The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, H.
Right arrow Articles by Klinman, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, H.
Right arrow Articles by Klinman, D. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 2002, 169: 5590-5594.
Copyright © 2002 by The American Association of Immunologists

Effect of Suppressive DNA on CpG-Induced Immune Activation1

Hiroshi Yamada, Ihsan Gursel, Fumihiko Takeshita, Jackie Conover, Ken J. Ishii, Mayda Gursel, Saoko Takeshita and Dennis M. Klinman2

Section of Retroviral Immunology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial DNA and synthetic oligodeoxynucleotides (ODN) containing unmethylated CpG motifs stimulate a strong innate immune response. This stimulation can be abrogated by either removing the CpG DNA or adding inhibitory/suppressive motifs. Suppression is dominant over stimulation and is specific for CpG-induced immune responses (having no effect on LPS- or Con A-induced activation). Individual cells noncompetitively internalize both stimulatory and suppressive ODN. Studies using ODN composed of both stimulatory and suppressive motifs indicate that sequence recognition proceeds in a 5'->3' direction, and that a 5' motif can block recognition of immediately 3' sequences. These findings contribute to our understanding of the immunomodulatory activity of DNA-based products and the rules that govern immune recognition of stimulatory and suppressive motifs.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Bacterial DNA contains bioactive CpG motifs that interact with Toll-like receptor 9 to trigger an innate immune response (1, 2, 3, 4, 5, 6). While CpG-induced immunity helps protect the host from pathogenic infections (7, 8, 9, 10), exposure to stimulatory motifs can have deleterious consequences, ranging from autoimmune disease to death (11, 12, 13, 14, 15).

Krieg et al. (16) were the first to report that neutralizing or suppressive motifs can selectively block CpG-mediated immune stimulation. These motifs inhibited cytokine production in vitro and reduced the adjuvant effects of CpG DNA in vivo. Suppressive motifs are rich in polyG or -GC sequences, tend to be methylated, and are present in the DNA of mammals and certain viruses (16, 17, 18).

Little is known about the kinetics, magnitude, or nature of the immune inhibition elicited by suppressive motifs. Current studies establish that the immunostimulatory activity of CpG DNA can be reversed within several hours by removal of stimulatory DNA or addition of suppressive DNA. Stimulatory and suppressive DNA binds to and interacts with the same cells. When both sequence types are present on a single strand of DNA, recognition proceeds in a 5'->3' direction. Suppression is generally dominant over stimulation, although a motif in the 5' position can interfere with recognition of a motif immediately downstream. Understanding the rules governing cellular responses to stimulatory and suppressive motifs should facilitate the design of oligodeoxynucleotides (ODN)3 for therapeutic uses.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals

Female BALB/c mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The mice were housed under specific pathogen-free conditions and were used at 8–20 wk of age. All studies involved protocols approved by the Center for Biologics Evaluation and Research animal care and use committee.

Oligodeoxynucleotides

Studies used phosphorothioate-modified ODNs that were synthesized at the Center for Biologics Evaluation and Research core facility (19). The following ODNs were used: immunostimulatory, ODN1466 (TCAACGTTGA) and ODN1555 (GCTAGACGTTAGCGT); control, ODN1471 (TCAAGCTTGA) and ODN1612 (GCTAGAGCTTAGGCT); and suppressive, ODN1502 (GAGCAAGCTGGACCTTCCAT) and ODNH154 (CCTCAAGCTTGAGGGG). The underlined bases represent the 10-mer sequences that were incorporated into complex multideterminant ODN used in some experiments. There was no detectable protein or endotoxin contamination of these ODN.

Mammalian DNA was purified from BALB/c spleens (Wizard Genomic DNA purification kit; Promega, Madison, WI). Escherichia coli DNA was obtained from Life Technologies (Gaithersburg, MD). Endotoxin contamination in these preparations was <0.1 U/ml after purification (20). Double-stranded DNA was converted to ssDNA by heat denaturing at 95°C for 5 min, followed by immediate cooling on ice.

Cytokine ELISAs

Spleen single-cell suspensions were washed three times and resuspended in RPMI 1640 supplemented with 5% heat-inactivated FCS, 1.5 mM L-glutamine, and 100 U/ml of penicillin/streptomycin. Cells (5 x 105/well) were cultured in flat-bottom microtiter plates (Costar, Corning, NY) with 1 µM ODN for 18–24 h. Culture supernatants were collected, and cytokine levels were measured by ELISA. In brief, 96-well Immulon H2B plates (Thermo LabSystems, Franklin, MA) were coated with cytokine-specific Abs and blocked with PBS 1% BSA as previously described (21). Culture supernatants were added, and bound cytokine was detected by the addition of biotin-labeled secondary Abs, followed by phosphatase-conjugated avidin and a phosphatase-specific colorimetric substrate (PNPP; Pierce, Rockford, IL). Standard curves were generated using recombinant cytokines. The detection limit for these assays was 0.8 U/ml for IFN-{gamma}, 0.1 ng/ml for IL-6, and 0.1 ng/ml for IL-12. All assays were performed in triplicate.

Cytokine-specific ELISPOT assays

A spleen single-cell suspension prepared in RPMI 1640 plus 5% FCS was serially diluted onto plates precoated with anti-cytokine Abs (21). Cells were incubated with 1 µM ODN at 37°C for 8–12 h, and the secretion of cytokine was detected colorimetrically as previously described (21).

Cell surface binding and internalization of ODN

Spleen cells (2 x 106/ml) were incubated with 1 µM of unlabeled and/or fluorescent-labeled ODN for 10 min at 4°C (binding experiments) or for 1 h at 37°C (uptake experiments). Cells were washed, fixed, and analyzed by FACScan (BD Biosciences, San Jose, CA) (22).

Statistical analysis

Statistically significant differences between two groups were determined using the Wilcoxon rank-sum test. When comparing more than two groups, differences were determined using a two-tailed nonparametric ANOVA with Dunn’s post-test analysis. A value of p < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Mammalian DNA suppresses CpG DNA-induced immune activation

Single-stranded bacterial DNA and synthetic ODN containing unmethylated CpG motifs stimulate immune cells to mature, proliferate, and produce cytokines, chemokines, and Ig (2, 3, 4, 5). These effects can be blocked by polyG- and/or GC-rich DNA motifs (16, 23). Scores of ODNs were synthesized and tested to identify motifs that selectively inhibited CpG-induced immune responses. The two most active of these suppressive ODN (ODN1502 (GAGCAAGCTGGACCTTCCAT) and ODNH154 (CCTCAAGCTTGAGGGG)) were selected for detailed study. As shown in Fig. 1Go, these suppressive ODN blocked a majority of the IFN-{gamma} production induced by bacterial DNA or CpG ODN (p < 0.01). Suppressive ODN were neither toxic nor broadly immunosuppressive, as they did not interfere with the mitogenic activity of LPS or Con A (Fig. 1Go and data not shown).



View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 1. Effect of suppressive ODN on CpG DNA and mitogen-induced IFN-{gamma} production. BALB/c spleen cells were stimulated with 1 µM CpG ODN (ODN1555, ODN1466), 50 µg/ml of bacterial DNA, 5 µg/ml of Con A, or 5 µg/ml of LPS. The response of these cultures ({blacksquare}) was compared with that of cells costimulated with 1 µM control ODN1612 (), suppressive ODN1502 (), or suppressive ODNH154 (). The number of IFN-{gamma}-secreting cells was determined by ELISPOT after 18 h. Data represent the average ± SD of triplicate cultures. The experiment was repeated three times with similar results.

 
The activity of suppressive ODNs was concentration dependent, with 50% suppression being achieved at a suppressive ODN:CpG ODN ratio of ~1:3 (Fig. 2Go). To examine the kinetics of this inhibition, suppressive ODN were added to BALB/c spleen cells at various times after CpG-induced stimulation. Maximal inhibition was observed when suppressive ODN were coadministered with CpG ODN, although statistically significant inhibition persisted when suppressive ODN were added up to 3 h later (Fig. 3Go). These findings suggest that CpG-induced immune activation is an ongoing process and can be inhibited after the stimulatory signal is delivered.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 2. Concentration effects of suppressive ODN. BALB/c spleen cells were stimulated with 1 µM CpG ODN1555 or ODN1466 plus increasing amounts of suppressive ODN1502 or ODNH154. Cytokine levels in culture supernatants were measured by ELISA after 24 h. Results represent the mean ± SD of four different experiments.

 


View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 3. Kinetics of suppressive ODN. BALB/c spleen cells were stimulated with 1 µM CpG ODN1555. At various times, 1 µM suppressive ODN1502 was added. Cytokine levels in supernatants were measured by ELISA after 24 h. Results represent the mean of two independent experiments.

 
To test this conclusion, spleen cells were incubated with CpG ODN for various periods, and cytokine production was analyzed after 24 h. Cells stimulated with CpG DNA for 8 h produced 90% as much cytokine as cells stimulated continuously for 24 h (Fig. 4Go). Cells treated with CpG ODN for only 4 h produced half as much cytokine, while cells treated with CpG DNA for <=2 h showed only minimal activation (Fig. 4Go). These findings support the conclusion that CpG-induced cellular activation is reversible for several hours.



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of removing CpG ODN from cultured cells. CpG ODN1555 (1 µM) was added to BALB/c spleen cells at time zero. The cells were washed free of this ODN after various incubation periods. IFN-{gamma} and IL-12 levels in culture supernatants were measured by ELISA after 24 h. Results represent the average ± SD of duplicate cultures. Similar results were obtained in studies of CpG ODN1466.

 
Suppressive ODN do not block CpG ODN uptake or induce the production of inhibitory factors

The results described above indicate that CpG-induced immune activation can be reversed either by adding suppressive ODN or by removing stimulatory ODN. This suggests that suppressive ODN might block the ongoing uptake of CpG DNA. Yet FACS analysis demonstrated that neither cell surface binding nor internalization of FITC-labeled CpG ODN was significantly reduced by suppressive ODN at concentrations that blocked cytokine production by ~75% (Fig. 5Go and data not shown). Moreover, precisely the same cells that bound and internalized CpG ODN interacted with suppressive ODN (Fig. 6Go).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 5. Suppressive ODN do not block the binding or uptake of CpG ODN. BALB/c spleen cells were incubated with 1 µM CpG ODN1555 ({blacksquare}) plus 1 µM suppressive ODN1502 () or control ODN1612 ({square}) for 2 h. The percentage of cells that bound or internalized the CpG ODN was determined by FACS. Similar results were obtained using CpG ODN1466, suppressive ODNH154, and control ODN1471.

 


View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 6. Binding and internalization of suppressive and CpG ODN. BALB/c spleen cells were incubated with 1 µM CpG ODN1555 and/or 1 µM suppressive ODN1502 at 4oC for 10 min or at 37oC for 2 h. Note that the same cells bound and internalized both CpG and suppressive ODN. Binding increased as the time of incubation was prolonged (Fig. 5Go).

 
The possibility that suppressive motifs might induce the production of a factor that blocked CpG-dependent immune stimulation was then investigated. Initial studies established that BALB/c spleen cells preincubated with suppressive ODN remained unresponsive to CpG-induced stimulation for several hours (Table IGo, line 3). If this nonresponsive state was mediated by a soluble factor (or inhibitory cell-cell interactions) then cells pretreated with suppressive ODN should block CpG-induced stimulation of naive splenocytes. As shown in Table IGo, cells treated with suppressive ODN had no significant effect on CpG-dependent cytokine production by fresh spleen cells.


View this table:
[in this window]
[in a new window]
  		Table I. Effect of mixing cells treated with suppressive vs stimulatory ODNa

 
Cellular recognition of suppressive vs stimulatory motifs

The above studies establish that suppressive motifs on one strand of DNA block the immune activation induced by stimulatory motifs on a different strand (i.e., trans-suppression). To better understand the interaction between suppressive and stimulatory motifs, ODNs containing both were synthesized. A set of four 20-mer ODNs was constructed in which one of two different CpG motifs was placed immediately 5' to either of two suppressive motifs (referred to as [CpG-Sup] ODN).

All four of these [CpG-Sup] ODN were stimulatory, triggering murine spleen cells to produce IL-6, IL-12, and IFN-{gamma} to the same extent as an ODN of the same length in which the suppressive motif was replaced by a control sequence (i.e., one that was neither stimulatory nor suppressive; Table IIGo). [CpG-Sup] ODNs did not inhibit the immune activation induced by an independent CpG ODN (Table IIGo). These results suggest that a suppressive motif is inactive when located immediately 3' to a CpG motif on the same strand of DNA.


View this table:
[in this window]
[in a new window]
  		Table II. Effect of motif position on immunostimulatory activitya

 
To better understand this phenomenon, longer ODNs were synthesized in which the CpG and suppressive motifs were separated by progressively longer CT spacers. Adding a 5-base spacer generated an ODN that was still stimulatory (Table IIIGo). However, separating the motifs by >=10 bases yielded ODNs that were suppressive, demonstrated by their ability to block the stimulatory activity of coadministered CpG ODNs (Table IIIGo). The trivial possibility that the CT spacer somehow reduced CpG activity was eliminated by substituting a control motif for the 3' suppressive motif. The resulting ODNs were fully stimulatory (Table IIIGo and data not shown).


View this table:
[in this window]
[in a new window]
  		Table III. Effect of distance between motifs on ODN activitya

 
The impact of placing a suppressive motif 5' to a CpG motif was then examined. ODNs with a suppressive motif in the 5' position induced little or no immune activation even when the CpG motif was shifted up to 20 bp downstream from the suppressive motif (Tables IIGo and IIIGo). This lack of activity could not be attributed to the 3' location of the CpG motif, since CpG ODNs with a control sequence at the 5' end were stimulatory. All ODNs containing a suppressive motif in the 5' position also inhibited the stimulatory activity of a coadministered CpG ODN (Tables IIGo and IIIGo). These findings suggest that the relative positions of stimulatory and suppressive motifs determine the immunomodulatory properties of DNA.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
DNA has multiple and complex effects on the immune system. The innate immune response triggered by unmethylated CpG motifs present in bacterial DNA improve host resistance to infectious pathogens (7, 9, 10, 24). Yet CpG stimulation can increase the host’s susceptibility to autoimmune disease and death (11, 12, 13, 14, 25, 26). This work examines the ability of suppressive motifs to specifically down-regulate CpG-induced immunity.

Previous studies established that CpG DNA interacts with TLR9 to trigger the translocation of NF-{kappa}B from the cytoplasm to the nucleus and the subsequent up-regulation of cytokine gene expression (1, 6, 27, 28, 29, 30). Current results demonstrate that this is not an all-or-none phenomenon. Although NF-{kappa}B translocation is initiated within minutes of CpG administration (29), the subsequent increase in cytokine production occurs over a period of hours (2) and is significantly reduced by the addition of suppressive ODN or the removal of stimulatory CpG DNA (Figs. 3Go and 4Go). Consistent with these findings, suppressive motifs were recently shown to down-regulate CpG-dependent NF-{kappa}B and AP-1 induction (17, 18). These observations suggest that CpG motifs must continuously signal receptive cells for triggering to persist.

The sequence and length of a DNA strand determine its activity. By synthesizing and testing scores of ODNs, our laboratory and that of Krieg et al. independently identified G- and GC-rich motifs that selectively block CpG-dependent activation (16). Of note, Zhao et al. (31) showed that not all GC-rich repeats confer suppressive activity, while Halpern et al. (32) showed that ODNs containing runs of >15 polyGs can inhibit both CpG- and mitogen-induced immune responses. Suppressive activity appears to depend upon an ODN's secondary/tertiary structure, although sequence-nonspecific competition for ODN uptake is also possible (28). In this context, G-rich regions facilitate the formation of complex intra- and interchain Hoogsteen hydrogen bonds (33, 34). Depending on how these chains fold, activity may be gained or lost.

To validate the findings in this report, all experiments were repeated with multiple ODNs containing different combinations of suppressive and/or CpG motifs. In addition, the critical role of the suppressive motifs was established by showing that control motifs neither enhanced nor prevented CpG induced immune stimulation. The data in Tables IIGo and IIIGo and Fig. 6Go suggest that suppressive and stimulatory motifs are active on the same cells, and that their relative locations on a DNA strand determine the magnitude and nature of the resultant response. The results indicate that 1) cellular recognition of stimulatory and suppressive motifs proceeds in a 5'->3' direction; and 2) suppression is generally dominant over stimulation, however, 3) when a CpG motif is immediately 5' to a suppressive motif, stimulation dominates. A likely explanation for the latter phenomenon is that molecules involved in recognizing the 5' motif block the cell’s ability to interact with an immediately adjacent suppressive motif, perhaps due to steric hindrance. When the distance between motifs exceeds 10 bases, this effect dissipates.

Our finding that the relative location of CpG vs suppressive motifs on a single strand of DNA influences the resultant immune response strongly suggests that individual cells recognize both motifs. Experiments using labeled ODNs demonstrate that both types of DNA enter the same cells (Fig. 5Go and data not shown). Indeed, the possibility that one type of cell responds only to stimulatory motifs and another only to suppressive motifs is inconsistent with the results in Tables IIGo and IIIGo. Moreover, the data shown in Table IGo indicate that cells exposed to suppressive ODNs do not produce factors or interact on a cell-to-cell basis in such a way as to inhibit other cells from responding to CpG motifs.

Suppressive ODNs could be of use in several therapeutic settings. CpG motifs in antisense and gene therapy vectors contribute to the immune recognition of transfected cells (35). Introducing suppressive sequences 5' to CpG motifs in these vectors might dampen this immune response and prolong the vector’s in vivo activity (16). Alternatively, the immunogenicity of DNA vaccines might be improved by deleting suppressive motifs (16). Finally, suppressive ODN may prove useful in situations where the host’s response to bacterial DNA contributes to pathology, as in septic shock or autoimmune disease (11, 25, 36, 37). Since suppressive ODN precisely target the inflammatory response induced by CpG DNA, these therapies may avoid the deleterious side effects associated with generalized immunosuppressive regimens.


   Footnotes
 
1 This work was supported in part by a grant from the National Vaccine Program. The assertions herein are the private ones of the authors and are not to be construed as official or as reflecting the views of the Food and Drug Administration at large. Back

2 Address correspondence and reprint requests to Dr. Dennis M. Klinman, Building 29A, Room 3D10, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892. E-mail address: klinman{at}cber.fda.gov Back

3 Abbreviations used in this paper: ODN, oligodeoxynucleotide. Back

Received for publication April 19, 2002. Accepted for publication September 6, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  2. Klinman, D. M., A. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12 and IFN-{gamma}. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  3. Roman, M., E. Martin-Orozco, J. S. Goodman, M. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1 promoting adjuvants. Nat. Med. 3:849.[Medline]
  4. Yamamoto, S., T. Yamamoto, T. Katoaka, E. Kuramoto, O. Yano, T. Tokunaga. 1992. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN and augment IFN-mediated natural killer activity. J. Immunol. 148:4072.[Abstract]
  5. Krieg, A. M., A. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  6. Takeshita, F., C. A. Leifer, I. Gursel, K. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Cutting wdge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167:3555.[Abstract/Free Full Text]
  7. Elkins, K. L., T. R. Rhinehart-Jones, S. Stibitz, J. S. Conover, D. M. Klinman. 1999. Bacterial DNA containing CpG motifs stimulates lymphocyte-dependent protection of mice against lethal infection with intracellular bacteria. J. Immunol. 162:2291.[Abstract/Free Full Text]
  8. Klinman, D. M., D. Verthelyi, F. Takeshita, K. J. Ishii. 1999. Immune recognition of foreign DNA: a cure for bioterrorism?. Immunity 11:123.[Medline]
  9. Krieg, A. M., L. L. Homan, A. K. Yi, J. T. Harty. 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161:2428.[Abstract/Free Full Text]
  10. Zimmermann, S., O. Egeter, S. Hausmann, G. B. Lipford, M. Rocken, H. Wagner, K. Heeg. 1998. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J. Immunol. 160:3627.[Abstract/Free Full Text]
  11. Sparwasser, T., T. Meithke, G. Lipford, K. Borschert, H. Hicker, K. Heeg, H. Wagner. 1997. Bacterial DNA causes septic shock. Nature 386:336.[Medline]
  12. Pisetsky, D. S.. 1997. Immunostimulatory DNA: a clear and present danger?. Nat. Med. 3:829.[Medline]
  13. Cowdery, J. S., J. H. Chace, A.-K. Yi, A. M. Krieg. 1996. Bacterial DNA induces NK cells to produce IFN-{gamma} in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
  14. Segal, B. M., D. M. Klinman, E. M. Shevach. 1997. Microbial products induce autoimmune disease by an IL-12 dependent process. J. Immunol. 158:5087.[Abstract]
  15. Deng, G. M., I. M. Nilsson, M. Verdrengh, L. V. Collins, A. Tarkowski. 1999. Intra-articularly localized bacterial DNA containing CpG motifs induces arthritis. Nat. Med. 5:702.[Medline]
  16. Krieg, A. M., T. Wu, R. Weeratna, S. M. Efler, L. Love, L. Yang, A. Yi, D. Short, H. L. Davis. 1998. Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs. Proc. Natl. Acad. Sci. USA 95:12631.[Abstract/Free Full Text]
  17. Lenert, P., L. Stunz, A. K. Yi, A. M. Krieg, R. F. Ashman. 2001. CpG stimulation of primary mouse B cells is blocked by inhibitory oligodeoxyribonucleotides at a site proximal to NF-{kappa}B activation. Antisense Nucleic Acid Drug Dev. 11:247.[Medline]
  18. Chen, Y., P. Lenert, R. Weeratna, M. McCluskie, T. Wu, H. L. Davis, A. M. Krieg. 2001. Identification of methylated CpG motifs as inhibitors of the immune stimulatory CpG motifs. Gene Ther. 8:1024.[Medline]
  19. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, D. M. Klinman. 2001. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 166:2372.[Abstract/Free Full Text]
  20. Klinman, D. M., G. Yamshchikov, Y. Ishigatsubo. 1997. Contribution of CpG motifs to the immunogenicity of DNA vaccines. J. Immunol. 158:3635.[Abstract]
  21. Klinman, D. M., T. B. Nutman. 1994. ELIspot assay to detect cytokine-secreting murine and human cells. J. E. Coligan, and A. M. Kruisbeek, and D. H. Margulies, and E. M. Shevach, and W. Strober, eds. Current Protocols in Immunology Greene Publishing Associates, Brooklyn.
  22. Gursel, M., D. Verthelyi, I. Gursel, K. J. Ishii, D. M. Klinman. 2002. Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotides. J. Leukocyte Biol. 71:813.[Abstract/Free Full Text]
  23. Pisetsky, D. S., C. Reich, S. D. Crowley, M. D. Halpern. 1995. Immunological properties of bacterial DNA. Ann. NY Acad. Sci. 772:152.[Medline]
  24. Klinman, D. M., J. Conover, C. Coban. 1999. Repeated administration of synthetic oligodeoxynucleotides expressing CpG motifs provides long-term protection against bacterial infection. Infect. Immun. 67:5658.[Abstract/Free Full Text]
  25. Krieg, A. M.. 1995. CpG DNA: a pathogenic factor in systemic lupus erythematosus?. J Clin. Immunol. 15:284.[Medline]
  26. Gilkeson, G. S., J. P. Grudier, D. G. Karounos, D. S. Pisetsky. 1989. Induction of anti-double stranded DNA antibodies in normal mice by immunization with bacterial DNA. J. Immunol. 142:1482.[Abstract]
  27. Yi, A., R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.[Abstract/Free Full Text]
  28. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO 17:6230.[Medline]
  29. Takeshita, F., K. J. Ishii, A. Ueda, Y. Ishigatsubo, D. M. Klinman. 2000. Positive and negative regulatory elements contribute to CpG ODN mediated regulation of human IL-6 gene expression. Eur. J. Immunol. 30:108.[Medline]
  30. Liang, H., Y. Nishioka, C. F. Reich, D. S. Pisetsky, P. E. Lipsky. 1996. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Invest. 98:1119.[Medline]
  31. Zhao, H., S. H. Cheng, N. S. Yew. 2000. Requirements for effective inhibition of immunostimulatory CpG motifs by neutralizing motifs. Antisense Nucleic Acid Drug Dev. 10:381.[Medline]
  32. Halpern, M. D., D. S. Pisetsky. 1995. In vitro inhibition of murine IFN {gamma} production by phosphorothioate deoxyguanosine oligomers. Immunopharmacology 29:47.[Medline]
  33. Han, H., H. L. Hurley. 2000. G-quadruplex DNA: a potential target for anti-cancer drug design. Trends Pharmacol. Sci. 21:136.[Medline]
  34. Murhie, A. I., D. M. Lilley. 1994. Tetraplex folding of telomere sequences and the inclusion of adenine bases. EMBO J. 13:993.[Medline]
  35. Tan, Y., S. Li, B. R. Pitt, L. Huang. 1999. The inhibitory role of CpG immunostimulatory motifs in cationic lipid vector-mediated transgene expression in vivo. Hum. Gene. Ther. 10:2153.[Medline]
  36. Lipford, G. B., T. Sparwasser, M. Bauer, S. Zimmermann, E. Koch, K.I. Heeg, H. Wagner. 1997. Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur. J. Immunol. 27:3420.[Medline]
  37. Sparwasser, T., T. Miethke, G. Lipford, A. Erdmann, H. Hacker, K. Heeg, H. Wagner. 1997. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-{alpha}-mediated shock. Eur. J. Immunol. 27:1671.[Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
D. Klinman, H. Shirota, D. Tross, T. Sato, and S. Klaschik
Synthetic oligonucleotides as modulators of inflammation
J. Leukoc. Biol., October 1, 2008; 84(4): 958 - 964.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Sato, T. Shimosato, W. G. Alvord, and D. M. Klinman
Suppressive Oligodeoxynucleotides Inhibit Silica-Induced Pulmonary Inflammation
J. Immunol., June 1, 2008; 180(11): 7648 - 7654.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
H. Yasuda, A. Leelahavanichkul, S. Tsunoda, J. W. Dear, Y. Takahashi, S. Ito, X. Hu, H. Zhou, K. Doi, R. Childs, et al.
Chloroquine and inhibition of Toll-like receptor 9 protect from sepsis-induced acute kidney injury
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1050 - F1058.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross
Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes
J. Immunol., July 1, 2007; 179(1): 45 - 52.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
U. A. Hasan, E. Bates, F. Takeshita, A. Biliato, R. Accardi, V. Bouvard, M. Mansour, I. Vincent, L. Gissmann, T. Iftner, et al.
TLR9 Expression and Function Is Abolished by the Cervical Cancer-Associated Human Papillomavirus Type 16
J. Immunol., March 1, 2007; 178(5): 3186 - 3197.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
T. H. Harris, N. M. Cooney, J. M. Mansfield, and D. M. Paulnock
Signal transduction, gene transcription, and cytokine production triggered in macrophages by exposure to trypanosome DNA.
Infect. Immun., August 1, 2006; 74(8): 4530 - 4537.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Adamsson, M. Lindblad, A. Lundqvist, D. Kelly, J. Holmgren, and A. M. Harandi
Novel immunostimulatory agent based on CpG oligodeoxynucleotide linked to the nontoxic B subunit of cholera toxin.
J. Immunol., April 15, 2006; 176(8): 4902 - 4913.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
F. J. Barrat, T. Meeker, J. Gregorio, J. H. Chan, S. Uematsu, S. Akira, B. Chang, O. Duramad, and R. L. Coffman
Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus
J. Exp. Med., October 17, 2005; 202(8): 1131 - 1139.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding
Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9
J. Immunol., September 15, 2005; 175(6): 3964 - 3970.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
O. Duramad, K. L. Fearon, B. Chang, J. H. Chan, J. Gregorio, R. L. Coffman, and F. J. Barrat
Inhibitors of TLR-9 Act on Multiple Cell Subsets in Mouse and Man In Vitro and Prevent Death In Vivo from Systemic Inflammation
J. Immunol., May 1, 2005; 174(9): 5193 - 5200.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Shirota, I. Gursel, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Protect Mice from Lethal Endotoxic Shock
J. Immunol., April 15, 2005; 174(8): 4579 - 4583.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
R. F. Ashman, J. A. Goeken, J. Drahos, and P. Lenert
Sequence requirements for oligodeoxyribonucleotide inhibitory activity
Int. Immunol., April 1, 2005; 17(4): 411 - 420.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Shirota, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling
J. Immunol., October 15, 2004; 173(8): 5002 - 5007.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Takeshita, K. Suzuki, S. Sasaki, N. Ishii, D. M. Klinman, and K. J. Ishii
Transcriptional Regulation of the Human TLR9 Gene
J. Immunol., August 15, 2004; 173(4): 2552 - 2561.
[Abstract] [Full Text] [PDF]

Home page
 J. Gen. Virol.Home page
F. C. Hasslung, M. Berg, G. M. Allan, B. M. Meehan, F. McNeilly, and C. Fossum
Identification of a sequence from the genome of porcine circovirus type 2 with an inhibitory effect on IFN-{alpha} production by porcine PBMCs
J. Gen. Virol., November 1, 2003; 84(11): 2937 - 2945.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Gursel, M. Gursel, H. Yamada, K. J. Ishii, F. Takeshita, and D. M. Klinman
Repetitive Elements in Mammalian Telomeres Suppress Bacterial DNA-Induced Immune Activation
J. Immunol., August 1, 2003; 171(3): 1393 - 1400.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. J. Stacey, G. R. Young, F. Clark, D. P. Sester, T. L. Roberts, S. Naik, M. J. Sweet, and D. A. Hume
The Molecular Basis for the Lack of Immunostimulatory Activity of Vertebrate DNA
J. Immunol., April 1, 2003; 170(7): 3614 - 3620.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, H.
Right arrow Articles by Klinman, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, H.
Right arrow Articles by Klinman, D. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS