|
|
||||||||
Dependent1



* Department of Biological Sciences, University of Maryland, Baltimore, MD 21250; and
Molecular Immunogenetics and Vaccine Research Section, Metabolism Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
-/- mice indicate that
IFN-
is essential for immunity. Therefore, immunosurveillance in
STAT6-/- mice facilitates survival against metastatic
cancer via an IFN-
-dependent mechanism involving hemopoietic and
nonhemopoietic derived cells, and is not exclusively dependent on
counteracting IL-13 or CD4+CD25+ T
cells. | Introduction |
|---|
|
|
|---|
As an alternative explanation to Th1 vs Th2 CD4+
helper cell ratio, it has been proposed that STAT6-deficient mice have
enhanced immunity because they lack an inhibitor that blocks the
development of tumor-reactive CD8+ T cells
(1, 3). In the primary fibrosarcoma system, IL-13 produced
by CD4+ NKT cells has been hypothesized as the
inhibitor (1). Three lines of evidence support a role for
IL-13: 1) IL-4R
-/- and
STAT6-/-, but not
IL-4-/- mice show the enhanced immunity, and
IL-13 is the only cytokine other than IL-4 known to use the
IL-4R
-chain and STAT6. 2) IL-13 is produced by NKT cells, and NKT
cell-deficient CD1 knockout mice have enhanced immunity to primary,
fibrosarcoma tumors. 3) Blockading of IL-13 with an IL-13 inhibitor
results in heightened immunity to primary fibrosarcoma tumor. Because
STAT6 is a downstream effector of the IL-4R and IL-13 binds to the type
2 IL-4R, deletion of STAT6 may be functionally equivalent to deletion
of IL-13 and NKT cells, and therefore enhanced immunity to primary
tumor in both CD1-/- and
STAT6-/- mice may be the result of elimination
of IL-13 (1). The cellular target for IL-13 is unclear.
Although CD8+ T cells are the antitumor
effectors, they do not have receptors for IL-13. Therefore, IL-13 may
act on an intermediate cell through a downstream STAT6-dependent
pathway, and subsequently modulate CD8+ T cell
activation (1).
Another potential inhibitor of tumor immunity is the CD4+CD25+ T cell. The presence of these cells inhibits the differentiation of cytotoxic CD8+ T cells against tumors (8), and their absence facilitates the development of autoimmunity (9, 10, 11).
Although STAT6-deficient mice have enhanced resistance to three independent mouse tumors, it is not clear whether the same mechanisms mediate heightened immunity to the fibrosarcoma, mastocytoma, and mammary carcinoma, or whether enhanced immunity to metastatic tumor occurs via the same mechanism as enhanced immunity to primary tumor. To address these questions, we have used the BALB/c-derived 4T1 mouse mammary carcinoma and assessed both primary tumor growth and metastastic disease in STAT6-/-- and NKT-deficient CD1-/- mice. The 4T1 mouse tumor closely parallels human breast cancer in its growth kinetics, pathology, invasiveness, poorly immunogenic phenotype, and pattern of spontaneous metastasis to multiple distant organs (12, 13). Inoculation of small numbers of 4T1 tumor cells into the mammary gland of syngeneic BALB/c mice causes lethality due to lung, liver, bone marrow, and/or brain metastasis within 68 wk of inoculation. The 4T1 tumor also closely parallels human breast cancer in that progression of metastatic disease is not affected by surgical removal of primary tumor, so that mice whose primary tumors are removed after metastatic disease is established also die within 68 wk of initial tumor inoculation (13). Because 4T1 tumor cells are resistant to 6-thioguanine, the number of metastatic cells in distant organs can be quantified using a clonogenic assay (12, 14, 15). Metastatic disease following surgical removal of primary tumor is the principal cause of death in patients with solid tumors (16). Therefore, the 4T1 tumor also allows us to assess tumor immunity in an animal model that closely parallels human cancer, by assessing survival of mice whose primary tumors are surgically removed.
Our studies show that tumor immunity in STAT6-/- mice is unusually effective in that 4580% of STAT6-/- mice with established, spontaneous metastatic disease, whose primary tumors have been surgically excised, survive indefinitely, as compared with <10% of wild-type BALB/c mice. Surprisingly, experiments with STAT6-/- and wild-type BALB/c reciprocal bone marrow chimeric mice and autologous bone marrow chimeras indicate that enhanced immunity requires STAT6-/- hemopoietic and nonhemopoietic derived components. Similar experiments with CD1-/- mice confirm earlier results that CD1-/- mice have heightened tumor immunity to primary tumors and demonstrate that they also are highly resistant to metastatic disease. However, STAT6-/- and CD1-/- reciprocal bone marrow chimeras do not have increased tumor immunity, suggesting that heightened immunity in STAT6-/- and CD1-/- mice is achieved via different mechanisms or different steps in a regulatory pathway. Studies aimed at clarifying the role of IL-13 in tumor immunity demonstrate that neither 4T1 primary tumor growth nor metastatic disease is reduced in mice treated with an IL-13 inhibitor, in contrast to the results with the fibrosarcoma primary tumor. Therefore, heightened tumor immunity in STAT6-deficient and CD1-deficient mice confers a distinct survival advantage on mice with established metastatic mammary cancer; however, the underlying mechanism of enhanced immunity differs from the mechanism responsible for increased immunity to primary fibrosarcoma tumor and is not solely dependent on elimination of IL-13 or CD4+CD25+ T regulatory cells.
| Materials and Methods |
|---|
|
|
|---|
BALB/c, BALB/c STAT6-/- (henceforth
called STAT6-/-), and BALB/c
CD1-/- (henceforth called
CD1-/-) mice were bred in the University of
Maryland Biology Department animal facility from breeding pairs
obtained from The Jackson Laboratory (Bar Harbor, ME), M. Grusby
(Dana-Farber Cancer Institute, Boston, MA), and L. van Kaer
(Washington University, St. Louis, MO), respectively. BALB/c
IL-4R
-deficient (henceforth called
IL-4R
-/-) mice were purchased from The
Jackson Laboratory. STAT6-/- and
CD1-/- mice were originally made by targeted
disruption of the STAT6 and CD1 genes, respectively, in 129 ES cells.
Offspring were backcrossed to BALB/c mice (10 backcross generations for
STAT6-/-; 9 backcross generations for
CD1-/-) (17, 18, 19). Female mice of
816 wk were used for all studies.
STAT6-/-IFN-
-/- mice
were generated by crossing STAT6-/- mice with
IFN-
-/- BALB/c mice. Heterozygous offspring
were intercrossed, and the F2 were screened by
PCR for homozygosity for STAT6-/- and
IFN-
-/-. Ear punch tissue of individual mice
was placed in a 0.5-ml microfuge tube, and 20 µl of 50 mM Tris-HCl
(pH 8.0), 2 mM NaCl, 10 mM EDTA, 1% SDS, and 1 µl of 20 mg/ml
proteinase K (Boehringer Mannheim, Indianapolis, IN) were added. Tubes
were incubated at 55°C for 20 min, and after vigorous vortexing for 2
min, the mixture was incubated for an additional 20 min at 55°C.
Sterile distilled water was then added to each tube to a
final total volume of 200 µl, and the tubes were heated at 100°C
for 5 min. The following primers were used: STAT6, 5' primer,
TGAGGTGGGGACCAGCCGG; STAT6, 3' primer, GTGACCAGGACACACAGCGG;
Neo-STAT6, primer, GCTACCCGTGATATTGCTGAAGAG; IFN-
, 5' primer,
AGAAGTAAGTGGAAGGGCCCAGAAG; IFN-
, 3' primer,
AGGGAAACTGGGAGAGGAGAAATAT; IFN-
Neo, 5' primer,
TCAGCGCAGGGGCGCCCGGTTCTTT; IFN-
Neo, 3' primer,
ATCGACAAGACCGGCTTCCATCCGA. PCR conditions for both IFN-
and
STAT6 genes were: denature at 94°C for 5 min, denature at 94°C for
1 min, anneal at 59°C for 1 min, extend at 72°C for 1.3 min, repeat
the last three steps 34 times, extend at 72o for
9 min. PCR products were electrophoresed on 2% agarose gels. The
wild-type STAT6 and STAT6-deletion genes produce 100- and 250-kb bands,
respectively (17). The wild-type IFN-
and
IFN-
-deletion genes produce 220- and 375-bp bands, respectively
(www.jax.org/resources/documents/imr/protocols/Ifng_KO.html).
The 4T1 mammary carcinoma cells were maintained in culture and inoculated into the abdominal mammary gland, and mice were followed for survival, as described (12, 13). Primary tumors were measured using an electronic calipers. Reported measurements are the square root of the product of two perpendicular diameters. Numbers of metastatic cells in lung, liver, bone marrow, and brain were determined using the clonogenic metastasis assay in which dissociated organ cells were cultured in medium supplemented with 6-thioguanine (12, 13, 14).
Surgical removal of primary mammary tumors
BALB/c, STAT6-/-, CD1-/-, and chimeric mice were inoculated in the abdominal gland with 7000 4T1 cells, and primary, solid tumors were surgically removed, as described (13, 20), with the following modifications: primary tumors were removed 1621 days after 4T1 inoculation when they were between 2 and 9 mm in diameter and well vascularized. More than 95% of mice survived surgery. Postsurgery mice were followed for metastasis development and/or survival. Mice in which primary tumors recurred at the site of the original tumor inoculation were omitted from the study. These mice were less than 5% of operated mice.
Bone marrow chimeras
STAT6-/- mice containing BALB/c
bone marrow (BALB/c
STAT6-/-), BALB/c mice
containing STAT6-/- bone marrow
(STAT6-/-
BALB/c),
STAT6-/- mice containing
CD1-/- bone marrow
(CD1-/-
STAT6-/-),
and CD1-/- mice containing
STAT6-/- bone marrow
(STAT6-/-
CD1-/-)
were constructed as follows using aseptic conditions. Donor mice were
asphyxiated with CO2 and immersed in 70%
ethanol, and their hind legs were removed at the hip. Femurs were
dissected away from the surrounding tissue, their ends were cut off,
and the remaining bone was flushed three times with sterile PBS using a
30-ml syringe fitted with a 27-gauge needle. Bone marrow cells were
collected in petri dishes and transferred to 15-ml conical tubes, and
the aggregated material was allowed to gravity settle and was
discarded. The remaining bone marrow cells were washed twice with PBS
and resuspended in medium (RPMI, 1% penicillin, 1% streptomycin, 1%
fungizone) at 200 µl per donor mouse. Recipient mice were taken off
food the evening before bone marrow transfer. Between 0 and 2 h
before bone marrow reconstitution, recipient mice were lethally
irradiated (8.75 Gy, Cs-137 source, Gammator B; Kewaunee Scientific,
Statesville, NC). Bone marrow was inoculated into recipient mice
through the tail vein using a 1-ml syringe fitted with a 27-gauge
needle. Each recipient received 100 µl of donor cells (bone marrow
from one donor femur). Reconstituted mice received daily injections of
gentamicin sulfate i.p. (100 µl of 5 mg/ml) for 7 days beginning 1
day before bone marrow reconstitution. Reconstituted mice were
maintained on 2% tetracycline water starting 12 wk before bone
marrow transfer and continuing for 68 wk after reconstitution. Eight
to 12 wk after bone marrow reconstitution, chimeras were bled from the
tail vein, and the blood was tested by PCR to ascertain hemopoietic
genotype and reconstitution.
All animal procedures have been reviewed and approved by the University of Maryland or National Cancer Institute Institutional Animal Care and Use Committee, and comply with National Institutes of Health guidelines for the humane treatment of laboratory animals.
Treatment with soluble IL-13R
2-Fc
BALB/c mice were inoculated with 7000 4T1 cells in the abdominal
mammary gland on day 0 and given soluble IL-13R
2-Fc
(sIL-13R
2-Fc)3 (0.2
mg/200 µl/dose) every other day from day 0 to 14. Control mice were
treated with human IgG having the same Fc as the Fc of the IL-13
inhibitor.
CTL assays
BALB/c, STAT6-/-, and bone marrow
chimeric mice were immunized with 50 Gy-irradiated 4T1 cells (1 x
106 cells i.p.) once every
14 days for three
to five immunizations. Splenocytes of immunized mice were harvested 5
days after the last immunization and used as effector cells in
overnight (
16-h) assays. CTL assays were performed as described
(3). Percent specific activity is the percentage of
cytotoxicity against 4T1 targets minus percentage of cytotoxicity
against B16 targets.
Flow cytometry
Mouse splenocytes were characterized by flow cytometry using the following mAbs: CD3 FITC, CD4 PE, B220 PE, Mac-1 FITC (Caltag, Burlingame, CA), as described (3).
CD4+CD25+ T cell depletions
The hybridoma PC61 secreting anti-CD25 mAb
(IL-2R
-specific, rat IgG1) (21) was obtained from
American Type Culture Collection (Manassas, VA) and was purified by
protein G affinity column from culture supernatants, as previously
described (12). For in vivo depletions, mice were given
800 µg in 100 µl PBS i.p., as described (8), on day
-4 and were inoculated on day 0 with 7000 4T1 cells in the abdominal
mammary gland. For experiments monitoring survival after surgery, mice
were given 800 µg PC6-5.3 in 100 µl PBS i.p. on day -4 after
inoculation of 7000 4T1 cells; primary tumor was surgically removed on
day 20; and mice were followed for survival. Efficiency of mAb
depletion of CD4+CD25+ T
cells was ascertained by double-staining splenocytes of treated mice
with directly coupled CD25-specific mAb (CD25 FITC; BD PharMingen, San
Diego, CA) and CD4-specific mAb (GK1.5 PE; BD PharMingen) 3 days and 1
wk after inoculation of mAb PC6-5.3. Undepleted mice showed
10% of
the splenocytes as
CD4+CD25+; depleted mice
had 12% of their cells as
CD4+CD25+.
Cytokine production
Naive or surgery-survivor mice were inoculated in an abdominal
mammary gland and/or i.p. with 105 or
106 live or irradiated 4T1 cells. Draining lymph
nodes or spleens were removed 5 days later, and 1 x
106 lymphocytes were cocultured with 3 x
105 80 Gy-irradiated 4T1/B7.1 or B16 melF10
stimulator cells in a total volume of 1 ml in 24-well plates (RPMI,
10% FCS, 5 x 10-5 M 2-ME, 1% penicillin,
1% streptomycin). Supernatants were harvested 48 h later and
tested in triplicate by ELISA for IL-2, IL-4, and IFN-
, according to
the manufacturers directions (Pierce/Endogen, Rockford, IL).
Specific cytokine release was determined by subtracting nonspecific
release (B16 melF10 stimulators) from 4T1-stimulated release.
Statistical analyses
Data were analyzed using unpaired Students t tests (Microsoft Excell, Redmond, WA).
| Results |
|---|
|
|
|---|
To assess the potency of the STAT6 antitumor effect against established metastatic tumor, BALB/c and STAT6-/- mice were inoculated with 4T1 cells, and followed for development of metastasis and survival after surgical removal of primary tumor. Groups of BALB/c and STAT6-/- mice were inoculated in the abdominal mammary gland with 7000 4T1 tumor cells, and the tumors were allowed to grow progressively. Although primary tumors in STAT6-/- mice grow more slowly than primary tumors in BALB/c mice (3), most tumors were 29 mm in diameter within 23 wk of 4T1 inoculation. Previous studies demonstrated that mice with primary tumors >2 mm in diameter have established metastatic disease (13). Surgical removal of primary tumors was completed over a 7-day period so that sizes of primary tumors between the BALB/c and STAT6-/- groups could be matched. Because metastasis is not reliably established when primary tumors are smaller than 2 mm in diameter (13), mice with tumors <2 mm in diameter were omitted from the experiment. Three to four weeks after surgery (4245 days post-4T1 inoculation), mice were sacrificed, and the lungs, liver, and bone marrow were isolated. The number of metastatic cells in each organ was determined using the clonogenic assay (12).
As shown in Table I
,
60% of
postsurgery STAT6-/- mice (12 of 20) do not
have detectable metastasis in the lungs, liver, or bone marrow, while
only 7.5% of intact BALB/c mice (1 of 13) are free of metastasis.
Those STAT6-/- mice that have organ metastases
have fewer metastatic cells per organ than BALB/c mice (a maximum of
3383 metastatic cells/organ in STAT6-/- mice vs
2.8 x 105 in BALB/c mice). Therefore, the
majority of STAT6-/- mice are resistant to the
outgrowth and development of 4T1 metastasis if the primary mammary
tumor is surgically removed.
|
|
STAT6-/- mice that have survived an initial 4T1 challenge are immune to subsequent spontaneous metastatic disease
In earlier studies, CD8+ T cells were shown
to be required for limiting tumor growth in
STAT6-/- mice, indicating that tumor resistance
is immune mediated (3). In these earlier experiments,
primary tumors remained in place, and all mice eventually died from
tumor, even though metastatic disease developed more slowly in
STAT6-/- mice than in BALB/c mice. However,
many STAT6-/- mice with established metastasis
survive indefinitely if their primary tumor is surgically removed (Fig. 1
A). To determine whether these survivors have enhanced
immunity and long-term memory, they were rechallenged with 4T1 tumor.
STAT6-/- mice whose primary tumors were removed
and who survived
185 days (STAT6-/- surgery
survivors from the experiment shown in Fig. 1
A) were
rechallenged in the mammary gland with 7000 4T1 cells and followed for
primary tumor development and survival. The single BALB/c surgery
survivor from Fig. 1
A was also rechallenged, as were naive
BALB/c and STAT6-/- mice. A control group of
STAT6-/- mice whose primary tumor was recently
removed, but which had not as yet gone through long-term survival and
was not reinoculated with 4T1 (STAT6-/- surgery
group), was also included.
As shown in Fig. 2
, the BALB/c surgery
survivor and naive BALB/c mice are dead by day 50, while naive
STAT6-/- mice die more slowly, but 100% are
dead by day 88. In contrast, 75% of the
STAT6-/- long-term surgery survivors survive
>350 days after their second 4T1 challenge, whereas only 45% of
STAT6-/- surgery mice survived long term.
Surgical removal of primary tumor, therefore, results in induction of
long-term antitumor immunity in up to 75% of
STAT6-/- mice, or selects for animals that are
more inherently resistant.
|
We originally hypothesized that deletion of the STAT6 gene
resulted in skewing of the CD4+ T cell population
toward a Th1 phenotype, thereby enhancing CD8-mediated tumor immunity.
However, Ab depletion experiments demonstrated that although
CD8+ T cells are involved,
CD4+ T cells are not required (3).
Deletion of the STAT6 gene, therefore, results in enhanced tumor
immunity via a mechanism independent of Th1 CD4+
T cells. To understand the mechanism of enhanced immunity in
STAT6-/- mice, we need to identify the cells
that must be STAT6 deficient. Because CD8+ T
cells are the effector cells against 4T1 tumor (3), we
asked whether it was sufficient that CD8+ T cells
be knocked out for the STAT6 gene. To test this hypothesis, BALB/c mice
with STAT6-/- bone marrow were prepared.
Experimental chimeras (STAT6-/- bone marrow
into lethally irradiated BALB/c mice;
STAT6-/-
BALB/c), control chimeras (BALB/c
bone marrow into lethally irradiated STAT6-/-
mice; BALB/c
STAT6-/-), and control naive
STAT6-/- and BALB/c mice were inoculated in the
abdominal mammary gland with 7000 4T1 cells. Onset and progression of
primary tumors did not significantly differ between the groups. Primary
tumors were surgically removed 1521 days later when they measured
between 2.8 and 7 mm in diameter and when metastatic disease was firmly
established. The mice were then followed for survival. As shown in Fig. 3
A, the chimeras and control
BALB/c mice are dead by day 45 post-4T1 inoculation, while 46% of the
STAT6-/- mice survive >350 days.
STAT6-/- hemopoietic derived cells, therefore,
are not sufficient for enhanced tumor immunity, suggesting that
STAT6-/- nonhemopoietic derived cells or both
hemopoietic and nonhemopoietic STAT6-/- cells
are required.
|
BALB/c; and STAT6-/- bone
marrow into STAT6-/- mice,
STAT6-/-
STAT6-/-).
These chimeras along with control naive BALB/c and
STAT6-/- mice were inoculated with 7000 4T1
cells in the abdominal mammary gland. Primary mammary tumors were
surgically removed at 23 wk when tumors were 36 mm in diameter, and
the mice were followed for survival. As shown in Fig. 3
BALB/c
chimeras died by day 47 post-4T1 inoculation. In contrast, 57.1% of
the STAT6-/- mice and 75% of the
STAT6-/-
STAT6-/-
chimeras survive
100 days. Enhanced immunity, therefore, requires
cells and/or components derived from both hemopoietic and
nonhemopoietic compartments.
Earlier in vivo depletion studies demonstrated that
CD8+ T cells are required for enhanced immunity
to 4T1 mammary carcinoma in STAT6-/- mice. In
vitro assays using splenocytes from BALB/c and
STAT6-/- mice immunized with 4T1 showed a
strong correlation between tumor rejection and the development of
tumor-specific CD8+ CTL (3). To
further test whether CTL activity reflects antitumor activity, bone
marrow chimeric mice were immunized with irradiated 4T1 tumor cells,
and splenocytes were tested for CTL activity against 4T1 and irrelevant
B16 melanoma target cells. As shown in Fig. 3
C,
4T1-immunized STAT6-/-mice have specific CTL
activity, while STAT6-/-
BALB/c,
BALB/c
STAT6-/-, and BALB/c mice do not.
Splenocyte in vitro cytotoxic activity to tumor, therefore, correlates
with in vivo tumor rejection, and STAT6-/- bone
marrow reconstitution alone is not sufficient to generate
tumor-specific cytotoxic activity.
CD1-deficient mice have enhanced immunity to metastatic mammary carcinoma, but not to primary mammary carcinoma
Earlier studies identified NKT cells and IL-13 as potential
inhibitors of tumor immunity to the HIV gp160-transfected 15-12RM 11
fibrosarcoma (1). To determine whether NKT cells and IL-13
also inhibit immunity to metastatic 4T1 tumor, NKT cell-deficient and
IL-13-deficient CD1-/- mice were tested.
CD1-/- mice were inoculated in the abdominal
mammary gland with 7000 4T1 cells. Primary tumors were removed from the
CD1-/- and control BALB/c and
STAT6-/- mice at 23 wk, and the mice were
followed for survival. As shown in Fig. 4
A, 100% of control BALB/c
mice were dead by day 52, while 80 and 60% of
CD1-/- and STAT6-/-
mice, respectively, survived >100 days. Elimination of NKT cells and
accompanying reduction in IL-13, therefore, produce resistance to 4T1
metastasis.
|
|
As seen in the experiments of Fig. 3
, enhanced immunity in
STAT6-/- mice requires hemopoietic and
nonhemopoietic derived cells. If STAT6-/- and
CD1-/- mice share a common mechanism underlying
their enhanced immunity, then chimeras of
STAT6-/- or CD1-/- bone
marrow and recipients may have enhanced immunity. To test this
hypothesis, STAT6-/- recipients were
reconstituted with CD1-/- bone marrow
(CD1-/-
STAT6-/-
chimeras), and CD1-/- recipients were
reconstituted with STAT6-/- bone marrow
(STAT6-/-
CD1-/-).
The chimeras, along with control STAT6-/-,
CD1-/-, and wild-type BALB/c mice, were
challenged with 7000 4T1 cells in the abdominal mammary gland, their
primary tumors were removed 23 wk later, and the mice were followed
for survival time. As shown in Fig. 4
B, 70% of
STAT6-/- and 100% of
CD1-/- mice survived >150 days, while 100% of
both chimeras died within 53 days. Therefore,
STAT6-/- and CD1-/-
hemopoietic derived cells are not equivalent in terms of tumor
immunity, and it is likely that enhanced immunity in
STAT6-/- and CD1-/-
mice is mediated by different mechanisms, or that they have defects in
distinct steps of the relevant regulatory pathway.
Inhibition of IL-13 in BALB/c mice does not facilitate tumor immunity to primary or metastatic 4T1 mammary carcinoma
As demonstrated by earlier studies, mice treated with an inhibitor
for IL-13 (sIL-13R
2-Fc) are resistant to recurrence of the 15-12RM
gp160-transfected fibrosarcoma (1). This result, coupled
with the observation that NKT-deficient CD1-/-
mice, as well as IL-13-nonresponsive STAT6-/-
mice, and IL-4R
-/- mice are also resistant
to 15-12RM (1), supports the hypothesis that IL-13
produced by NKT cells blocks activation of CD8+ T
cells. Inhibition of IL-13 by sIL-13R
2 therefore blocks IL-13
activity, and allows tumor-specific CD8+ T cells
to differentiate (1). To determine whether enhanced
immunity to 4T1 in STAT6-/- mice is due to
nonresponsiveness to IL-13, BALB/c mice were treated with the IL-13
inhibitor, sIL-13R
2-Fc, and inoculated with 4T1. Groups of BALB/c
mice were either treated with sIL-13R
2-Fc or a control human IgG
starting on day 0, and inoculated in the abdominal mammary
gland with 7000 4T1 cells. Inhibitor or control IgG treatment was
continued for the first 2 wk of tumor growth. On day 26, primary tumors
were surgically removed, and the mice were followed for survival. As
shown in Fig. 5
, neither primary tumor
progression (Fig. 5
A) nor survival following surgical
removal of primary tumor (Fig. 5
B) is altered by
sIL-13R
2-Fc treatment, suggesting that inhibition of IL-13 does not
yield enhanced tumor immunity to the 4T1 mammary carcinoma.
|
CD4+CD25+ T cells have
also been shown to inhibit the activation of CD8+
T cytotoxic cells (8, 9, 11). To determine whether
CD4+CD25+ T regulatory
cells inhibit activation of 4T1-specific CD8+ T
cells, BALB/c mice were depleted for
CD4+CD25+ T cells before
inoculation with 4T1 mammary carcinoma. BALB/c mice were either
untreated or given CD25 mAb starting on day -4, and inoculated with
7000 4T1 cells in the abdominal mammary gland on day 0. In one group of
mice, progression of primary tumors was followed. In a second group of
mice, primary tumors were surgically excised on day 21, and the mice
were followed for survival. Depletion of
CD4+CD25+ T cells does not
alter growth of primary 4T1 (Fig. 6
A) nor survival (Fig. 6
B). Therefore, inactivation of
CD4+CD25+ T regulatory
cells is not responsible for enhanced immunity to 4T1 primary tumor or
metastatic disease in STAT6-/- mice.
|
is essential for tumor resistance in STAT6-/-
mice
To determine whether tumor resistance correlated with differential
cytokine production, draining lymph node cells of
STAT6-/- and BALB/c mice were assayed. Mice
were inoculated in an abdominal mammary gland with 4T1 cells, and 5
days later draining inguinal lymph nodes were removed and cocultured
with irradiated 4T1/B7.1 or irrelevant stimulators. A total of 21
STAT6-/- and 17 BALB/c mice were tested in
seven separate experiments. Fig. 7
A shows the pooled results of
these experiments. STAT6-/-, but not BALB/c
mice produce high levels of IFN-
, while BALB/c mice produce more
IL-4 than STAT6-/- mice. Both strains produce low levels
of IL-2. If 100 pg/ml of IFN-
is used as a cutoff for responders,
then 62% of the STAT6-/- mice produce IFN-
,
which is approximately equal to the percentage of
STAT6-/- mice that survive in a typical surgery
experiment.
|
production is essential for enhanced tumor
resistance in STAT6-/- mice, double knockout
STAT6-/-IFN-
-/-
mice were inoculated in the abdominal mammary gland with 4T1 cells, and
followed for survival after surgical removal of primary tumor. As
shown in Fig. 7
-/- and
IFN-
-/- mice die by day 62, while 87% of
the STAT6-/- mice survive. Therefore, IFN-
is essential for enhanced tumor resistance in
STAT6-/- mice. | Discussion |
|---|
|
|
|---|
Because any immune system cells that might be involved are bone marrow
derived, we expected that reconstitution of BALB/c mice with
STAT6-/- bone marrow would generate mice that
were as tumor resistant as STAT6-/- mice.
Surprisingly, STAT6-/-
BALB/c chimeras
were just as susceptible as BALB/c mice. Because the STAT6 gene is
deleted in all cells of STAT6-/- mice
(17), the bone marrow chimera data are consistent with the
hypothesis that both hemopoietic and nonhemopoietic cells contribute to
the antitumor phenotype. STAT6-/- bone marrow
may not give a tumor immune phenotype in BALB/c recipients because
STAT6-/- stem cells may require a
STAT6-/- thymus for appropriate development.
STAT6-/- thymic epithelium may provide
different signals during positive selection that result in positive
selection of a different T cell repertoire than that generated in
wild-type STAT6+/+ mice. Alternatively, negative
selection may be impacted by the STAT6 deletion and result in a T cell
repertoire that includes CD8+ T cells that would
normally be deleted during negative selection in
STAT6+/+ mice. In either case, the novel T cell
repertoire could contain CD8+ T cells that when
activated are more effective against metastatic tumor. A third
alternative is that the regulatory pathway requires a nonhemopoietic
cell, or a cell that survives the radiation treatment used to prepare
the chimeras.
The mechanism underlying tumor resistance to 4T1 in
STAT6-/- mice remains unclear. It was
originally hypothesized that enhanced immunity in
STAT6-/- mice is due to preferential production
of CD4+ Th1 cells. However, in vivo depletion of
CD4+ T cells does not reduce tumor resistance,
indicating that CD4+ T cells are not required for
enhanced immunity (3). However, IFN-
, a cytokine that
is pivotal for Th1 cell differentiation, is produced early after 4T1
inoculation and is essential for enhanced immunity because
IFN-
-deficient STAT6-/- mice are as
susceptible to 4T1 as are wild-type BALB/c mice. IFN-
is a highly
pleiotropic cytokine that has many functions in addition to its role in
Th1 differentiation (24, 25), and any of these additional
activities could facilitate tumor rejection in
STAT6-/- mice.
CD4+CD25+ T cells have also been proposed as inhibitors of tumor immunity. Inhibitory CD4+ T cells were first described by North et al. (26) over 17 years ago. More recently, immunosuppressive T cells have been phenotyped, when studies in autoimmune systems led to the identification of CD4+CD25+ T cells that regulate/suppress autoreactive CD8+ T effector cells (9, 10, 11). The inhibitory effects of CD25+CD4+ T cells on tumor immunity have also been demonstrated in several tumor systems (8, 27). Although it is likely that STAT6-/- mice have enhanced immunity because of deletion of an inhibitor, the CD25-depletion studies performed in this work demonstrate that CD4+CD25+ T cells are not the relevant inhibitor in STAT6-/- mice.
Earlier studies using the 15-12RM fibrosarcoma and
CD1-/- and STAT6-/-
mice led to the hypothesis that IL-13, secreted by NKT cells, inhibits
the differentiation of tumor-specific CD8+ T
cells by acting on an intermediate cell through a STAT6-dependent
pathway (1). Although our studies confirm that
NKT-deficient CD1-/- mice also have enhanced
immunity to 4T1 tumor, inhibition of IL-13 alone is not sufficient
because treatment of BALB/c mice with the IL-13 inhibitor,
sIL-13R
-Fc, does not produce 4T1-resistant mice. Because
STAT6-/- mice are also deficient for response
to IL-4 activity, IL-4 is another candidate inhibitor. However,
previous studies using BALB/c IL-4-/- mice
demonstrated that these mice also do not have enhanced immunity to 4T1
primary tumor or metastatic disease (28) or to 15-12RM
(1). Therefore, neither loss of response to IL-13 nor loss
of response to IL-4 alone is sufficient for the resistance of
STAT6-/- mice to 4T1 metastatic disease.
Furthermore, neither
STAT6-/-
CD1-/- nor
CD1-/-
STAT6-/- bone
marrow chimeras have enhanced immunity to 4T1 metastatic disease, so it
is likely that resistance in STAT6-/- and
CD1-/- mice occurs via noncomplementing steps
in the same regulatory pathway or via different mechanisms.
STAT6 transduces the signal from both IL-4 and IL-13, and
IL-13 and IL-4 bind to the same receptor (type II IL-4R consisting of
IL-4R
and IL-13R
1 chains) (29). Therefore,
elimination of the activity of both cytokines simultaneously may be
necessary for enhanced immunity because IL-4 may compensate for the
absence of IL-13 and vice versa (30). In preliminary
experiments, we have tested this hypothesis in BALB/c mice depleted of
IL-4 by in vivo treatment with an anti-IL-4 mAb (11B11) and
simultaneously treated with the IL-13 inhibitor. These mice showed no
enhanced immunity to 4T1 in a postsurgery setting (M. Terabe, J. M.
Park, and J. A. Berzofsky, unpublished results). Similarly,
IL-4R
-/- mice, which are incapable of
transmitting either IL-13 or IL-4 signals, showed no enhanced immunity
to 4T1 (Clements and Ostrand-Rosenberg, unpublished results).
Simultaneous elimination of IL-4 plus IL-13, therefore, does not result
in immunity to primary and/or metastatic 4T1 tumor.
As a transcriptional regulatory factor, STAT6 is well positioned to
modulate expression of numerous critical inhibitory molecules. The role
of STAT6 protein in IL-13 and IL-4 activity is well known; however,
STAT6 may also play a role in the expression or activity of as yet
uncharacterized cells and/or cytokines and/or other molecules that
inhibit tumor immunity. For example, STAT6 may activate a novel factor
that stimulates CD25- regulatory T cells
(suppressor cells), which in turn inhibit differentiation of
tumor-specific CD8+ T lymphocytes.
STAT6-/- mice, therefore, would not contain the
inhibitory T cells, and tumor-specific CD8+ T
cells would be produced and mediate tumor regression. Alternatively,
NKT cells may secrete a novel molecule (in addition to IL-4 or IL-13)
that acts via the STAT6 pathway to block tumor-specific
CD8+ T cell differentiation. If this novel
molecule uses a receptor other than IL-4R
, then
CD1-/- and STAT6-/-
mice would show enhanced immunity because one strain would not produce
and the other strain would not respond to the inhibitory molecule.
Although we cannot at present distinguish between these hypothetical
mechanisms, it is intriguing to speculate that a novel
molecule/cell/cytokine produced by or in response to NKT cells and
operating via a STAT6 pathway negatively regulates tumor immunity. Such
a factor could be responsible for the absence of effective tumor
immunity in tumor-bearing or tumor-immunized individuals, and could be
a target for future immunotherapies.
| Acknowledgments |
|---|
-/- mice, Drs. Michael
Grusby and Luc van Kaer for generously supplying multiple mating pairs
of STAT6-/- and CD1-/- mice, respectively,
and Dr. Debra Donaldson (Wyeth Laboratories, Boston, MA) for
providing the IL-13 inhibitor. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Suzanne Ostrand-Rosenberg, Department of Biological Sciences, University of Maryland, 1000 Hilltop Circle, Baltimore, MD 21250. E-mail address: srosenbe{at}umbc.edu ![]()
3 Abbreviations used in this paper: sIL-13R
2-Fc, soluble IL-13R
2-Fc; TD, tumor diameter. ![]()
Received for publication November 12, 2001. Accepted for publication September 11, 2002.
| References |
|---|
|
|
|---|
chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155:1151.[Abstract]
. Cancer Immunol. Immunother. 49:34.[Medline]
. Annu. Rev. Immunol. 15:749.[Medline]
interferon in antimicrobial immunity. Curr. Opin. Microbiol. 4:251.[Medline]
-dependent phagocytic cells are a critical component of innate immunity to metastatic mammary carcinoma. Cancer Res. 62:4406.This article has been cited by other articles:
![]() |
J. B. Swann, A. P. Uldrich, S. van Dommelen, J. Sharkey, W. K. Murray, D. I. Godfrey, and M. J. Smyth Type I natural killer T cells suppress tumors caused by p53 loss in mice Blood, June 18, 2009; 113(25): 6382 - 6385. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Pilones, N. Kawashima, A. M. Yang, J. S. Babb, S. C. Formenti, and S. Demaria Invariant Natural Killer T Cells Regulate Breast Cancer Response to Radiation and CTLA-4 Blockade Clin. Cancer Res., January 15, 2009; 15(2): 597 - 606. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Berzofsky and M. Terabe NKT Cells in Tumor Immunity: Opposing Subsets Define a New Immunoregulatory Axis J. Immunol., March 15, 2008; 180(6): 3627 - 3635. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Bunt, L. Yang, P. Sinha, V. K. Clements, J. Leips, and S. Ostrand-Rosenberg Reduced Inflammation in the Tumor Microenvironment Delays the Accumulation of Myeloid-Derived Suppressor Cells and Limits Tumor Progression Cancer Res., October 15, 2007; 67(20): 10019 - 10026. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ambrosino, M. Terabe, R. C. Halder, J. Peng, S. Takaku, S. Miyake, T. Yamamura, V. Kumar, and J. A. Berzofsky Cross-Regulation between Type I and Type II NKT Cells in Regulating Tumor Immunity: A New Immunoregulatory Axis J. Immunol., October 15, 2007; 179(8): 5126 - 5136. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lizee, L. G. Radvanyi, W. W. Overwijk, and P. Hwu Improving Antitumor Immune Responses by Circumventing Immunoregulatory Cells and Mechanisms. Clin. Cancer Res., August 15, 2006; 12(16): 4794 - 4803. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawakami, M. Terabe, M. Kawakami, J. A. Berzofsky, and R. K. Puri Characterization of a Novel Human Tumor Antigen Interleukin-13 Receptor {alpha}2 Chain. Cancer Res., April 15, 2006; 66(8): 4434 - 4442. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Terabe, C. Khanna, S. Bose, F. Melchionda, A. Mendoza, C. L. Mackall, L. J. Helman, and J. A. Berzofsky CD1d-Restricted Natural Killer T Cells Can Down-regulate Tumor Immunosurveillance Independent of Interleukin-4 Receptor-Signal Transducer and Activator of Transcription 6 or Transforming Growth Factor-{beta}. Cancer Res., April 1, 2006; 66(7): 3869 - 3875. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Terabe, J. Swann, E. Ambrosino, P. Sinha, S. Takaku, Y. Hayakawa, D. I. Godfrey, S. Ostrand-Rosenberg, M. J. Smyth, and J. A. Berzofsky A nonclassical non-V{alpha}14J{alpha}18 CD1d-restricted (type II) NKT cell is sufficient for down-regulation of tumor immunosurveillance J. Exp. Med., December 19, 2005; 202(12): 1627 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sinha, V. K. Clements, and S. Ostrand-Rosenberg Interleukin-13-regulated M2 Macrophages in Combination with Myeloid Suppressor Cells Block Immune Surveillance against Metastasis Cancer Res., December 15, 2005; 65(24): 11743 - 11751. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang and G. G. Meadows Chronic alcohol consumption in mice increases the proportion of peripheral memory T cells by homeostatic proliferation J. Leukoc. Biol., November 1, 2005; 78(5): 1070 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. McKallip, M. Nagarkatti, and P. S. Nagarkatti {Delta}-9-Tetrahydrocannabinol Enhances Breast Cancer Growth and Metastasis by Suppression of the Antitumor Immune Response J. Immunol., March 15, 2005; 174(6): 3281 - 3289. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sinha, V. K. Clements, and S. Ostrand-Rosenberg Reduction of Myeloid-Derived Suppressor Cells and Induction of M1 Macrophages Facilitate the Rejection of Established Metastatic Disease J. Immunol., January 15, 2005; 174(2): 636 - 645. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Gumperz CD1d-restricted "NKT" cells and myeloid IL-12 production: an immunological crossroads leading to promotion or suppression of effective anti-tumor immune responses? J. Leukoc. Biol., August 1, 2004; 76(2): 307 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mitsuhashi, J. Liu, S. Cao, X. Shi, and X. Ma Regulation of interleukin-12 gene expression and its anti-tumor activities by prostaglandin E2 derived from mammary carcinomas J. Leukoc. Biol., August 1, 2004; 76(2): 322 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Ma, M. J. Whitters, B. A. Jacobson, D. D. Donaldson, M. Collins, and K. Dunussi-Joannopoulos Tumor cells secreting IL-13 but not IL-13R{alpha}2 fusion protein have reduced tumorigenicity in vivo Int. Immunol., July 1, 2004; 16(7): 1009 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guiducci, E. Di Carlo, M. Parenza, M. Hitt, M. Giovarelli, P. Musiani, and M. P. Colombo Intralesional Injection of Adenovirus Encoding CC Chemokine Ligand 16 Inhibits Mammary Tumor Growth and Prevents Metastatic-Induced Death after Surgical Removal of the Treated Primary Tumor J. Immunol., April 1, 2004; 172(7): 4026 - 4036. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Terabe, S. Matsui, J.-M. Park, M. Mamura, N. Noben-Trauth, D. D. Donaldson, W. Chen, S. M. Wahl, S. Ledbetter, B. Pratt, et al. Transforming Growth Factor-{beta} Production and Myeloid Cells Are an Effector Mechanism through Which CD1d-restricted T Cells Block Cytotoxic T Lymphocyte-mediated Tumor Immunosurveillance: Abrogation Prevents Tumor Recurrence J. Exp. Med., December 1, 2003; 198(11): 1741 - 1752. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |