|
|
||||||||






* Institut National de la Santé et de la Recherche Médicale E0021, Département dImmunologie, Institut Pasteur,
Unité dImmunophysiologie et Parasitisme Intracellulaire, Institut Pasteur, and
Département dImmunologie, Institut Pasteur, Paris, France; and
Department of Microbiology and Immunology, University of Leicester, Leicester, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It has been suggested that hepatocytes are the major source of C1 inh
biosynthesis in humans (10, 11, 12). Other studies, however,
demonstrated predominant extrahepatic sources of C1 inh mainly by cells
of the monocyte/macrophage lineage (13, 14, 15, 16). In keeping
with this, the human monocytic cell line U937 also synthesizes C1 inh
(13). In the rat, isolated Kupffer cells have been
reported to synthesize and secrete C1 inh, whereas peritoneal
macrophages synthesize only trace amounts; IFN-
up-regulates
C1 inhibitor gene expression in both cell populations
(17). Fibroblasts, megakaryocytes, platelets, and
endothelial cells are also able to produce C1 inh (18, 19).
Inflammation and tissue injury modulate complement expression at extrahepatic sites (20, 21, 22). Human astrocyte cell lines as well as neuroblastoma cell lines have been reported to express and secrete all the components of the alternative and of the classical pathway (23, 24, 25). In vivo results, however, demonstrated that such in vitro findings have to be considered with caution (26). C1 inh has been identified in both normal and Alzheimers disease brain tissue (27); its immunohistochemical detection has been reported in activated astrocytes and dystrophic neurites in plaque areas. In situ hybridization indicated that neurons might be major sites of synthesis of C1 inh in the brain (28).
The C1q subcomponent of the C1 complex is produced by microglial cells of rats (29). It was also found in heart, kidney, lung, and brain of mice (30). In rat spleen, C1q is produced by follicular dendritic cells (FDC) and by interdigitating cells within the white pulp as well as by monocyte/macrophage lineage cells within the red pulp (31). In line with the observed T cell deficiency in C1q-deficient mice (32), the predominant expression of C1q in the spleen and its apparent biosynthesis by FDC imply a role in triggering the components of the adaptive immune system.
We describe in this study the in vivo biosynthesis of C1 inh in transgenic mice that carry all assigned regulatory elements of the human C1NH gene (33, 34, 35).
| Materials and Methods |
|---|
|
|
|---|
The C1 inh minigene is a construct of 7.5 kb, inserted between the XhoI and the XbaI sites of the vector pBluescript KS+ (Stratagene, La Jolla, CA) and containing a shortened version of the human C1NH gene (36) (accession no. X54486), including genomic sequences up to 1.18 kb from the transcription start site and 2.5 kb of 3' flanking sequences. This construct also includes exons 1 and 2 and the first two introns, but lacks introns 37 of C1NH, because the genomic stretch between the BamHI site in exon 3 and the BglII site in exon 8 was replaced with the corresponding cDNA sequence. Purification of the human C1 inh DNA minigene for embryo injection was accomplished by digesting the plasmid with XhoI and XbaI to remove vector sequences, followed by agarose gel electrophoresis and purification (Nucleotrap extraction kit; Macherey-Nagel, Düren, Germany).
Generation and identification of transgenic mice
Superovulated female (C56BL/6 x DBA/2)F2 mice were mated with 10- to 20-wk-old mice of the same strain. Fertilized eggs were flushed from the oviducts, and the minigene construct was injected at 4 ng/µl into the pronuclei (1 pl = 500 copies). Viable injected oocytes were transferred to day 0.5 pseudopregnant F1 foster mothers. The integration of the transgene in the genome of founder mice was assessed by Southern blot analysis of tail DNA using a 32P-radiolabeled full-length human C1 inh cDNA probe. Each lane of the Southern blot contained 7 µg of BamHI-digested total genomic DNA. To estimate the copy number of the human C1NH minigene in the transgenic founder lines, 12 or 120 pg of the 7.5-kb XhoI-XbaI segment containing the minigene was added to 7 µg of nontransgenic mouse DNA before BamHI digestion and was electrophoresed on separate lanes of the Southern blot to mimick the presence of 1 copy and 10 copies, respectively, in a diploid mouse genome. Intensities of hybridizing fragments were quantified by phosphor imager analysis. The offspring of transgenic mice were tested routinely for presence of high plasma levels of human C1 inh (see below).
Evaluation of the plasma level of human C1 inh in transgenic mice
Blood samples were collected in 5 mM EDTA (final concentration) to prevent in vitro activation of the complement and the contact systems. Tubes were centrifuged at 1300 x g for 10 min, and plasma was aliquoted and stored at -20°C until testing. ELISA were conducted using mAb RII (a generous gift of E. Hack, Amsterdam, The Netherlands), which recognizes native as well as complexed or inactivated C1 inh (37). To this end, 96-well microtiter plates (Nunclon, Naperville, IL) were coated with 2 µg/ml mAb in PBS overnight at 4°C. Blocking was done with 3% (w/v) BSA in PBS for 1 h. Different dilutions of mouse plasma up to 100 µl were incubated for 1.5 h, followed by four washes with 0.1% Tween 20 in PBS. Detection of C1 inh Ag was performed with biotinylated rabbit polyclonal anti-human-C1 inh Ab for 1 h, followed by 30-min incubation with streptavidin-coupled HRP (Amersham Biosciences, Orsay, France), both diluted 1/1000 in PBS, 0.1% (v/v) Tween 20, and 0.2% (w/v) gelatin. Development was performed with 3,3',5,5'-tetramethylbenzidine (Sigma-Aldrich, Poole, U.K.), 3% H2O2, and 0.11 M NaAc, pH 5.5; reactions were stopped after 510 min with 2 M H2SO4 and read at 450 nm with a Dynatech MR 5000 (Chantilly, VA). Results were related to a calibration curve prepared for each ELISA plate by serially diluting fresh pooled human plasma containing 275 µg native C1 inh/ml.
Histology and immunohistochemical staining
Mice were sacrificed by cervical dislocation; brain, heart, lung, liver, kidney and spleen were immediately excised and fixed for 15 h in cold Kryofix (Merck, Poole, U.K.), a mixture of ethyl-alcohol and polyethylene-glycol (38). After dehydration with increasing concentrations of ethanol, tissues were embedded in paraffin at 60°C. Sections were cut on a microtome at 6 µm thickness, dewaxed, washed with PBS solution, and treated with 0.1% Triton X-100.
Sections were preincubated with sheep serum for 2 h to block nonspecific binding sites, and incubated for 45 min at room temperature with the primary Ab. The anti-human C1 inh rabbit polyclonal Ab OTNK 04/05 (Behring, Marburg, Germany) was diluted to 1/300 in 10% FCS in RPMI medium. Sections were then washed with PBS and incubated with sheep anti-rabbit second Ab for 30 min at room temperature (1/300 dilution in 1% gelatin; type B from bovine skin; Sigma-Aldrich), washed in PBS, and placed in a 1/100 dilution of HRP-rabbit peroxidase antiperoxidase (PAP) complex solution (DAKO AEC Substrate System, Carpenteria, CA) in 1% gelatin for 30 min at room temperature. Sections were then rinsed with PBS and incubated for 10 min in peroxidase substrate-chromogen solution (DAKO AEC Substrate System). Finally, sections were rinsed with water and counterstained with hematoxylin (Thermol Shandon, Pontoise, France). Negative controls included incubations of the sections without primary Ab.
Serial 6-µm-thick cryostat sections were prepared from spleens directly embedded in OCT (Tissue-Tek, Sakura Finetek, Zoeterwoude, The Netherlands), allowed to air dry for 6 h, and fixed in acetone for 10 min. The following rat anti-mouse monoclonals were used on frozen sections. The F4/80 Ab (Serotec, Oxford, U.K.) recognizes the mouse F4/80 Ag, i.e., a 160-kDa glycoprotein expressed by the majority of mouse macrophages and by red pulp macrophages (39). The mucosal addressin cell adhesion molecule-1 Ab (BD PharMingen, San Diego, CA) reacts with a mucosal vascular addressin, which is preferentially expressed in mucosal lymphoid tissues and lamina propria. In the spleen, it is a marker of the endothelial cell lining in the marginal sinus of the marginal zone (40, 41). The MOMA-2 Ab (Serotec) recognizes an intracellular Ag of mouse macrophages and monocytes. In the spleen, it reacts with the marginal zone macrophages at the border with the red pulp (42). SER-4 is a hybridoma supernatant directed to SER, a macrophage receptor that binds unopsonized sheep E via recognition of sialylated glycoconjugates. In the spleen, it reacts with the marginal metallophilic macrophages at the border of the marginal sinus and the white pulp (43). FDC-M1 is a hybridoma supernatant (a kind gift of M. H. Kosco-Vilbois, Serono Pharmaceutical Research Institute, Geneva, Switzerland) specific for a subpopulation of murine spleen cells morphologically related to the dendritic cells of the germinal centers (44).
Sections were preincubated for 2 h with rabbit serum to block nonspecific sites, and then incubated with the relevant mAb diluted 1/10 in 0.005 M Tris, pH 7.6, 0.05% saponin. A biotinylated rabbit anti-rat second Ab (diluted 1/100 in the same buffer) was then used for 1 h. Sections were then washed and placed in avidin DH-biotinylated alkaline phosphatase H complex (1/100 dilution in buffer) for 1 h at room temperature (Vectastain ABC-AP kit, Vector Laboratories, Burlingame, CA). After three washes, the enzymatic activity of alkaline phosphatase was revealed by incubation in Fast Red substrate-chromogen solution, rinsed with water, and counterstained with hematoxylin.
In situ hybridization
Human and mouse C1 inh mRNAs were localized by in situ hybridization using 35S-labeled antisense RNA probes. In vitro transcription and in situ hybridization were performed according to the methods of Melton et al. (45) and Schäfer et al. (46), respectively. To avoid that the cRNA probe for the detection of human mRNA cross-hybridizes with murine C1 inh mRNA and vice versa, the probes were generated from areas of human and mouse C1 inh cDNA, which share no extensive homology. The human probe was transcribed from a 572-bp BglII/BamHI fragment from the 5' end of the cDNA, which was cloned into pBSIIKS+. The mouse probe was transcribed from a cDNA template comprising 222 bp between the internal EcoRI and BamHI sites, which was also cloned into pBSIIKS+. For controls, the mouse C1 inh template was transcribed in the opposite direction, generating a sense cRNA probe. The 20-µm sections of mouse tissue were cut using a cryostat, mounted on polysine microscope slides (Merck), and hybridized with the 35S-labeled probes. After hybridization and washing, the signals were detected by exposing the sections to Kodak BioMax MR x-ray film (Sigma-Aldrich) or by dipping the slides in LM-1 photographic emulsion (Amersham Biosciences).
| Results |
|---|
|
|
|---|
The DNA construct used to produce transgenic mice was a
C1NH minigene in which most exons were replaced by a cDNA
fragment encoding human C1 inh. The construct retained the promoter
region extending up to 1.18 kb from the transcription start site and
the integrity of introns 1 and 2 (Fig. 1
). We have previously reported the mouse
sequence (accession AF052039) corresponding to the region from -813
(upstream of the transcription start site) to +650 (intron 2) of the
human C1NH gene, and have discussed the striking
conservation of regulatory elements in the promoter region and within
intron 1 (35). Functional studies also support the
important role of intron 1 sequences in determining the transcriptional
regulation and particularly the responses to IFNs (47)
(our unpublished data).
|
100), whereas one founder in addition to F14
(lane 8 of Fig. 1
To evaluate the levels of the human C1 inh protein in transgenic mice,
their plasma was analyzed by ELISA using the mAb RII. The human C1 inh
protein was detected in the plasma of animals with high and low copy
numbers of the human minigene construct at levels showing a positive
correlation with the number of minigene copies. There was no difference
between males and females (data not shown). Mice with high copy numbers
of the human transgene had human C1 inh plasma levels between 1 and 2
mg/ml, and the low copy number line F14 had plasma levels
of
2.5 µg/ml. Two founder lines (F7 and
F10) with high copy numbers of the human transgene and the
low copy number line F14 were used in all experiments, except for the
in situ hybridization studies, in which only the high copy number line
F10 was used.
Distribution of mouse and human C1 inh mRNA in spleen, brain, and liver of transgenic mice
The distribution of C1 inh synthesis was investigated in the
spleen because of the evidence of local production of complement
components, particularly C1q (31) and C3
(48), by specific cell types. In situ hybridizations of
spleen sections with human or mouse C1 inh antisense RNA probes
revealed an identical distribution in the follicles of the white pulp,
in the marginal zone, and to a lesser extent in the red pulp (Fig. 2
, A and B). In
keeping with the high copy number of the human transgene, the
hybridization with the human probe was always stronger (Fig. 2
B).
|
The distribution of C1 inh mRNA was then examined in the brain.
Sections hybridized with mouse- or human-specific probes revealed
higher expression levels of the human RNA. However, no qualitative
difference was observed in the distribution of endogenous and of
transgenic RNA (Fig. 2
, C and D). Significant C1
inh RNA expression was observed in the cortex and external capsule of
the forebrain. In the midbrain, the dentate gyrus was densely packed
with cells that express C1 inh mRNA, and the cortex was also
positive.
Control hybridizations with sense probes were always negative, as
illustrated in Fig. 2
E by the extremely weak signal of a
mouse sense probe hybridized on a transgenic mouse brain, which is
compared in the inset with the hybridization observed with a
mouse antisense probe. Control hybridizations on spleen or brain
sections from nontransgenic mice with the human C1 inh antisense probe
were also negative, as illustrated in Fig. 2
F using a human
antisense C1 inh cRNA probe hybridized on a brain section of a
nontransgenic mouse, which yields a weak and uniform background signal,
compared with the specific signal observed on a similar section of a
transgenic brain (shown in the inset of F).
High power in situ hybridization on spleen, brain, and liver sections
confirmed the codistribution observed for the endogenous and the
transgenic mRNA. In the liver, human C1 inh mRNA was abundantly
expressed in discrete cells that correspond in their morphology and
distribution to Kupffer cells (Fig. 3
, see the inset in A).
|
The observation of concordant expression, at the mRNA level, of the human transgene and of the endogenous gene in spleen and brain prompted us to study the cell type distribution of C1 inh in these and other tissues, using immunohistochemical methods. To reveal human C1 inh, we used a rabbit polyclonal Ab, which does not cross-react with mouse C1 inh (35).
In the liver sections (Fig. 3
A), human C1 inh was abundantly
detected in discrete cells that correspond to the morphology and the
distribution of Kupffer cells, whereas hepatocytes as well as the
vessels within the portal tract and the centrilobular veins were
negative. High power in situ hybridizations with mouse C1 inh and with
human C1 inh cRNA probes on liver sections (inset in Fig. 3
A) revealed a similar discrete pattern, consistent with
predominant expression in Kupffer cells. The sinusoids showed very weak
staining; their lining cells being negative, the weak signal in the
lumen was interpreted as being due to the presence of residual
circulating protein.
Lung sections (Fig. 3
B) revealed abundant and homogeneous
human C1 inh immunostaining of the bronchiolar submucosal connective
layer and of the apex of the epithelial cells. The alveolar septa
stained heterogeneously: some type II pneumocytes (see
inset) were positive as well as the capillaries. The
connective tissue of the tunica adventitia in the vessels and the
tunica adventitia of the pulmonary arterioles stained positively. These
observations are consistent with our previous finding of relatively
high expression of C1 inh mRNA in the lung of normal mice
(35).
The renal cortex (Fig. 3
C) contained abundant C1
inh-positive areas in the renal corpuscles and blood vessels, mainly
localized to the lumen of the glomerular capillary network, while the
capillary endothelial cells and the capillary basement membrane were
negative (see inset). The periglomerular connective tissue
was positive. The endothelial cells of the capillary network that
surrounds the renal tubules stained positively, whereas the renal
tubules were negative.
In the myocardium (Fig. 3
D), the interstitial connective
tissue and the tunica adventitia of the arterioles were positive.
In the brain sections (Fig. 3
E), the macrophages and the
endothelial cells of the choroid plexus capillaries showed strong
staining for human C1 inh, whereas all other cell types were below
levels of detection, in apparent contrast with the strong expression of
C1 inh RNA in several areas of the brain.
In the spleen (Fig. 3
F), the marginal zone was often
positive. Moreover, clusters of C1 inh-positive cells were often seen
in some follicles (discussed below).
Controls without the first Ab (shown for lung and spleen in G and H) were always negative.
C1 inh was localized in parallel studies performed on normal BALB/c mice using an anti-mouse C1 inh Ab that we have produced against an N-terminal peptide (aa 1536) (35). Best results were obtained with this Ab using cryostat sections. No qualitative difference could be seen compared with the pattern of expression resulting from the human transgene (data not shown).
Colocalization of C1 inh with a marker of FDC in the white pulp of the spleen
To identify the C1 inh-expressing cells in the spleen, serial
cryostat sections were treated with Abs that are markers of cells of
the macrophage lineage or of FDC, or of marginal sinus endothelial
cells, respectively (Fig. 4
).
Interestingly, C1 inh-expressing cells were found clustered in the
follicles (Fig. 4
A), with the same distribution as FDC-M1,
reactive with FDC (Fig. 4
B). This observation indicates that
FDC express C1 inh (see, in C and D, the enlarged
views of the relevant areas of the sections shown in A and
B, respectively).
|
| Discussion |
|---|
|
|
|---|
,
should be similar (34, 35) (our unpublished data).
The human C1NH minigene used in this study to produce
transgenic mice (Fig. 1
) contains all in vitro assigned regulatory
elements in the promoter region as well as in the first intron
(33, 34, 47). For this reason, 1.18 kb of upstream
sequences and intron 1 were retained in the minigene, as well as intron
2 and
2.5 kb of 3' flanking sequences. The results of
immunohistochemical and in situ hybridization studies showed a
remarkable fidelity of the in vivo expression from the human minigene
construct, indicating that the transgene carried all essential control
elements. Moreover, its expression did not appear to be affected by
position effects due to different integration sites of the clusters
containing multiple copies of the human minigene.
The high copy number of the transgenic lines selected for this study resulted in high mRNA and protein expression. We took advantage of these high levels of specific expression to define the distribution of C1 inh protein in several organs (i.e., liver, lung, kidney, heart, brain, and spleen). Immunohistochemical studies conducted on normal BALB/c mice using an anti-mouse C1 inh Ab raised against an N-terminal peptide (35) yielded a qualitatively similar distribution.
The concordant expression of the human transgene and of the endogenous
C1nh gene probably reflects the high level of
conservation of promoter and regulatory sequences in their 5' regions.
Although the available mouse sequence (accession AF052039) extends only
up to -750 bp from the transcription start site (35),
thus preventing an estimate of the extent of overall sequence
conservation in the more remote 5' flanking regions, a stretch of 147
nt of the human sequence starting at position -141 and overlapping the
transcription initiation site contains several key regulatory elements
(33) and reveals a very high degree of sequence
conservation. Specifically: 1) the IFN-
-activated sequence mapped at
position -126 to -118 in the human gene (34, 35) is
conserved; 2) the sequence
CTTAATTTGTAACTGGGCAGTG between -94 and -73,
which contains an hepatocyte nuclear factor-1 binding site and a
stimulating factor (Sp-1) site (33), has only two
nucleotide differences (positions underlined); 3) the CAAT box at
position -62 to -59 and the initiator site at position -3 to +5 are
both conserved; and 4) a shorter version of the polypurine
polypyrimidine segment at position -48 to -17 (33) is
found in the mouse sequence. Moreover, most of intron 1 reveals a high
degree of sequence conservation, particularly the stretch between
positions 355 and 410 of the human sequence, which contains two
intronic IFN-
-activated sequence elements (35) that we
have characterized functionally (our unpublished data). The inclusion
of all the above elements in the construct used in this study and the
presence of rather long 5' and 3' flanking sequences of the human
C1NH gene (1.18 and 2.5 kb, respectively) are probably the
key elements that explain the high specificity of expression of the
human transgene.
The results of these studies confirm the previously reported strong expression of C1 inh by Kupffer cells in the liver of rodents (17). Combined evidence, based on in situ hybridization and immunohistochemistry, indicates that also in normal mice C1 inh expression in hepatocytes is below level of detection. Our immunohistochemical data are consistent with the previously observed high levels of mRNA expression in lung, kidney, and spleen (35). In contrast, the expression of the C1 inh protein in the brain does not seem to follow the relatively strong expression observed at the RNA level. Although the reasons for this discrepancy remain to be elucidated, this observation suggests that C1 inh expression may be regulated also at a posttranscriptional level in several areas of the brain.
Human C1 inh was detected abundantly in the red pulp of the spleen, but did not seem to colocalize completely in this area with the distribution of F4/80-positive macrophages. C1 inh was not expressed by two populations of macrophages of the marginal zone, defined by the MOMA-2 and by the SER-4 Abs. Interestingly, distinct C1 inh staining was observed in patches of the white zone that contain cells recognized by the FDC-M1 Ab, which is a marker commonly used for FDC (32, 44). These data indicate that FDC (or at least a subpopulation thereof) are able to produce not only C1q (31), but also C1 inh. Additional in situ hybridization studies using C1r- and C1s-specific probes also suggest colocalization of the biosynthesis of all components of the macromolecular C1 complex in several tissues, including the spleen (data not shown). Local activation of the classical pathway of complement, under the control of C1 inh, may play an important role in the maintenance of Ag on FDC or its presentation to primed B lymphocytes, or in triggering the subsequent steps of adaptive immunity. It remains to be seen which of these functions require full activation of the classical pathway of complement.
The broad distribution of tissues and cell types expressing C1 inh probably reflects the important role of local activation of the classical pathway of complement and of its control. The transgenic mice described in this work provide a model system for specific expression at high levels of human C1 inh in vivo and should be particularly useful to study the evolution of local inflammatory responses. Moreover, similar constructs, carrying the promoter and regulatory sequences described in this work, may be used to produce transgenic mice for faithful expression in vivo of any C1 inh variant or to reproduce for any protein of interest the specificity in time and space of C1 inh expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Giovanna Vinci, Institut National de la Santé et de la Recherche Médicale E0021, Département dImmunologie, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France. E-mail address: vinci{at}pasteur.fr ![]()
3 Current address: Institut National de la Santé et de la Recherche Médicale EMI 9906 Faculté de Médecine et Pharmacie, Université de Rouen, 22 Boulevard Gambetta, 7600 Rouen Cedex, France. E-mail address: mario.tosi{at}univ-rouen.fr ![]()
4 Abbreviations used in this paper: C1 inh, C1 inhibitor; FDC, follicular dendritic cell; PAP, peroxidase antiperoxidase. ![]()
Received for publication April 23, 2002. Accepted for publication September 11, 2002.
| References |
|---|
|
|
|---|
1-antitrypsin and other members of the serpins superfamily. Gene 42:265.[Medline]
production by antigen-specific T cells. J. Exp. Med. 187:1789.
-responsive element in the 5' flanking region of the C1 inhibitor gene. J. Immunol. 159:6091.[Abstract]
-interferon. J. Biol. Chem. 269:9669.This article has been cited by other articles:
![]() |
M. S. Bolger, D. S. Ross, H. Jiang, M. M. Frank, A. J. Ghio, D. A. Schwartz, and J. R. Wright Complement levels and activity in the normal and LPS-injured lung Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L748 - L759. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cai and A. E. Davis III Complement Regulatory Protein C1 Inhibitor Binds to Selectins and Interferes with Endothelial-Leukocyte Adhesion J. Immunol., November 1, 2003; 171(9): 4786 - 4791. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |