The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freeburn, R. W.
Right arrow Articles by Ward, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freeburn, R. W.
Right arrow Articles by Ward, S. G.
The Journal of Immunology, 2002, 169: 5441-5450.
Copyright © 2002 by The American Association of Immunologists

Evidence That SHIP-1 Contributes to Phosphatidylinositol 3,4,5-Trisphosphate Metabolism in T Lymphocytes and Can Regulate Novel Phosphoinositide 3-Kinase Effectors1

Robin W. Freeburn*, Karen L. Wright*, Steven J. Burgess*, Emmanuelle Astoul{dagger}, Doreen A. Cantrell{dagger} and Stephen G. Ward2,*

* Department of Pharmacy and Pharmacology, Bath University, Bath, United Kingdom; and {dagger} Lymphocyte Activation Laboratory, Cancer Research U.K., London, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The leukemic T cell line Jurkat is deficient in protein expression of the lipid phosphatases Src homology 2 domain containing inositol polyphosphate phosphatase (SHIP) and phosphatase and tensin homolog deleted on chromosome ten (PTEN). We examined whether the lack of expression of SHIP-1 and PTEN is shared by other leukemic T cell lines and PBLs. Analysis of a range of cell lines and PBLs revealed that unlike Jurkat cells, two other well-characterized T cell lines, namely CEM and MOLT-4 cells, expressed the 5'-phosphatase SHIP at the protein level. However, the 3-phosphatase PTEN was not expressed by CEM or MOLT-4 cells or Jurkat cells. The HUT78 cell line and PBLs expressed both SHIP and PTEN. Jurkat cells exhibited high basal levels of phosphatidylinositol 3,4,5-trisphosphate (PI(3,4,5)P3; the lipid substrate for both SHIP and PTEN) as well as saturated protein kinase B (PKB) phosphorylation. Lower levels of PI(3,4,5)P3 and higher levels of phosphatidylinositol 3,4-bisphosphate (PI(3,4)P2) as well as unsaturated constitutive phosphorylation of PKB were observed in CEM and MOLT-4 cells compared with Jurkat cells. In PBLs and HUT78 cells which express both PTEN and SHIP-1, there was no constitutive PI(3,4,5)P3 or PKB phosphorylation, and receptor stimuli were able to elicit robust phosphorylation of PKB. Expression of a constitutively active SHIP-1 protein in Jurkat cells was sufficient to reduce both constitutive PKB membrane localization and PKB phosphorylation. Together, these data indicate important differences between T leukemic cells as well as PBLs, regarding expression of key lipid phosphatases. This study provides the first evidence that SHIP-1 can influence the constitutive levels of PI(3,4,5)P3 and the activity of downstream phosphoinositide 3-kinase effectors in T lymphocytes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of phosphoinositide 3-kinases (PI3Ks)3 in T cells is triggered by Ag receptors, costimulatory molecules such as CD28, cytokines, and chemokines (1, 2). PI3Ks phosphorylate phosphoinositide (PI) lipids at the 3'OH position of the inositol ring (2). The main 3'-phosphorylated PI species found in mammalian cells are phosphatidylinositol 3-phosphate, phosphatidylinositol 3,4-bisphosphate (PI(3, 4)P2), and phosphatidylinositol 3,4,5-trisphosphate (PI(3, 4, 5)P3). The basal levels of PI(3, 4)P2 and PI(3, 4, 5)P3 in cells are usually in low abundance, but can rise sharply after cell stimulation (2). PI(3, 4, 5)P3 and PI(3, 4)P2 interact with an array of protein effectors via pleckstrin homology (PH) domains (2, 3, 4).

The PH domain containing effectors such as PDK-1, protein kinase B (PKB), Btk, guanine nucleotide exchange factors, and GTPase-activating proteins are involved in an array of functional outcomes (2, 3, 4) and can exhibit high selectivity for distinct 3'-phosphorylated PI lipids. Thus, PH domains of Btk, Grp-1, centaurin-1, DOS, Gab-1, and PDK-1 recognize PI(3, 4, 5)P3 with high affinity and specificity (5, 6). However, PKB and dual adaptor for phosphotyrosine and 3-PI PH domains bind almost equally well to both PI(3, 4)P2 and PI(3, 4, 5)P3 (5, 6). There is now evidence emerging that certain PH domains will only interact with PI(3, 4)P2. Hence, PH domains of tandem PH domain-containing protein (TAPP)-1 and TAPP-2 will interact specifically with PI(3, 4)P2 (7). Given the plethora of receptors coupled to PI3K isoforms and the wealth of functional outcomes that appear to be determined by PI3K lipids (1, 2), it is essential that cells maintain tight control of PI lipid accumulation. This is achieved by a delicate balance of kinase and phosphatase activity that form and degrade the three main signal transducing PI lipids. Most attention has focused on two inositol phosphatases implicated in the degradation of PI(3, 4, 5)P3, namely the 5' phosphatase Src homology 2 domain containing inositol polyphosphate phosphatase (SHIP) and the 3' phosphatase and tensin homolog deleted on chromosome ten (PTEN) (8, 9, 10).

SHIP-1 is a 145-kDa protein that becomes tyrosine phosphorylated after stimulation of cells of hemopoietic lineage, by a variety of cytokines as well as T and B cell Ag receptors, and the T cell costimulatory receptor CD28 (11, 12, 13). In addition to its catalytic inositol 5-phosphatase domain, SHIP-1 possesses several recognized motifs that can sustain protein-protein interactions with Grb-2 (8, 11, 14) and Shc (8, 15). SHIP-1 inhibits immune receptor activation in both mast cells and B cells by binding to the tyrosine-phosphorylated immunoreceptor tyrosine-based inhibitory motif of the inhibitory coreceptor Fc{gamma}RIIB (16, 17). SHIP plays an important role as a negative regulator of cell activation in B lymphoid cells (18, 19, 20), myeloid cells (18, 19, 20), and mast cells (21). Although SHIP-deficient mice exhibit hyperresponsive B cells and elevated circulating Abs as well as symptoms of autoimmune disease (18, 19, 20), the loss of SHIP results in a much less severe T cell phenotype, with SHIP-/-Rag-/- mice reported as having normal TCR/CD28-driven T cell proliferation and IL-2 production (18). Indeed, several lines of evidence have suggested that the 3-phosphatase PTEN, rather than SHIP, is the key negative regulator of 3'-phosphorylated lipids in T cells (22, 23, 24). In addition, recent evidence has indicated that the PI3K effector PKB is constitutively phosphorylated and activated in the leukemic T cell line Jurkat. However, since this particular cell line is deficient in both PTEN and SHIP-1 expression at the protein level (25, 26), it is not clear whether lack of either or both lipid phosphatases contributes to the dysregulated 3'-phosphorylated PI lipids in these cells.

Given that SHIP-1 is tyrosine phosphorylated in response to TCR and CD28 ligation (13), it seems likely that it has some role to play in the regulation of signaling via these receptors. Therefore, we have examined whether the lack of SHIP and PTEN expression is peculiar to Jurkat cells or if it is shared by other leukemic T cell lines and PBLs. In addition, we have designed a membrane-localized constitutively active SHIP mutant which we have expressed in the Jurkat cell line using a tetracycline (Tet)-regulated expression system. We have used this system to verify that SHIP can contribute to degradation of PI(3, 4, 5)P3 in T cells, and thus, influence signaling away from PI(3, 4, 5)P3-dependent effectors toward effectors that are exclusively driven by PI(3, 4)P2.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abs and reagents

CD28 mAb 9.3 was kindly provided by C. June (University of Pennsylvannia, Philadelphia, PA); anti-PTEN (A2B1, sc-7974, 1:2000), anti-SHIP (P1C1, sc-8425, 1:2000), anti-Src homology 2 domain containing protein tyrosine phosphatase (SHP-2) (C-18, sc-280, 1:2000), anti-glycogen synthase kinase 3 (R-20, sc-1846, 1:1000), and anti-PKB (D-17, sc-7126, 1:1000) Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phospho-PKB (no. 9271, 1:1000) and anti-phospho-glycogen synthase kinase 3 (no. 9331, 1:1000) Abs were from Cell Signaling Technologies (Calne, U.K.). The rat CD2 mAb (OX34) was purified from hybridoma supernatants by standard protocols. Secondary Abs conjugated to HRP were from DAKO (Cambridge, U.K). The green fluorescent protein (GFP)-tagged PH domain of PKB and its nonlipid binding R25C mutated form were gifts from Dr. J. Downward (Cancer Research U.K., London, U.K.). The GFP-tagged C-terminal PH domain of TAPP-1 and its nonlipid binding R212L mutated form were gifts from Dr. D. Alessi (MRC Protein Phosphorylation Unit, Dundee, U.K.). LY294002 was purchased from Affiniti Biomol (Exeter, U.K.).

Cell lines and cell culture

The human leukemic T cell lines Jurkat, CEM, MOLT-4, and HUT78 as well as the murine B cell lymphoma cell line A20 were cultured in humidified incubators at 37°C, 5% (v/v) CO2 in RPMI 1640 medium supplemented with 10% (v/v) FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen, Paisley, Scotland). Human PBLs were prepared from heparinized blood samples as described previously (27).

RNA extraction and RT-PCR

Cellular RNA was extracted using RNAzol B (AMS Biotechnology, Oxon, U.K.). This method is based on the acid guanidium-phenol-chloroform method from Chomczynski et al. (28). Reverse transcription was performed using an oligo (dT) primer and Moloney murine leukemia virus reverse transcriptase on 1 µg of cellular RNA (Advanced Biotechnologies, Surrey, U.K.) in a 20-µl reaction. Using 2 µl of cDNA as template, PCR was performed using PTEN (forward: 5'-3'GTACTTTGAGTTCCCTCAGC, reverse: 5'-3'GGAGAAAAGTATCGGTTGGC), SHIP (forward: 5'-3'TGAACATTCTCCGGTTCCTG, reverse: 5'-3'TAAGACTGACACACCACGTG), and {beta}-actin (forward: 5'-3'CATCACCATTGGCAATGAGC, reverse: 5'-3'ATACTCCTGCTTGCTGATCC) specific primers with 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 40 s. Products were electrophoresed through a 1.5% agarose gel and visualized using ethidium bromide staining.

Cell lysis and immunoblotting

Cells (1 x 107 cells/ml) were equilibrated for 60 min at 37°C in serum-free RPMI 1640 and then stimulated in RPMI 1640 medium as described in the figure legends. Reactions were terminated by addition of ice-cold lysis buffer (1% (v/v) Nonidet P-40, 100 mM NaCl, 20 mM Tris (pH 7.4), 10 mM iodoacetamide, 10 mM NaF, 1 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 10 µg/ml {beta}-glycerophosphate, and 1 mM sodium orthovanadate). Immunoprecipitation and immunoblotting were performed as described in detail elsewhere (13).

Phosphatidylinositol lipid analysis and inositol phosphate 5-phosphatase assays

Leukemic T cells or PBLs (1 x 108) were labeled with 1 mCi [32P]-orthophosphate (8500–9120 Ci/mmol; DuPont Pharmaceuticals, Wilmington, DE) as described (29). 32P-labeled cells were aliquoted at 107/120 µl, stimulated as described in the figure legends, and the phospholipids extracted with 700 µl chloroform:methanol:H2O (32.6%:65.3%:2.1% v/v/v, respectively). The samples were deacylated and analyzed by anion exchange HPLC analysis as described elsewhere (29). Where appropriate, CD2:SHIP immunoprecipitates derived from resting and CD28-stimulated Jurkat cells were washed and assayed for 5-phosphatase activity by determining the in vitro hydrolysis of [3H]-Ins(1, 3, 4, 5)P4 to [3H]Ins(1, 3, 4)P3 as described elsewhere (11, 13).

Cellular localization

Transfection of T cell lines with GFP-tagged PH domain plasmids was conducted using DMRIE-C according to the manufacturer’s instructions (Invitrogen). After 6-h transfections, cells were attached to poly-L-lysine-coated cover slips before fixation in 4% paraformaldehyde/glutaraldehyde for 10 min and mounting in a Mowiol-based media (Calbiochem, Nottingham, U.K.). After drying overnight at 4°C, slides were examined on an Olympus inverted stage confocal microscope (Olympus Optical, Hamburg, Germany) using Fluoview software.

Construction and characterization of chimeric SHIP proteins

A membrane-localized chimeric protein was created by fusing the extracellular and transmembrane domain of rat CD2 molecule with the catalytic core of human SHIP-1. The coding regions of the catalytic core of human SHIP-1 (aa 364–826) were attached to a truncated rat CD2 molecule consisting of the extracellular and transmembrane domain (aa 1–212) (European Molecular Biology Laboratory accession no. X05111). The rCD2 intracellular domain was truncated by a restriction digest using NotI. The human SHIP catalytic core was adapted by PCR to introduce a NotI site at its 5' end and then ligated to the truncated rCD2 via the mutual NotI sites. The CD2:SHIP chimeras were assembled by subcloning the cDNAs into the pEFBos vector, and the construct was verified by nucleotide sequencing and/or restriction enzyme analysis. The CD2:SHIP construct was blunt-end ligated into the pUHD10-3-hygromycin regulatory plasmid containing a Tet-off responsive element. A point-mutated version of the CD2:SHIP protein in which the cysteine residue at position 701 within the catalytic signature motif was mutated to alanine was also constructed by standard PCR procedures (CD2:C701ASHIP).

Screening for Tet-regulated expression

Jurkat cells (2 x 107) expressing the Tet-controlled transactivator (Clontech Laboratories, Palo Alto, CA,) were transfected with 10 µg of linearized plasmid by electroporation and cells were transferred to growth media containing 2 µg/ml Tet and cultured for 48 h in the absence of selection agents. Following this recovery period, the transfected cells were washed, resuspended in media containing Tet (2 µg/ml), G418 sulfate (500 µg/ml), and hygromycin B (300 µg/ml) and aliquoted into 96-well plates at 1 x 104 cells/well. From ~2 wk posttransfection, selected colonies were picked, transferred to selective media, and further expanded. To test for inducible expression of the CD2:SHIP constructs, clones were washed and incubated for 24 h in media in the presence and absence of Tet, and cell lysates immunoblotted with the anti-rat CD2 mAb OX34.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of PI lipid phosphatases in T cell leukemic lines and PBLs

Previous work has shown that the Jurkat leukemic T cell line is deficient in both SHIP and PTEN at the protein level (25, 26). However, it is not clear whether the lack of SHIP and PTEN protein expression is a feature peculiar to the Jurkat line, or whether it is a feature shared by all T leukemic cell lines. Using RT-PCR analysis, we have shown that both SHIP and PTEN mRNA are constitutively expressed in PBLs and the Jurkat, CEM, MOLT-4, and HUT78 cell lines (Fig. 1GoA). Equivalent levels of mRNA were used in each sample as verified by parallel amplification of the housekeeping gene {beta}-actin. Reverse transcriptase reactions performed in the absence of reverse transcriptase enzyme verfied that there was no contamination of the RNA samples with DNA. Immunoblotting of cell lysates with anti-SHIP and anti-PTEN mAbs (Fig. 1GoB) confirmed that Jurkat cells contained no detectable protein for either SHIP or PTEN. Interestingly, MOLT-4 and CEM cells contained protein for SHIP, but contained no detectable levels of PTEN. In contrast, PBLs and HUT-78 cells were positive for the expression of both SHIP and PTEN at the protein level.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 1. Expression and tyrosine phosphorylation of SHIP and PTEN in leukemic T cell lines and PBLs. A, mRNA from 5 x 106 cells was extracted and cDNA was prepared via reverse transcription reactions (RT+). Reverse transcription reactions lacking enzyme (RT-) were also performed to check for genomic DNA contamination. Primers specific to the inositol phosphatases SHIP (top panel) and PTEN (middle panel) plus the housekeeping gene {beta}-actin (bottom panel) were used in PCR to amplify the cDNA. Samples were visualized on agarose gels with ethidium bromide staining. B, Lysates (40 µg of protein) from the cells indicated were immunoblotted with anti-SHIP (top panel) or anti-PTEN (middle panel) Abs as described in Materials and Methods. PTEN blot was stripped and reprobed with anti-SHP2 Abs (bottom panel) to show similar loading in all lanes. C, CEM and MOLT-4 cells were left unstimulated (unstim.) or stimulated with 10 µg/ml anti-CD28 mAb 9.3 or 10 µg/ml anti-CD3 mAb UCHT1 for the times indicated (minutes). Cells (107 per stimulation) were lysed and immunoprecipitated with anti-SHIP-1 Ab. Samples were blotted and probed with anti-phosphotyrosine Ab (4G10; upper panels) before membranes were stripped and reprobed with anti-SHIP-1 Ab (lower panels). Data are from individual experiments, representative of three others.

 
SHIP is tyrosine phosphorylated in response to CD28 and CD3 ligation in CEM and MOLT-4 cells

Previous evidence has shown that SHIP is a downstream target following ligation of either CD3 or CD28 in murine hybridoma T cells (13). Having confirmed protein expression of SHIP in MOLT-4 and CEM cells, we investigated whether it was also a target for receptor-activated PTKs in these cells. Accordingly, stimulation of CEM and MOLT-4 cells with anti-CD28 mAb 9.3 or anti-CD3 mAb UCHT1 resulted in a large increase in SHIP tyrosine phosphorylation compared with unstimulated controls (Fig. 1GoC). These data suggest that the SHIP expressed in CEM and MOLT-4 is a target for receptor-activated protein tyrosine kinases.

Comparison of basal and receptor-stimulated levels of 3'phosphorylated PI lipids in leukemic T cells and PBLs

In view of the differing expression of lipid phosphatases, we hypothesized that accumulation of basal and stimulated levels of D-3 PI lipids may vary between cell types. Indeed, the leukemic T cell lines exhibited interesting differences in their relative PI(3, 4, 5)P3:PI(3, 4)P2 ratios under basal conditions (Table IGo, column 3). Thus, Jurkat cells (PTEN-/SHIP-) consistently exhibited a high basal level of PI(3, 4, 5)P3 relative to PI(3, 4)P2, compared with both CEM (PTEN-/SHIP+) and MOLT-4 cells (PTEN-/SHIP+). In contrast, a much lower PI(3, 4, 5)P3:PI(3, 4)P2 ratio was observed in both CEM and MOLT-4 cells compared with Jurkat cells, suggesting that SHIP-1 expressed in these cells may be able to at least partially influence the PI(3, 4, 5)P3 accumulation in the absence of PTEN expression. This notion was further enhanced by the observation that very low basal levels of PI(3, 4, 5)P3 were present in HUT78 cells (PTEN+/SHIP-1+), while levels of PI(3, 4)P2 were negligible.


View this table:
[in this window]
[in a new window]
 
Table I. Phosphatidylinositol levels in T cell linesa

 
We next investigated whether the differential expression of lipid phosphastases had any impact on receptor-stimulated levels of PI lipids. Stimulation of Jurkat cells with the anti-CD28 mAb 9.3 resulted in a rapid accumulation of PI(3, 4, 5)P3 sustained until 10 min when PI(3, 4, 5)P3 levels had risen ~15 times above basal levels (Table IGo, column 8). A small increase in PI(3, 4)P2 levels was also observed. Ligation of CD28 resulted in marked elevation of both PI(3, 4, 5)P3 and PI(3, 4)P2 in CEM cells and MOLT-4 cells. Both cell lines exhibited a similar PI(3, 4, 5)P3:PI(3, 4)P2 ratio that was some 20-fold less than that observed for Jurkat cells. This lower ratio indicates that the relative levels of PI(3, 4)P2 are much greater in CEM and MOLT-4 compared with Jurkat cells. Ligation of CD28 induced marked accumulation of PI(3, 4, 5)P3 in HUT78 cells (Table IGo, columns 4 and 5). Surprisingly, we could detect little or no PI(3, 4)P2 in this cell line which may reflect the efficient removal of this lipid by the combined phosphatase action of PTEN and SHIP-1.

Differential expression of lipid phosphatases correlates with PKB phosphorylation levels

The interaction of the PH domain of PKB with PI(3, 4, 5)P3 and PI(3, 4)P2 plays an important role in the phosphorylation of PKB at Thr308 and Ser473, resulting in its subsequent activation (2). Given the differences seen in regulation of PI(3, 4, 5)P3 and PI(3, 4)P2 between the cell lines, we sought to correlate lipid phosphatase expression with PKB phosphorylation in these cell lines. Immunoblotting using Abs specific to PKB phosphorylated at Ser473 (pPKBser473) was performed. This revealed that Jurkat cells have very high levels of basal pPKBser473 (Fig. 2GoA), reflecting the high basal levels of PI(3, 4, 5)P3 measured in vivo and confirming previous observations from ourselves and others (25, 26). Stimulation of Jurkat cells via CD28 or CD3 did not show an increase in pPKBser473 levels, probably indicating that PI3K/PKB signaling is at or near to saturation levels (Fig. 2GoB, lanes 8 and 9). However, in marked contrast, both CEM and MOLT-4 cells exhibited comparatively lower constitutive levels of pPKBser473 (Fig. 2GoA). PKB phosphorylation could be further enhanced by ligation of either CD28 or CD3 in both MOLT-4 and CEM cells (Fig. 2GoB, lanes 8 and 9), suggesting that basal pPKBser473 is not saturated in these cells. Remarkably, no constitutive pPKBser473 levels could be detected in HUT78 cells or PBLs (Fig. 2GoA). However, ligation of CD28 elicited a marked phosphorylation of PKB in both cell types (Fig. 2GoB, lane 9). CD3 was also able to elicit a strong phosphorylation of PKB in PBLs, but in HUT78 cells the lack of effect of CD3 ligation on PKB phosphorylation (Fig. 2GoB, lane 8) correlated with our inability to detect CD3 expression in HUT78 cells by flow cytometry (data not shown).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 2. Comparison of basal and stimulated levels of phospho-PKB in T cell lines and PBLs. A, Lysates (40 µg of protein) from unstimulated Jurkat, CEM, MOLT-4, HUT78 cells, and PBLs. B, Jurkat, CEM, MOLT-4, HUT78 cells, and PBLs were either left unstimulated (unstim.) or treated with LY294002 (10 µM) for times indicated (minutes) or stimulated with 10 µg/ml CD28 or CD3 specific mAbs for 5 min. A and B, Cell lysates were immunoblotted with Ser473-specific phospho-PKB Ab (PKBser473; upper panels). Membranes were stripped and equal loading verified by reprobing with pan-PKB Ab (PKB; lower panels).

 
Inhibition of PI3K terminates PKB phosphorylation at different rates

The ability of active PI3K to sustain PKB membrane localization and phosphorylation is dependent on its catalytic activity and the generation of PI(3, 4, 5)P3 and/or PI(3, 4)P2 (2). Therefore, PKB phosphorylation is an indicator of the membrane levels of these lipids. PI3K inhibitors are slow to terminate PKB activation in Jurkat cells (Fig. 2GoB), reflecting that constitutive levels of PI(3, 4, 5)P3 formed before addition of the inhibitor are maintained at levels sufficient to promote phosphorylation of PKB (25, 26). In contrast, the rate at which pPKBser473 phosphorylation is terminated in the presence of LY294002 in MOLT4 and CEM cells was much more rapid than observed in Jurkat cells (Fig. 2GoB, lanes 1–7). This data suggests that both MOLT4 and CEM cells possess more efficient mechanisms for the removal of PI(3, 4, 5)P3.

Expression of membrane-localized SHIP-1 in Jurkats

To verify that SHIP-1 expression could indeed influence constitutive levels of 3'-phosphorylated PI lipids, we constructed a chimeric protein which contains the phosphatase core of SHIP-1 fused to the extracellular/transmembrane region of rat CD2 (CD2:SHIP). The resulting membrane-localized SHIP catalytic domain was predicted to be a constitutively active 5'-inositol phosphatase. The phosphatase activity of the expressed CD2:SHIP protein was confirmed using an in vitro assay of OX34 immunoprecipitates of cell lysates derived from Jurkat cells transiently transfected with the CD2:SHIP construct (Fig. 3GoA). The assays revealed robust catalytic activity in these immunoprecipitates that was comparable to the activity present in SHIP immunoprecipitates derived from a murine lymphoma B cell line A20. As a negative control, Jurkat cells were also transiently transfected with CD2:C701ASHIP which was predicted to be a catalytic inactive mutant based on previous observations (30, 31). Our data suggest that this mutant retains some activity, at least in vitro, although it is at least 10-fold less active than the CD2:SHIP protein.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Tet-regulated expression of membrane-localized SHIP. A, Measurement of catalytic activity in SHIP-1 immunoprecipitates derived from A20 cells or rCD2 immunoprecipitates derived from Jurkat cells transiently transfected with CD2:SHIP or CD2:C701ASHIP using [3H]-Ins(1,3,4,5)P4 as a substrate. B, Six individual Jurkat clones transfected with the CD2:SHIP chimera plasmid or the point-mutated CD2:C701ASHIP were cultured overnight at 1 x 105 cells/ml either with (+) or without (-) Tet (2 µg/ml). Whole-cell lysates (40 µg of protein) were Western blotted with anti-rCD2 mAb OX34 (upper panels) and then reprobed with anti-SHP2 mAb (lower panels).

 
To minimize any potential detrimental effects of the chimeric protein in further experimentation, we used the Tet-Off expression system (Clontech Laboratories) to establish Jurkat cells with regulatable expression of CD2:SHIP. Over 50 clones from several independent transfections were screened to identify three independent clones with equivalent expression levels and good Tet-regulated expression. Fig. 3GoB shows Tet-regulated expression in independent Jurkat clones for both CD2:SHIP (clones 1–3) and CD2:C701ASHIP (clones 4–6). Whole-cell lysates were Western blotted to show regulated protein expression of CD2:SHIP (Fig. 3GoB, upper panel) following overnight culture of the cells with and without Tet. Blots were stripped and reprobed with anti-SHP-2 Ab to show similar protein amounts in all lanes (Fig. 3GoB, lower panel). Subsequent experiments were performed using clones 1–6, with representative data from one clone shown in each case.

The effect of Tet-regulated expression of the CD2:SHIP construct on the in vivo levels of 3'-phosphorylated PI lipids was investigated under resting and stimulated conditions. Hence, control empty vector clones, CD2:SHIP clone 2, and the CD2:C701ASHIP clone 4 Jurkats were cultured overnight in the absence of Tet accompanied by the metabolic labeling of intact cellular pools of ATP with 32P. It should be noted that the PI(3, 4, 5)P3:PI(3, 4)P2 ratio under basal and stimulated conditions, when using the Tet-Off Jurkat cells, was markedly different to that observed for the Jurkat cells used in Table IGo. The reasons for these differences are not clear but may reflect clonal variations in the Jurkat cell line. Evidently, Tet-Off Jurkats are less efficient at labeling of their PI lipids, which may be a consequence of the gene expression systems used in these cells. Nevertheless, CD28 stimulated a large increase in PI(3, 4, 5)P3 compared with basal levels in all clones following CD28 stimulation (Table IIGo, columns 1 and 4). A sharp increase in PI(3, 4)P2 levels following CD28 stimulation is only seen in the CD2:SHIP clone as PI(3, 4)P2 levels remain constant in the empty vector clone. These data confirm that CD2:SHIP is acting as a constitutively active 5' inositol phosphatase. CD28 also stimulates a modest increase in PI(3, 4)P2 levels in CD2:C701ASHIP-expressing cells, albeit to a much lesser extent than observed in the CD2:SHIP-expressing cells. This confirms our previous observation from in vitro assays, that the CD2:C701ASHIP is not completely phosphatase inactive.


View this table:
[in this window]
[in a new window]
 
Table II. Phosphatidylinositol levels in transfected Jurkat clonesa

 
Effect of expression of membrane-localized SHIP in Jurkats on PKB phosphorylation

The effect of CD2:SHIP expression on CD28-stimulated PKB phosphorylation was examined. Fig. 4GoA shows Tet-controlled expression of CD2:SHIP clone 2 (Fig. 4GoA, top panel). In the presence of Tet, no CD2:SHIP protein is expressed and high constitutive levels of pPKBser473 are seen (Fig. 4GoA, middle panel), similar to those observed earlier in untransfected Jurkat cells. Stimulation of the cells via CD28 has little effect on pPKBser473 in the absence of CD2:SHIP expression (Fig. 4GoA, middle panel). However, removal of Tet leads to CD2:SHIP expression (Fig. 4GoA, top panel), and a major reduction in basal levels of pPKBser473 (Fig. 4GoA, middle panel). Under these conditions of CD2:SHIP expression and low basal pPKBser473, CD28 ligation stimulates a robust increase in PKB phosphorylation that is detectable after 5 min. CD28-stimulated PKBser473 phosphorylation is maintained for up to 45 min and is comparable with the saturated levels of PKB phosphorylation observed in the absence of CD2:SHIP expression. Expression of the impaired phosphatase CD2:C701ASHIP clone 4 (Fig. 4GoB, top panel) had no effect on basal PKB phosphorylation and it was not possible to detect increases in PKB phosphorylation after CD28 ligation in CD2:C701ASHIP-expressing cells (Fig. 4GoB, middle panel).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 4. CD2:SHIP chimera inhibition of CD28-mediated PKB phosphorylation. Jurkat cells stably transfected with CD2:SHIP (clone 2) (A) or CD2:C701ASHIP (clone 4) (B) were cultured overnight either with (+, lanes 1, 3, 5, 7, 9, 11, and 13) or without (-, lanes 2, 4, 6, 8, 10, 12, and 14) Tet (2 µg/ml). Cells were washed and serum starved for 1 h before 10 µg/ml anti-CD28 mAb 9.3 stimulation for the times indicated. Whole-cell lysates (40 µg of protein) were Western blotted using anti-rCD2 (rCD2; top panel) or anti-phospho-PKB (pPKBser473; middle panel) Abs. Phospho-PKB blot was reprobed with PKB-specific Ab (PKB; bottom panel). Results are from a single experiment representative of at least two others from Jurkat clones 2 and 4. The data are also representative of results obtained in 2 other CD2:SHIP and CD2:C701ASHIP Jurkat cell clones.

 
Cellular localization of PKB PH domain in T cell lines

It is well accepted that PH domain-mediated membrane localization of PKB is a crucial step in its phosphorylation and activation. Having established that basal PKB phosphorylation and activation correlated closely with the expression of SHIP-1 and/or PTEN, we next investigated whether the expression of CD2:SHIP correlated with changes in localization of PKB. The PH domain of PKB was expressed with a GFP tag and transfected into the T cell lines (Fig. 5GoA). Under basal conditions, a distinct membrane localization of PKB is seen in Jurkat and CEM cells although some cytosolic PKB is also evident in the CEM cells. Equal membrane and cytosolic cellular distribution of PKB is observed in HUT78 (SHIP-1+/PTEN+) cells. A GFP-PKB mutant PH domain, which is unable to bind PI(3, 4, 5)P3 or PI(3, 4)P2 due to a single amino acid substitution (R25C), showed uniform cellular distribution in all cell lines, confirming the membrane localization seen in Jurkat and CEM cells is due to a specific binding of the PH domain with 3'-phosphorylated PI lipids and is not due to nonspecific GFP localization.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 5. Cellular distribution of PKB-PH domain in T cell lines. A, Jurkat, CEM, and HUT78 cells were transfected with GFP-tagged PH domain of PKB or PKB-PH domain mutant (R25C) and analyzed by confocal microscopy as described in Materials and Methods. Results are from a single experiment representative of at least two others. B and C, Jurkat cells stably transfected with CD2:SHIP or CD2:C701ASHIP (as indicated) were cultured overnight either with 2 µg/ml Tet (+Tet) or without Tet (no Tet) before transfections with GFP-tagged PH domain of PKB or PKB-PH domain mutant (R25C) as indicated. C, Jurkat cells were either left unstimulated or stimulated with 10 µg/ml anti-CD28 mAb 9.3 for the times indicated. Results are from a single experiment representative of at least two others from Jurkat clones 2 and 4. The data are also representative of results obtained in two other CD2:SHIP and CD2:C701ASHIP Jurkat cell clones.

 
Cellular localization of GFP-PKB-PH domain in Jurkat cells with Tet-regulated expression of CD2:SHIP and CD2:C701ASHIP was also studied. In the presence of Tet, a distinct membrane localization of GFP-PKB-PH was evident in both the CD2:SHIP clone and CD2:C701ASHIP clone (Fig. 5GoB) similar to that seen in untransfected Jurkats (Fig. 5GoA). However, expression of CD2:SHIP was sufficient to substantially reduce membrane association of GFP-PKB-PH and increase cytosolic localization, while expression of the phosphatase inactive CD2:C701ASHIP had no effect on PKB-PH domain cellular localization. No differences in cellular localization were seen with the PKB-PH domain mutant in either clone.

The effect of CD28 stimulation on PKB cellular localization was also examined (Fig. 5GoC). In the presence of Tet, the distinct membrane localization of GFP-PKB-PH seen under basal conditions is maintained after CD28 stimulation for at least 15 min in both the CD2:SHIP clone (Fig. 5GoC, top panels) and CD2:C701ASHIP clone (data not shown). Expression of CD2:SHIP again led to decreased membrane association of GFP-PKB-PH under basal conditions and was sustained after 2 min of CD28 stimulation. After 5-min of CD28 stimulation, increased membrane localization of GFP-PKB-PH was seen with a distinct membrane localization of GFP-PKB-PH visible in the CD2:SHIP clone after 15 min of CD28 stimulation. Expression of CD2:C701ASHIP had no effect on GFP-PKB-PH cellular localization (data not shown). These data correlate well with the PKB phosphorylation time course shown in Fig. 4Go and show that CD2:SHIP is able to decrease both the constitutive membrane localization and phosphorylation of PKB. However, it is unable to prevent either event after sustained (e.g., 5 min or longer) CD28 stimulation. Data from the CD2:C701ASHIP clones imply that the phosphatase activity of CD2:SHIP is essential for these changes.

Basal and receptor-stimulated cellular localization of a PI(3, 4)P2-specific PH domain in T cell lines

The recent discovery of adapter proteins with PH domains specific for PI(3, 4)P2 has raised the possibility that SHIP-1 may not just function as a negative regulator of PI3K signaling but may "shunt" signaling toward PI(3, 4)P2-specific pathways. The PI(3, 4)P2-specific C-terminal PH domain of the adapter protein TAPP-1 tagged with GFP was used to study potential functional consequences of differing PI(3, 4)P2 levels in the various cell lines. Jurkat cells showed uniform cellular distribution of GFP-TAPP-PH domain in unstimulated cells, with no significant changes seen after CD28 stimulation. However, a slight membrane localization of GFP-TAPP-PH was seen in unstimulated CEM cells, which greatly increased following CD28 stimulation (Fig. 6GoA). A TAPP-1 PH domain containing an arginine to leucine substitution at aa 212 (R212L), which has greatly reduced affinity for PI(3, 4)P2, did not show membrane localization in any cell type after CD28 stimulation. Cellular localization of GFP-TAPP-PH domain was examined in the Jurkat clones expressing CD2:SHIP and CD2:C701ASHIP (Fig. 6GoB). In either the absence or presence of CD2:SHIP expression, an even cellular distribution of GFP-TAPP-PH was observed in unstimulated cells. However, ligation of CD28 stimulated a robust membrane localization of the GFP-TAPP-PH domain in the presence (but not in the absence) of CD2:SHIP expression. No cellular localization was seen in the presence or absence of CD2:C701ASHIP in either unstimulated or CD28-stimulated cells (data not shown).



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 6. Cellular distribution of TAPP-1 adapter protein following CD28 stimulation. A, Jurkat and CEM cells were transfected with GFP-tagged PH domain of TAPP-1 or GFP-tagged PH domain mutant (R212L) and analyzed by confocal microscopy as described in Materials and Methods. Before fixing, cells were left unstimulated or stimulated with 10 µg/ml anti-CD28 mAb 9.3 for 10 min. B, Jurkat cells stably transfected with CD2:SHIP or CD2:C701ASHIP (as indicated) were cultured overnight either with (+Tet, 2 µg/ml) or without (no Tet) Tet before transfections with GFP-tagged PH domain of TAPP. Jurkat cells were either left unstimulated or stimulated with 10 µg/ml anti-CD28 mAb 9.3 for 10 min. Results are from a single experiment representative of at least two others from Jurkat clones 2 and 4. The data are also representative of results obtained in two other CD2:SHIP and CD2:C701ASHIP Jurkat cell clones.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, analysis of a range of cell lines and PBLs revealed that we were unable to show any PTEN protein expression in CEM, MOLT-4, and Jurkat cells. In contrast, SHIP-1 protein expression could be detected in CEM and MOLT-4 cells but not in Jurkat cells. The lack of both SHIP-1 and PTEN in Jurkat cells correlated with very high basal levels of PI(3, 4, 5)P3 that were sufficient to cause both PH domain-dependent membrane localization and constitutive phosphorylation of PKB. Expression of SHIP-1 (even in the absence of PTEN) correlated with lower levels of PI(3, 4, 5)P3 and higher levels of PI(3, 4)P2 and less robust PKB phosphorylation in CEM and MOLT-4 cells. However, in PBLs and HUT78 cells which both express PTEN and SHIP-1, there was no constitutive PI(3, 4, 5)P3 or PKB phosphorylation, and receptor stimuli were able to elicit robust phosphorylation of PKB. Together, these comparative studies indicated that expression of SHIP-1 and either its constitutive activity and/or its availability for coupling to activated receptors may influence the constitutive levels of PI(3, 4, 5)P3 and the activity of downstream PI3K effectors. The mechanisms by which CD28 and CD3 couple to SHIP are unclear, although previous work suggests no direct interaction CD28 with SHIP (13), implying that intermediate adaptor proteins may be involved. The notion that availability of SHIP may determine the activity of the PI3K-dependent signaling cascades was confirmed by the expression of constitutively active membrane-localized SHIP construct which was sufficient to reduce both PKB-PH domain membrane localization and phosphorylation.

Given that PTEN is one of the most commonly mutated genes in human cancer, with >330 somatic point mutations reported in primary metastasis, it is not surprising that its expression is aberrant in a number of human cell lines. In Jurkat cells, several mutations causing premature stop codons have been described which result in truncated proteins that are highly unstable and rapidly degraded (26, 32). In this study, we have demonstrated mRNA expression of both PTEN and SHIP-1 in all the T cell lines investigated, but were unable to show any SHIP-1 protein expression in Jurkat cells or PTEN protein expression in CEM, MOLT-4, and Jurkat cells. The identification of an intronless PTEN pseudogene (33, 34) raises the possibility of genomic DNA contamination, but controls used in this study make it more likely that CEM and MOLT-4 cells contain mutation in the PTEN gene which results in altered protein expression/stability. Mutation of the PTEN gene in CEM cells has been described previously by Sakai et al. (32), but the same study failed to find any alterations in MOLT-4 cells, although this may reflect limited efficiency of the mutation detection system used in this study (33, 35). The inability to detect SHIP-1 protein expression in Jurkat cells despite the presence of mRNA may be due to a similar gene mutation as PTEN. The PCR fragment amplified in this study only covers the catalytic core of SHIP-1; therefore, the possibility of truncated SHIP-1 mRNA transcripts being present cannot be dismissed. Also, the identification of different-sized isoforms of SHIP-1 due to alternative splicing and specific proteolytic degradation from the C-terminal end (36, 37) raises the possibility of Jurkat cells expressing an isoform of SHIP not detected in our study. However, data derived from the lipid labeling experiments support the lack of a functional 5' inositol phosphatase in Jurkat cells. PKB has previously been reported to be overexpressed in several carcinomas (38, 39). Therefore, it will be interesting to investigate whether lack of expression of lipid phosphatases and the resultant dysregulated PKB activity that is observed in T cell leukemic cell lines is also reflected in primary T cell leukemias.

There are several lines of evidence provided by this study which collectively suggest that active SHIP-1 contributes to degradation of PI(3, 4, 5)P3. First, SHIP-1 is expressed by both CEM and MOLT-4 cells, which have high basal levels of PI(3, 4)P2 compared with SHIP-deficient Jurkat cells. Because these CEM and MOLT-4 cells also lack PTEN, PI(3, 4)P2 is at greater levels than would be seen in cells with an active 3'-inositol phosphatase such as HUT78 cells. Second, in CEM and MOLT-4 cells, PKB phosphorylation is unsaturated and terminated faster by PI3K inhibition compared with Jurkat cells, suggesting that cells which express SHIP possess more efficient mechanisms for the removal of PI(3, 4, 5)P3. Although this notion fits well with the expression of SHIP-1 in CEM and MOLT-4, other factors may influence the observed differential rate of termination of PKB phosphorylation in these cells. For instance, there may be different expression of PKB-specific phosphatases. However, it is important to note that expression of a constitutively active SHIP protein in Jurkat cells is sufficient to reduce PKB phosphorylation below saturation levels and relocalizes GFP-tagged PKB PH domains from the plasma membrane to the cytosol.

Results from this study may shed some light on the controversy surrounding the model of PKB activation, concerning whether PI(3, 4)P2 or PI(3, 4, 5)P3 is the critical messenger that attracts PKB and its kinases to the plasma membrane in vivo. Although the PH domain of PKB has been reported to have dual specificity for both PI(3, 4, 5)P3 and PI(3, 4)P2 (5, 6), there are also substantial in vitro data suggesting that PI(3, 4)P2 has a higher affinity than PI(3, 4, 5)P3 for PKB (40, 41, 42). Also, the addition of di-C16-PI(3, 4)P2 to serum-starved NIH3T3 cells stimulates PKB autophosphorylation, while di-C16-PI(3, 4, 5)P3 causes slight inhibition (40). Studies in platelets have also shown that PKB activation correlates with PI(3, 4)P2 rather than PI(3, 4, 5)P3 production following thrombin stimulation (40), while integrin cross-linking has been reported to generate PI(3, 4)P2 but not PI(3, 4, 5)P3, yet still results in PKB activation (43). More recently, it has been suggested that PI(3, 4)P2 is essential for phosphorylation of PKB at Ser473 (44). Our data do not entirely rule out the possibility that low levels of PI(3, 4)P2 detected in the leukemic cell lines may be sufficient to influence PKB activation. However, it does appear that a high ratio of PI(3, 4, 5)P3 relative to PI(3, 4)2 favors PKB activation in T cells, given the robust membrane localization of the PKB-PH domain in unstimulated Jurkats. Importantly, the expression of a constitutively active SHIP protein in Jurkat cells caused large increases in PI(3, 4)P2 levels that correlated with a reduction in Ser473 phosphorylation and relocalization of GFP-tagged PKB PH domains from the plasma membrane to the cytosol. These data correlate well with observations from CEM and MOLT-4 cells that express SHIP-1 and generally exhibit much higher levels of PI(3, 4)P2 than Jurkat cells under both resting and stimulated conditions, but exhibit constitutive phosphorylation of PKB well below saturation levels.

It is important to emphasize that while expression of constitutively active SHIP was able to decrease both constitutive PKBser473phosphorylation and GFP-tagged PKB PH domain plasma membrane localization, neither response is abrogated following prolonged CD28 stimulation. Thus, stimulation of cells expressing CD2:SHIP with anti-CD28 Ab for longer than 5 min led to levels of PKBser473 phosphorylation similar to the saturated levels observed in the absence of CD2:SHIP expression. A distinct membrane localization of PKB was also seen after >5 min of CD28 stimulation despite expression of CD2:SHIP. The reason why CD28-stimulated PKB phosphorylation approaches saturated levels even in the presence of an active SHIP mutant is probably because CD28 stimulates PI(3, 4, 5)P3 formation in excess of the ability of membrane-localized CD2:SHIP to remove it. These observations correlate well with recent evidence from Xu et al. (45), who reported that inducible expression of PTEN in Jurkat cells was able to significantly reduce basal PKBser473 phosphorylation and PKB membrane localization, but was unable to eliminate phosphorylation of PKB following TCR ligation. In this regard, it should be remembered that under physiological conditions, both SHIP and PTEN probably contribute to the regulation of CD28-stimulated PI(3, 4, 5)P3.

The use of a PI(3, 4)P2-specific PH domain also allowed us to demonstrate in vivo the effect of SHIP-1 not only as a negative regulator of PI(3, 4, 5)P3-mediated signaling, but also as a positive regulator of TAPP-1 binding and membrane localization. Stimulation of CEM cells with CD28 was required to cause major membrane localization of the TAPP PH domain despite high basal levels PI(3, 4)P2. Similarly, Jurkat cells expressing CD2:SHIP also required CD28 stimulation before membrane localization of the TAPP PH domain was observed. However, the TAPP-1 C-terminal PH domain used in this study has a 5-fold lower affinity for PI(3, 4)P2 than full-length TAPP-1 (7), and therefore, basal PI(3, 4)P2 in CEM and CD2:SHIP expressing Jurkat cells may exist below the threshold levels required to support PH domain binding and constitutive membrane localization. The biological role of the adapter proteins remains obscure. The last three residues of TAPP-1 and TAPP-2 conform to the minimal sequence motif required for binding to a PDZ domain, and both TAPP-1 and TAPP-2 have recently been reported to interact through their C-terminal residues with a multi-PDZ-containing protein termed MUPP1 (46). Therefore, further work to elucidate the pathways influenced by TAPP is required, but its role in T cell signaling may be easily unraveled with the use of the CEM and MOLT-4 cell lines.

The data presented in this study suggest that SHIP-1 does make an important contribution to the control of PI(3, 4, 5)P3 levels in situations where PTEN is not expressed. The reason why SHIP-1-/- mice (18, 19, 20) exhibit a much less severe T cell phenotype than T cells from PTEN-/+ mice (22, 23, 24) is not clear. However, it is important to note that while the CD2:SHIP mutant increased PI(3, 4)P2, it also actually resulted in slightly enhanced levels of PI(3, 4, 5)P3. The reason for this is not clear, but may reflect increased activity of proximal lipid kinases which act to replenish PI(3, 4, 5)P3. This finding may provide an important clue to the relative roles of SHIP-1. That is to say PTEN may function as the "work horse" phosphatase that provides general clearance of active signaling moieties such as PI(3, 4, 5)P3 that is essential for general homeostasis. In contrast, SHIP-1 may function in a much more subtle way, and in this respect, it is interesting to note that SHIP-1 has been proposed to play a gatekeeper role in IgE-mediated mast cell degranulation by setting the threshold for and limiting the degranulation process (21, 47). Thus, SHIP-1 may function more as a gatekeeper of spatio-temporal signaling after receptor activation in T lymphocytes, shunting signal transduction pathways away from PI(3, 4, 5)P3-dependent effectors toward PI(3, 4)P2-dependent effectors.


    Acknowledgments
 
We thank Dr. Melanie Welham for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by the Wellcome Trust (to R.W.F. and S.G.W.). Back

2 Address correspondence and reprint requests to Dr. Stephen G. Ward, Department of Pharmacy and Pharmacology, University of Bath, Claverton Down, Bath, BA2 7AY, U.K. E-mail address: S.G.Ward{at}bath.ac.uk Back

3 Abbreviations used in this paper: SHP-2, Src homology 2 domain containing protein tyrosine phosphatase; PI3K, phosphoinositide 3-kinase; PI, phosphoinositide; GFP, green fluorescent protein; PH, pleckstrin homology; PI(3,4)P2, phosphatidylinositol 3,4-bisphosphate; PI(3,4,5)P3, phosphatidylinositol 3,4,5-trisphosphate; PKB, protein kinase B; PTEN, phosphatase and tensin homolog deleted on chromosome ten; SHIP, Src homology 2 domain containing inositol polyphosphate phosphatase; SHP-2, Src homology 2 domain containing protein tyrosine phosphatase; TAPP, tandem PH domain-containing protein; Tet, tetracycline. Back

Received for publication June 10, 2002. Accepted for publication September 11, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ward, S. G., D. A. Cantrell. 2001. Phosphoinositide 3-kinases in T lymphocyte activation. Curr. Opin. Immunol. 13:332.[Medline]
  2. Vanhaesebroeck, B., S. J. Leevers, K. Ahmadi, J. Timms, R. Katso, P. C. Driscoll, R. Woscholski, P. J. Parker, M. D. Waterfield. 2001. Synthesis and function of 3-phosphorylated inositol lipids. Annu. Rev. Biochem. 70:535.[Medline]
  3. Cullen, P. J., G. E. Cozier, G. Banting, H. Mellor. 2001. Modular phosphoinositide-binding domains—their role in signalling and membrane trafficking. Curr. Biol. 11:R882.[Medline]
  4. Xu, Y., L. F. Seet, B. Hanson, W. Hong. 2001. The Phox homology (PX) domain, a new player in phosphoinositide signalling. Biochem. J. 360:513.[Medline]
  5. Lemmon, M. A., K. M. Ferguson. 2001. Signal-dependent membrane targeting by pleckstrin homology (PH) domains. Biochem. J. 350:1.
  6. Isakoff, S. J., T. Cardozo, J. Andreev, Z. Li, K. M. Ferguson, R. Abagyan, M. A. Lemmon, A. Aronheim, E. Y. Solnik. 1998. Identification and analysis of PH domain-containing targets of phosphatidylinositol 3-kinase using a novel in vivo assay in yeast. EMBO J. 17:5374.[Medline]
  7. Dowler, S., R. A. Currie, D. G. Campbell, M. Deak, G. Kular, C. P. Downes, D. R. Alessi. 2000. Identification of pleckstrin-homology-domain-containing proteins with novel phosphoinositide-binding specificities. Biochem. J. 351:19.[Medline]
  8. Rohrschneider, L. R, J. F. Fuller, I. Wolf, Y. Liu, D. M. Lucas. 2000. Structure, function, and biology of SHIP proteins. Genes Dev. 14:505.[Free Full Text]
  9. Cantley, L. C., B. G. Neel. 2000. New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc. Natl. Acad. Sci. USA 96:4240.[Abstract/Free Full Text]
  10. Leslie, N. R., C. P. Downes. 2002. PTEN: the down side of PI 3-kinase signalling. Cell. Signal. 14:285.[Medline]
  11. Damen, J. E., L. Liu, P. Rosten, R. K. Humphries, A. B. Jefferson, P. W. Majerus, G. Krystal. 1996. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc. Natl. Acad. Sci. USA 93:1689.[Abstract/Free Full Text]
  12. Chacko, G. W., S. Tridandapani, J. E. Damen, L. Liu, G. Krystal, K. M. Coggeshall. 1996. Negative signaling in B lymphocytes induces tyrosine phosphorylation of the 145-kDa inositol polyphosphate 5-phosphatase, SHIP. J. Immunol. 157:2234.[Abstract]
  13. Edmunds, C., R. V. Parry, S. J. Burgess, B. Reaves, S. G. Ward. 1999. CD28 stimulates tyrosine phosphorylation, cellular redistribution and catalytic activity of the inositol lipid 5-phosphatase SHIP. Eur. J. Immunol. 11:3507.
  14. Kavanaugh, W. M., D. A. Pot, S. M. Chin, M. Deuter-Reinhard, A. B. Jefferson, F. A. Norris, F. R. Masiarz, L. S. Cousens, P. W. Majerus, L. T. Williams. 1996. Multiple forms of an inositol polyphosphate 5-phosphatase form signaling complexes with Shc and Grb2. Curr. Biol. 6:438.[Medline]
  15. Lioubin, M. N., P. A. Algate, S. Tsai, K. Carlberg, A. Aebersold, L. R. Rohrschneider. 1996. p150Ship, a signal transduction molecule with inositol polyphosphate-5-phosphatase activity. Genes Dev. 10:1084.[Abstract/Free Full Text]
  16. Ono, M., S. Bolland, P. Tempst, J. V. Ravetch. 1997. Role of the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc{gamma}RIIB. Nature 383:263.
  17. Ono, M., H. Okada, S. Bolland, S. Yanagi, T. Kurosaki, J. V. Ravetch. 1997. Deletion of SHIP or SHP-1 reveals two distinct pathways for inhibitory signaling. Cell 90:293.[Medline]
  18. Liu, Q., A. J. Oliveira-Dos-Santos, S. Mariathasan, D. Bouchard, J. Jones, R. Sarao, I. Kozieradzki, P. S. Ohashi, J. M. Penninger, D. J. Dumont. 1998. The inositol polyphosphate 5-phosphatase SHIP is a crucial negative regulator of B cell antigen receptor signaling. J. Exp. Med. 188:1333.[Abstract/Free Full Text]
  19. Liu, Q., T. Sasaki, I. Kozieradzki, A. Wakeham, A. Itie, D. J. Dumont, J. M. Penninger. 1999. SHIP is a negative regulator of growth factor receptor-mediated PKB/Akt activation and myeloid cell survival. Genes Dev. 13:786.[Abstract/Free Full Text]
  20. Helgason, C. D., J. E. Damen, P. Rosten, R. Grewal, P. Sorensen, S. M. Chappel, A. Borowski, F. Jirik, G. Krystal, R. K. Humphries. 1998. Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev. 12:1610.[Abstract/Free Full Text]
  21. Huber, M., C. D. Helgason, M. P. Scheid, V. Duronio, R. K. Humphries, G. Krystal. 1998. Targeted disruption of SHIP leads to Steel factor-induced degranulation of mast cells. EMBO J. 17:7311.[Medline]
  22. Suzuki, A., J. L. de la Pompa, V. Stambolic, A. J. Elia, T. Sasaki, I. del Barco Barrantes, A. Ho, A. Wakeham, A. Itie, W. Khoo, et al 1998. High cancer susceptibility and embryonic lethality associated with mutation of the PTEN tumor suppressor gene in mice. Curr. Biol. 8:1169.[Medline]
  23. Podyspania, K., L. H. Ellenson, A. Nemes, J. Gu, M. Tamura, K. M. Yamada, C. Cordon-Cardo, G. Catoretti, P. E. Fisher, R. Parsons. 1999. Mutation of the Pten/Mmac1 in mice causes neoplasia in multiple organ systems. Proc. Natl. Acad. Sci. USA 96:1563.[Abstract/Free Full Text]
  24. Di Cristofan, A., B. Pesce, C. Cordon-Cardo, P. P. Pandolfi. 1998. PTEN is essential for embryonic development and tumor suppression. Nat. Genet. 19:348.[Medline]
  25. Shan, X., M. J. Czar, S. C. Bunnell, P. Liu, Y. Liu, P. L. Schwartzberg, R. L. Wange. 2000. Deficiency of PTEN in Jurkat T cells causes constitutive localization of Itk to the plasma membrane and hyper-responsiveness to CD3 stimulation. Mol. Cell. Biol. 18:6945.
  26. Astoul, E., C. Edmunds, D. A. Cantrell, S. G. Ward. 2001. PI 3-K and T-cell activation: limitations of T-leukemic cell lines as signaling models. Trends Immunol. 22:490.[Medline]
  27. Ward, S. G., D. A. Cantrell. 1990. Heterogeneity of the regulation of phospholipase C by phorbol esters in T lymphocytes. J. Immunol. 144:3523.[Abstract]
  28. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  29. Ward, S. G.. 2000. Measurement of phosphoinositide 3-kinase activity. Methods Mol. Biol. 138:163.[Medline]
  30. Jefferson, A. B., P. W. Majerus. 1996. Mutation of the conserved domains of two inositol polyphosphate 5-phosphatases. Biochemistry 35:7890.[Medline]
  31. Ellson, C. D., S. Gobert-Gosse, K. E. Anderson, K. Davidson, H. Erdjument-Bromage, P. Tempst, J. W. Thuring, M. A. Cooper, Z. Y. Lim, A. B. Holmes, et al 2001. PtdIns(3)P regulates the neutrophil oxidase complex by binding to the PX domain of p40phox. Nat. Cell Biol. 7:679.
  32. Sakai, A., C. Thieblemont, A. Wellmann, E. S. Jaffe, M. Raffeld. 1998. PTEN gene alterations in lymphoid neoplasms. Blood 92:3410.[Abstract/Free Full Text]
  33. Dahia, P. L., M. G. FitzGerald, X. Zhang, D. J. Marsh, Z. Zheng, T. Pietsch, A. von Deimling, F. G. Haluska, D. A. Haber, C. Eng. 1998. A highly conserved processed PTEN pseudogene is located on chromosome band 9p21. Oncogene 16:2403.[Medline]
  34. Kim, S. K., L. K. Su, Y. Oh, B. L. Kemp, W. K. Hong, L. Mao. 1998. Alterations of PTEN/MMAC1, a candidate tumor suppressor gene, and its homologue, PTH2, in small cell lung cancer cell lines. Oncogene 16:89.[Medline]
  35. Freeburn, R. W., R. E. Gale, H. M. Wagner, D. C. Linch. 1996. The {beta} subunit common to the GM-CSF, IL-3 and IL-5 receptors is highly polymorphic but pathogenic point mutations in patients with acute myeloid leukemia (AML) are rare. Leukemia 10:123.[Medline]
  36. Damen, J. E., L. Liu, M. D. Ware, M. Ermolaeva, P. W. Majerus, G. Krystal. 1998. Multiple forms of the SH2-containing inositol phosphatase, SHIP, are generated by C-terminal truncation. Blood 92:1199.[Abstract/Free Full Text]
  37. Lucas, D. M., L. R. Rohrschneider. 1999. A novel spliced form of SH2-containing inositol phosphatase is expressed during myeloid development. Blood 93:1922.[Abstract/Free Full Text]
  38. Cheng, J. D., B. Ruggeri, W. M. Klein, G. Sonada, D. A. Altomare, D. K. Watson, J. R. Testa. 1996. Amplification of Akt2 in human pancreatic-cancer cells and inhibition of Akt2 expression and tumorigenicity by antisense RNA. Proc. Natl. Acad. Sci. USA 93:3636.[Abstract/Free Full Text]
  39. Jones, P. F., T. Jakubowicz, F. J. Pitossi, F. Maurer, B. A. Hemmings. 1991. Molecular cloning and identification of a serine/threonine protein kinase of the second messenger sub-family. Proc. Natl. Acad. Sci. USA 88:4171.[Abstract/Free Full Text]
  40. Franke, T. F., D. R. Kaplan, L. C. Cantley, A. Toker. 1997. Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science 275:665.[Abstract/Free Full Text]
  41. Frech, M., M. Andjelkovic, E. Ingley, K. K. Reddy, J. R. Falck, B. A. Hemmings. 1997. High affinity binding of inositol phosphates and phosphoinositides to the pleckstrin homology domain of RAC/protein kinase B and their influence on kinase activity. J. Biol. Chem. 272:8474.[Abstract/Free Full Text]
  42. Klippel, A., W. M. Kavanaugh, D. Pot, L. T. Williams. 1997. A specific product of phosphatidylinositol 3-kinase directly activates the protein kinase Akt through its pleckstrin homology domain. Mol. Cell. Biol. 17:338.[Abstract]
  43. Banfic, H., X. Tang, I. H. Batty, C. P. Downes, C. Chen, S. E. Rittenhouse. 1998. A novel integrin-activated pathway forms PKB/Akt-stimulatory phosphatidylinositol 3,4-bisphosphate via phosphatidylinositol 3-phosphate in platelets. J. Biol. Chem. 273:13.[Abstract/Free Full Text]
  44. Scheid, M. P., M. Huber, J. E. Damen, M. Hughes, V. Kang, P. Neilsen, G. D. Prestwich, G. Krystal, V. Duronio. 2002. Phosphatidylinositol(3,4,5)P3 is essential but not sufficient for protein kinase B (PKB) activation; phosphatidylinositol(3,4)P2 is required for PKB phosphorylation at Ser-473: studies using cells from SH2-containing inositol-5-phosphatase knockout mice. J. Biol. Chem. 277:9027.[Abstract/Free Full Text]
  45. Xu, Z., D. Stokoe, L. P. Kane, A. Weiss. 2002. The inducible expression of the tumour suppressor gene PTEN promotes apoptosis and decreases cell size by inhibiting the PI3K/Akt pathway in Jurkat cells. Cell Growth Differ. 13:285.[Abstract/Free Full Text]
  46. Kimber, W. A., L. Trinkle-Mulcah, P. C. Cheung, M. Deak, L. J. Marsden, A. Kieloch, S. Watt, R. T. Javier, A. Gray, C. P. Downes, et al 2002. Evidence that the tandem-pleckstrin-homology-domain-containing protein TAPP1 interacts with PtdIns(3,4)P2 and the multi-PDZ-domain-containing protein MUPP1 in vivo. Biochem. J. 361:525.[Medline]
  47. Huber, M., C. D. Helgason, J. E. Damen, L. Liu, R. K. Humphries, G. K. Krystal. 1998. The src homology 2-containing inositol phosphatase (SHIP) is the gatekeeper of mast cell degranulation. Proc. Natl. Acad. Sci. USA 95:11330.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
Y. Yamanaka, H. Tagawa, N. Takahashi, A. Watanabe, Y.-M. Guo, K. Iwamoto, J. Yamashita, H. Saitoh, Y. Kameoka, N. Shimizu, et al.
Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia
Blood, October 8, 2009; 114(15): 3265 - 3275.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
G. Firaguay and J. A. Nunes
Analysis of Signaling Events by Dynamic Phosphoflow Cytometry
Sci. Signal., September 1, 2009; 2(86): pl3 - pl3.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
A. Denley, M. Gymnopoulos, S. Kang, C. Mitchell, and P. K. Vogt
Requirement of Phosphatidylinositol(3,4,5)Trisphosphate in Phosphatidylinositol 3-Kinase-Induced Oncogenic Transformation
Mol. Cancer Res., July 1, 2009; 7(7): 1132 - 1138.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. Beneteau, M. Pizon, B. Chaigne-Delalande, S. Daburon, P. Moreau, F. De Giorgi, F. Ichas, A. Rebillard, M.-T. Dimanche-Boitrel, J.-L. Taupin, et al.
Localization of Fas/CD95 into the Lipid Rafts on Down-Modulation of the Phosphatidylinositol 3-Kinase Signaling Pathway
Mol. Cancer Res., April 1, 2008; 6(4): 604 - 613.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Harris, R. V. Parry, J. Westwick, and S. G. Ward
Phosphoinositide Lipid Phosphatases: Natural Regulators of Phosphoinositide 3-Kinase Signaling in T Lymphocytes
J. Biol. Chem., February 1, 2008; 283(5): 2465 - 2469.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Tarasenko, H. K. Kole, A. W. Chi, M. M. Mentink-Kane, T. A. Wynn, and S. Bolland
T cell-specific deletion of the inositol phosphatase SHIP reveals its role in regulating Th1/Th2 and cytotoxic responses
PNAS, July 3, 2007; 104(27): 11382 - 11387.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Dong, B. Corre, E. Foulon, E. Dufour, A. Veillette, O. Acuto, and F. Michel
T cell receptor for antigen induces linker for activation of T cell-dependent activation of a negative signaling complex involving Dok-2, SHIP-1, and Grb-2
J. Exp. Med., October 30, 2006; 203(11): 2509 - 2518.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Buckler, P. T. Walsh, P. M. Porrett, Y. Choi, and L. A. Turka
Cutting Edge: T Cell Requirement for CD28 Costimulation Is Due to Negative Regulation of TCR Signals by PTEN
J. Immunol., October 1, 2006; 177(7): 4262 - 4266.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
L. M. Ooms, C. G. Fedele, M. V. Astle, I. Ivetac, V. Cheung, R. B. Pearson, M. J. Layton, A. Forrai, H. H. Nandurkar, and C. A. Mitchell
The Inositol Polyphosphate 5-Phosphatase, PIPP, Is a Novel Regulator of Phosphoinositide 3-Kinase-dependent Neurite Elongation
Mol. Biol. Cell, February 1, 2006; 17(2): 607 - 622.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. V. Parry, G. C. Whittaker, M. Sims, C. E. Edmead, M. J. Welham, and S. G. Ward
Ligation of CD28 Stimulates the Formation of a Multimeric Signaling Complex Involving Grb-2-Associated Binder 2 (Gab2), Src Homology Phosphatase-2, and Phosphatidylinositol 3-Kinase: Evidence That Negative Regulation of CD28 Signaling Requires the Gab2 Pleckstrin Homology Domain
J. Immunol., January 1, 2006; 176(1): 594 - 602.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R.-i. Fukuda, A. Hayashi, A. Utsunomiya, Y. Nukada, R. Fukui, K. Itoh, K. Tezuka, K. Ohashi, K. Mizuno, M. Sakamoto, et al.
Alteration of phosphatidylinositol 3-kinase cascade in the multilobulated nuclear formation of adult T cell leukemia/lymphoma (ATLL)
PNAS, October 18, 2005; 102(42): 15213 - 15218.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. G. Tomlinson, V. L. Heath, C. W. Turck, S. P. Watson, and A. Weiss
SHIP Family Inositol Phosphatases Interact with and Negatively Regulate the Tec Tyrosine Kinase
J. Biol. Chem., December 31, 2004; 279(53): 55089 - 55096.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Ikehara, S. K. Ikehara, and J. C. Paulson
Negative Regulation of T Cell Receptor Signaling by Siglec-7 (p70/AIRM) and Siglec-9
J. Biol. Chem., October 8, 2004; 279(41): 43117 - 43125.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Huang and R. L. Wange
T Cell Receptor Signaling: Beyond Complex Complexes
J. Biol. Chem., July 9, 2004; 279(28): 28827 - 28830.
[Full Text] [PDF]


Home page
J. Immunol.Home page
D. G. Cronshaw, C. Owen, Z. Brown, and S. G. Ward
Activation of Phosphoinositide 3-Kinases by the CCR4 Ligand Macrophage-Derived Chemokine Is a Dispensable Signal for T Lymphocyte Chemotaxis
J. Immunol., June 15, 2004; 172(12): 7761 - 7770.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. J. Bensinger, P. T. Walsh, J. Zhang, M. Carroll, R. Parsons, J. C. Rathmell, C. B. Thompson, M. A. Burchill, M. A. Farrar, and L. A. Turka
Distinct IL-2 Receptor Signaling Pattern in CD4+CD25+ Regulatory T Cells
J. Immunol., May 1, 2004; 172(9): 5287 - 5296.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. K. Krahn, K. Ma, S. Hou, V. Duronio, and A. J. Marshall
Two Distinct Waves of Membrane-Proximal B Cell Antigen Receptor Signaling Differentially Regulated by Src Homology 2-Containing Inositol Polyphosphate 5-Phosphatase
J. Immunol., January 1, 2004; 172(1): 331 - 339.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. P. Curnock, Y. Sotsios, K. L. Wright, and S. G. Ward
Optimal Chemotactic Responses of Leukemic T Cells to Stromal Cell-Derived Factor-1 Requires the Activation of Both Class IA and IB Phosphoinositide 3-Kinases
J. Immunol., April 15, 2003; 170(8): 4021 - 4030.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freeburn, R. W.
Right arrow Articles by Ward, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freeburn, R. W.
Right arrow Articles by Ward, S. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS