| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Biological Sciences, Imperial College of Science Technology and Medicine, London, United Kingdom; and
Department of Cell Biology, Complutense University, Madrid, Spain
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
superfamily of secreted proteins, are involved in patterning
and cellular fate determination during the development of many tissues.
BMP2 and BMP4 are closely related, highly conserved homologs of the
Drosophila protein decapentaplegic. Decapentaplegic plays
multiple roles in Drosophila development (1, 2), and BMP4 is essential for mesoderm formation and patterning
during mouse development (3).
BMP4-/- embryos die between embryonic day (E)
6.5 and E9.5 (3), and BMP4 is important in cartilage and
bone formation (4) and as a negative regulator of neural
induction (5). The mature coding region of mouse BMP2 is
92% identical with mouse BMP4 at the amino acid level
(6). BMP2 is also essential in mouse development, and
BMP2-/- embryos die between E7.5 and E9 due to
defects in the amnion and heart (7).
Like other members of the TGF- superfamily, BMPs signal through
ligation and heterodimerization of type one and type two
serine-threonine kinase receptors that phosphorylate downstream signal
transduction/transcription factors, the receptor-regulated
pathway-specific Smads. BMP2 and BMP4 specifically signal through the
ligation of the BMP receptors, BMPR-1A and BMPR-1B with BMPR-II, which
leads to the subsequent phosphorylation of the receptor Smads, Smad-1,
Smad-5, and Smad-8 (8). In addition, the signaling pathway
requires activation of the common mediator Smad, Smad-4, that is also
necessary for signaling by other members of the superfamily
(8).
BMP signaling is regulated by extracellular inhibitors that bind BMPs with high affinity, preventing BMPs binding to their cell surface receptors. Such inhibitors of BMP2 and BMP4 include Noggin, Chordin (5, 9, 10, 11), and Twisted gastrulation (Tsg). Noggin was first identified as a dorsalizing factor in the Spemann organizer of Xenopus embryos (12), and mouse Noggin is required for patterning of the neural tube (13) and cartilage morphogenesis (14). Chordin also functions as a dorsalizing factor of the Xenopus Spemann organizer (15), and as a regulator of mammalian brain development (16). Tsg, which in Drosophila embryos specifies dorsal cell fate, has recently been shown to function as an extracellular BMP antagonist in vertebrates (17, 18, 19). Mouse Tsg can bind to and cleave Chordin, enhancing Chordin’s ability to inhibit BMP4, and can also bind directly to BMP4 (19).
Recently, BMP4 has been shown to regulate the development and proliferation of human hemopoietic stem cells (20, 21). Mouse Tsg is expressed during lymphocyte development (22), and Chordin (23), BMP4 (24), and the Smad-interacting transcription factor Schnurri-2 (25) are expressed in the mouse thymus, suggesting that BMP signaling may play a role in thymocyte development.
The mouse thymus is seeded by blood-borne progenitor cells that migrate from the fetal liver or adult bone marrow (26). Developing thymocytes then pass through a series of stages that can be defined in terms of cell surface expression of developmentally regulated markers. CD4-CD8- double-negative (DN) thymocytes progress to the CD4+CD8+ double-positive (DP) stage and then to mature CD4 or to CD8 single-positive T cells. The DN population can be further subdivided by expression of CD44 and CD25. The earliest CD44+CD25- cells acquire CD25 expression, then lose CD44 expression and finally become CD44-CD25- DN cells before differentiating to DP cells (27). The transition from a CD25+ DN cell to DP cell depends on the expression of a functional pre-TCR complex (28).
The earliest CD44+CD25- DN cells also express CD117 and are not fully committed to the T cell lineage. This population contains cells that are capable of differentiating into T, B, NK, and dendritic cells (26, 29, 30). However, the majority of CD44+CD25- DN thymocytes do differentiate into T cells and their fate is probably influenced by the fact that the thymic microenvironment is not only necessary for normal T cell development (31), but also favorable to it. Little is known about the factors that control T cell lineage commitment of CD44+CD25- cells and their differentiation to CD44-CD25+ cells. A recent study has shown that inactivation of the Notch1 gene arrests thymocyte development at the CD44+CD25- stage and prevents T cell lineage commitment (32). In this study, we show that BMP4 and BMP2 and their extracellular inhibitors Noggin, Chordin, and Tsg are expressed in the thymus, and that BMP2/4 signaling regulates differentiation of early CD44+CD25- DN thymocytes along the T cell lineage.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RT-PCR was performed as described (33). RNA
was prepared using a StrataPrep Total RNA kit (Stratagene, La Jolla,
CA), including a DNase1 digestion step. Primers were purchased from
Genosys (The Woodlands, TX). The following primer pairs were
used: hypoxanthine guanine phosphoribosyl transferase
(HPRT), forward (F):TCGTGATTAGCGATGATGAACC, reverse
(R):CTGGCAACATCAACAGGACTCC; BMP2, F:TGTGACCAGACTATTGGACACC,
R:AGTTCAGGTGGTCAGCAAGG; BMP4, F:TTTCTGTCAAGACACATGATT,
R:AACTCCTCACAGTGTTGGCTCG (BMP4 primers were selected to span
exon-exon boundaries); BMPR-IA, F:CGCTATGGAGAAGTATGGATGG,
R:GGTCAGCAATACAGCAACTTCC; BMPR-IB, F:CACCTTAGACGCAAAGTCCA,
R:CCATCGATTGGGGAATGAA; BMPRII, F:AGATCTACCTCTCCCTAAG,
R:TTAGAATGGACTGCCCTGTC; Smad-1, F:ACTGAAGCCTCTGGAATGCT,
R:GCGGTTCTTATTGTTGGACG; Smad-4, F:CATTCCTGTGGCTTCCACAA,
R:GACTGATGGCTGGAGCTATT; Smad-5, F:CAGAAGAAATGGGGTTCAGC,
R:ATGCCCAGCATATCCAGCAG; Smad-8, F:CCATACCATTACCGCAGAGTGG,
R:TGAAGCCGTCTATGAGCACG; Noggin in Fig. 1
, F:AAGGATCTGAACGAGACG,
R:GCAGGAACACTTACACTCG; Noggin in Fig. 2, F:CGGCCAGCACTATCTACACA,
R:TCCTCCTCAGCTTCTTGCTC; Chordin, F:ACCAACGCAGTAGAGACCTCCC,
R:GGGGTAGCAGGAATGGTGTG; Tsg, F:ATTGTGCCTTGGCTGGCTTACC,
R:GAGTCTAATGGAGCATCGAA.
|
|
Primers used to detect BMPR-IB, BMPRII, Smad-1, -4, and -5 were described previously (34). Primers used to detect Noggin and Chordin were also described previously (35).
Histology and immunofluorescence
Thymus cryosections (7 µm) were air dried for 2 h at room temperature and fixed in acetone for 10 min. Nonspecific binding of Abs was blocked by incubation with diluted donkey serum (Santa Cruz Biotechnology, Santa Cruz, CA) and avidin-biotin (Vector Laboratories, Burlingame, CA). Mouse thymus sections were sequentially incubated with anti-BMP4 Abs (Santa Cruz Biotechnology), biotin-conjugated mouse adsorbed F(ab')2 of donkey anti-goat IgG (Jackson ImmunoResearch Laboratories, West Grove, PA), FITC-conjugated streptavidin (Amersham Pharmacia Biotech, Buckinghamshire, U.K.), and anti-cytokeratin (BioGenex Laboratories, San Ramon, CA) followed by Texas Red-conjugated mouse adsorbed F(ab')2 of donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories). To analyze the expression of BMP2/4 receptor, human thymic sections were used to avoid nonspecific stainings generated by the use of mouse Abs on mouse tissue sections. In this case, sections were incubated with anti-BMPR-IB Abs (R&D Systems, Minneapolis, MN), biotin-conjugated F(ab')2 of donkey anti-mouse IgG (Jackson ImmunoResearch Laboratories), FITC-conjugated streptavidin (Amersham Pharmacia Biotech), and anti-CD2 (Beckman Coulter, Brea, CA) followed by Texas Red-conjugated F(ab')2 of donkey anti-rat IgG (Jackson ImmunoResearch Laboratories). Slides were mounted in Vectashield (Vector Laboratories) and examined on a Zeiss Axioplan-2 microscope (Zeiss, Oberkochen, Germany).
Mice
BALB/c mice were purchased from B&K Universal (Grimston, U.K.)
and Rag1-/- mice and
TCR-/-
-/- mice
were purchased from The Jackson Laboratory (Bar Harbor, ME).
Timed matings were conducted as described (36).
Flow cytometry and Abs
Cell suspensions of thymocytes were prepared by crushing the
thymus between two pieces of ground glass. Cells were stained as
described (36) using combinations of the following
directly conjugated Abs purchased from BD PharMingen (San Diego, CA):
anti-CD4PE,
anti-CD4CyChrome,
anti-CD8
FITC,
anti-CD8CyChrome,
anti-CD25PE,
anti-CD25FITC,
anti-CD44FITC,
anti-CD44PE,
anti-CD2PE,
anti-CD3CyChrome,
CD117PE, and analyzed on a FACScan (BD
Biosciences, Mountain View, CA). Data are representative of at least
six experiments. To analyze composition of the DN subsets, cells were
stained with anti-CD4, anti-CD3, and anti-CD8 conjugated to
the same fluorochrome, and gated to exclude those cells that stained
positive with these Abs. For the experiment in Fig. 2
, C and
D, purified DN cells were sorted by flow cytometry on a
MoFlo. Final purity was in excess of 98%.
Annexin V staining was conducted using an annexin V-FITC apoptosis detection kit (BD PharMingen), according to manufacturer’s instructions. Before annexin V staining, cells were stained with CD44-PE and CD25-CyChrome. Data shown represent annexin-positive cells that fell into a "live gate" defined by FSC and SSC.
Propidium iodide (PI) staining of cells permeabalized in 0.1% Triton X-100 in PBS was conducted according to the manufacturer’s instructions using a BD PharMingen apoptosis detection kit. Data were acquired on a linear scale using a doublet discrimination module on the FACScan.
Fetal thymus organ culture (FTOC)
Fetal thymi were dissected on E14.5 or E13 and cultured on Millipore filters (0.8-µm pore size) (Millipore, Bedford, MA) in AIM-V serum-free lymphocyte medium (Life Technologies, Grand Island, NY). Human recombinant BMP4 was purchased from R&D Systems. This recombinant human BMP4 was generated from DNA sequence encoding the human BMP2 signal peptide and propeptide fused to the human BMP4 mature chain and expressed in a mouse myeloma cell. The manufacturer assessed the activity of the protein by its ability to induce alkaline phosphatase production by mouse ATDC-5 chondrogenic cells, and its ED50 was typically 10–30 ng/ml. The recombinant BMP4 was used within the manufacturer’s recommended dose range.
The recombinant Noggin-Fc fusion protein was purchased from R&D Systems and was used at the concentration recommended by the manufacturer to neutralize 0.1 µg/ml BMP4.
Thymic stroma was prepared by culturing E14.5 thymi for 7 days with 0.36 mg/ml 2'4'deoxyguanosine (Sigma-Aldrich, St. Louis, MO).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To assess the expression of RNAs encoding the secreted factors,
BMP2 and BMP4 and their receptor molecules, BMPR-IA, BMPR-IB, and
BMPRII, we performed RT-PCR on RNA prepared from E15 thymus. RNA
isolated from E15 head was used as a positive control for expression of
these molecules (Fig. 1A). We detected both BMP2 and BMP4 in
embryo thymus as well as their requisite receptor molecules, BMPR-IA,
BMPR-IB, and BMPRII (Fig. 1B).
The specific downstream effector molecules for the BMP signaling
pathway are Smad-1, -5, and -8 (37). Upon activation by
phosphorylation, these molecules form complexes with the common Smad
(Smad-4). RNAs for these four Smad proteins (Smad-1, -4, -5, and -8)
were detected in the thymus (Fig. 1B). In the case of Smad-8
and Smad-4, two different-size transcripts were detected and the band
corresponding to the published size of transcript is indicated by an
arrow.
As the BMP2/4 signaling pathway is modified by extracellular
antagonists, we analyzed expression of the antagonists Noggin, Chordin,
and Tsg in RNA isolated from E15 head, thymus, and adult
Rag1-/- thymus. The levels of cDNA used in each
reaction were equivalent as judged by expression of HPRT (Fig. 1C). Noggin was easily detected in E15 head, but only a weak
band was amplified from E15 thymus and Rag1-/-
thymus (Fig. 1D). Tsg and Chordin was detected in all
tissues analyzed (Fig. 1, E and F). The presence
of these RNAs in adult Rag1-/- thymus indicates
that these molecules are expressed in adult thymus as well as during
fetal ontogeny, and that they do not require pre-TCR signaling for
their expression.
To analyze expression of BMP4 at the protein level the histological
localization of BMP4-expressing cells was analyzed by double
immunofluorescent stainings on thymic tissue sections. BMP4 was
detected in cytokeratin-positive epithelial cells that appeared in the
subcapsular and cortical areas (Fig. 2A), but not in the
medullary region (data not shown). The expression of BMP4 receptor
protein was revealed with anti-BMPR-IB Abs and was found in most
thymocytes throughout the thymic parenchyma (Fig. 2B) and
also in some epithelial cells (data not shown). In this case, stainings
were made on human thymic sections to avoid nonspecific staining
generated by the use of mouse Abs on mouse tissue sections. To confirm
expression of the BMP2/4 receptor molecules in mouse thymocytes we
analyzed expression of BMPR-IA, BMPR-IB, BMPRII, and Smad-1, -4, -5,
and -8 in RNA isolated from sorted DN mouse thymocytes. In support of
the Ab staining, we detected expression of BMPR-IB in DN thymocytes, as
well as BMPR-IA, BMPRII, and the four Smad proteins (Fig. 2C). Thus, DN thymocytes express the molecules necessary to
respond to BMP2 and BMP4. Further analysis of expression of the BMP
antagonists revealed that Tsg was expressed both in thymic stroma and
DN thymocytes. Chordin expression was restricted to the thymic stroma,
and a weak band for Noggin was also amplified from the stroma (Fig. 2D). The expression of both BMP2 and BMP4 and their
inhibitor molecules strongly suggests that the BMP2/4 pathway is active
in the thymus.
BMP4 arrests early thymocyte development in a dose-dependent manner
As expression of all components of the BMP2/4 signaling pathway
were found in the E15 thymus, we tested the effect of BMP4 on thymocyte
development in FTOC. We treated E14.5 FTOC for 3 days with 0.1 µg/ml
recombinant BMP4. The thymocytes were then harvested and analyzed by
flow cytometry. Fig. 3A,
upper panel, shows CD4 and CD8 staining in control and
BMP4-treated cultures. Analysis of the DN cells revealed an increased
percentage of CD44+CD25-
DN cells in BMP4-treated cultures compared with control cultures,
whereas the percentage of
CD44-CD25+ DN cells was
significantly lower in BMP4-treated cultures compared with control
cultures. In a typical experiment, in BMP4-treated
cultures 47% of DN thymocytes were
CD44+CD25- and 15%
CD44-CD25+, compared with
6% CD44+CD25- and 53%
CD44-CD25+, respectively,
in control cultures (Fig. 3A). Thus, addition of BMP4 caused
accumulation of CD44+CD25-
precursor cells. The percentage of cells expressing CD2, a molecule
that is up-regulated on the cell surface following pre-TCR signaling
(38, 39), was reduced in BMP4-treated cultures (Fig. 3B). Only 5% of cells cultured in the presence of BMP4
expressed high cell surface levels of CD2, compared with 26% of cells
in control cultures. The reduction in CD2 expression is consistent with
the accumulation of
CD44+CD25- cells,
indicating an accumulation of immature thymocytes. To show that the
CD44+CD25- DN cells that
accumulated in the BMP4-treated cultures were the earliest precursor
population, we analyzed the expression of the developmentally regulated
marker CD117 (c-kit) in the cultures (Fig. 3C).
In a typical experiment in which 47% of DN cells expressed CD44 after
5 days of treatment with BMP4, compared with 10% in the control
cultures, 50% of DN cells were
CD117+CD25-, compared with
only 5.7% in the control. To confirm that these
CD117+ DN cells also expressed CD44, we stained
the DN cells with both anti-CD117 and anti-CD44, having gated
out CD4+, CD8+,
CD3+, and CD25+ cells. In
both control and BMP4-treated cultures, the CD44+
cells also expressed CD117 (Table I).
|
|
D),
and more CD44+CD25- DN
cells were recovered from BMP4-treated cultures than from control
cultures (Fig. 3E).
The inhibition of thymocyte development by BMP4 was dose-dependent, as
demonstrated by the percentage of DN thymocytes in the four populations
defined by cell surface CD25 and CD44 expression (Fig. 3F,
left panel), and by the ratio of
CD44+CD25- to
CD44-CD25+ cells in the
cultures (Fig. 3F, right panel).
Noggin neutralizes the effect of BMP4 in FTOC
One explanation for the accumulation of immature thymocytes in the
presence of BMP4 is that BMP4 is toxic for all more mature thymocytes.
To assess this possibility we tested whether the addition of
recombinant Noggin, in the form of a Noggin-Fc fusion protein, would
neutralize the effects of exogenous BMP4. Recombinant Noggin should
bind directly to BMP4 and thereby prevent it from binding its receptor.
E14.5 FTOC were treated with BMP4 and Noggin for 5 days and then
stained with anti-CD44, anti-CD25, anti-CD4, anti-CD3,
and anti-CD8 Abs. In the BMP4-treated cultures, 33% of DN cells
were CD25+CD44-, compared
with 61 and 70% in the control cultures and the cultures treated with
both BMP4 and Noggin, respectively. Likewise, the increase in the
percentage of CD44+CD25-
DN cells in the BMP4-treated cultures was neutralized by addition of
Noggin from 20% (BMP4-treated) to 1.5% (BMP4- and Noggin-treated),
compared with 4% in control cultures (Fig. 4A). The fact that addition of
Noggin to the BMP4-treated cultures neutralizes the action of BMP4 on
thymocyte development indicates that BMP4 is not nonspecifically toxic
to developing thymocytes but is mediating a biological effect.
|
BMP2/4 signaling affects apoptosis and cell cycle progression in
many developmental systems (3, 4, 5, 7, 16). Therefore, it
seemed possible that addition of BMP4 to the FTOC was increasing the
percentage of CD44+CD25-
DN thymocytes by inducing apoptosis specifically in more mature
thymocyte populations. To test this, we measured apoptosis in cultured
thymocytes by annexin V staining. FTOC were treated with BMP4 for 5
days and then cells were stained with annexin V and anti-CD44 and
anti-CD25 Abs. The percentage of dying cells was significantly
lower in BMP4-treated cultures compared with control cultures for all
of the DN populations (Fig. 4B). Thus, addition of BMP4 does
not induce cell death, but enhances survival of cultured thymocytes,
suggesting that BMP4 acts directly to prevent the differentiation of
CD44+CD25- DN cells along
the T cell lineage, rather than indirectly, by causing the death of the
subsequent thymocyte populations.
BMP4 inhibits thymocyte proliferation
The cell cycle status of thymocytes in BMP4-treated cultures was
assessed by PI staining. Cells harvested from the same FTOC used for
the cell death assay were stained with PI and anti-CD44 Ab. FACS
analysis revealed a reduction in the proportion of cells in S and
G2 in the BMP4-treated cultures compared with
control cultures (Fig. 4C). There was an 
2.5-fold
reduction in the percentage of CD44+ cells in S
and G2 in the BMP4-treated cultures compared with
the control cultures. This indicates that the enrichment of the
CD44+CD25- DN population
in the BMP4-treated culture is not a result of an increase in their
rate of proliferation relative to other populations in the culture, but
rather is due to an arrest in thymocyte differentiation at that stage
of development. Thus, BMP4 acts both to arrest early thymocyte
differentiation and to inhibit thymocyte proliferation, thereby
negatively regulating progression of developing cells along the T cell
lineage.
The BMP2/4 antagonist Noggin accelerates maturation of DN thymocytes
To study the function of endogenously produced BMP2 and BMP4 in
the thymus, we neutralized endogenous BMP2/4 activity in FTOC by
addition of recombinant Noggin alone. E14.5 FTOC were treated with
Noggin for 6 days. The thymocytes were then analyzed by flow cytometry.
In the Noggin-treated cultures, the percentages of DP cells (Fig. 5A) and
CD44-CD25- DN cells (Fig. 5, B and C) were higher than in control cultures.
In addition, the percentage of CD2-expressing cells was increased in
Noggin-treated cultures compared with control cultures (Fig. 5, D and E). In a representative experiment, 42% of
cells stained brightly with anti-CD2 Ab, compared with 25% of
thymocytes in the control culture. The increase in CD2 expression is in
accordance with the increased percentage of the most mature
CD44-CD25- population of
DN cells, because cell surface CD2 expression is up-regulated on
pre-TCR signaling (38, 39).
|
F.
In some experiments, we treated E13 FTOC for 5 days with Noggin or
BMP4. Addition of Noggin at this earlier stage of ontogeny reduced the
proportion of CD44+CD25-
DN from 9% in control cultures to 2.9% in Noggin-treated cultures,
whereas 42% of cells were
CD44+CD25- DN in
BMP4-treated cultures (Fig. 6A). In agreement with the
data from E14.5 FTOC, the proportion of CD2+
cells was increased in the Noggin-treated cultures and decreased in the
BMP4-treated cultures relative to the control (Fig. 6B). As
in the E14.5 FTOC, Noggin treatment increased the percentage of DP
cells, which were just beginning to appear in the control cultures
(Fig. 6C). BMP4 treatment blocked the production of DP
thymocytes in E13 FTOC (Fig. 6C). We did not observe this
absence of DP cells in the E14.5 BMP4-treated cultures (Fig. 3A), and this difference is probably because the BMP4 was
added at a later time point when some cells were irreversibly destined
to become DP.
|
Thymocytes from Noggin-treated FTOC were stained with PI and
anti-CD44 Ab. There was no statistically significant difference in
the proportion of CD44+ or
CD44- thymocytes in the S and
G2 stages of the cell cycle between
Noggin-treated and control cultures (Fig. 6D). Thus, the
increased expression of CD2 in the DN cells of Noggin-treated cultures
was not due to increased proliferation of this population, but rather
resulted from an increase or acceleration in thymocyte differentiation.
Thymocytes from the same cultures were stained with annexin V and
anti-CD44 and anti-CD25 Abs. The percentage of annexin
V-positive dying cells was significantly lower in Noggin-treated
cultures compared with control cultures (Fig. 6E). The fact
that both BMP4 and its inhibitor Noggin reduced thymocyte apoptosis in
FTOC seems surprising, but may reflect the different cellular
composition of the BMP4-treated and Noggin-treated cultures, and
differences in the survival signals required by thymocytes at different
stages in their development. Alternatively, the heterogeneity of cells
within each thymocyte population, with regards to developmental state
and lineage commitment, could mean that within a given subset there may
be both cells that survive better in response to BMP4 treatment and
cells that survive better in response to BMP4 neutralization (Noggin
treatment).
Bmp2/4 regulation in TCR-/--/-
FTOC
Thymocyte development in
TCR-/--/- mice is
arrested at the CD25+ DN stage, due to the
inability of the developing thymocytes to express and signal through
the pre-TCR complex (40). As Noggin treatment accelerated
thymocyte differentiation in wild-type FTOC and increased populations
that arise after pre-TCR signaling, we asked whether neutralization of
endogenous BMP2/4 signaling by Noggin treatment would be sufficient to
overcome the block in thymocyte development in
TCR-/--/- FTOC.
We treated
TCR-/--/- FTOC
with Noggin for 5 days. Noggin was unable to overcome the developmental
arrest, and 95% of thymocytes recovered from the Noggin-treated
cultures were DN cells, compared with 93.6% in control cultures (Fig. 7A). When we treated
TCR-/--/- FTOC
for 5 days with BMP4 alone, both BMP4 and Noggin, and Noggin alone, and
analyzed the DN populations, we found that BMP4 increased the
percentage of CD44+CD25-
cells compared with control cultures (Fig. 7B). In contrast
to the effect of Noggin treatment in wild-type FTOCs, there was no
increase in the percentage of
CD44-CD25- DN cells in
Noggin-treated
TCR-/--/- FTOC
compared with control cultures (Fig. 7B), confirming that
neutralization of endogenous BMP2/4 signaling in the FTOC is
insufficient to overcome the developmental arrest caused by the lack of
pre-TCR signaling. In cultures treated with both BMP4 and Noggin, the
effect of BMP4 was neutralized and no difference was observed in
comparison to control cultures (Fig. 7B).
|
-/--/- FTOCs
induced cell death in comparison to control FTOCs as assessed by
annexin V staining (Fig. 7C). PI staining showed that BMP4
inhibited cell proliferation in
TCR-/--/- FTOCs.
The percentage of CD44+ cells in the S and
G2 phases was lower in BMP4-treated cultures
compared with control cultures and cultures treated with Noggin, and
both Noggin and BMP4 (Fig. 7D). The cell recovery from the
cultures are consistent with these findings (Fig. 7E).
These data suggest that the ability of BMP4 to arrest thymocyte
differentiation is independent of pre-TCR signaling, and that
neutralization of BMP2/4 signaling is insufficient to overcome the need
for a pre-TCR signal. This is consistent with the finding that in
wild-type FTOC, BMP4 arrested thymocyte development at the
CD44+CD25- stage, before
TCR rearrangement and pre-TCR signaling.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Both TGF and sonic hedgehog (Shh) negatively regulate thymocyte
development and inhibit the transition from DN to DP cell (24, 42). Shh arrests thymocyte development at the
CD25+ DN stage, after TCR gene rearrangement
(24), whereas BMP4 treatment arrests thymocyte development
at the earliest CD44+CD25-
DN stage. The Shh and BMP4 pathways interact during the organization of
many developing tissues, and in human hemopoietic precursors the Shh
pathway is upstream of BMP4 signaling (21). As BMP4
arrests thymocyte development at an earlier developmental stage than
Shh, it seems likely that Shh signaling is downstream of BMP4 signaling
in the regulation of thymocyte development, although the relationship
between these two pathways remains to be elucidated.
We found expression of both BMP2 and BMP4 in the thymus. BMP2 and BMP4 are >92% identical at the amino acid level and they have the same biological activity (6). However, they are encoded by different genes and they have unique essential nonredundant roles during mouse embryogenesis (3, 7), which presumably reflect differences in the timing and tissue specificity of their expression. Our study does not distinguish between the function of BMP2 and BMP4 in the thymus, as both gene products are expressed, and the increased thymocyte differentiation in FTOC on Noggin treatment could be due to neutralization of the activity of either or both these BMPs. It is possible that BMP2 and BMP4 have overlapping functions in the thymus, or that the two genes are expressed at different times and in different locations, thereby effecting different target cells.
BMP4 treatment arrested thymocyte development at the earliest CD44+CD25- stage. This population is not committed to the T cell lineage but contains cells that have multipotent activity, and can give rise to T, B, NK, and dendritic cells (26, 29). Neutralization of endogenous BMP2/4 signaling promoted thymocyte differentiation. Taken together these findings suggest that BMP2/4 signaling might be involved in the specification of T cell lineage commitment. Local concentrations of positive (Chordin, Noggin, Tsg) or negative (BMP2/4) regulators could signal to individual thymocyte precursors, determining their lineage commitment, and the timing and speed of their differentiation along the T cell lineage.
In the future it will be interesting to assess this model for the function of BMP2/4 in the thymus using genetic models, and to study the interactions between BMP signaling and the other patterning genes that have been shown to function during T cell development (24, 32, 43, 44).
|
Footnotes |
|---|
2 A.L.H.-T. and S.V.O. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Tessa Crompton, Department of Biological Sciences, Imperial College of Science and Technology and Medicine, London SW7 2 AZ, U.K. E-mail address: t.crompton{at}ic.ac.uk
4 Abbreviations used in this paper: BMP, bone morphogenetic protein; DN, double negative; E, embryonic day; Tsg, Twisted gastrulation; DP, double positive; PI, propidium iodide; FTOC, fetal thymus organ culture; HPRT, hypoxanthine guanine phosphoribosyl transferase; Shh, sonic hedgehog.
Received for publication June 28, 2002. Accepted for publication September 16, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
related genes in development. Curr. Opin. Genet. Dev. 4:517.[Medline]
/BMP signaling. J. Cell. Physiol. 187:265.[Medline]
inhibitors: new and unexpected requirements in vertebrate development. Trends Genet. 15:3.[Medline]
chain-deficient mice. Eur. J. Immunol. 27:100.[Medline]
, and bone morphogenetic protein in the murine erythroleukemic cell line, F5–5.fl. Eur. J. Endocrinol. 143:705.[Abstract]
signalling from cell membrane to nucleus through SMAD proteins. Nature 390:465.[Medline]
, -expressing fetal mouse thymocytes are generated without T cell receptor V selection. Eur. J. Immunol. 26:804.[Medline]
chain dimers on immature thymocytes from normal mice. Eur. J. Immunol. 23:1393.[Medline]
selection events in cell development. Immunity 7:83.[Medline]
. J. Exp. Med. 179:1495.This article has been cited by other articles:
|
|
 |
|
  D. A. Sultana, S. Tomita, M. Hamada, Y. Iwanaga, Y. Kitahama, N. Van Khang, S. Hirai, I. Ohigashi, S. Nitta, T. Amagai, et al. Gene expression profile of the third pharyngeal pouch reveals role of mesenchymal MafB in embryonic thymus development Blood, March 26, 2009; 113(13): 2976 - 2987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Outram, A. L. Hager-Theodorides, D. K. Shah, N. J. Rowbotham, E. Drakopoulou, S. E. Ross, B. Lanske, J. T. Dessens, and T. Crompton Indian hedgehog (Ihh) both promotes and restricts thymocyte differentiation Blood, March 5, 2009; 113(10): 2217 - 2228. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. T. Jeker, T. Barthlott, M. P. Keller, S. Zuklys, M. Hauri-Hohl, C.-X. Deng, and G. A. Hollander Maintenance of a normal thymic microenvironment and T-cell homeostasis require Smad4-mediated signaling in thymic epithelial cells Blood, November 1, 2008; 112(9): 3688 - 3695. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. C. Wan, J. H. Pomerantz, L. J. Brunet, J.-B. Kim, Y.-F. Chou, B. M. Wu, R. Harland, H. M. Blau, and M. T. Longaker Noggin Suppression Enhances in Vitro Osteogenesis and Accelerates in Vivo Bone Formation J. Biol. Chem., September 7, 2007; 282(36): 26450 - 26459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Chandler, K. J. Chandler, K. A. McFarland, and D. P. Mortlock Bmp2 Transcription in Osteoblast Progenitors Is Regulated by a Distant 3' Enhancer Located 156.3 Kilobases from the Promoter Mol. Cell. Biol., April 15, 2007; 27(8): 2934 - 2951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Assarsson, B. J. Chambers, K. Hogstrand, E. Berntman, C. Lundmark, L. Fedorova, S. Imreh, A. Grandien, S. Cardell, B. Rozell, et al. Severe Defect in Thymic Development in an Insertional Mutant Mouse Model J. Immunol., April 15, 2007; 178(8): 5018 - 5027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Tzachanis, L. Li, E. M. Lafuente, A. Berezovskaya, G. J. Freeman, and V. A. Boussiotis Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-{beta} signaling in activated T lymphocytes Blood, April 1, 2007; 109(7): 2944 - 2952. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Nicolls, L. Taraseviciene-Stewart, P. R. Rai, D. B. Badesch, and N. F. Voelkel Autoimmunity and pulmonary hypertension: a perspective Eur. Respir. J., December 1, 2005; 26(6): 1110 - 1118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. C. Bleul and T. Boehm BMP Signaling Is Required for Normal Thymus Development J. Immunol., October 15, 2005; 175(8): 5213 - 5221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Hager-Theodorides, J. T. Dessens, S. V. Outram, and T. Crompton The transcription factor Gli3 regulates differentiation of fetal CD4-CD8- double-negative thymocytes Blood, August 15, 2005; 106(4): 1296 - 1304. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. E. Mick, T. K. Starr, T. M. McCaughtry, L. K. McNeil, and K. A. Hogquist The Regulated Expression of a Diverse Set of Genes during Thymocyte Positive Selection In Vivo J. Immunol., November 1, 2004; 173(9): 5434 - 5444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Gutierrez-Frias, R. Sacedon, C. Hernandez-Lopez, T. Cejalvo, T. Crompton, A. G. Zapata, A. Varas, and A. Vicente Sonic Hedgehog Regulates Early Human Thymocyte Differentiation by Counteracting the IL-7-Induced Development of CD34+ Precursor Cells J. Immunol., October 15, 2004; 173(8): 5046 - 5053. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Schramm, S. Huber, M. Protschka, P. Czochra, J. Burg, E. Schmitt, A. W. Lohse, P. R. Galle, and M. Blessing TGF{beta} regulates the CD4+CD25+ T-cell pool and the expression of Foxp3 in vivo Int. Immunol., September 1, 2004; 16(9): 1241 - 1249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Yang, F. M. Murillo, K.-Y. Lin, W. H. Yutzy IV, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden Human Papillomavirus Type-16 Virus-Like Particles Activate Complementary Defense Responses in Key Dendritic Cell Subpopulations J. Immunol., August 15, 2004; 173(4): 2624 - 2631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Shah, A. L. Hager-Theodorides, S. V. Outram, S. E. Ross, A. Varas, and T. Crompton Reduced Thymocyte Development in Sonic Hedgehog Knockout Embryos J. Immunol., February 15, 2004; 172(4): 2296 - 2306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. T. Tsai, R. A. Lee, and H. Wu BMP4 acts upstream of FGF in modulating thymic stroma and regulating thymopoiesis Blood, December 1, 2003; 102(12): 3947 - 3953. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
