively. The X box/E box bound regulatory factor X5 and, surprisingly, NF-{kappa}B p50 and p65. Overexpression of NF-{kappa}B p50 enhanced the activity of the CR2 promoter in B cell lines and primary B cells, suggesting a direct role for NF-{kappa}B in regulating promoter activity. Importantly, mutation of the NF-{kappa}B element or the X box/E box rendered the promoter unresponsive to NF-{kappa}B p50. Using chromatin immunoprecipitation in live B cell lines and primary B cells, we found that NF-{kappa}B proteins p50, p65, and c-Rel bound to the genomic promoter at two locations that overlap with the consensus NF-{kappa}B element or the X box/E box. Finally, stimuli that activate NF-{kappa}B enhanced the activity of the CR2 promoter, and LPS rapidly increased the number of CR2 proteins on the surface of primary B cells. We propose that the NF-{kappa}B signaling pathway enhances the expression of the CR2 gene, as a result of NF-{kappa}B proteins binding to two CR2 promoter elements. Thus, at the onset of an infection, LPS could sensitize the B cell to Ag by enhancing the level of CR2-costimulatory molecules on the cell surface.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Complement receptor 2 (CR2, CD21) is the receptor for the C3d, C3dg, and iC3b fragments of C3, as well as for CD23 (1) and IFN-{alpha} (2). In addition, EBV binds to CR2 through envelop protein gp350/220 and infects human B cells (3, 4). CR2 is present in the B cell membrane in a functional complex with CD19 and CD81.

CR2 is expressed primarily on B cells and follicular dendritic cells, and also on a subset of T cells, epithelial cells, and thymocytes (5, 6, 7, 8). During B lymphocyte development CR2 is present on mature B cells but not on early (pre-B cell) or late (plasma cell) developmental stages (9), indicating that its expression is under tight control. The functional role of CR2 on the B cell offers an explanation for the need of controlled expression. CR2 on B cells serves as a coreceptor for the Ag receptor (reviewed in Ref. 10 , and was shown to amplify the B cell response to Ag up to 10,000-fold (11). There are indications that the level of CR2 expression influences the capacity of B cells to respond to antigenic stimuli (12, 13, 14, 15). Thus, the immune system, to balance the opposing requirements of robust Ab response and self tolerance, must keep the level of CR2 on B cells within an optimal range.

We showed that the activity of the CR2 promoter is induced in IM-9 B cells by the protein kinase A- and protein kinase C-signaling pathways, and by anti-CD40 Ab and IL-4 (16). The transcription factors that were subsequently identified to play a role in this induced expression include AP-1, CREB, and an X box/E box-binding protein. In addition, we found the protein kinase A and protein kinase C-responsive heterogeneous nuclear ribonucleoprotein D (hnRNP D)3 to bind specifically a novel element in the CR2 promoter (17, 18, 19). A silencing element located in the first intron was shown to regulate cell type-specific expression of CR2 in both humans and mice (20, 21). A cell type-specific repressor element that binds E2a proteins was also described within the promoter region (22).

NF-{kappa}B is involved in the regulation of numerous genes activated during inflammatory and immune responses (reviewed in Refs. 23 and 24). NF-{kappa}B is activated by LPS, dsRNA, and viruses, as well as by IL-1, TNF-{alpha}, reactive oxygen intermediates, and UV light. Promoter elements that bind NF-{kappa}B were identified in genes of many cytokines and adhesion molecules, including IL-1, IL-2, IL2-R, IL-6, IL-8, TNF-{alpha}, IFN-{beta}, VCAM-1, endothelial leukocyte adhesion molecule-1, and ICAM-1. In addition, NF-{kappa}B regulates the expression of several acute phase response proteins, including complement factor B. The NF-{kappa}B/rel family of transcription factors contains p65/RelA, RelB, c-Rel, p50, and p52, which can interact with each other. NF-{kappa}B binds to DNA as a dimer most frequently composed of p65 and p50.

In this study, we investigated the promoter requirements of CR2 expression in B cell lines and primary B cells. NF-{kappa}B regulated the activity of the CR2 promoter. NF-{kappa}B proteins bound to CR2 promoter elements in vitro, and NF-{kappa}B targeted the genomic CR2 promoter in live B cells in vivo. LPS enhanced the number of CR2 proteins on the surface of primary B cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell cultures

Raji cells and CA46 cells were obtained from the American Type Culture Collection (Manassas, VA). Peripheral blood B cells were obtained from normal donors by magnetic separation using a negative selection strategy, as suggested by the manufacturer (Miltenyi Biotec, Bergisch Gladbach, Germany). We routinely obtained cell populations with 95% or more primary B cells, as assessed by staining for CD19, followed by flow cytometry. All cells were cultured in RPMI 1640 (Life Technologies, Gaithersburg, MD) containing 10% FBS (Life Technologies), 2 µM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 25 mM HEPES.

Truncated and mutated CR2 promoter constructs

The SP65-CAT plasmid containing the human CR2 promoter from -1252 to +75 was the gift of Dr. M. Holers, Denver, CO. Truncated CR2 promoter constructs were generated by PCR, as described previously (16). PCR-based mutagenesis was used with primers containing three to seven mutated nucleotides to introduce mutations into potential transcription factor binding sites (Table IGo), as described (16). The sequences of all constructs were confirmed by DNA sequence analysis.


View this table:
[in this window]
[in a new window]
 
Table 1. List of oligonucleotides used in EMSA and mutations introduced into CAT reporter constructsa

 
DNA transfection and reporter gene analysis

For B cell lines, plasmid DNA was introduced into cells by the DEAE-dextran method (25). Reporter plasmid (6 µg) and p50 or p65 expression plasmid (10 µg; gift of Dr. J. Hiscott, Montreal, Canada (26)) was used per 107 cells. The integrity of the p50 and p65 expression vectors were verified after transfection by Western blotting (data not shown). After transfection, 5 x 106 cells per sample in 5 ml medium were cultured for 44–48 h; then freeze-thaw lysates were assayed for chloramphenicol acetyltransferase (CAT) activity by TLC, as described (27). Data were analyzed with a Molecular Imager FX System and Quantity One software (Bio-Rad Laboratories, Hercules, CA).

Unstimulated primary human B cells were transfected immediately after purification, using the Human B Cell Nucleofector Kit and Nucleofector of Amaxa Biosystems (Cologne, Germany), as suggested by the manufacturer. For transfection, we used 8 µg reporter plasmid per 5 x 106 cells, or 5 µg reporter plasmid and 3 µg p50 or p65 expression plasmid per 5 x 106 cells, in a total volume of 100 µl. After transfection, 2.5 x 106 cells per sample in 2 ml medium were stimulated with 10 µg/ml LPS (Sigma-Aldrich, St. Louis, MO; from Escherichia coli 0111:B4) or 100 ng/ml PMA (Sigma-Aldrich), then cultured for 15 h, and assayed for CAT activity.

EMSA

Nuclear proteins were obtained as described (28). Double-stranded oligonucleotides (Table IGo) were end-labeled with [{gamma}-32P]ATP, purified on Centri-Sep columns (Princeton Separations, Adelphia, NJ), and used as probes in EMSA.

EMSA were performed using 4 µg of nuclear protein and 20 fmol of labeled oligonucleotide per sample, as described (17). In supershift experiments, the following Ab (3 µg per sample) were used: anti-p50, anti-p65, anti-c-Rel, anti-RelB, anti-p52, anti-Jun, and anti-ATF-1 (all from Santa Cruz Biotechnology, Santa Cruz, CA); anti-regulatory factor X5 (RFX5) (Rockland, Gilbertsville, PA); and anti-hnRNP D/AUF1 (Upstate Biotechnology, Lake Placid, NY). Ab were added to nuclear extracts just before the addition of the labeled oligonucleotide and then incubated for 30–40 min at room temperature.

Chromatin immunoprecipitation (ChIP)

Soluble chromatin was prepared as described (29), with several modifications. Live cells were fixed with 1% formaldehyde at 37°C for 10 min. The fixed cells were washed twice with cold PBS and then lysed in 50 mM Tris (pH 8.1), 10 mM EDTA, 1% SDS, 1 mM PMSF, 0.5 µM leupeptin, and 1 µg/ml aprotinin for 10 min on ice. The samples were subsequently sonicated on ice for 5 x 10 s using continuous output and setting 4. The sonicated samples were centrifuged at 13,000 rpm for 10 min, and the supernatant was diluted 10-fold in dilution buffer (167 mM NaCl, 16.7 mM Tris (pH 8.1), 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 1 mM PMSF, 1 µg/ml aprotinin, and 0.5 µM leupeptin) and filtered through a 45-µm pore size filter to remove remaining aggregates. Extracts obtained from 5 x 106 cells per immunoprecipitation reaction was precleared for 0.5 h with Protein A/G PLUS-agarose that had been incubated overnight with 0.1 mg/ml sonicated salmon sperm DNA. The precleared samples were immunoprecipitated with 1 µg Ab at 4°C overnight; then the immune complexes were recovered by adding 40 µl of protein A/G PLUS-agarose, which had been treated with sonicated salmon sperm DNA, for 1 h. Precipitates were subsequently washed five times by rotating the samples for 6 min each with wash buffer 1 (150 mM NaCl, 20 mM Tris (pH 8.1), 2 mM EDTA, 0.1% SDS, and 1% Triton X-100), once for 6 min with wash buffer 2 (250 mM LiCl, 10 mM Tris (pH 8.0), 1 mM EDTA, 0.5% Nonidet P-40, and 0.5% sodium deoxycholate), and twice for 6 min with wash buffer 3 (10 mM Tris (pH 8.0), 1 mM EDTA). The samples were subsequently digested with 0.5 mg/ml proteinase K in 100 µl wash buffer 3 with 0.5% SDS at 37°C for 4 h. The cross-links were reversed by heating the samples at 65°C overnight. The samples were briefly centrifuged, and the DNA was recovered from the supernatant by phenol-chloroform extraction and ethanol precipitation. The purified DNA was run on 2% agarose gel, the 150- to 350-bp fraction was excised, and the DNA was recovered, as suggested for ChIP assay (30). One-fifth (10 µl) of the recovered DNA was used per PCR. The following primers were used in PCR: TCCCAGTTAACCCTTCAGAT and TGTCCTCAGCATTTTGGTATT to amplify the -1198/-944 segment of the CR2 promoter; GAGAAAGAATAGAGAATGGTAAAG and CTCCCAGTTTGAAAAAGCAGT to amplify the -596/-399 segment; and CCGCAACGAGGGGTGAGTCTGA and TCTGGGAGGGCAAGGCTGGAG to amplify the -148/+71 segment.

Flow cytometry

Freshly purified primary B cells (0.17 x 106 cells in 0.3 ml medium per sample) were stimulated with 10 µg/ml LPS for 2.5 h or left unstimulated. Cells were stained with an anti-CD21-PE Ab (BD Biosciences, San Jose, CA) using standard protocols, and analyzed by flow cytometry.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The -57/+75 segment of the CR2 promoter is active in Raji B cells

To determine which segment(s) of the CR2 promoter are active in unstimulated B cells, we generated a series of sequentially truncated CR2 promoter constructs that drive CAT reporter genes. Raji B cells, a mature B cell line that highly expresses CR2 on its surface, were transfected with the reporter constructs, and the CAT activities were determined 2 days later. We found that truncation of sequences from -1252 to -57 did not have a significant effect on promoter activity (Fig. 1GoA). Thus, the -57/+75 construct displayed activity similar to that of the -1252/+75 full promoter. These findings clearly suggest that critical positive promoter elements are present in the -57/+75 region, which contains potential the CREB/AP-1 half-site, X box, and E box. These findings do not exclude the possibility that promoter elements upstream of -57 play a role in regulating CR2 promoter activity. The truncation approach may not, for example, reveal pairs of activator and repressor elements that cancel out each other and were removed in one truncation step.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 1. Deletion and mutation analysis of the human CR2 promoter in functional reporter gene assays reveal DNA motifs that are important for activity. Raji B cells were transiently transfected with CAT reporter plasmids driven by truncated (A), internally deleted (B), or mutagenized (C) (Table IGo) CR2 promoter constructs, as indicated. In all numbering, the transcription initiation site is considered +1. Cells were assayed for CAT activity 44–48 h after transfection. A not-to-scale draft of the CR2 promoter denotes predicted (42 ) and known (17 ) transcription factor-binding sites; all CREB/AP-1 sites are half-sites. Values represent percent of CAT activity, considering the activity of the empty vector zero and the activity of the full length wild-type promoter 100%. Means ± SEM are shown (n = 4–8). All samples are compared with the full length wild-type CR2 promoter. *, p < 0.05, and **, p < 0.01, using an one-way ANOVA.

 
The -951/-65 segment of the CR2 promoter is involved in sustaining activity

To extend the above analysis and determine whether regulatory elements that participate in sustaining the activity of the CR2 promoter lie outside the -57/+75 region, but were not identified by truncation experiments, we internally deleted nucleotides -951 to -65 from the full promoter (construct {Delta}-951/-65). We found that removal of this nearly 900-nucleotide segment greatly decreased the promoter activity down to 11% (Fig. 1GoB). This suggests that promoter elements within the -951/-65 region affect promoter activity.

Overall, the data that we present in Fig. 1Go, A and B, indicate the complexity of the transcriptional regulation of the CR2 promoter. A possible explanation that could resolve the apparent contradiction between the results of the truncation and internal deletion experiments is that the internal deletion perturbed the functional connections between transcription factors that bind inside and outside the removed promoter segment. Alternatively, the positioning of upstream (-1252/-952) promoter elements next to TATA box proximal elements may have produced novel functional protein connections that resulted in reduced promoter activity.

Identification of promoter elements that regulate the expression of the CR2 promoter

To identify distinct regulatory elements in the CR2 promoter, we mutagenized several predicted transcription factor-binding sites. Within the -951/-65 promoter region, mutation of a consensus NF-{kappa}B site (Table IGo, mutation 1) reduced promoter activity to ~50% (Fig. 1GoC), suggesting that transcription factor(s) that bind to this promoter element increase promoter activity. Mutation of an hnRNP D site (17) (mutation 2) resulted in ~2-fold increase in promoter activity, implying that hnRNP D binding to this site reduces promoter activity. Mutation of a consensus AP-2 site (mutation 3) or mutation of all three elements in the same construct (mutation 4) did not affect CR2 promoter activity. The latter observation could be explained by the opposing effects of the NF-{kappa}B and hnRNP D sites on CR2 promoter activity.

Within the -57/+75 region, mutation of a predicted CREB/AP-1 half-site (one-half of the palindromic octamer core motif) (mutation 5) had no effect on promoter activity (Fig. 1GoC). In contrast, mutation of the predicted overlapping X box and E box (mutation 6) reduced promoter activity by 72%. To assess the possible functional interaction of the CREB/AP-1 and X box/E box regulatory elements, we mutated both elements simultaneously (mutation 7). This double mutation did not reduce further the activity of the CR2 promoter over that already observed with mutation 6, indicating that the CREB/AP-1 half-site does not play a role in regulating basal CR2 promoter activity in Raji cells.

Identification of transcription factors that bind to functionally relevant DNA sites along the CR2 promoter

To identify proteins that bind to regulatory elements that were found by mutagenesis experiments to be functionally important, we performed shift assays. For each binding site, we performed experiments using either wild-type or mutated synthetic oligonucleotides defined by the CR2 promoter (Table IGo) and nuclear proteins extracted from Raji cells or primary human B cells. The mutations were the same as those used in the reporter experiments. Abs were also used in EMSA to detect the presence of candidate proteins.

Incubation of the -531/-509 oligonucleotide containing the predicted NF-{kappa}B site produced three or two shifted bands using Raji or primary B cell nuclear extracts, respectively (Fig. 2Go, A and B). Excess unlabeled nonmutated oligonucleotide competed all protein-DNA complexes efficiently, indicating that all proteins bind to the -531/-509 oligonucleotide specifically. By using Raji cell nuclear extracts, we found that mutation of five nucleotides, which are part of the consensus NF-{kappa}B motif, abolished the formation of bands 1 and 2 but allowed formation of band 3, indicating that the mutated nucleotides affected interaction with proteins present in bands 1 and 2 but not in band 3 (Fig. 2GoA, right sample). Both NF-{kappa}B p50 and p65 Ab strongly interfered with the formation of band 2, using nuclear extracts of both cell types, indicating that it is composed of the p50 and p65 subunits of NF-{kappa}B. We have not yet identified the proteins present in bands 1 and 3. c-Rel, Rel B, or p52-specific Ab had no effect on any of the protein-DNA complexes, indicating that these additional NF-{kappa}B family members do not bind.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. EMSA analysis of functionally important promoter elements demonstrates the interaction of several transcription factors. Nuclear extracts of Raji cells (A, C, E) or primary human B cells (B, D, F) were incubated with labeled wild-type or mutated (Mut) oligonucleotides, as indicated above each panel (see also Table IGo), and analyzed by EMSA. In competition studies, 10-, 50-, or 100-fold molar excesses of unlabeled (cold) nonmutated oligonucleotides (oligo) were included in the reaction. In supershift assays, Abs specific for NF-{kappa}B p50, p65, c-Rel, RelB, p52, Jun, ATF1, hnRNP D, or RFX5 were included in the reaction. Arrows indicate the positions of the shifted and supershifted (ss) bands.

 
Incubation of the -495/-468 oligonucleotide containing the hnRNP D site produced one shifted band using both Raji and primary B cell nuclear extracts (Fig. 2Go, C and D). Anti-hnRNP D Ab decreased the intensity of the shifted band, indicating that hnRNP D binds to the -495/-468 oligonucleotide.

Incubation of the -54/-32 oligonucleotide produced three or one shifted bands using Raji or primary B cell nuclear extracts, respectively (Fig. 2Go, E and F). By using Raji cell nuclear extracts, we found that mutation of five central nucleotides abolished the formation of bands 1 and 2, but allowed formation of band 3, indicating that the mutated nucleotides only affect interaction with proteins present in bands 1 and 2. Nevertheless, we found by using excess unlabeled nonmutated oligonucleotide that all protein-DNA complexes were specific. Addition of an Ab specific for RFX5, which was shown to bind X boxes in promoters of MHC class II genes (31), diminished the intensity of band 2 (Fig. 2GoE), indicating that RFX5 is present in the complex. Jun or ATF1 Ab, which we used as controls, did not alter the appearance of any of the bands. Unexpectedly, using nuclear extracts of both Raji and primary B cells, NF-{kappa}B p65 Ab interfered with the formation of band 1, whereas using Raji cell extracts p50 Ab resulted in disappearance of band 2, indicating that both the p50 and p65 subunits of NF-{kappa}B can bind to the -54/-32 oligonucleotide, in distinct protein complexes. Because the -54/-32 oligonucleotide does not define a recognized NF-{kappa}B-like site we speculate that NF-{kappa}B components may bind to this oligonucleotide indirectly through another DNA-binding protein.

Finally, the -64/-45 oligonucleotide containing a potential CREB/AP-1 half-site produced no shifted complexes in EMSA (data not shown), supporting the results of the reporter gene experiments where we found that mutagenesis of the CREB/AP-1 site did not alter promoter activity.

Overexpression of NF-{kappa}B p50 increases the transcriptional activity of the CR2 promoter

The mutagenesis and EMSA experiments suggested that NF-{kappa}B could play a role in regulating the activity of the CR2 promoter. To examine the functional role of NF-{kappa}B proteins in the transcriptional regulation of CR2 expression, we overexpressed p50 and p65 in Raji B cells and monitored the activity of the CR2 promoter that was cotransfected. Overexpression of p50 increased transcriptional activity of the wild-type CR2 promoter by ~2-fold, whereas p65 increased it by ~25% (Fig. 3GoA). When the consensus NF-{kappa}B element was mutated in the promoter (mutation 1), overexpression of p50 or p65 failed to induce promoter activity. Similarly, mutation of the X box/E box (mutation 6), which also interacted with NF-{kappa}B in EMSA, rendered the CR2 promoter nonresponsive to p50 and p65. These results suggest that one or both of the NF-{kappa}B interaction sites are required for the promoter to respond to p50 and p65. However, both promoter sites that we mutagenized also interacted with proteins other than NF-{kappa}B in EMSA (Fig. 2Go). Thus, it is possible that loss of binding of non-NF-{kappa}B proteins contribute to the observed disappearance of NF-{kappa}B responsiveness in the mutagenized promoter constructs.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. NF-{kappa}B regulates the activity of the human CR2 promoter. Raji cells (A), CA46 cells (B), or primary human B cells (C) were transiently cotransfected with CAT reporter plasmids driven by wild-type (WT) or mutagenized (MUT) (see Table IGo) CR2 promoter, and NF-{kappa}B p50 or p65 expression plasmids or a control (abbreviated as C) plasmid. Cells were assayed for CAT activity 44–48 (A and B) or 15 (C) h after transfection. Values represent percentage of CAT activity, considering the activity of the empty vector zero and the activity of the wild-type CR2 promoter 100%. Means ± SEM are shown (n = 3–10). p50- and p65-transfected samples are compared with the control plasmid-transfected sample within groups transfected with the same reporter plasmid. *, p < 0.05, and **, p < 0.01, using ANOVA.

 
We also overexpressed p50 and p65 in the EBNA2-negative mature B cell line CA46. We found that overexpression of p50 increased the transcriptional activity of the wild-type CR2 promoter ~2-fold (Fig. 3GoB), similarly to what we found in Raji cells. When the consensus NF-{kappa}B element was mutated in the promoter, p50 failed to induce promoter activity. These findings strongly argue for a direct role of p50 in regulating CR2 promoter activity through the consensus NF-{kappa}B element. Overexpression of p65 inhibited the activity of the wild-type CR2 promoter in CA46 cells (Fig. 3GoB). The inhibition by p65 was not dependent on the consensus NF-{kappa}B element, because the CR2 promoter with the consensus NF-{kappa}B site mutated was still subject to inhibition. Thus, in CA46 cells p50 and p65 have opposing effects on CR2 promoter activity, and only p50 seems to operate through the consensus NF-{kappa}B element.

We overexpressed p50 and p65 in resting primary B cells using a novel transfection protocol, to establish the role of NF-{kappa}B proteins in the regulation of the CR2 promoter activity in primary B cells. Overexpression of p50 enhanced the activity of the cotransfected wild-type CR2 promoter by ~3.5-fold, whereas p65 increased it by 60% (Fig. 3GoC).

ChIP assays reveal that NF-{kappa}B targets the genomic CR2 promoter in live Raji and primary B cells

To study whether NF-{kappa}B targeted the genomic CR2 promoter in vivo we performed ChIP assays (29). In addition to Raji cells, we studied primary human B cells. Live Raji or primary B cells were fixed with formaldehyde to produce covalent bonds between proteins and DNA that are in close proximity; then the cells were lysed, and the DNA was fragmented by sonication. The soluble, fragmented chromatin was immunoprecipitated with Abs specific to NF-{kappa}B p50, p65, or c-Rel under stringent conditions. As a control, we used an actin-specific Ab or no Ab. The cross-links were reversed, and the precipitated DNA recovered. We used only the 150- to 350-bp fractions of the recovered DNA in PCR to ensure that the desired resolution power of 350 bp was reached. We used three PCR primer pairs to test the presence of the corresponding genomic DNA fragments in the same immunoprecipitated samples. PCR primer pairs B and C (as marked in Fig. 4Go) were designed to amplify segments of the promoter that were suspected to bind NF-{kappa}B. PCR primer pair A was chosen as an internal control because NF-{kappa}B was not expected to bind there. The location of the PCR primers and the 350-bp resolution were planned so that any given immunoprecipitated DNA fragment could be amplified by only one of the three primer pairs.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. NF-{kappa}B targets the genomic CR2 promoter in live B cells. Top, schematic representation of the human CR2 gene promoter region from -1250 to +75, relative to the transcription start site. Suspected NF-{kappa}B interaction sites are marked by objects. The positions of primer sets A, B, and C are indicated by inverted arrows. Raji B cells (A) or primary human B cells (B) were cross-linked with 1% formaldehyde. Soluble, fragmented chromatin was immunoprecipitated with Abs, as indicated above the samples. Specifically, the cells were lysed, and the DNA was fragmented by sonication. The lysates (from 5 x 106 cells per immunoprecipitation) were immunoprecipitated with 1 µg of Ab specific to NF-{kappa}B p50, p65, or c-Rel or to actin. DNA was purified then size fractionated on agarose gel. DNA 150–350 bp long were cut out from the gel and recovered, and one-fifth of the sample was used in each PCR as template. The input contained fragmented DNA from prior immunoprecipitation reactions. All three PCR produced a single amplified product with the expected size (data not shown).

 
Using Raji cells, we found that Abs specific for both NF-{kappa}B p50 and p65 efficiently immunoprecipitated region B of the CR2 promoter, which covers the -531/-509 oligonucleotide containing the consensus NF-{kappa}B site, providing strong support for the binding of these proteins in vivo. The same Abs immunoprecipitated region C of the promoter, albeit less efficiently. It is unlikely that region C was amplified as a result of NF-{kappa}B binding around region B, because that would require the presence of DNA fragments that are at least 470 bp long. The finding that region A was not amplified from the same samples also argues against a potential contamination of the PCR with longer DNA fragments. The results of the ChIP assays strongly validate our EMSA data and greatly extend those by showing that the genomic CR2 promoter is targeted by NF-{kappa}B p50 and p65 in vivo.

Using primary B cells, we found that region B of the CR2 promoter was precipitated by Ab specific for p65 (Fig. 4GoB). Ab specific to c-Rel, but not p50, also precipitated region B, suggesting that in primary B cells c-Rel, rather than p50, targets this segment of the CR2 promoter, in conjunction with p65. Region C of the promoter was not precipitated with any of the NF-{kappa}B Abs that we used, indicating that in primary B cells this promoter region is not targeted by NF-{kappa}B, or at least not in uninduced cells.

Activators of NF-{kappa}B enhance CR2 promoter activity and increase the number of the CR2 proteins on the surface of primary B cells

If NF-{kappa}B regulates the CR2 promoter, then stimuli that activate NF-{kappa}B should affect the promoter activity and CR2 gene expression. First, we monitored changes in CR2 promoter activity after stimulation of cells with a known NF-{kappa}B-inducing drug, PMA, and an established physiological inducer, LPS. We transfected resting primary B cells with the wild-type CR2 promoter using a novel transfection protocol (see Materials and Methods for details) that delivers the plasmid directly into the nucleus, stimulated the cells with PMA or LPS, and determined CAT activities 15 h later. This protocol resulted in transfection of ~20% of B cells, as estimated by using a plasmid encoding green fluorescence protein (data not shown). We found that PMA enhanced CR2 promoter activity by ~3-fold, whereas LPS enhanced it by 50% (Fig. 5GoA). The signal intensities that we obtained in CAT reporter assays using primary B cells were quite strong, as illustrated by a representative experiment shown on top of Fig. 5GoA. Next, we tested the effect of LPS stimulation of B cells on the expression of the endogenous CR2 gene. We detected 40–50% more CR2 (mean fluorescence intensity) on the surface of primary B cells 2.5 h after stimulation with LPS (Fig. 5GoB). This modest but reproducible increase in CR2 expression returned to baseline by 3.5 h (data not shown), indicating a rapid and transient modulation of cell surface CR2 protein by LPS.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 5. Activators of NF-{kappa}B stimulate CR2 promoter activity and CR2 surface protein expression. A, Primary human B cells were transiently transfected with CAT reporter plasmid driven by the wild-type CR2 promoter, or an empty vector and then stimulated with PMA or LPS, as indicated. After 15 h, cells were assayed for CAT activity. Top, radioactive image of a representative experiment with duplicate samples; bottom, relative CAT activities, considering the activity of the unstimulated CR2 promoter-transfected sample 1. Values are means ± SEM. The stimulated samples are compared with the unstimulated sample. *, p < 0.05, using ANOVA. B, Primary human B cells were stimulated with LPS for 2.5 h or left untreated and then stained with anti-CD21-PE Ab and analyzed by flow cytometry. A control sample was stained with isotypic control Ab (dotted line). The results of a representative experiment is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we found NF-{kappa}B to regulate the activity of the CR2 promoter and gene in human B cells. Stimuli that activate NF-{kappa}B, as well as forced expression of NF-{kappa}B p50, enhanced the activity of the CR2 promoter in vivo. We identified a consensus NF-{kappa}B site 520 nucleotides upstream of the transcriptional initiation site by promoter mutagenesis, EMSA, and in vivo ChIP analysis. In addition, we found evidence of a nonconventional, TATA-proximal NF-{kappa}B site. Significantly, LPS, a physiological inducer of NF-{kappa}B, enhanced the number of CR2 molecules on the surface of primary B cells.

Our initial approach to find functionally active CR2 promoter segments in Raji B cells was to gradually truncate the promoter from the 5' end. We found that the -57/+75 segment of the promoter was as active as the full promoter, suggesting that strong transcriptional activators bind there. Indeed, promoter mutagenesis and EMSA studies supported the presence of an X box/E box at -43, which also interacted with NF-{kappa}B and yet unidentified protein(s). We have found previously that the same X box/E box is important for the cAMP and PMA-induced activity of the CR2 promoter in IM-9 B cells (16). A recent study, focusing on the -315/+75 segment of the CR2 promoter in Raji cells, has also identified the -43 E box as a strong positive regulator of CR2 expression (32). The cell type-specific expression of CR2 was shown to depend on E2A proteins binding to another E box at -55 (22). Thus, several lines of evidences now indicate the involvement of E box-binding proteins (reviewed in Ref. 33) in regulating the CR2 promoter. Importantly, deletion of nearly 900 nucleotides between -951 and -65 resulted in 10-fold decreased promoter activity, indicating the existence of additional regulatory promoter elements. In this 900-nucleotide promoter region, we identified functional NF-{kappa}B and hnRNP D sites, 40 nucleotides from each other. Mutation of the NF-{kappa}B site reduced, whereas mutation of the hnRNP D site increased promoter activity 2-fold, indicating that the former is an activator, and the latter is a repressor element. The opposing functional role of these two promoter sites also explains that the likely reason they were not identified by promoter truncation is that they were removed in one truncation step. hnRNP D was shown to contain a trans-activator domain (34) but may function in Raji cells as a repressor, similarly to a number of transcription factors that can function as activators or repressors, depending on promoter context and cell type (35). We showed by EMSA using both Raji and primary B cell nuclear extracts that p50 and p65, as well as unidentified protein(s) bind to the NF-{kappa}B site, whereas hnRNP D binds to the hnRNP D site.

Next, we studied in detail the functional importance of NF-{kappa}B in regulating CR2 promoter activity. Overexpression of p50 increased activity of the CR2 promoter 2-fold in Raji and CA46 B cells and 3.5-fold in primary B cells. Overexpression of p65 in primary B cells and Raji cells resulted in moderately increased promoter activity, whereas in CA46 cells p65 had an inhibitory effect. These findings strongly suggest that NF-{kappa}B p50 enhances the activity of the CR2 promoter. The functional role of p65 is less clear and may depend on cell type-specific factors, such as expression levels of the different NF-{kappa}B proteins. Although p50 homodimers usually suppress gene activation, they do activate a number of promoters (36, 37, 38, 39, 40). p50 was shown to provide strong transcriptional activation in vitro and in vivo when adopting an active conformation induced by certain DNA motifs (36). Mutation of the consensus NF-{kappa}B site at -520, or that of the X box/E box at -43, rendered the CR2 promoter unresponsive to p50 overexpression in B cell lines, arguing for a direct role of NF-{kappa}B to regulate CR2 promoter activity through these sites. The finding that mutation of either of these sites resulted in loss of NF-{kappa}B responsiveness could point to a functional cooperation between the two sites and the proteins that bind to them. However, because neither the mutation of the -520 NF-{kappa}B site nor that of the X box/E box affected NF-{kappa}B binding selectively in EMSA, we cannot definitively conclude that the drop in promoter activity in response to these mutations is due to loss of NF-{kappa}B binding alone. However, it is likely that NF-{kappa}B is critically involved, because primarily NF-{kappa}B proteins bound to these sites in EMSA.

We performed ChIP experiments, both in Raji B cells and primary B cells, to test whether NF-{kappa}B targeted the genomic CR2 promoter in vivo. No study has thus far addressed the binding of transcription factors to the genomic CR2 promoter. Because transient transfection assays and EMSA studies can generate data that do not reflect the situation at the genomic promoter, the ChIP experiments are important to extend and validate the findings that were obtained by these methods. We detected by ChIP in Raji cells both p50 and p65 binding to the CR2 promoter region that included the -520 NF-{kappa}B site. p65, but not p50, targeted the same promoter region in primary B cells, in addition to c-Rel. These results strongly support a role for NF-{kappa}B in binding to the -520 site in the genomic CR2 promoter and regulating its activity. The relative contribution of the different NF-{kappa}B family members in this process is less clear. The ChIP studies indicate the involvement of p65, together with p50 in Raji cells and c-Rel in primary B cells. The overexpression experiments in both B cell lines and primary B cells, however, suggest the functional importance of p50. Because we performed the EMSA and ChIP studies using nonstimulated cells, it is possible that dominantly p65 binds to the CR2 promoter in nonstimulated cells, and p50 binds and activates the promoter upon stimulation of the cells. In addition, we detected by ChIP in Raji cells the binding of p50 and p65 to the X box/E box at -43, that was surprising, given that this site does not contain an apparent NF-{kappa}B motif. It is possible that this site, which is located in a very active promoter region next to the TATA box, interacts with NF-{kappa}B indirectly through another protein. However, because in EMSA p50 and/or p65 interacted with a 23-bp-long synthetic oligonucleotide containing the X box/E box but not the TATA box, direct binding of NF-{kappa}B components to a nonconventional binding site cannot be excluded.

We found that stimuli that activate NF-{kappa}B, such as PMA and LPS, enhanced the activity of the CR2 promoter in primary B cells. Most importantly, LPS significantly enhanced the number of CR2 proteins on the surface of primary B cells 2.5 h after stimulation. There are indications that the relatively modest (40–50%) increase in CR2 expression by LPS can significantly affect B cell Ag receptor signaling and activation. In vitro, human B cells with high levels of CR2 expression respond better to antigenic stimulus (12). B cells from knockout mice heterozygous for the inactivated CR2 locus express 50% of the normal levels of CR2, and respond to Ag less efficiently than B cells from wild-type animals (15). CD19, the signaling subunit of the CR2/CD19/CD81 membrane complex, was found to modify AgR signaling, with as low as 10–25% increases in CD19 protein levels resulting in substantial changes in the functional capacity of B cells (41). The extremely rapid and transient increase in CR2 protein levels by LPS indicates tight regulation that would allow enhanced B cell AgR signaling only within a narrow time window, ensuring a localized response.

This is the first study that shows a role for NF-{kappa}B in regulating the activity of the CR2 gene. The possibility that NF-{kappa}B is involved in fine-tuning the level of CR2 on the B cell surface is significant. CR2 functions as a critical regulator of B cell response to Ag (10). NF-{kappa}B serves as a central linker between infection and the resulting immune response, by inducing proinflammatory genes (23, 24). Thus, at the onset of an infection, the NF-{kappa}B pathway could sensitize the B cell to Ag by enhancing the level of CR2 available to interact with Ag-C3d complexes. In addition, because binding of C3dg or the EBV protein gp350 to CR2 were shown to induce NF-{kappa}B (40), an amplification mechanism may exist in which C3dg binding to CR2 induces NF-{kappa}B, which in turn enhances CR2 expression. This study lends support to the idea that the inflammatory environment in which the immune response to infections evolves, and in which NF-{kappa}B is activated, could facilitate B cell activation by increasing the number of CR2-costimulatory molecules on the B cell surface, as a result of NF-{kappa}B acting on the CR2 promoter.


    Acknowledgments
 
We thank Dr. John Hiscott for the p50 and p65 expression plasmids and Dr. Michael Holers for the CR2 reporter plasmid. We thank Dr. Krishnan Sandeep for his help with the flow cytometer.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant RO1-AI42782. Back

2 Address correspondence and reprint requests to Dr. Mate Tolnay, Department of Cellular Injury, Walter Reed Army Institute of Research, 503 Robert Grant Avenue, Building 503, Room 1A32, Silver Spring, MD 20910-7500. E-mail address: mtolnay{at}hotmail.com Back

3 Abbreviations used in this paper: hnRNP D, heterogeneous nuclear ribonucleoprotein D; CAT, chloramphenicol acetyltransferase; ChIP, chromatin immunoprecipitation; RFX5, regulatory factor X5. Back

Received for publication June 4, 2002. Accepted for publication September 20, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Aubry, J. P., S. Pochon, P. Graber, K. U. Jansen, J. Y. Bonnefoy. 1992. CD21 is a ligand for CD23 and regulates IgE production. Nature 358:505.[Medline]
  2. Delcayre, A. X., F. Salas, S. Mathur, K. Kovats, M. Lotz, W. Lernhardt. 1991. Epstein-Barr virus/complement C3d receptor is an interferon {alpha} receptor. EMBO J. 10:919.[Medline]
  3. Fingeroth, J. D., J. J. Weis, T. F. Tedder, J. L. Strominger, P. A. Biro, D. T. Fearon. 1984. Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc. Natl. Acad. Sci. USA 81:4510.[Abstract/Free Full Text]
  4. Tanner, J., J. Weis, D. Fearon, Y. Whang, E. Kieff. 1987. Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis. Cell 50:203.[Medline]
  5. Carroll, M. C., E. M. Alicot, P. J. Katzman, L. B. Klickstein, J. A. Smith, D. T. Fearon. 1988. Organization of the genes encoding complement receptors type 1 and 2, decay-accelerating factor, and C4-binding protein in the RCA locus on human chromosome 1. J. Exp. Med. 167:1271.[Abstract/Free Full Text]
  6. Fischer, E., C. Delibrias, M. D. Kazatchkine. 1991. Expression of CR2 (the C3dg/EBV receptor, CD21) on normal human peripheral blood T lymphocytes. J. Immunol. 146:865.[Abstract]
  7. Tsoukas, C. D., J. D. Lambris. 1988. Expression of CR2/EBV receptors on human thymocytes detected by monoclonal antibodies. Eur. J. Immunol. 18:1299.[Medline]
  8. Young, L. S., J. W. Sixbey, D. Clark, A. B. Rickinson. 1986. Epstein-Barr virus receptors on human pharyngeal epithelia. Lancet 1:240.[Medline]
  9. Tedder, T. F., L. T. Clement, M. D. Cooper. 1984. Expression of C3d receptors during human B cell differentiation: immunofluorescence analysis with the HB-5 monoclonal antibody. J. Immunol. 133:678.[Abstract]
  10. Fearon, D. T., M. C. Carroll. 2000. Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu. Rev. Immunol. 18:393.[Medline]
  11. Dempsey, P. W., M. E. D. Allison, S. Akkaraju, C. C. Goodnow, D. T. Fearon. 1996. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271:348.[Abstract]
  12. Boyd, A. W., K. C. Anderson, A. S. Freedman, D. C. Fisher, B. Slaughenhoupt, S. F. Schlossman, L. M. Nadler. 1985. Studies of in vitro activation and differentiation of human B lymphocytes. I. Phenotypic and functional characterization of the B cell population responding to anti-Ig antibody. J. Immunol. 134:1516.[Abstract]
  13. Griffioen, A. W., E. A. Toebes, B. J. Zegers, G. T. Rijkers. 1992. Role of CR2 in the human adult and neonatal in vitro antibody response to type 4 pneumococcal polysaccharide. Cell. Immunol. 143:11.[Medline]
  14. Timens, W., A. Boes, S. Poppema. 1989. Human marginal zone B cells are not an activated B cell subset: strong expression of CD21 as a putative mediator for rapid B cell activation. Eur. J. Immunol. 19:2163.[Medline]
  15. Takahashi, K., Y. Kozono, T. J. Waldschmidt, D. Berthiaume, R. J. Quigg, A. Baron, V. M. Holers. 1997. Mouse complement receptor type 1 (CR1; CD35) and type 2 (CR2; CD21) expression on normal B cell subpopulations and decreased levels during the development of autoimmunity in MRL/lpr mice. J. Immunol. 159:1557.[Abstract]
  16. Vereshchagina, L. A., M. Tolnay, G. C. Tsokos. 2001. Multiple transcription factors regulate the inducible expression of the human complement receptor 2 promoter. J. Immunol. 166:6156.[Abstract/Free Full Text]
  17. Tolnay, M., J. D. Lambris, G. C. Tsokos. 1997. Transcriptional regulation of the complement receptor 2 gene: role of a heterogeneous nuclear ribonucleoprotein. J. Immunol. 159:5492.[Abstract]
  18. Tolnay, M., L. A. Vereshchagina, G. C. Tsokos. 1999. Heterogeneous nuclear ribonucleoprotein D0B is a sequence-specific DNA-binding protein. Biochem. J. 338:417.
  19. Tolnay, M., Y. T. Juang, G. C. Tsokos. 2002. Protein kinase A enhances, whereas glycogen synthase kinase-3{beta} inhibits, the activity of the exon 2-encoded transactivator domain of heterogeneous nuclear ribonucleoprotein D in a hierarchical fashion. Biochem. J. 363:127.[Medline]
  20. Hu, H., B. K. Martin, J. J. Weis, J. H. Weis. 1997. Expression of the murine CD21 gene is regulated by promoter and intronic sequences. J. Immunol. 158:4758.[Abstract]
  21. Makar, K. W., C. T. Pham, M. H. Dehoff, S. M. O’Connor, S. M. Jacobi, V. M. Holers. 1998. An intronic silencer regulates B lymphocyte cell- and stage-specific expression of the human complement receptor type 2 (CR2, CD21) gene. J. Immunol. 160:1268.[Abstract/Free Full Text]
  22. Ulgiati, D., V. M. Holers. 2001. CR2/CD21 proximal promoter activity is critically dependent on a cell type-specific repressor. J. Immunol. 167:6912.[Abstract/Free Full Text]
  23. Akira, S., T. Kishimoto. 1997. NF-IL6 and NF-{kappa}B in cytokine gene regulation. Adv. Immunol. 65:1.[Medline]
  24. Ghosh, S., M. J. May, E. B. Kopp. 1998. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
  25. Segal, S.. 1986. DEAE dextran-mediated transfection of nonadherent and adherent mammalian cells. L. G. Davis, and M. D. Dibner, and J. F. Battey, eds. Basic Methods in Molecular Biology 290.-292. Elsevier, New York.
  26. Garoufalis, E., I. Kwan, R. Lin, A. Mustafa, N. Pepin, A. Roulston, J. Lacoste, J. Hiscott. 1994. Viral induction of the human {beta} interferon promoter: modulation of transcription by NF-{kappa}B/rel proteins and interferon regulatory factors. J. Virol. 68:4707.[Abstract/Free Full Text]
  27. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Assays for chloramphenicol acetyltransferase. In Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, p. 16.60–16.62.
  28. Schreiber, E., P. Matthias, M. M. Muller, W. Schaffner. 1989. Rapid detection of octamer binding proteins with "mini-extracts," prepared from a small number of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  29. Orlando, V., H. Strutt, R. Paro. 1997. Analysis of chromatin structure by in vivo formaldehyde cross-linking. Methods 11:205.[Medline]
  30. Johnson, T. A., H. L. Wilson, W. J. Roesler. 2001. Improvement of the chromatin immunoprecipitation (ChIP) assay by DNA fragment size fractionation. BioTechniques 31:740.[Medline]
  31. Caretti, G., F. Cocchiarella, C. Sidoli, J. Villard, M. Peretti, W. Reith, R. Mantovani. 2000. Dissection of functional NF-Y-RFX cooperative interactions on the MHC class II Ea promoter. J. Mol. Biol. 302:539.[Medline]
  32. Ulgiati, D., C. Pham, V. M. Holers. 2002. Functional analysis of the human complement receptor 2 (CR2/CD21) promoter: characterization of basal transcriptional mechanisms. J. Immunol. 168:6279.[Abstract/Free Full Text]
  33. Massari, M. E., C. Murre. 2000. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 20:429.[Free Full Text]
  34. Tolnay, M., L. Baranyi, G. C. Tsokos. 2000. Heterogeneous nuclear ribonucleoprotein D0 contains transactivator and DNA-binding domains. Biochem. J. 348:151.
  35. Thomas, M. J., E. Seto. 1999. Unlocking the mechanisms of transcription factor YY1: are chromatin modifying enzymes the key?. Gene 236:197.[Medline]
  36. Fujita, T., G. P. Nolan, S. Ghosh, D. Baltimore. 1992. Independent modes of transcriptional activation by the p50 and p65 subunits of NF-{kappa}B. Genes Dev. 6:775.[Abstract/Free Full Text]
  37. Lin, R., D. Gewert, J. Hiscott. 1995. Differential transcriptional activation in vitro by NF-{kappa}B/Rel proteins. J. Biol. Chem. 270:3123.[Abstract/Free Full Text]
  38. Fujita, T., G. P. Nolan, H. C. Liou, M. L. Scott, D. Baltimore. 1993. The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-{kappa}B p50 homodimers. Genes Dev. 7:1354.[Abstract/Free Full Text]
  39. Kretzschmar, M., M. Meisterernst, C. Scheidereit, G. Li, R. G. Roeder. 1992. Transcriptional regulation of the HIV-1 promoter by NF-{kappa}B in vitro. Genes Dev. 6:761.[Abstract/Free Full Text]
  40. Sugano, N., W. Chen, M. L. Roberts, N. R. Cooper. 1997. Epstein-Barr virus binding to CD21 activates the initial viral promoter via NF-{kappa}B induction. J. Exp. Med. 186:731.[Abstract/Free Full Text]
  41. Zhou, L. J., H. M. Smith, T. J. Waldschmidt, R. Schwarting, J. Daley, T. F. Tedder. 1994. Tissue-specific expression of the human CD19 gene in transgenic mice inhibits antigen-independent B-lymphocyte development. Mol. Cell. Biol. 14:3884.[Abstract/Free Full Text]
  42. Quandt, K., K. Frech, H. Karas, E. Wingender, T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23:4878.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
I. Debnath, K. M. Roundy, J. J. Weis, and J. H. Weis
Defining In Vivo Transcription Factor Complexes of the Murine CD21 and CD23 Genes
J. Immunol., June 1, 2007; 178(11): 7139 - 7150.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-W. Jang, Y. S. Kim, Y. R. Kim, H. J. Sung, and J. Ko
Regulation of Human LZIP Expression by NF-{kappa}B and Its Involvement in Monocyte Cell Migration Induced by Lkn-1
J. Biol. Chem., April 13, 2007; 282(15): 11092 - 11100.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Wu, S. A. Boackle, P. Hanvivadhanakul, D. Ulgiati, J. M. Grossman, Y. Lee, N. Shen, L. J. Abraham, T. R. Mercer, E. Park, et al.
Association of a common complement receptor 2 haplotype with increased risk of systemic lupus erythematosus
PNAS, March 6, 2007; 104(10): 3961 - 3966.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Mohan, J. Dement-Brown, S. Maier, T. Ise, B. Kempkes, and M. Tolnay
Epstein-Barr virus nuclear antigen 2 induces FcRH5 expression through CBF1
Blood, June 1, 2006; 107(11): 4433 - 4439.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
H.-g. Hu, H. Illges, C. Gruss, and R. Knippers
Distribution of the chromatin protein DEK distinguishes active and inactive CD21/CR2 gene in pre- and mature B lymphocytes
Int. Immunol., June 1, 2005; 17(6): 789 - 796.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Yan, L. Phan, F. Yang, M. Talpaz, Y. Yang, Z. Xiong, B. Ng, N. A. Timchenko, C. J. Wu, J. Ritz, et al.
A Novel Mechanism of Alternative Promoter and Splicing Regulates the Epitope Generation of Tumor Antigen CML66-L
J. Immunol., January 1, 2004; 172(1): 651 - 660.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. Sarkar, Q. Xi, C. He, and R. J. Schneider
Selective Degradation of AU-Rich mRNAs Promoted by the p37 AUF1 Protein Isoform
Mol. Cell. Biol., September 15, 2003; 23(18): 6685 - 6693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tolnay, M.
Right arrow Articles by Tsokos, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation