|
|
||||||||
Department of Microbiology, National Public Health Institute, Helsinki, Finland
| Abstract |
|---|
|
|
|---|
production. Besides
functional similarities, IL-23 bears structural resemblance to IL-12.
Biologically active IL-23 is a heterodimer whose p40 subunit is
identical to IL-12p40 while its p19 subunit is distantly related to
IL-12p35. In the present study we demonstrate that human
monocyte-derived macrophages are able to produce IL-23 in response to
virus infection. Sendai virus stimulates the expression of p19 and p40
mRNAs in macrophages. Furthermore, it enhances p35 mRNA expression and
the production of IL-12. Influenza A virus, in contrast, fails to
stimulate IL-12 or IL-23 expression in macrophages. IL-12 and IL-23
contribute to the IFN-
-inducing activity that cell culture
supernatant from Sendai virus-infected macrophages show in NK-92 cells.
The induction of IFN-
production occurs in concert with IFN-
and IL-18, which are also secreted from the virus-infected cells. The
IFN-
-inducing activity is inhibited by IL-4, which down-regulates
the transcription of p19 and p40 genes
and the secretion of IFN-
, IL-12, and IL-18. IFN-
, in
contrast, up-regulates the p19 and p40 mRNA expression in Sendai virus
infection. Thus, IL-4 and IFN-
serve as opposing factors in the
regulation of IFN-
-inducing cytokines, including IL-23, in
macrophages. | Introduction |
|---|
|
|
|---|

, IL-12,
and IL-18 are particularly important in the interactions between the
innate and adaptive arms of immunity. IFN-
possesses antiviral
activity against several viruses and, like, IL-12 and IL-18, has
proinflammatory and chemotactic properties (1, 2, 3). First,
IFN-
, IL-12, and IL-18 direct the immune response against viruses
toward cell-mediated immunity. They enhance the generation and activity
of cytotoxic NK and T cells and favor Th1 differentiation. In response
to synergistic actions of IFN-
, IL-12 and IL-18 NK and T cells
produce IFN-
(4, 5, 6, 7, 8), which, consecutively, is
critically required for macrophage activation (9).
Recently, a new IFN-
-inducing cytokine, IL-23, was discovered
(10). Functional IL-23 is a heterodimer that shares its
p40 subunit with IL-12. Another subunit of IL-23 is p19, a novel
protein that is distantly related to p35 of IL-12. Biological
properties of IL-23 result from interaction of p19p40 complex with
IL-12R
1, the p40-specific component of IL-12R, and an unique
p19p40-specific receptor component termed IL-23R (10, 11).
Like engagement of IL-12R by IL-12, binding of IL-23 to its receptor
complex activates Janus kinase-Stat signaling cascade (10, 11). Not surprisingly, IL-23 has biological activities
comparable to though distinct from IL-12. Similar to IL-12, IL-23
enhances proliferation of T cells and increases their IFN-
production (10). Abnormal phenotype of p19 transgenic mice
resembles that of IL-12 transgenic mice (12), and this
suggests more functional similarities between IL-23 and IL-12.
While IFN-
and IL-18 are shown to be essential for the immunity
to viruses (1, 13), IL-12 is proposed to play a modest
part in the antiviral resistance. In mice IL-12 does contribute to
early control of several virus infections, including that of influenza
A (14, 15, 16), whereas certain viruses, like measles virus
and HIV, can selectively inhibit IL-12 production and induce
immunosuppression (17, 18, 19). The role of IL-23 in microbial
infections is still an unexplored area. Human and murine dendritic
cells secrete IL-23 after activation with LPS (10), but
nothing is known about IL-23 expression during viral infections. We
have previously shown that influenza A and Sendai virus infections in
macrophages generate different expression patterns of IFN-
and
IL-18 (20). Sendai virus is a better enhancer of
IFN-
production, whereas influenza A infection results in a more
pronounced IL-18 secretion that is partly regulated by IFN-
through caspase activation (21). In this report, we
demonstrate that Sendai virus-infected human primary macrophages also
produce IL-12 and IL-23. Sendai virus enhances mRNA expression of p19,
p35, and p40 subunits of IL-12 and IL-23. Thus, Sendai virus is a
potential stimulator of four distinct IFN-
-inducing cytokines in
macrophages. Influenza A virus infection, instead, does not induce p19,
p35, or p40 mRNA expression, which supports the concept that IL-12- and
IL-23-independent, but IFN-
- and IL-18-dependent, mechanisms of
IFN-
production are operative in influenza A virus infection.
| Materials and Methods |
|---|
|
|
|---|
Macrophages from healthy blood donors were isolated and purified as previously described (20). In brief, to obtain macrophages PBLs were subjected to Ficoll-Paque (Pharmacia Biotech, Uppsala, Sweden) gradient centrifugation and depleted from lymphocytes by allowing monocytes to adhere onto six-well cell culture plates (Falcon Multiwell; BD Biosciences, Franklin Lakes, NJ). Monocytes were grown into differentiated macrophages by culturing them for 2 wk in serum-free medium (Life Technologies, Gaithersburg, MD) supplemented with GM-CSF (10 ng/ml; Schering-Plough, Innishannon, Ireland).
Virus stocks and infections
Human pathogenic influenza A virus (strain Beijing/353/89, H3N2) and murine Sendai virus (strain Cantell) were grown as previously described (20). Macrophages were infected with 250 hemagglutination units per milliliter of influenza A and 150 hemagglutination units per milliliter of Sendai virus in serum-free medium. After adsorption for 1 h, virus inoculum was removed and the cells were washed with PBS and fed with RPMI 1640 medium containing 10% FCS. The cells and cell culture supernatants were harvested 324 h after the infection and samples for Northern blotting, ELISA, and biological IFN analyses were prepared. Each sample represents a pool of separately infected macrophages from four to six different donors.
Cytokines and Abs
Highly purified human leukocyte IFN-
was provided by the
Finnish Red Cross Blood Transfusion Service (Helsinki, Finland).
Recombinant human IL-4 and IL-12 were purchased from R&D Systems
(Abingdon, U.K.), and recombinant human IL-18 was from Hayashibara
Biochemical Laboratories (Okayama, Japan). Neutralizing Abs against
human IFN-
and anti-IL-18 Ab have been described previously
(20, 22). Anti-IL-12 Ab was from R&D Systems. To obtain
anti-IL-23 Ab for Western blotting, rabbits were immunized with
purified glutathione S-transferase-p19 fusion protein (three
injections of 20 µg at 0, 2, and 6 wk). The fusion protein was
manufactured as follows. The coding sequence of p19 was
obtained from total macrophage cellular RNA by RT-PCR (TaqMan RT
system; Promega, Madison, WI) using BglII sites containing
oligonucleotides CAGGGCAGATCTGTGCCTGGGGGCAGC and
AGGGTTAGATCTCCATGGGCAAAGACC. The amplified fragment of
p19 was ligated into BamHI site of the
pGEM-3zf(+) vector (Promega). After sequence analysis, the
p19 insert was subcloned into the pGEX-2T vector (Pharmacia
Biotech). p19 was expressed in Escherichia coli B
strain BL21(DE3) as a glutathione S-transferase fusion
protein and purified in a preparative SDS-PAGE (Prep-Cell; Bio-Rad,
Richmond, CA).
Cytokine ELISAs
The amounts of IL-1
, IL-12, IL-18, TNF-
, and IFN-
in
cell culture supernatants were determined by specific ELISAs. IL-1
and TNF-
ELISAs were purchased from R&D Systems, and IL-12 and
IFN-
ELISAs were from Nordic Biosite (Täby, Sweden). IL-18
ELISA was obtained from Fujisaki Institute (Hayashibara Biochemical
Laboratories) (23).
Biological assay for IFN-

Macrophage culture supernatants were assayed for the presence of
IFN-
in Hep2 cells by vesicular stomatitis virus plaque reduction
(24). The results are expressed as international units per
milliliter using an international control IFN-
preparation as a
standard.
IFN-
-inducing activity of macrophage-derived cytokines
The IFN-
-inducing activity of macrophage-derived cytokines
was measured in a NK-92 cell line (ATCC CRL-2407) that has
characteristics of human NK cells. Cell culture supernatants from
virus-infected macrophages were incubated with NK-92 cells (3 x
106 cells/ml) in 24-well cell culture plates
(Falcon Multiwell; BD Biosciences). After a 20-h incubation, NK-92 cell
supernatants were collected and the amount of IFN-
in the
supernatants was determined by ELISA. To dissect the effect of
individual cytokines, different combinations of neutralizing Abs
against IFN-
, IL-12, and IL-18 were added into macrophage
supernatants before subjecting them onto NK-92 cells.
Western blot analysis
Western blot samples from virus-infected macrophages were separated (30 µg of protein per lane) on 15% SDS-PAGE with the Laemmli buffer system. Proteins separated on gels were transferred onto Immobilon-P membranes (Millipore, Bedford, MA) with an Isophor electrotransfer apparatus (Hoeffer Scientific Instruments, San Francisco, CA) at 200 mA for 2 h. The membranes were blocked with PBS containing 5% nonfat milk. The blots were stained with anti-p19 Ab for 1 h at room temperature, followed by secondary staining (1 h at room temperature) with peroxidase-conjugated goat anti-rabbit IgG (Bio-Rad). The protein bands in filters were visualized by the ECL system (Amersham, Little Chalfont, U.K.).
RNA isolation and Northern blot analysis
Total cellular RNA from macrophages was isolated by guanidium
isothiocyanate lysis followed by centrifugation through a CsCl cushion.
Aliquots of RNA (20 µg) were size-fractionated on 1%
formaldehyde-agarose gels and blotted to Hybond-N membranes (Amersham).
The membranes were hybridized with human p35 and
p40 (25), and p19 cDNA probes. The
p19 probe was cloned from total cellular RNA obtained from
macrophages by RT-PCR using oligonucleotides TGCAAAGGATCCACCAGGGTCTGA
(sense) and TGAGTGGGATCCTTGAGCTGCTGC (antisense). The probes were
labeled with [
-32P]dCTP (3000 Ci/mmol;
Amersham) by a random-primed DNA labeling kit purchased from Boehringer
Mannheim (Mannheim, Germany). Hybridizations were performed at 42°C
in a solution containing 50% formamide, 5x Denhardts solution, 5x
standard saline citrate phosphate/EDTA, and 0.5% SDS. After
washing with 1x SSC supplemented with 0.1% SDS at room temperature
and once at 60°C for 30 min, the filters were exposed to Kodak AR
X-Omat films (Eastman Kodak, Rochester, NY) at -70°C in intensifying
screens. For controlling equal RNA loading, rRNA bands were visualized
by EtBr staining.
| Results |
|---|
|
|
|---|
Influenza A and Sendai viruses differ in their ability to
stimulate IFN-
and IL-18 production in human macrophages, and
this is reflected by the dissimilar IFN-
-inducing activity in T and
NK cells (7, 8, 20). We have further studied the
regulation of IFN-
-inducing cytokines in macrophages during virus
infection and analyzed the expression of IL-12 and IL-23. mRNA for
IL-12 or IL-23 was not basally expressed in macrophages, but infection
with Sendai virus activated gene expression of p35 and p40 subunits of
IL-12 as well as expression of IL-23-specific subunit p19 (Fig. 1
). p19 mRNA expression was induced at
6 h after Sendai virus infection and it persisted up-regulated up
to 24 h, whereas the expression of p35 and p40 mRNAs peaked
already at 3 h postinfection. Influenza A virus, in contrast, was
not able to enhance p19, p35, or p40 mRNA expression in macrophages
(Fig. 1
). It also failed to stimulate secretion of p35p40, the
biologically active IL-12 heterodimer that was produced in response to
Sendai virus infection. In fact, during Sendai virus infection
macrophages produced as much as 1800 pg/ml IL-12 (Fig. 2
). Similarly, only Sendai virus was able
to stimulate expression of p19 protein (Fig. 3
).
|
|
|
production in NK-92 cells
IFN-
, IL-12, IL-18, and IL-23 all posses IFN-
-inducing
activity (4, 7, 10, 15, 26). To test which of these
cytokines are involved in IFN-
stimulation during virus infection we
stimulated NK-92 cells with supernatants from influenza A or Sendai
virus-infected macrophages. Both influenza A and Sendai virus
infections induced a release of factors that resulted in IFN-
production from NK-92 cells (Fig. 4
).
When supernatants from influenza A virus-infected macrophages were
treated with neutralizing anti-IFN-
Abs the IFN-
-inducing
activity was completely abrogated. Anti-IL-18 Abs also diminished
IFN-
production, whereas anti-IL-12 Abs had no effect on IFN-
induction by influenza A supernatants. IFN-
also mediated Sendai
virus-induced IFN-
activity. However, anti-IFN-
Abs in
supernatants of Sendai virus-infected macrophages only partially
inhibited IFN-
production from NK-92 cells. Treatment of
supernatants with anti-IL-12 and anti-IL-18 Abs showed that in
the case of Sendai virus IFN-
-inducing cytokines include also IL-12
and IL-18.
|
up-regulates virus-induced p19, p35, and p40 mRNA
expression
IFN-
is suggested to enhance IFN-
, IL-12, and IL-18
expression in macrophages (27, 28, 29). We studied the effect
of IFN-
on IL-23 production by treating macrophages with IFN-
(10
IU/ml) 20 h before influenza A or Sendai virus infection. IFN-
alone could not stimulate p19 mRNA expression, but priming the cells
with IFN-
strongly enhanced the Sendai virus-induced expression of
p19 mRNA (Fig. 5
). Similarly, p35 and p40
gene expression was increased in IFN-
-pretreated and Sendai
virus-infected macrophages. However, IFN-
priming could not activate
p19, p35, or p40 gene expression in
influenza A virus-infected cells.
|
Macrophage functions are negatively controlled through the
activity of IL-4 (30). During influenza A and Sendai virus
infections IL-4 had substantial effects on cytokine expression in
macrophages. Treatment of macrophages with IL-4 for 0.520 h before
virus inoculum reduced p19 and p40 mRNA expression in Sendai
virus-infected cells (Fig. 6
). The
down-regulation of IL-12 gene expression through diminished p40 mRNA
expression was followed by reduced IL-12 protein release in response to
Sendai virus infection (Fig. 7
). In
addition, secretion of IFN-
, IL-1
, and IL-18 was considerably
diminished in IL-4-primed macrophages. This effect was seen during both
Sendai and influenza A virus infections (Fig. 7
). Virus-induced TNF-
production was not significantly affected by IL-4 (Fig. 7
).
|
|

, IL-12, IL-18, and
IL-23 expression was seen as a lower IFN-
-inducing activity.
Supernatants from IL-4-treated and virus-infected macrophages induced
less IFN-
from NK-92 cells than IL-4-nontreated and virus-infected
control cells (Fig. 8
amounts was comparable to the reduction provoked by
anti-IFN-
, anti-IL-12, and anti-IL-18 Abs (Fig. 4
|
| Discussion |
|---|
|
|
|---|

, IL-12, and IL-18, which
synergistically induce IFN-
production in NK and T cells
(4, 5, 6, 7, 8). Recently, a novel IFN-
-inducing cytokine IL-23
was discovered (10), and this is the first report
demonstrating that IL-23 expression is stimulated by virus infection.
We have studied regulation of cytokine expression in human primary
macrophages during influenza A and Sendai virus infections and reported
that these viruses differ in their ability to stimulate IFN-
and
IL-18 production (20, 21). Now we show that Sendai, but
not influenza A, virus induces IL-12 and IL-23 expression in
macrophages, and we show how macrophage-derived cytokines enhance
IFN-
production in NK cells. In addition, the roles of IFN-
and
IL-4 in the regulation of IL-12 and IL-23 activity are defined.
Biologically active IL-12 is a 70-kDa heterodimer composed of two
covalently linked subunits, p40 and p35. p35 and p40 are encoded by two
separate genes whose expression is independently regulated at the
transcriptional level (31, 32). While the p35
gene is expressed in most cells, p40 expression is
restricted to a few cell types, such as dendritic cells, monocytes, and
macrophages (33). In contrast, activated phagocytic cells
express
10- to 100-fold more p40 than p35 mRNA, which leads to
overproduction of free p40 chain compared with the p35-containing
IL-12. Abundant production of p40 chain may, however, have a
physiological function; p40 chains form a homodimer that serves as an
IL-12 antagonist by competing for IL-12R (34, 35, 36).
Recently, Oppmann et al. (10) discovered a new function
for excessive p40. p40 combines with a novel protein called p19 to form
biologically active cytokine IL-23.
Regulation of IL-23 activity is still an open question. mRNA for the
p19 component of IL-23 is expressed at least in endothelial and
hematopoietic cells, including B and T cells, macrophages, and
dendritic cells (10). However, expression of p19 via mRNA
on its own does not elicit a biological response (12), and
purified p19 protein is not sufficient to increase IFN-
expression
in hematopoietic cells (10). It seems that the formation
of functional IL-23 requires synthesis of both p19 and p40 subunits
within the same cell, and the p40 component is a limiting factor in
IL-23 production. Therefore, it is logical that the physiological
source of active IL-23 could be p40-expressing dendritic cells and
macrophages, which are the major producers of IL-12 as well. At the
moment it is known that LPS stimulation of murine and human dendritic
cells can result in IL-23 production (10). Our present
study with human macrophages demonstrates that virus-infected
macrophages are potential producers of IL-23.
Influenza A and Sendai virus infections in macrophages result in the
secretion of IFN-
and IL-18 (7, 20). In addition,
Sendai, but not influenza A, virus stimulates macrophages to produce
IL-12 (Fig. 2
). IL-12 production is preceded by increased expression of
p35 and p40 mRNA (Fig. 1
). Interestingly, Sendai virus induces also the
transcription of p19 gene (Fig. 1
) and the expression of the
p19 protein (Fig. 3
), suggesting that macrophages are able to produce
IL-23 as well. We tested the biological activity of the virus-induced
cytokines by measuring the capacity of macrophage supernatants to
induce IFN-
expression in NK-92 cells. Supernatants from both
influenza A and Sendai virus-infected macrophages stimulate high
IFN-
production from NK-92 cells (Fig. 4
). Treatment of influenza A
supernatants with neutralizing anti-IFN-
Abs abrogates
completely the IFN-
production, and anti-IL-18 Abs diminish it.
As expected, neutralizing anti-IL-12 Abs have no effect on
influenza A virus-induced IFN-
activity. This implies that, in the
case of influenza A virus, the stimulators of IFN-
are IFN-
and IL-18. The fact that anti-IFN-
Abs alone are sufficient
to inhibit IFN-
stimulation is explained by a synergistic effect of
IFN-
and IL-18. IL-18 on its own is a weak inducer of IFN-
(Fig. 4
), but together with IFN-
it has a strong effect on T and NK cells
(7, 8). In addition, in influenza A virus-infected
macrophages IFN-
is involved in the regulation of IL-18 secretion
(21). IFN-
induction by Sendai virus supernatants is
also diminished with anti-IFN-
Abs, but more pronounced
inhibition requires neutralization of IL-12 and IL-18 as well (Fig. 4
).
However, even a combined administration of anti-IFN-
,
anti-IL-12, and anti-IL-18 Abs cannot entirely block Sendai
virus-induced IFN-
activity (data not shown). Therefore, it is
conceivable that, in addition to IFN-
, IL-12, and IL-18, IL-23
takes part in Sendai virus-induced IFN-
production. Possible
synergistic actions of IL-23 with IFN-
, IL-12, and/or IL-18
warrant further investigation.
The induction of IFN-
production by IFN-
and IL-12 involves a
potential autostimulatory loop. In macrophages IFN-
has been shown
to have a stimulatory effect on IFN-
and IL-12 release in response
to bacterial products (27, 37, 38, 39, 40). In Sendai
virus-infected macrophages IFN-
enhances IFN-
production
(41); moreover, the virus-induced p19 and p40 mRNA
expression is up-regulated by IFN-
priming (Fig. 5
). This suggests
that a positive feedback mechanism acts on IL-23 and IFN-
expression
during virus infection.
Another key regulator of cytokine expression in myeloid cells is IL-4
(30). It inhibits virus-induced IFN-
production
(42, 43, 44) and modulates expression of IL-12 (45, 46). IL-4 is also involved in the regulation of IL-12- and
IL-18-induced IFN-
production (47), but its role in
suppressing IL-12 or IL-18 expression during virus infections is still
inadequately characterized. Even less is known about the possible
contribution of IL-4 to IL-23 expression and subsequent IFN-
production. We studied the regulatory role of IL-4 in the expression of
IFN-
-inducing cytokines by treating macrophages with IL-4 before
infecting them with influenza A or Sendai viruses. IL-4 diminishes the
production of IFN-
and IL-18 in response to either virus
infection (Fig. 7
). In a like manner, Sendai virus-induced IL-12
production is significantly reduced in IL-4-treated cells (Fig. 7
). The
reduced IL-12 production is apparently due to down-regulation of the
p40 gene because IL-4 during Sendai virus infection
decreases mRNA expression of p40 but not that of p35 (Fig. 6
). In
addition, IL-4 decreases Sendai virus-induced p19 mRNA expression (Fig. 6
). Consequently, IL-4-dependent down-regulation of IL-23 expression
can occur through declined transcription of both p19 and
p40 genes. The fact that even a short-term IL-4 stimulation
is sufficient to inhibit IL-23 expression suggests that IL-4 acts on
macrophages via a direct mechanism. The decreased production of
IFN-
, IL-12, IL-18, IL-4, and probably also that of IL-23,
is reflected in diminished IFN-
production in NK cells stimulated by
supernatants of virus-infected macrophages (Fig. 8
).
In conclusion, our present study demonstrates that a novel
IFN-
-inducing cytokine, IL-23, is involved in the cross-talk of
immune cells during viral infection. Sendai virus infection in
macrophages stimulates high expression of p19 and
p40 genes, which encode for the two subunits of the IL-23
heterodimer. The expression of p19 and p40 is
up-regulated by IFN-
and down-regulated by IL-4, the latter of which
inhibits the production of IFN-
, IL-12, and IL-18 as well.
Through limiting the expression of these macrophage-derived cytokines,
IL-4 counteracts an IFN-
-driven positive feedback mechanism that
operates in macrophages and NK and T cells. Further studies on
cytokine-mediated cellular interactions will certainly bring new
perspectives on the development of immune responses against
viruses.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jaana Pirhonen, Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail address: jaana.pirhonen{at}ktl.fi ![]()
Received for publication February 11, 2002. Accepted for publication September 17, 2002.
| References |
|---|
|
|
|---|
production by T cells. Nature 378:88.[Medline]
-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-
production. Eur. J. Immunol. 26:1647.[Medline]
, interleukin-1
and interferon-
-inducing factor on the production of interferon-
by natural killer. Eur. J. Immunol. 27:2787.[Medline]

and IL-18 synergistically enhance IFN-
gene expression in human T cells. J. Immunol. 160:6032.
and IL-18 synergistically enhance IFN-
production in human NK cells: differential regulation of Stat4 activation and IFN-
gene expression by IFN-
and IL-12. Eur. J. Immunol. 31:2236.[Medline]
1 and a novel cytokine receptor subunit, IL-23R. J. Immunol. 168:5699.
and IL-18 production in human macrophages by a caspase-1-dependent pathway. J. Immunol. 162:7322.
-inducing factor (IGIF) monoclonal antibodies and their application in the measurement of human IL-18 by ELISA. J. Immunol. Methods 206:107.[Medline]
in uninduced human leukocyte suspensions. J. Interferon Res. 11:231.[Medline]
in monocytic cells. J. Exp. Med. 183:147.
up-regulates IL-18 gene expression via IFN consensus sequence-binding protein and activator protein-1 elements in macrophages. J. Immunol. 165:3198.
, interleukin-4, and interleukin-10. Ann. NY Acad. Sci. 685:713.[Medline]
and tumor necrosis factor
. J. Exp. Med. 181:1615.
and IFN-
in human macrophages. J. Interferon Cytokine Res. 18:697.[Medline]
enhances production of IFN-
in human macrophages but not in monocytes. J. Interferon Cytokine Res. 16:461.[Medline]
and -
in human peripheral blood monocytes in vitro. Scand J. Immunol. 35:167.[Medline]
production by peripheral blood mononuclear cells in response to viral stimulation. J. Immunol. 160:5861.
production by IL-4 and IL-10 in murine peritoneal macrophages. Virology 277:270.[Medline]
by IL-12/IL-18-activated macrophages requires STAT4 signaling and is inhibited by IL-4. J. Immunol. 166:3075.This article has been cited by other articles:
![]() |
F Brentano, C Ospelt, J Stanczyk, R E Gay, S Gay, and D Kyburz Abundant expression of the interleukin (IL)23 subunit p19, but low levels of bioactive IL23 in the rheumatoid synovium: differential expression and Toll-like receptor-(TLR) dependent regulation of the IL23 subunits, p19 and p40, in rheumatoid arthritis Ann Rheum Dis, January 1, 2009; 68(1): 143 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. de Boer, J. T. van Dissel, T. W. J. Kuijpers, G. F. Rimmelzwaan, F. P. Kroon, and T. H. M. Ottenhoff Influenza Virus Vaccination Induces Interleukin-12/23 Receptor {beta}1 (IL-12/23R{beta}1)-Independent Production of Gamma Interferon (IFN-{gamma}) and Humoral Immunity in Patients with Genetic Deficiencies in IL-12/23R{beta}1 or IFN-{gamma} Receptor I Clin. Vaccine Immunol., August 1, 2008; 15(8): 1171 - 1175. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Y. Cheung, C. K. Wong, and C. W. K. Lam Molecular Mechanisms of Cytokine and Chemokine Release from Eosinophils Activated by IL-17A, IL-17F, and IL-23: Implication for Th17 Lymphocytes-Mediated Allergic Inflammation J. Immunol., April 15, 2008; 180(8): 5625 - 5635. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mise-Omata, E. Kuroda, J. Niikura, U. Yamashita, Y. Obata, and T. S. Doi A Proximal {kappa}B Site in the IL-23 p19 Promoter Is Responsible for RelA- and c-Rel-Dependent Transcription J. Immunol., November 15, 2007; 179(10): 6596 - 6603. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Roth-Cross, L. Martinez-Sobrido, E. P. Scott, A. Garcia-Sastre, and S. R. Weiss Inhibition of the Alpha/Beta Interferon Response by Mouse Hepatitis Virus at Multiple Levels J. Virol., July 1, 2007; 81(13): 7189 - 7199. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. L. Rudner, K. I. Happel, E. A. Young, and J. E. Shellito Interleukin-23 (IL-23)-IL-17 Cytokine Axis in Murine Pneumocystis carinii Infection Infect. Immun., June 1, 2007; 75(6): 3055 - 3061. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Butchar, M. V. S. Rajaram, L. P. Ganesan, K. V. L. Parsa, C. D. Clay, L. S. Schlesinger, and S. Tridandapani Francisella tularensis Induces IL-23 Production in Human Monocytes J. Immunol., April 1, 2007; 178(7): 4445 - 4454. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Utsugi, K. Dobashi, T. Ishizuka, T. Kawata, T. Hisada, Y. Shimizu, A. Ono, and M. Mori Rac1 Negatively Regulates Lipopolysaccharide-Induced IL-23 p19 Expression in Human Macrophages and Dendritic Cells and NF-{kappa}B p65 trans Activation Plays a Novel Role J. Immunol., October 1, 2006; 177(7): 4550 - 4557. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hu, T. Dehmel, J. Pirhonen, H.-P. Hartung, and B. C. Kieseier Interleukin 23 in acute inflammatory demyelination of the peripheral nerve. Arch Neurol, June 1, 2006; 63(6): 858 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matikainen, J. Siren, J. Tissari, V. Veckman, J. Pirhonen, M. Severa, Q. Sun, R. Lin, S. Meri, G. Uze, et al. Tumor Necrosis Factor Alpha Enhances Influenza A Virus-Induced Expression of Antiviral Cytokines by Activating RIG-I Gene Expression J. Virol., April 1, 2006; 80(7): 3515 - 3522. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Melchjorsen, S. B. Jensen, L. Malmgaard, S. B. Rasmussen, F. Weber, A. G. Bowie, S. Matikainen, and S. R. Paludan Activation of Innate Defense against a Paramyxovirus Is Mediated by RIG-I and TLR7 and TLR8 in a Cell-Type-Specific Manner J. Virol., October 15, 2005; 79(20): 12944 - 12951. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Breckpot, J. Corthals, A. Bonehill, A. Michiels, S. Tuyaerts, C. Aerts, C. Heirman, and K. Thielemans Dendritic cells differentiated in the presence of IFN-{beta} and IL-3 are potent inducers of an antigen-specific CD8+ T cell response J. Leukoc. Biol., October 1, 2005; 78(4): 898 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Osterlund, V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and I. Julkunen Gene Expression and Antiviral Activity of Alpha/Beta Interferons and Interleukin-29 in Virus-Infected Human Myeloid Dendritic Cells J. Virol., August 1, 2005; 79(15): 9608 - 9617. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Noone, E. A. Lewis, A. B. Frawely, R. W. Newman, B. P. Mahon, K. H. Mills, and P. A. Johnson Novel mechanism of immunosuppression by influenza virus haemagglutinin: selective suppression of interleukin 12 p35 transcription in murine bone marrow-derived dendritic cells J. Gen. Virol., July 1, 2005; 86(7): 1885 - 1890. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Siren, J. Pirhonen, I. Julkunen, and S. Matikainen IFN-{alpha} Regulates TLR-Dependent Gene Expression of IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 J. Immunol., February 15, 2005; 174(4): 1932 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Andersson, R. Kokkola, J. Wefer, H. Erlandsson-Harris, and R. A. Harris Differential macrophage expression of IL-12 and IL-23 upon innate immune activation defines rat autoimmune susceptibility J. Leukoc. Biol., December 1, 2004; 76(6): 1118 - 1124. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Veckman, M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen, and I. Julkunen Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce maturation and production of Th1-type cytokines and chemokines in human monocyte-derived dendritic cells J. Leukoc. Biol., May 1, 2004; 75(5): 764 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Rosenthal, L. D. Mikus, A. Tuffaha, A. G. Mosser, R. L. Sorkness, and R. F. Lemanske Jr. Attenuated Innate Mechanisms of Interferon-{gamma} Production in Rats Susceptible to Postviral Airway Dysfunction Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 702 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ghilardi, N. Kljavin, Q. Chen, S. Lucas, A. L. Gurney, and F. J. de Sauvage Compromised Humoral and Delayed-Type Hypersensitivity Responses in IL-23-Deficient Mice J. Immunol., March 1, 2004; 172(5): 2827 - 2833. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lee, W. L. Trepicchio, J. L. Oestreicher, D. Pittman, F. Wang, F. Chamian, M. Dhodapkar, and J. G. Krueger Increased Expression of Interleukin 23 p19 and p40 in Lesional Skin of Patients with Psoriasis Vulgaris J. Exp. Med., January 5, 2004; 199(1): 125 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, R. Lund, T. Aittokallio, M. Kosonen, O. Nevalainen, and R. Lahesmaa Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes J. Immunol., October 1, 2003; 171(7): 3627 - 3635. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bassaganya-Riera, R. M. Pogranichniy, S. C. Jobgen, P. G. Halbur, K.-J. Yoon, M. O'Shea, I. Mohede, and R. Hontecillas Conjugated Linoleic Acid Ameliorates Viral Infectivity in a Pig Model of Virally Induced Immunosuppression J. Nutr., October 1, 2003; 133(10): 3204 - 3214. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |