|
|
||||||||








* Immunobiology Group, Medical Research Council Center for Inflammation Research,
Respiratory Medicine Unit, and
Department of Pathology, University of Edinburgh School of Medicine, Edinburgh, United Kingdom; and
Department of Biological Sciences, Imperial College of Science, Technology and Medicine, London, United Kingdom
| Abstract |
|---|
|
|
|---|
, and IL-10 by activated
CD4+ T cells. The synthesis of IL-2 and IFN-
, but not
IL-10, by CD4+ T cells was down-regulated by
the addition of neutralizing anti-Shh Ab. Cell surface expression
of CD25 and CD69 on activated T cells was up-regulated by exogenous
Shh, whereas in the presence of the neutralizing anti-Shh Ab
expression it was reduced. Collectively, our findings demonstrate that
Shh-mediated signaling is a physiological component of T cell
responses, which acts to modulate CD4+ T cell
effector function. | Introduction |
|---|
|
|
|---|
Shh signaling can induce proliferation in a variety of cell types, which include keratinocytes (13), neuronal precursor cells (14), and hemopoietic stem cells (15). Mutations in Ptc and Smo, which result in constitutive activation of this signaling pathway, have been demonstrated in proliferative diseases, such as basal cell carcinoma (16), further illustrating the ability of Shh signaling to induce proliferation. Components of the Shh pathway have now been detected in thymus, in which they are reported to contribute to T cell development (17). However, while the receptors Ptc and Smo are expressed on thymocytes, Shh was found only to be present on thymic epithelial cells. By neutralizing the activity of Shh, it was observed that the differentiation of thymocytes from the double-negative (CD4-CD8-) to double-positive (CD4+ CD8+) stage was increased, whereas the addition of Shh arrested thymocyte development at the double-negative stage (17). It has been reported that Shh can also induce proliferation in human hemopoietic stem cells, and, in addition, the presence of transcripts for shh, Ptc, and smo has been demonstrated in mature CD19+ and CD3+ cell populations (15). However, information on the effects of Shh signaling on the function of peripheral T cells is limited (18).
The contribution of the Shh signaling pathway in the development and
differentiation of the immune system prompted us to determine whether
the activation of this pathway can influence the human peripheral
CD4+ T cell repertoire. We report in this study
that Shh and Ptc are present on resting and activated peripheral
CD4+ T cells and that Ptc expression
is increased in approximately one-half of the randomly selected,
anonymous blood donors tested, by the addition of exogenous Shh,
indicating, therefore, that Shh signaling had occurred in the T cells.
The addition of Shh enhanced the expression of CD25 and CD69 and
cytokine production, namely IL-2, IL-10, and IFN-
, by
CD4+ T cells activated by anti-CD3 and
anti-CD28 Abs. In the absence of exogenous Shh, the addition
of a neutralizing anti-Shh Ab, which recognizes an epitope that
overlaps the Ptc binding site of Shh and thus blocks signaling by
preventing Shh binding (19, 20, 21, 22, 23), reduced cell surface
expression of CD25 and CD69 on activated T cells. The production of
IL-2 and IFN-
, but not IL-10, was inhibited by the anti-Shh Ab.
Taken collectively, our results demonstrate that the induction of Shh
signaling in peripheral human CD4+ T cells
modulates T cell activation and cytokine production.
| Materials and Methods |
|---|
|
|
|---|
Human PBMCs were isolated from randomly selected, anonymized, single-donor Buffy coats, obtained from the Blood Transfusion Center (Royal Infirmary of Edinburgh, U.K.), by centrifugal separation over Histopaque 1077 (Sigma-Aldrich, Dorset, U.K.). CD4+ T cells were separated using negative selection affinity columns (R&D Systems, Abingdon, U.K.), according to the manufacturers instructions. After separation, the T cells were washed and resuspended in RPMI 1640 culture medium supplemented with 5% heat-inactivated human AB serum, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine (Life Technologies, Paisley, U.K.). Purity of the CD4+ T cell preparations was analyzed by flow cytometry and was consistently >93%.
Immunocytochemistry
Purified CD4+ T cells were spun onto Vectabond-treated microscope slides (Vector Laboratories, Peterborough, U.K.) using a Cytospin 3 (Shandon Scientific, Runcorn, Cheshire, U.K.), set at 300 rpm for 3 min. The cells were air dried and fixed with methanol. After blocking endogenous peroxidase in 3% H2O2, sections were loaded onto a Sequenza (Shandon Scientific). Nonspecific binding was blocked using normal rabbit serum, and endogenous biotin was blocked using Vector blocking kit (Vector Laboratories), according to the manufacturers instructions. Slides were incubated with the primary Ab diluted in appropriate serum for 30120 min at room temperature, washed with PBS, and incubated with a biotinylated secondary Ab for 30 min. They were washed again, and Vector RTU ABC (Vector Laboratories) was applied and positive signal was detected by the addition of diaminobenzidine (DAKO U.K., Ely, U.K.), with a hematoxylin counterstain. Primary Abs to the N terminus of Shh (N-19, 5 µg/ml, 1/40 dilution; Santa Cruz Biotechnology, Santa Cruz, CA; Insight Biotechnology, Wembley, Middlesex, U.K.) and to the C terminus of Ptc (C-20, 5 µg/ml, 1/40 dilution; Santa Cruz Biotechnology) were used, with a biotinylated anti-goat IgG secondary Ab (DAKO). Both anti-Shh and anti-Ptc Abs are completely blocked by the use of the relevant peptide (data not shown). Images were captured using a Progress 3012 camera (Kontron Elektronik, Zurich, Switzerland) through a Zeiss Axioskop microscope (Oberkochen, Germany).
CD4+ T cell cultures
Purified CD4+ T cells (5 x 105/ml) were stimulated by the combination of immobilized anti-CD3 (1 µg/ml) and soluble anti-CD28 (5 µg/ml) Abs (BD PharMingen, San Diego, CA). In experiments in which either exogenous soluble N-Shh peptide or anti-Shh Ab and isotype control was added, this was performed at the initiation of the cultures.
The mouse rShh, a 180-residue N-terminal peptide (R&D Systems), was reconstituted in filter-sterilized PBS containing 0.2% endotoxin-free BSA, to a final concentration of 50 µg/ml.
The neutralizing anti-Shh Ab (5E1; Developmental Studies Hybridoma Bank, Iowa City, IA) (19, 20, 21, 22, 23) and the murine IgG1 isotype control (P3 x 63Ag8; European Cell Culture Collection, Porton Down, Wiltshire, U.K.) were purified from hybridoma supernatants using protein G columns (Amersham Pharmacia Biotech, Piscataway, NJ). Western blotting confirmed that 5E1, but not the isotype Ab bound to the Shh peptide (data not shown).
CD4+ T cell proliferation
CD4+ T cells were cultures as above in 96-well plates with and without the addition of exogenous Shh or anti-Shh Ab. Proliferation was assessed by the incorporation of methyl tritiated thymidine ([3H]TdR; Amersham Pharmacia Biotech). Cultures were pulsed after 48 h of anti-CD3/28 activated with 1 µCi/well of [3H]TdR and at 72 h harvested onto glass fiber filters (Wallac, Milton Keynes, U.K.). [3H]TdR incorporation was measured using a Betaplate counter (Wallac).
Flow cytometry
Phenotypic analysis was performed using PE- and FITC-conjugated mAbs specific for CD3, CD4, CD25, CD69, and the appropriate isotype controls (BD PharMingen) using a BD Biosciences FACSCalibur (BD Immunocytometry Systems, San Jose, CA). Viable CD4+ T cells were gated using forward and side scatter.
Measurement of cytokine production by ELISA
Cytokine production by purified human CD4+
T cells (IL-2, IL-10, and IFN-
was measured using Duoset ELISA
development system kits (R&D Systems), following the manufacturers
protocols.
Isolation of RNA and RT-PCR
Extraction of total RNA from purified CD4+ T cells was performed using TRIzol reagent (Life Technologies), as per the manufacturers recommendations. The RNA pellets were air dried and resuspended in prewarmed nuclease-free H2O (Promega, Southampton, U.K.). To remove any contaminating DNA, the RNA was DNase treated. Total RNA from the CD4+ T cells was transcribed into cDNA using Access RT-PCR kit (Promega), according to the manufacturers instructions. The PCR program was as follows: 35 cycles of 30 s at 94°C, 1 min at melting temperature (Tm) annealing temperature, and 2 min at 68°C, followed by a final extension of 7 min at 68°C. This was performed on a PTC-200 Peltier thermal cycler (MJ Research, Massachusetts, MA).
The following primers were used to detect ptc, with a Tm of 58°C, giving a PCR product of 462 bp: forward primer, CCATGTTCCAGTTAATGACTC; reverse primer, ACATCATCCACACCAACA.
The following primers were used to detect Shh, with a Tm of 60°C, giving a PCR product of 335 bp: forward primer, CAGCGCGTGTACGTGGTGGC; reverse primer, GGAGCGTCGGCAGCACCTG.
The demonstration that transcripts for both Shh and Ptc are present in the human lung epithelial cell line A549 served as a positive control.
Real-time RT-PCR
Primers and probes were designed using Primer Express software (PE Biosystems, U.K.). RNA samples for real-time PCR were reverse transcribed into cDNA using TaqMan MultiScribe Reverse Transcriptase kit (PE Biosystems), as per the manufacturers instructions. The thermocycler was programmed as follows: 1 cycle at 25°C for 10 min, 1 cycle at 48°C for 30 min, and 1 cycle at 95°C for 5 min. The probe specifically annealed the template between the PCR primers. A sequence detector (ABI Prism 7700; PE Biosystems) measured amplification of the product. Each sample was run in duplicate in 96-well optical reaction plates (PE Biosystems). A total of 25 µl of the PCR was added per well.
The thermocycler was programmed as follows: 40 cycles of 50°C for 2 min, 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min. All the values obtained were normalized to 18S rRNA, which was included in the Multiplex PCR with its own set of primers and probe, as an internal endogenous control.
The following primers and probe were used for analysis of Ptc expression: forward primer, CGGCAGCCGCGATAAG; reverse primer, TTAATGATGCCATCTGCATCCA; probe, ATCGACATCAGCCAGTT GACTAAACAGCGTC.
The software then analyzed the data and output a pair of ct values for each sample. Ct is the number of cycles needed to result in a signal crossing at set threshold. Each sample yielded two ct values, one for the gene of interest and one for the 18S housekeeping control. The ct values were then analyzed to give a value representing the relative mRNA levels present for the gene of interest linearly.
Statistical analysis
A paired t test using a one-tailed p value was used to test the significance of the increase in expression of CD25 and CD69. For comparing data from [3H]TdR incorporation and cytokine production, a one-way ANOVA was performed with a Tukey-Kramer multiple comparisons post test. Values of p < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
To determine the expression of the Ptc and Shh proteins on
human peripheral CD4+ T cells, cytospin
preparations of purified CD4+ T cells were
analyzed using immunocytochemistry. Cell surface expression of both
Ptc (Fig. 1
A) and Shh
(Fig. 1
B) was observed. Cells stained with normal goat IgG
at the same protein concentration were negative (Fig. 1
C).
The presence of the Shh signaling pathway in CD4+
T cells was confirmed by RT-PCR because specific mRNAs for both
Ptc and Shh were detected in purified
CD4+ve T cells and in a control cell line
(A549) derived from a human lung carcinoma (Fig. 1
D).
|
Shh signaling amplifies CD4+ T cell effector function
To determine whether Shh signaling contributes to
CD4+ T cell effector function induced following
Ag recognition, T cells were stimulated with anti-CD3/CD28 Abs in
the presence of exogenous Shh. We observed that the addition of
exogenous Shh added at the initiation of the T cell cultures led to a
significant enhancement of anti-CD3/CD28 Ab-induced T cell
proliferation (Fig. 2
), in a
dose-dependent manner (p < 0.05 at 0.01 ng/ml
of Shh, and p < 0.001 at 1 ng/ml of Shh), but had no
effect on resting CD4+ T cells (data not shown).
To further investigate the influence of Shh signaling on T cell
function, cytokine production by activated CD4+ T
cells exposed to increasing concentrations of exogenous N-Shh peptide
was determined. We observed that the addition of Shh (>100 ng/ml)
significantly (p < 0.001) enhanced the levels
of IL-2 (Fig. 3
A), IL-10 (Fig. 3
B), and IFN-
(Fig. 3
C). In approximately
one-half (6 of 13) of the individuals tested, we noted that the
addition of exogenous Shh failed to amplify the proliferation of
CD4+ T cells.
|
|
(Fig. 4
|
To further investigate the effects of Shh on
CD4+ T cell activation, the cell surface
expression of CD25 and CD69 was analyzed. N-Shh peptide (1000 ng/ml)
was added to anti-CD3/28 Ab-activated CD4+ T
cells, and cell surface expression of CD25 and CD69 was measured by
FACS analysis at 48 and 72 h after treatment. The FACS profiles
for the expression of CD25 and CD69 for activated T cells in the
presence and absence of Shh (1000 ng/ml) are shown in Fig. 5
, A and B,
respectively. Optimum up-regulation of CD25 was seen at 72 h of
culture, and of CD69 at 48 h of culture. This was further
investigated by titrating the dose of Shh used and observing the
increase in these activation markers at their optimum time of
induction. The increase in expression was dose dependent (Fig. 5
C). In the presence of 5E1 (50 µg/ml), the percentage of
cells expressing CD25 was reduced, as was the geometric mean
fluorescence intensity (Fig. 6
A). Similarly, the percentage
of T cells expressing CD69 was also increased, as was the geometric
mean fluorescence intensity (Fig. 6
B).
|
|
| Discussion |
|---|
|
|
|---|
The recognition of peptide/MHC class II complexes expressed on the cell surface of APCs together with secondary signals, such as ligation of costimulatory receptors, are required for the activation, the expansion, and the induction of effector function of CD4+ T cells (e.g., reviewed in Ref. 26). The results of this study indicate that one action of Shh on the peripheral immune system is to potentiate TCR and costimulatory receptor-mediated signaling and both amplify clonal expansion and enhance the effector function of CD4+ T cells.
We have shown that human peripheral CD4+ T cells express both Shh and Ptc, as determined by immunocytochemistry and RT-PCR. Furthermore, we have noted that both Shh and Ptc are present on human CD8+ T cells (data not shown). Our findings are in agreement with and extend those of Bhardwaj et al. (15), who demonstrated using RT-PCR that mature human CD3+ cells express Shh, Ptc, and smo. In contrast to peripheral T cells, it has been reported that thymocyte populations appear to express only the receptors Ptc and smo (17), which implies that Shh neither mediates interactions between thymocyte populations nor influences the differentiation and expansion of thymocytes through its autocrine activity. Shh signaling induces the expression of Ptc (11) and, therefore, the ability of exogenous Shh to up-regulate ptc expression on human CD4+ T cells activated by anti-CD3/CD28 Ab treatment confirms that this pathway is functional in T cells.
It is well documented that Shh has proliferative effects on a wide range of different cell types, including those of the hemopoietic system (15). In this study, we demonstrate that exogenous Shh enhances TCR-mediated proliferation by CD4+ T cells. The failure of Shh to induce proliferation or increase expression of Ptc on resting CD4+ T cells suggests that it acts a cofactor, which potentiates TCR-mediated signaling and amplifies clonal expansion. The proliferative activity of Shh is, in part, through it effects on cell cycle (e.g., Refs. 13, 14, 27, 28) and, for example, it has been reported that Shh can increase the number of neuronal precursors in S phase (14). In parallel studies on murine CD4+ T cells, we have noted that Shh promotes their entry into the proliferative S/G2 phase of cell cycle (18). Kenney and Rowitch (14) observed that Shh failed to advance quiescent neuronal cells into the cell cycle, which is consistent with our results that Shh has no activity on resting T cells. Furthermore, although it has been reported that Shh can induce bcl-2 (29), we observed that the addition of Shh failed to increase survival in activated T cells (data not shown) and, therefore, it is unlikely that enhancement of T cell proliferation by Shh is brought about through a reduction in apoptosis (30, 31, 32).
For some individuals, we observed that the addition of exogenous Shh
failed to enhance the proliferation response. Mutations in
Ptc and smo, resulting in constitutive activation
of Shh signaling, have been reported (33). Thus,
polymorphisms that bring about loss or modulation of function are also
possible and would provide one explanation for our observations.
Furthermore, there is a large body of evidence, which demonstrates that
proliferation can be dissociated from other T cell effector functions,
such as cytotoxic activity and the production of cytokines (e.g.,
reviewed in Ref. 33). Therefore, we investigated the
ability of Shh to modulate cytokine production by
CD4+ T cells activated by anti-CD3/CD28 Ab
treatment. The addition of exogenous Shh to activated T cells increased
production of the different cytokines measured in this study, namely
IL-2, IL-10, and IFN-
. There was no evidence that Shh had selective
effects on the synthesis of these cytokines. This is in contrast to a
previous report in which increasing the threshold of TCR-mediated
signaling enhanced IFN-
production, but had no effect on IL-10
production or T cell proliferation (34). Furthermore, we
demonstrate that the addition of exogenous Shh to activated
CD4+ T cells results in the up-regulation of cell
surface expression of CD69, implying that the T cells had been further
activated by Shh signaling. The expression of CD25 on activated T cells
was also enhanced by exogenous Shh. These findings taken together with
the observation that Shh enhances the production of IL-2, in part, may
be an additional mechanism by which Shh is able to increase the
proliferation of activated T cells. It also suggests that Shh signaling
does not act by modulating the threshold of TCR signaling
(35). We observed that the addition of the neutralizing
anti-Shh Ab was able to inhibit the production of IL-2 and IFN-
,
but not IL-10, in contrast to exogenous peptide, which enhanced the
synthesis of these cytokines. This suggests that IL-10 production can
be regulated by TCR signaling independently of Shh activation. However,
one effect of Shh on peripheral T cells appears to be its ability to
amplify cytokine production by activated CD4+ T
cells in a nonselective manner.
We demonstrate that the addition of a neutralizing anti-Shh Ab to CD4+ T cells activated by anti-CD3/28 Ab treatment inhibits T cell proliferation, IL-2 production, and the expression of the activation Ags CD25 and CD69. These findings imply that induction of Shh signaling is a physiological component of T cell activation following the ligation of TCR and costimulatory receptors. Furthermore, this result suggests that Shh produced by CD4+ T cells themselves in response to TCR-mediated activation functions in an autocrine manner. In the thymus, Shh is expressed on epithelial cells, and Ptc and Smo on the thymocytes (15), suggesting that Shh signaling can also be delivered by APCs. We have also detected Ptc and smo in macrophages (unpublished data). The expression of receptors for Shh on both T cells and APCs would be consistent with the concept that the effector function of both these cell populations can be modulated by Shh signaling. However, the effects of Shh on APC function remain to be determined.
In summary, we show that the Shh signaling is functional in peripheral CD4+ T cells. Both Shh and its receptor Ptc are expressed on T cells, and they are up-regulated when the T cells are activated by TCR and costimulatory receptor ligation. The functional consequences of this are that T cell proliferation is enhanced and cell surface expression of the activation Ags CD25 and CD69 is increased, as is cytokine production. Furthermore, the ability of a neutralizing Ab to directly inhibit the biological activity of activated T cells suggests that Shh signaling is a physiological component of CD4+ T cell responses.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to: Dr. Sarah E. M. Howie, Department of Pathology, Edinburgh University Medical School, Teviot Place, Edinburgh EH8 9AG, U.K. E-mail address: s.e.m.howie{at}ed.ac.uk ![]()
3 Abbreviations used in this paper: Shh, Sonic hedgehog; Ptc, Patched; Smo, Smoothened; Tm, melting temperature. ![]()
Received for publication July 12, 2002. Accepted for publication September 11, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. N Hines and R. A Rippe Role of hedgehog signalling in bile ductular cells Gut, September 1, 2008; 57(9): 1198 - 1199. [Full Text] [PDF] |
||||
![]() |
A. Varas, C. Hernandez-Lopez, J. Valencia, S. Mattavelli, V. G. Martinez, L. Hidalgo, C. Gutierrez-Frias, A. G. Zapata, R. Sacedon, and A. Vicente Survival and function of human thymic dendritic cells are dependent on autocrine Hedgehog signaling J. Leukoc. Biol., June 1, 2008; 83(6): 1476 - 1483. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kobune, J. Kato, Y. Kawano, K. Sasaki, H. Uchida, K. Takada, S. Takahashi, R. Takimoto, and Y. Niitsu Adenoviral Vector-Mediated Transfer of the Indian Hedgehog Gene Modulates Lymphomyelopoiesis In Vivo Stem Cells, February 1, 2008; 26(2): 534 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ji, F. C. Mei, B. H. Johnson, E. B. Thompson, and X. Cheng Protein Kinase A, not Epac, Suppresses Hedgehog Activity and Regulates Glucocorticoid Sensitivity in Acute Lymphoblastic Leukemia Cells J. Biol. Chem., December 28, 2007; 282(52): 37370 - 37377. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Rowbotham, A. L. Hager-Theodorides, M. Cebecauer, D. K. Shah, E. Drakopoulou, J. Dyson, S. V. Outram, and T. Crompton Activation of the Hedgehog signaling pathway in T-lineage cells inhibits TCR repertoire selection in the thymus and peripheral T-cell activation Blood, May 1, 2007; 109(9): 3757 - 3766. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. F. Chan, S.-y. Chau, L. Tian, Y. Chen, S. K. Y. Kwong, J. Quackenbush, M. Dallman, J. Lamb, and P. K. H. Tam Sonic hedgehog promotes CD4+ T lymphocyte proliferation and modulates the expression of a subset of CD28-targeted genes Int. Immunol., December 1, 2006; 18(12): 1627 - 1636. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Martinez, F. Larbret, F. Zobairi, J. Coulombe, N. Debili, W. Vainchenker, M. Ruat, and J.-M. Freyssinet Transfer of differentiation signal by membrane microvesicles harboring hedgehog morphogens Blood, November 1, 2006; 108(9): 3012 - 3020. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Bijlsma, M. P. Peppelenbosch, and C. A. Spek Hedgehog Morphogen in Cardiovascular Disease Circulation, October 31, 2006; 114(18): 1985 - 1991. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Willinger, T. Freeman, M. Herbert, H. Hasegawa, A. J. McMichael, and M. F. C. Callan Human Naive CD8 T Cells Down-Regulate Expression of the WNT Pathway Transcription Factors Lymphoid Enhancer Binding Factor 1 and Transcription Factor 7 (T Cell Factor-1) following Antigen Encounter In Vitro and In Vivo J. Immunol., February 1, 2006; 176(3): 1439 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sacedon, B. Diez, V. Nunez, C. Hernandez-Lopez, C. Gutierrez-Frias, T. Cejalvo, S. V. Outram, T. Crompton, A. G. Zapata, A. Vicente, et al. Sonic Hedgehog Is Produced by Follicular Dendritic Cells and Protects Germinal Center B Cells from Apoptosis J. Immunol., February 1, 2005; 174(3): 1456 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sacedon, A. Varas, C. Hernandez-Lopez, C. Gutierrez-deFrias, T. Crompton, A. G. Zapata, and A. Vicente Expression of Hedgehog Proteins in the Human Thymus J. Histochem. Cytochem., November 1, 2003; 51(11): 1557 - 1566. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |