The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gadjeva, M.
Right arrow Articles by Carroll, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gadjeva, M.
Right arrow Articles by Carroll, M. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITROPHENOLS
The Journal of Immunology, 2002, 169: 5489-5495.
Copyright © 2002 by The American Association of Immunologists

Macrophage-Derived Complement Component C4 Can Restore Humoral Immunity in C4-Deficient Mice1

Mihaela Gadjeva*,{dagger}, Admar Verschoor{ddagger}, Mark A. Brockman§, Heather Jezak*, Li Ming Shen*, David M. Knipe§ and Michael C. Carroll2,*,{dagger},{ddagger}

* Center for Blood Research, Boston, MA 02115; and Departments of {dagger} Pediatrics, {ddagger} Pathology, and § Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA 02115


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice with a disrupted C4 locus (C4-/-) have an impaired immune response to thymus-dependent Ags. To test the role of bone marrow-derived C4 in humoral immunity, we reconstituted deficient animals with wild-type bone marrow or an enriched fraction of bone marrow-derived macrophages. C4 chimeras were immunized with 4-hydroxy-3-nitrophenyl5 conjugated to keyhole limpet hemocyanin (NP5- KLH) or infected with HSV-1, and the Ab response was evaluated. Wild-type bone marrow rescued the humoral immune response to both Ags, i.e., the soluble Ag and HSV-1, demonstrating that local C4 production is sufficient for humoral responses. Although the C4 chimeric animals lacked detectable C4 in their sera, C4 mRNA was identified in splenic sections by in situ hybridization, and C4 protein deposits were identified in the germinal center areas of splenic follicles by immunofluorescence staining. Macrophages derived from bone marrow produced sufficient C4 protein to restore the humoral response to NP5-KLH in C4-deficient animals when administered along with Ag. Cell-sorting experiments, followed by C4-specific RT-PCR, identified splenic macrophages (CD11b+, CD11c-) as a cellular source for C4 synthesis within the spleen.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Activation of complement modulates humoral responses (1, 2). Studies with transient depletion of complement with cobra venom factor or with animals bearing naturally occurring complement deficiencies demonstrate the importance of the complement system in thymus-dependent (T-D)3 responses (3, 4, 5). Similarly, genetically engineered mice strains deficient in complement C1qA (6), C3, C4 (7), and CD35/CD21 (8, 9, 10), or mice treated with blocking Ab (11, 12, 13) or soluble receptor (14) show defective responses to T-D Ags administered in the absence of adjuvants. The reduction in Ab production correlates with reduced numbers of germinal centers (GC) (7, 9, 10, 15). T cells appear to be activated normally, suggesting that the defect is in the B cell response (7, 11, 16). Complement enhances B cell responses by localization of Ag on follicular dendritic cells (FDC) (15, 17) and B cell coreceptor signaling via CD21/CD19/CD81 (9, 18). Coligation of CD21/CD19 coreceptor enhances B cell receptor signaling (19, 20) and effectively lowers the threshold for activation. The effects of complement are dependent on covalent attachment of C3 to Ag or Ab (21, 22). Significantly, direct coupling of C3d multimers to protein Ag can increase the immunogenicity by greater than 1000-fold (23).

The impairment in T-D responses to Ags administered i.v. can be restored by passive administration of purified C3 or C4 along with Ag (24, 25). Although the liver is the major source of serum C3 and C4, certain bone marrow (BM)-derived cells are also capable of producing complement proteins (26, 27). Notably, reconstitution of C3-deficient animals with wild-type (WT) BM can restore the humoral response to T-D Ag administered i.v (28) or intradermally (i.d.) (29). BM-derived cells are also a source of C1q (30); thus, myeloid cells can provide a local source for complement, both in the spleen and lymph nodes. These studies raise important questions regarding the source and regulation of myeloid-derived complement.

To determine whether local synthesis is sufficient to restore the humoral response, C4-deficient mice were engrafted with WT BM or with an enriched fraction of BM-derived macrophages. BM engraftment was sufficient to restore the humoral response to a T-D-soluble Ag 4-hydroxy-3-nitrophenyl5 conjugated to keyhole limpet hemocyanin (NP5-KLH) or infectious virus (HSV-1). Local C4 was produced by CD11b+/CD11c- splenic macrophages, which also synthesized C1q and C3. Moreover, an enriched population of BM-derived macrophages was capable of restoring the B cell response to NP5-KLH in deficient animals. Taken together, these data suggest that upon stimulation, macrophages within the secondary lymphoid compartment produce early complement components, which allows for triggering of the complement cascade via the classical pathway, leading to enhancement of humoral responses to T-D Ags.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mouse strains

C4-/- mice were generated by homologous recombination, as described previously (7), and backcrossed with C57BL/6 (The Jackson Laboratory, Bar Harbor, ME) mice for five generations (>95% C57BL/6). Animals were bred and maintained at the Warren Alpert Animal Facility at Harvard Medical School. STAT-1- and IFN-{gamma}R-deficient mice were purchased from Taconic (Germantown, NY) and The Jackson Laboratory, respectively.

Generation of BM chimeras

BM cells were collected by flushing the femurs and tibias with cold PBS/0.1 mM EDTA, followed by depletion of erythrocytes by lysis with 0.15 M NH4Cl, 10 mM KHCO3. At 7–10 wk of age, C4-/- or C57BL/6 mice were lethally irradiated using two 650-rad doses and reconstituted i.v with 10 x 106 BM cells derived from gender- and age-matched C57BL/6 mice.

Immunization protocol

After transplantation, animals were rested for 6 wk and then either immunized with 100 µg NP5-KLH i.v. or infected with 2 x 106 PFU HSV-1 (KOS1.1 strain) i.d. (16, 31). After each immunization, mice were rested for 3 wk and then boosted. Animals were sacrificed 1 wk after the third boost. Serum samples were collected weekly.

Serum C4 ELISA

Immulon 1B microtiter plates (DYNEX Technologies, Chantilly, VA) were coated overnight with rat anti-murine C4 mAb 16D2 (a kind gift from E. Kremmer, GSF National Research Center for Environment and Health, Munich, Germany) in carbonate buffer. After blocking with 5% dry milk in PBS and 0.01% Tween 20, serial dilutions of mouse serum in blocking buffer were applied to the wells and incubated for 2 h at 37°C. Murine C4 was detected with rabbit anti-human C4c (DAKO, Glostrup, Denmark) and then followed by alkaline phosphatase-conjugated goat anti-rabbit IgG (Sigma-Aldrich, St. Louis, MO). Plates were developed by adding Sigma-Aldrich alkaline phosphatase substrate 104, and absorbance was measured at 405 nm.

Ab titers

Immulon 1B microtiter plates (DYNEX Technologies) were coated overnight with NP5-haptenated BSA (32) (Sigma-Aldrich), blocked as described above, and serial serum dilutions were applied and incubated for 3 h at 37°C. Murine IgG was detected by alkaline phosphatase-conjugated rat anti-mouse IgG (Sigma-Aldrich). HSV-1-specific ELISA was performed as previously described (29).

In situ C4 hybridization

A BamHI-KpnI restriction fragment representing the 5' terminal end of C4 cDNA (a kind gift from R. Ogata, Torrey Pines Institute for Molecular Studies, San Diego, CA) was subcloned into pBluescript II KS+/- (Stratagene, La Jolla, CA). Antisense digoxigenin (DIG)-labeled mC4 transcripts were produced by linearizing the pBSTmC4 plasmid with Xba and transcribing with T3 RNA polymerase I. DIG-labeled probes were produced with a DIG RNA labeling kit (SP/T7) (Roche Diagnostics, Indianapolis, IN) per manufacturer’s instructions. RNase-free sections (4 µm) were cut, and in situ hybridization was performed, as described previously (28).

BM-derived macrophages

BM-derived macrophages were grown in L929 (American Type Culture Collection, Manassas, VA)-preconditioned DMEM (Life Technologies, Rockville, MD) medium and supplemented with 10% FCS, 5% horse serum (Sigma-Aldrich), 2 mM L-glutamine, and 100 U/ml penicillin/streptomycin (Life Technologies) until the cells were confluent. Cells were scraped with a cell lifter (Fisher Scientific, Pittsburgh, PA), replated at 1 x 106 cells/well density in six-well cell culture Costar plates (Corning Glass, Corning, NY), and stimulated with 5000 IU rIFN-{gamma} (R&D Systems, Minneapolis, MN) for 12 h.

Immunofluorescence

Spleens were snap frozen in OCT (Tissue Tek Sakura, Torrence, CA)-filled molds (VWR, West Chester, PA) and stored at -80°C until cryosections were cut. Sections (5 µm) were fixed for 4 min in ice-cold acetone. Sections were blocked with 2% BSA, 2% FCS, and PBS. The following steps were conducted in the presence of the blocking buffer: sections were stained with anti-C4 rat mAb 15H12 or 16D2 (kind gifts from E. Kremmer) conjugated to Cy5 (Amersham, Arlington Heights, IL) or biotin- and FITC-conjugated peanut agglutinin (PNA; EY Laboratories, San Mateo, CA), as described (9). Both mAbs produced similar results when used for immunofluorescence. The biotinylated 16D2 was visualized using avidin-PE (BD PharMingen, San Diego, CA).

FACS analysis and sorting

Splenocytes were incubated on ice with anti-FcR (2.4G2), before treatment with Abs specific for CD45.1, CD45.2, CD11b, or CD11c (all from BD PharMingen), and analyzed using a FACSCalibur flow cytometer with CellQuest software (BD Biosciences, San Jose, CA), or sorted using a FACSVantage. When necessary, the splenocytes were depleted from B and T lymphocytes by magnetic cell sorting with microbeads before FACS analysis or sorting. For depletion purposes, biotinylated Abs specific for CD19 or CD3 (BD PharMingen) were used, followed by streptavidin MACS beads (Miltenyi Biotec, Auburn, CA). The separation was performed on MACS LD-separation columns (Miltenyi Biotec), and the unbound cells were collected and analyzed further. Cell viability was accounted for by propidium iodide (PI) staining and subsequent gating out of PI positively stained cells during the analysis.

RT-PCR

Total RNA was purified from sorted cells or splenic tissue per Qiagen (Valencia, CA) RNeasy mini kit instructions. First strand synthesis was performed with SuperScript RT (Life Technologies). C4 RT-PCR yielded a 472-bp-specific band after 30 rounds of amplification with the following primer set: sense (GGTTCTGAAGGTGCCTTGTCCC) and antisense (GTGAAGGGCAATGACCACAAAGG). C3 message was amplified after 35 cycles with the following set of primers: sense (GGCTGACTCTGTGTGGGT) and antisense (TCTCTGGTTCTTTCAACTCT).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Humoral responses are restored in the WT BM->C4-/- chimeric animals

To determine whether myeloid-derived C4 was important in the T-D humoral response, C4-deficient mice were reconstituted with WT BM (WT BM->C4-/-). Three cohorts of chimeric animals were analyzed in these studies: 1) WT BM->WT; 2) WT BM->C4-/-; and 3) C4 -/- BM->C4-/-. C57BL/6 (CD45.2) and C4-/- mice on C57BL/6 (CD45.2) background were used as recipients for donor marrow from C57BL/6 (CD45.1) mice. The congenic CD45.1 C57BL/6 strain was used to facilitate tracking of the donor-derived cells bearing the allotypic CD45.1 marker in the recipient mice. Mice were immunized i.v. with 100 µg of soluble haptenated NP5-KLH at days 0 and 21. This dose of Ag was previously shown to be fully immunogenic (28). Adjuvants were omitted from the immunization protocol to avoid circumventing the role of complement. NP-specific IgG titers were determined by ELISA (Fig. 1Goa). Alternatively, mice were infected i.d. with 2 x 106 PFU of infectious HSV-1 (Fig. 1Gob). Consistent with previous studies using C4-deficient mice, the immune response of C4-deficient chimeras to both soluble Ag (7) and infectious HSV (16) was ~8- to 18-fold lower than that of WT chimeras. By contrast, nearly normal primary and secondary Ab responses were observed in C4-deficient mice reconstituted with WT BM.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 1. BM engraftment restores humoral immunity in C4-deficient animals to T-D Ag. a, Ab response to protein Ag NP5-KLH. Mice were immunized with 100 µg of NP5-KLH i.v. at 0, 3, and 6 wk (indicated by arrows) and bled weekly. C4-/- chimeras have an impaired response to NP5-KLH. By contrast, WT BM->C4-/- chimeras respond similar to WT BM->WT mice. Ab IgG titers (reciprocal of dilution x 103) were determined by ELISA using NP5-BSA-coated plates. b, Ab response to HSV-1 in C4-deficient animals. Mice were inoculated i.d. with 2 x 106 PFU of HSV-1 (KOS1.1 strain) at 0, 3, and 6 wk, and bled weekly. C4-/- BM->C4-/- chimeras fail to respond to HSV-1 infection even after three injections. However, reconstitution of C4-/- mice with WT BM restores humoral response. Ab IgG titers (reciprocal of dilution x 102) to HSV-1 were determined by ELISA. Error bars represent SEM; n = number of mice in each group.

 
To further characterize the humoral response in the chimeric animals, splenic sections were prepared, and the number of GCs was determined by PNA staining, followed by immunofluorescence analysis. At least five animals per group were analyzed 7 days after the tertiary immunization (Table IGo). The percentage of GCs per follicle was similar to that observed in splenic sections of WT BM->C4-/- chimeras and WT BM->WT chimeras (Table IGo, Fig. 1Go). By contrast, the percentage of GCs in the splenic sections of C4-/- BM->C4-/- chimeras was reduced. Immunohistochemical analysis of splenic sections identified detectable C4 deposits in the GC areas in all of the WT chimeras, compared with ~50% in WT BM->C4-/- chimeras (Table IGo, Fig. 2Gob). C4-specific staining in the spleen of all analyzed sections was found in the GC areas and appeared to be network-like, consistent with the presence of adducts of C4 and Ag/C3 protein captured by the FDCs.


View this table:
[in this window]
[in a new window]
  		Table I. Reconstitution of GC formation in secondary lymphoid tissue of C4 BM chimeric animalsa

 


View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 2. Reconstitution of complement C4 synthesis by BM engraftment. a, C4 protein levels in sera of chimeric mice were determined by ELISA. The dotted line depicts the limits of sensitivity of the assay. Results are shown relative to WT and represent a minimum of three mice per group. b, Immunofluorescent detection of C4 deposits within the GC of the groups of chimeric mice immunized with 100 µg NP5-KLH. Spleens were harvested 1 wk after the final immunization. Cryosections were treated with anti-murine C4 mAb 15H12, conjugated to Cy5 (blue) and FITC-conjugated PNA (green). Sections are representative of spleens analyzed from at least three mice per group. Magnification, x100. c, In situ detection of C4 mRNA. Spleens were harvested 1 wk after the last immunization with NP5-KLH. Cryosections were prepared and probed with a DIG-labeled C4 antisense probe and developed with an HRP-coupled anti-DIG mAb. Sections are representative of three mice per group. Sections at x400.

 
The cellular source of complement C4

The WT BM->C4-/- chimeric animals lacked measurable C4 protein in their sera based on ELISA analysis (Fig. 2Goa), but C4 was detected in splenic sections by immunofluorescence, as discussed above (Fig. 2Gob). Moreover, C4 RNA was identified in splenic sections by in situ hybridization (Fig. 2Goc). The C4-producing cells were detected with a DIG-labeled C4 antisense RNA probe derived from C4 cDNA. Comparison of splenic sections from the three groups of chimeras immunized with NP5-KLH revealed a similar distribution of C4 mRNA-positive cells throughout the white pulp and some individual cells in the red pulp. As expected, no C4 mRNA-positive cells were observed in sections prepared from C4-/- BM->C4-/- animals (Fig. 2Goc). In summary, reconstitution of C4-/- mice with WT BM restored C4 synthesis within the spleen and lymph nodes, as measured by protein staining (Fig. 2Gob), in situ hybridization (Fig. 2Goc), and RT-PCR (data not shown).

To determine the extent of engraftment and identify the cellular source of donor-derived C4, single cell suspensions of spleen cells were prepared from chimeras and analyzed by FACS. Over 90% of the CD11b+ population in the spleen was of donor origin, based on expression of the CD45.1 donor allotype (Fig. 3Go). This compartment includes myeloid-derived cells, such as splenic macrophages, dendritic cells, and neutrophils. The CD11b+ splenocytes were further subdivided based on CD11c staining and forward and side scatter characteristics. CD11b+ R2- and CD11b+ R3-gated cells were sorted (Fig. 4Goa), and cytospins were prepared. Nuclear morphology determined with Giemsa Wright staining showed that the R2 gate included granulocytes, whereas the R3 gate was comprised primarily of monocytes (macrophages). To establish whether the sorted cells produced not only C4 and C3 complement components, but also C1q, total RNA was prepared from the sorted populations and analyzed by RT-PCR. Although both granulocytes and monocytes synthesize C3 (Fig. 4Gob), only the monocytic population was positive for C4 and C1q mRNA. Thus, a similar population of macrophages produced C1q, C4, and C3.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 3. Engraftment of C4-/- animals with WT BM results in over 90% donor CD11b+ cells in the spleens of recipient mice after 14 wk. a, Degree of chimerism in CD11b+ splenic populations in BM chimeras. Freshly harvested splenocytes were stained with Abs specific for CD45.1, CD45.2, and CD11b. PI was added to detect dead cells. Flow data were analyzed by gating on the majority of splenocytes based on forward and side scatter (R1), excluding PI-positive cells (R2) (data not shown). The CD11b profile (R3) is based on combined R1 and R2 gates. Representative histograms are shown from WT BM->WT, WT BM->C4-/-, and C4-/- BM->C4-/- chimeras 14 wk after BM transplantation. b, Mean level of chimerism in WT BM->WT and WT BM->C4-/- is determined by the frequency of CD45.1 allotype-marked donor cells. Significantly, >90% of CD11b+ cells are donor derived. Results represent analysis of splenocytes harvested from five mice per group. Note that C4-/- BM donor cells are CD45.2; therefore, the degree of chimerism could not be determined.

 


View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 4. Splenic macrophages are a common cellular source for C1q, C3, and C4. a, A representative sorting experiment to distinguish between monocytes and polymorphonuclear cells in the spleens of C57BL/6 animals. The splenocytes were sorted on the basis of their granularity and size, determined by forward (FSC) and side scatter (SSC) characteristics and expression of CD11b and CD11c. The CD11b+CD11c- cells (R1 gated) were subdivided based on FSC and SSC characteristics into two groups, i.e., R2 and R3 gates. Cytospins were prepared from sorted cells and analyzed following Giemsa Wright staining. b, Detection of synthesis of complement components. Total RNA was prepared from 20 x 104 sorted cells (R2 and R3 gates) and analyzed by RT-PCR for C4, C3, and C1q mRNA presence. As controls, total RNA from splenic tissues was prepared from C57BL/6, C3-/-/C4-/-, and C1q-/- mice, followed by actin, C3, C4, or C1q RT-PCRs. Results are representative of at least three separate sorting experiments.

 
BM-derived macrophages can produce sufficient C4 to restore humoral immunity to NP5-KLH

To test the ability of macrophages to produce complement C4, monocytic cells were derived from cultured C57BL/6 BM. FACS analysis of the cultured cells revealed a high frequency of macrophages (CD11b+, F480+CD11c-, and I-Ab- cells; data not shown), confirming the expected macrophage phenotype of the cells in the cultures. C4 expression by BM macrophages (BMM) was detected by RT-PCR (Fig. 5Goa) after stimulation with 5000 IU of rIFN-{gamma}. Expression was STAT-1 dependent, as BMM isolated from STAT-1- or IFN-{gamma}-deficient mice (data not shown) failed to up-regulate C4 mRNA, suggesting that C4 expression is tightly regulated (Fig. 5Goa).



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. Adoptive transfer of BMM in C4-/- mice restores humoral immunity. a, C4 message is detected in BM-derived macrophages by RT-PCR upon IFN-{gamma} stimulation. BMM prepared from C57BL/6 and STAT-1-/- mice were cultured for 5 days. BMM (1 x 106 cells) were stimulated with 5000 IU rIFN-{gamma}; 6 h later, total RNA was prepared, followed by RT-PCR using primers for C4 and actin. Results indicate negligible levels of C4 mRNA in BMM isolated from STAT-1-/- mice or untreated BMM isolated from C57BL/6 mice. However, treatment of C57BL/6-, but not STAT-1-/--derived BMM with 5000 U IFN-{gamma} induces C4 mRNA expression. Results are representative of three different experiments. b, Ab response to NP5-KLH in C4-deficient animals after adoptive transfer. C4-/- animals were engrafted with 20 x 106 BMM prepared from C57BL/6 mice before immunization with NP5-KLH at 0 and 3 wk. Animals were bled weekly, and Ab IgG titers were determined by ELISA, as described in Fig. 1Go.

 
To test the functional importance of C4 expression by BMM in vivo, 20 x 106 nonstimulated BMM were administered i.v. to C4-deficient mice 1 h before immunization with 100 µg NP5-KLH. At 3 wk, a comparable dose of BMM was administered, and mice were boosted with 100 µg NP5-KLH. Serum titers of anti-NP IgG were assayed weekly (Fig. 5Gob). As expected, the response in C4-deficient animals receiving C4-/- BMM was impaired compared with WT animals. By contrast, the response observed in WT and C4-/- animals that received BMM was comparable. Thus, engraftment of C4-/- mice with an enriched population of BMM was sufficient to restore humoral response to NP5-KLH.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Mice homozygous for null alleles at C3, C4 (7), or C1q (6) loci have an impaired immune response to T-D Ags such as {phi}X174 or NP5-KLH. BM engraftment restores this defect in C3-deficient animals (28). It is possible that BM-derived cells can be a source of local complement synthesis that includes not only C3, but also other complement proteins. To test this possibility, C4-/- mice were engrafted with WT BM or an enriched population of BMM. We found that BM engraftment leads to restoration of humoral response in C4-deficient animals despite an apparent absence of C4 protein in the serum.

Ab responses to two different T-D Ags were evaluated (soluble protein Ag and infectious HSV-1). In both cases, WT BM engraftment led to reconstitution of humoral responses as measured by Ab titers (Fig. 1Go). Peripheral infection with HSV-1 represents a physiologically relevant model to study the role of complement activation. Previous analysis of mice deficient in C3, C4, or CD21/35 following infection with HSV-1 revealed an impaired secondary response characterized by low Ab titers. These results suggest that the classical pathway is important in initiating complement activation leading to the activation of C3. The effects of C3 are dependent on CD21/CD35, as a similar impairment is observed in CD21/CD35-deficient mice (16). Previously, we demonstrated that WT BM engraftment in C3-/- mice restored the impaired Ab response to HSV-1 (29). WT BM->C4-/- chimeric mice have a phenotype similar to WT BM->C3-/- mice with regard to HSV-1 Ab titers, indicating that local complement production is adequate to enhance the antiviral response and that BM-derived cells can produce complement components C3 and C4. These findings implicate locally produced complement as important to the humoral immune response and may be helpful in the design of future vaccines.

In contrast to WT BM->C1q-/- chimeras (30), in which WT BM engraftment led to reconstitution of circulating C1q serum levels, engraftment did not restore C4 serum levels in WT BM->C4-/- chimeras (Fig. 2Goa); this finding is similar to previous observations in WT BM->C3-/- mice (28). These variations could be explained by the differences in regulation of C1q vs C3 and C4. Macrophages, a major cellular source of C1q, are responsible for circulating C1q levels, while hepatocytes are the predominant source of serum C3 and C4 (26, 27, 30).

C4 synthesis by BM-derived cells was detected by in situ hybridization (Fig. 2Goc). C4 mRNA localized randomly throughout the splenic white pulp, suggesting that the monocytic-producing cells were not clustered within a subregion, such as the follicular zone. A similar pattern was previously observed for C3 mRNA (28). In this study, the pattern of C3 mRNA expression correlated with MOMA-2+ cells based on immunohistochemistry of serial sections. Moreover, MOMA-2+ cells were identified as a major source of C3 by RT-PCR analysis of an enriched fraction of cells. We used a similar approach to sort MOMA-2+ cells by magnetic beads from a suspension of splenocytes; RT-PCR analysis identified C4 mRNA in MOMA-2+, but not B cell controls (results not shown). Thus, the MOMA-2+ population of macrophages can express both C3 and C4.

Previous experiments have identified numerous sites for C3 synthesis in addition to the liver. In humans, extrahepatic C3-producing cells include monocytes/macrophages, fibroblasts, capillary endothelial cells, T cells, endometrium, adipocytes, osteoblasts, and intestinal epithelial cells (33, 34, 35, 36, 37, 38). Similar extrahepatic sources have been identified in the mouse (39, 40). Although studied less intensely, C4 synthesis appears to be more limited than C3. Murine C4 synthesis was identified in peritoneal and resident kidney macrophages (41, 42). Bone marrow-derived macrophages (CD11b+CD11c-) are a cellular source of C4 in the spleen and lymph nodes (Figs. 4Go and 5Go, and data not shown). The CD11b+ cells in WT BM->C4-/- chimeras were over 98% donor derived, as judged by the frequency of the allotypic marker (Fig. 3Go). Splenic populations were sorted based on CD11b vs CD11c expression, size, and granularity (43). C4 and C1q mRNAs were detected only in the monocytic/macrophage-sorted population (Fig. 5Gob), whereas granulocytes and monocytic cells both expressed C3. This pattern of differential synthesis of complement may reflect the various physiological activities of the cell types. Macrophages appear to produce all the necessary complement components to enhance B cell activation, whereas neutrophils might contribute more to alternative pathway-mediated inflammatory reactions.

Notably, engraftment of WT BM led to sufficient C4 synthesis to allow for local complement activation. As a consequence of complement activation, C4 deposits were captured on FDCs (Fig. 2Gob). The C4-specific staining in the splenic sections colocalized with PNA (Fig. 2Gob) and Ag (data not shown). The frequency of GCs in the splenic follicles of immunized WT BM->WT and WT BM->C4-/- mice was comparable (Table IGo). However, while C4 deposits were detectable within all GCs in WT BM->WT chimeras, only ~50% of the GCs of WT BM->C4-/- chimeras included detectable C4 deposits. By contrast, few GCs were observed in the follicles of C4-/- BM->C4-/- and nonimmunized age-matched controls. The immunoreactive C4 protein visualized by the immunofluorescent staining most likely represents C4-bearing immune complexes. These data are consistent with previously published reports identifying the presence of activated products of complement (C1q, C3, C4, and C5) within the GCs (6, 28, 44, 45). Taylor et al. (46) recently reported that the FDC-restricted epitope, FDC-M2, is complement C4 and that its localization in the spleen follows complement activation and is in the form of immune complexes. Complement facilitates trapping of Ag-Ab complexes within the FDC network. C4 deposits on FDCs can be explained by direct interaction with CD35 (9, 15). Alternatively, C4 capture may be C3 dependent because activated C3b can covalently attach to a specific site in the C4b molecule (47).

Dermal infection of BALB/C mice with HSV-1 is associated with a Th1-type response characterized by IFN-{gamma} production (48). The cytokine environment within lymphoid organs of immune mice may favor induction of local complement expression. For example, C3 synthesis by macrophages is regulated by IFN-{gamma} and is shown to be STAT-1 dependent (49). It has been proposed that IFN-{gamma} also increases the stability of C3 and C4 mRNA (50). Similar to C3, BMMs express higher levels of C4 message by RT-PCR upon IFN-{gamma} stimulation (Fig. 5Goa). The IFN-{gamma} effect is also STAT-1 dependent (Fig. 5Goa). It is likely that a common activation pathway exists in macrophages to ensure rapid up-regulation of complement production locally following infection.

Adoptive transfer experiments of BM-derived macrophages in C4-/- mice suggest a physiological role for macrophage-produced C4 (Fig. 5Gob). Low levels of macrophage C4 can suffice to facilitate complement activation, leading to Ag tagging with C3/C4 fragments, capture, and retention on FDCs. The data are consistent with the hypothesis that complement activation via the classical pathway is required to enhance T-D responses to inert protein Ags delivered i.v.

In summary, WT BM or BMM engraftment can provide sufficient C4 to allow for complement activation and restoration of humoral responses in WT BM->C4-/- chimeric mice. Thus, enhancement of humoral immunity to pathogens is an important function of locally produced early complement.


   Acknowledgments
 
We thank Drs. R. Barrington and M. Zhang for helpful comments during preparation of the manuscript; Dr. T. Schneider for assistance with cell-sorting experiments; A. Burton and J. Xia for genotyping the mice; and M. Ottaviano for technical assistance.


   Footnotes
 
1 This work was supported by grants from the National Institutes of Health, P01 AI42257 and R01 HD38749. Back

2 Address correspondence and reprint requests to Dr. Michael C. Carroll, Center for Blood Research, 221 Longwood Avenue, LMRC501, Boston, MA 02115. E-mail address: carroll{at}cbr.med.harvard.edu Back

3 Abbreviations used in this paper: T-D, thymus dependent; BM, bone marrow; BMM, BM macrophage; DIG, digoxigenin; FDC, follicular dendritic cell; GC, germinal center; i.d., intradermally; KLH, keyhole limpet hemocyanin; NP5, 4-hydroxy-3-nitrophenyl5; PI, propidium iodide; PNA, peanut agglutinin; WT, wild type. Back

Received for publication July 23, 2002. Accepted for publication September 16, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fearon, D. T., R. H. Carter. 1995. The CD19/CR2/TAPA-1 complex of B lymphocytes: linking natural to acquired immunity. Annu. Rev. Immunol. 13:127.[Medline]
  2. Carroll, M. C., M. B. Fischer. 1997. Complement and the immune response. Curr. Opin. Immunol. 9:64.[Medline]
  3. Pepys, M. B.. 1974. Role of complement in induction of antibody production in vivo: effect of cobra factor and other C3-reactive agents on thymus-dependent and thymus-independent antibody responses. J. Exp. Med. 140:126.[Abstract]
  4. Bottger, E. C., S. Metzger, D. Bitter-Suermann, G. Stevenson, S. Kleindienst, R. Burger. 1986. Impaired humoral immune response in complement C3-deficient guinea pigs: absence of secondary antibody response. Eur. J. Immunol. 16:1231.[Medline]
  5. O’Neil, K. M., H. D. Ochs, S. R. Heller, L. C. Cork, J. M. Morris, J. A. Winkelstein. 1988. Role of C3 in humoral immunity: defective antibody production in C3-deficient dogs. J. Immunol. 140:1939.[Abstract/Free Full Text]
  6. Cutler, A. J., M. Botto, D. van Essen, R. Rivi, K. A. Davies, D. Gray, M. J. Walport. 1998. T cell-dependent immune response in C1q-deficient mice: defective interferon {gamma} production by antigen-specific T cells. J. Exp. Med. 187:1789.[Abstract/Free Full Text]
  7. Fischer, M. B., M. Ma, S. Goerg, X. Zhou, J. Xia, O. Finco, S. Han, G. Kelsoe, R. G. Howard, T. L. Rothstein, et al 1996. Regulation of the B cell response to T-dependent antigens by classical pathway complement. J. Immunol. 157:549.[Abstract]
  8. Croix, D. A., J. M. Ahearn, A. M. Rosengard, S. Han, G. Kelsoe, M. Ma, M. C. Carroll. 1996. Antibody response to a T-dependent antigen requires B cell expression of complement receptors. J. Exp. Med. 183:1857.[Abstract/Free Full Text]
  9. Ahearn, J. M., M. B. Fischer, D. Croix, S. Goerg, M. Ma, J. Xia, X. Zhou, R. G. Howard, T. L. Rothstein, M. C. Carroll. 1996. Disruption of the Cr2 locus results in a reduction in B-1a cells and in an impaired B cell response to T-dependent antigen. Immunity 4:251.[Medline]
  10. Molina, H., V. M. Holers, B. Li, Y. Fung, S. Mariathasan, J. Goellner, J. Strauss-Schoenberger, R. W. Karr, D. D. Chaplin. 1996. Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2. Proc. Natl. Acad. Sci. USA 93:3357.[Abstract/Free Full Text]
  11. Gustavsson, S., T. Kinoshita, B. Heyman. 1995. Antibodies to murine complement receptor 1 and 2 can inhibit the antibody response in vivo without inhibiting T helper cell induction. J. Immunol. 154:6524.[Abstract]
  12. Thyphronitis, G., T. Kinoshita, K. Inoue, J. E. Schweinle, G. C. Tsokos, E. S. Metcalf, F. D. Finkelman, J. E. Balow. 1991. Modulation of mouse complement receptors 1 and 2 suppresses antibody responses in vivo. J. Immunol. 147:224.[Abstract]
  13. Heyman, B., E. J. Wiersma, T. Kinoshita. 1990. In vivo inhibition of the antibody response by a complement receptor-specific monoclonal antibody. J. Exp. Med. 172:665.[Abstract/Free Full Text]
  14. Hebell, T., J. M. Ahearn, D. T. Fearon. 1991. Suppression of the immune response by a soluble complement receptor of B lymphocytes. Science 254:102.[Abstract/Free Full Text]
  15. Fang, Y., C. Xu, Y. X. Fu, V. M. Holers, H. Molina. 1998. Expression of complement receptors 1 and 2 on follicular dendritic cells is necessary for the generation of a strong antigen-specific IgG response. J. Immunol. 160:5273.[Abstract/Free Full Text]
  16. Da Costa, X. J., M. A. Brockman, E. Alicot, M. Ma, M. B. Fischer, X. Zhou, D. M. Knipe, M. C. Carroll. 1999. Humoral response to herpes simplex virus is complement-dependent. Proc. Natl. Acad. Sci. USA 96:12708.[Abstract/Free Full Text]
  17. Papamichail, M., C. Gutierrez, P. Embling, P. Johnson, E. J. Holborow, M. B. Pepys. 1975. Complement dependence of localization of aggregated IgG in germinal centers. Scand. J. Immunol. 4:343.[Medline]
  18. Fischer, M. B., S. Goerg, L. Shen, A. P. Prodeus, C. C. Goodnow, G. Kelsoe, M. C. Carroll. 1998. Dependence of germinal center B cells on expression of CD21/CD35 for survival. Science 280:582.[Abstract/Free Full Text]
  19. Carter, R. H., D. T. Fearon. 1992. CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science 256:105.[Abstract/Free Full Text]
  20. Cherukuri, A., P. C. Cheng, S. K. Pierce. 2001. The role of the CD19/CD21 complex in B cell processing and presentation of complement-tagged antigens. J. Immunol. 167:163.[Abstract/Free Full Text]
  21. Isenman, D. E., J. R. Young. 1984. The molecular basis for the difference in immune hemolysis activity of the Chido and Rodgers isotypes of human complement component C4. J. Immunol. 132:3019.[Abstract]
  22. Law, S. K., R. P. Levine. 1977. Interaction between the third complement protein and cell surface macromolecules. Proc. Natl. Acad. Sci. USA 74:2701.[Abstract/Free Full Text]
  23. Dempsey, P. W., M. E. Allison, S. Akkaraju, C. C. Goodnow, D. T. Fearon. 1996. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271:348.[Abstract]
  24. Finco, O., S. Li, M. Cuccia, F. S. Rosen, M. C. Carroll. 1992. Structural differences between the two human complement C4 isotypes affect the humoral immune response. J. Exp. Med. 175:537.[Abstract/Free Full Text]
  25. Ochs, H. D., R. J. Wedgwood, M. M. Frank, S. R. Heller, S. W. Hosea. 1983. The role of complement in the induction of antibody responses. Clin. Exp. Immunol. 53:208.[Medline]
  26. Alper, C. A., A. M. Johnson, A. G. Birtch, F. D. Moore. 1969. Human C'3: evidence for the liver as the primary site of synthesis. Science 163:286.[Abstract/Free Full Text]
  27. Saunders, D., M. Edidin. 1974. Sites of localization and synthesis of Ss protein in mice. J. Immunol. 112:2210.[Abstract/Free Full Text]
  28. Fischer, M. B., M. Ma, N. C. Hsu, M. C. Carroll. 1998. Local synthesis of C3 within the splenic lymphoid compartment can reconstitute the impaired immune response in C3-deficient mice. J. Immunol. 160:2619.[Abstract/Free Full Text]
  29. Verschoor, A., M. A. Brockman, D. M. Knipe, M. C. Carroll. 2001. Cutting edge: myeloid complement C3 enhances the humoral response to peripheral viral infection. J. Immunol. 167:2446.[Abstract/Free Full Text]
  30. Petry, F., M. Botto, R. Holtappels, M. J. Walport, M. Loos. 2001. Reconstitution of the complement function in C1q-deficient (C1qa-/-) mice with wild-type bone marrow cells. J. Immunol. 167:4033.[Abstract/Free Full Text]
  31. Jacob, J., R. Kassir, G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J. Exp. Med. 173:1165.[Abstract/Free Full Text]
  32. Hatcher, V., O. Makela. 1972. Immunological cross-reactions within a family of related haptens. Immunochemistry 9:1139.[Medline]
  33. Katz, Y., R. C. Strunk. 1989. IL-1 and tumor necrosis factor: similarities and differences in stimulation of expression of alternative pathway of complement and IFN-{beta}2/IL-6 genes in human fibroblasts. J. Immunol. 142:3862.[Abstract]
  34. Pantazis, P., V. S. Kalyanaraman, D. H. Bing. 1990. Synthesis of the third component of complement (C3) by lectin-activated and HTLV-infected human T-cells. Mol. Immunol. 27:283.[Medline]
  35. Sundstrom, S. A., B. S. Komm, H. Ponce-de-Leon, Z. Yi, C. Teuscher, C. R. Lyttle. 1989. Estrogen regulation of tissue-specific expression of complement C3. J. Biol. Chem. 264:16941.[Abstract/Free Full Text]
  36. Choy, L. N., B. S. Rosen, B. M. Spiegelman. 1992. Adipsin and an endogenous pathway of complement from adipose cells. J. Biol. Chem. 267:12736.[Abstract/Free Full Text]
  37. Hong, K., T. Kinoshita, P. Pramoonjago, Y. U. Kim, T. Seya, K. Inoue. 1991. Reconstitution of C5 convertase of the alternative complement pathway with isolated C3b dimer and factors B and D. J. Immunol. 146:1868.[Abstract]
  38. Molmenti, E. P., T. Ziambaras, D. H. Perlmutter. 1993. Evidence for an acute phase response in human intestinal epithelial cells. J. Biol. Chem. 268:14116.[Abstract/Free Full Text]
  39. Circolo, A., G. Garnier, W. Fukuda, X. Wang, T. Hidvegi, A. J. Szalai, D. E. Briles, J. E. Volanakis, R. A. Wetsel, H. R. Colten. 1999. Genetic disruption of the murine complement C3 promoter region generates deficient mice with extrahepatic expression of C3 mRNA. Immunopharmacology 42:135.[Medline]
  40. Pratt, J. R., S. A. Basheer, S. H. Sacks. 2002. Local synthesis of complement component C3 regulates acute renal transplant rejection. Nat. Med. 8:582.[Medline]
  41. Passwell, J., G. F. Schreiner, M. Nonaka, H. U. Beuscher, H. R. Colten. 1988. Local extrahepatic expression of complement genes C3, factor B, C2, and C4 is increased in murine lupus nephritis. J. Clin. Invest. 82:1676.
  42. Sackstein, R., H. R. Colten. 1984. Molecular regulation of MHC class III (C4 and factor B) gene expression in mouse peritoneal macrophages. J. Immunol. 133:1618.[Abstract]
  43. Lagasse, E., I. L. Weissman. 1996. Flow cytometric identification of murine neutrophils and monocytes. J. Immunol. Methods 197:139.[Medline]
  44. Masuda, A.. 1988. Immunohistochemical study of Warthin’s tumor with special regard to the germinal center. Histol. Histopathol. 3:81.[Medline]
  45. Schwaeble, W., M. K. Schafer, F. Petry, T. Fink, D. Knebel, E. Weihe, M. Loos. 1995. Follicular dendritic cells, interdigitating cells, and cells of the monocyte-macrophage lineage are the C1q-producing sources in the spleen: identification of specific cell types by in situ hybridization and immunohistochemical analysis. J. Immunol. 155:4971.[Abstract]
  46. Taylor, P. R., M. C. Pickering, M. H. Kosco-Vilbois, M. J. Walport, M. Botto, S. Gordon, L. Martinez-Pomares. 2002. The follicular dendritic cell restricted epitope, FDC-M2, is complement C4; localization of immune complexes in mouse tissues. Eur. J. Immunol. 32:1888.[Medline]
  47. Kim, Y. U., M. C. Carroll, D. E. Isenman, M. Nonaka, P. Pramoonjago, J. Takeda, K. Inoue, T. Kinoshita. 1992. Covalent binding of C3b to C4b within the classical complement pathway C5 convertase: determination of amino acid residues involved in ester linkage formation. J. Biol. Chem. 267:4171.[Abstract/Free Full Text]
  48. Brubaker, J. O., C. M. Thompson, L. A. Morrison, D. M. Knipe, G. R. Siber, R. W. Finberg. 1996. Th1-associated immune responses to {beta}-galactosidase expressed by a replication-defective herpes simplex virus. J. Immunol. 157:1598.[Abstract]
  49. Meraz, M. A., J. M. White, K. C. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. Kaplan, J. K. Riley, A. C. Greenlund, D. Campbell, et al 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431.[Medline]
  50. Mitchell, T. J., M. Naughton, P. Norsworthy, K. A. Davies, M. J. Walport, B. J. Morley. 1996. IFN-{gamma} up-regulates expression of the complement components C3 and C4 by stabilization of mRNA. J. Immunol. 156:4429.[Abstract]



This article has been cited by other articles:


Home page
 JEMHome page
E. Mehlhop and M. S. Diamond
Protective immune responses against West Nile virus are primed by distinct complement activation pathways
J. Exp. Med., May 15, 2006; 203(5): 1371 - 1381.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Verschoor, M. A. Brockman, M. Gadjeva, D. M. Knipe, and M. C. Carroll
Myeloid C3 Determines Induction of Humoral Responses to Peripheral Herpes Simplex Virus Infection
J. Immunol., November 15, 2003; 171(10): 5363 - 5371.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gadjeva, M.
Right arrow Articles by Carroll, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gadjeva, M.
Right arrow Articles by Carroll, M. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITROPHENOLS

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS