| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Pharmacy and Pharmacology, Bath University, Bath, United Kingdom; and
Lymphocyte Activation Laboratory, Cancer Research U.K., London, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The PH domain containing effectors such as PDK-1, protein kinase B (PKB), Btk, guanine nucleotide exchange factors, and GTPase-activating proteins are involved in an array of functional outcomes (2, 3, 4) and can exhibit high selectivity for distinct 3'-phosphorylated PI lipids. Thus, PH domains of Btk, Grp-1, centaurin-1, DOS, Gab-1, and PDK-1 recognize PI(3, 4, 5)P3 with high affinity and specificity (5, 6). However, PKB and dual adaptor for phosphotyrosine and 3-PI PH domains bind almost equally well to both PI(3, 4)P2 and PI(3, 4, 5)P3 (5, 6). There is now evidence emerging that certain PH domains will only interact with PI(3, 4)P2. Hence, PH domains of tandem PH domain-containing protein (TAPP)-1 and TAPP-2 will interact specifically with PI(3, 4)P2 (7). Given the plethora of receptors coupled to PI3K isoforms and the wealth of functional outcomes that appear to be determined by PI3K lipids (1, 2), it is essential that cells maintain tight control of PI lipid accumulation. This is achieved by a delicate balance of kinase and phosphatase activity that form and degrade the three main signal transducing PI lipids. Most attention has focused on two inositol phosphatases implicated in the degradation of PI(3, 4, 5)P3, namely the 5' phosphatase Src homology 2 domain containing inositol polyphosphate phosphatase (SHIP) and the 3' phosphatase and tensin homolog deleted on chromosome ten (PTEN) (8, 9, 10).
SHIP-1 is a 145-kDa protein that becomes tyrosine phosphorylated after
stimulation of cells of hemopoietic lineage, by a variety of cytokines
as well as T and B cell Ag receptors, and the T cell costimulatory
receptor CD28 (11, 12, 13). In addition to its catalytic
inositol 5-phosphatase domain, SHIP-1 possesses several recognized
motifs that can sustain protein-protein interactions with Grb-2
(8, 11, 14) and Shc (8, 15). SHIP-1 inhibits
immune receptor activation in both mast cells and B cells by binding to
the tyrosine-phosphorylated immunoreceptor tyrosine-based inhibitory
motif of the inhibitory coreceptor Fc
RIIB (16, 17). SHIP plays an important role as a negative regulator of
cell activation in B lymphoid cells (18, 19, 20), myeloid
cells (18, 19, 20), and mast cells (21). Although
SHIP-deficient mice exhibit hyperresponsive B cells and elevated
circulating Abs as well as symptoms of autoimmune disease
(18, 19, 20), the loss of SHIP results in a much less severe T
cell phenotype, with
SHIP-/-Rag-/- mice
reported as having normal TCR/CD28-driven T cell proliferation and IL-2
production (18). Indeed, several lines of evidence have
suggested that the 3-phosphatase PTEN, rather than SHIP, is the key
negative regulator of 3'-phosphorylated lipids in T cells
(22, 23, 24). In addition, recent evidence has indicated that
the PI3K effector PKB is constitutively phosphorylated and activated in
the leukemic T cell line Jurkat. However, since this particular cell
line is deficient in both PTEN and SHIP-1 expression at the protein
level (25, 26), it is not clear whether lack of either or
both lipid phosphatases contributes to the dysregulated
3'-phosphorylated PI lipids in these cells.
Given that SHIP-1 is tyrosine phosphorylated in response to TCR and CD28 ligation (13), it seems likely that it has some role to play in the regulation of signaling via these receptors. Therefore, we have examined whether the lack of SHIP and PTEN expression is peculiar to Jurkat cells or if it is shared by other leukemic T cell lines and PBLs. In addition, we have designed a membrane-localized constitutively active SHIP mutant which we have expressed in the Jurkat cell line using a tetracycline (Tet)-regulated expression system. We have used this system to verify that SHIP can contribute to degradation of PI(3, 4, 5)P3 in T cells, and thus, influence signaling away from PI(3, 4, 5)P3-dependent effectors toward effectors that are exclusively driven by PI(3, 4)P2.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD28 mAb 9.3 was kindly provided by C. June (University of Pennsylvannia, Philadelphia, PA); anti-PTEN (A2B1, sc-7974, 1:2000), anti-SHIP (P1C1, sc-8425, 1:2000), anti-Src homology 2 domain containing protein tyrosine phosphatase (SHP-2) (C-18, sc-280, 1:2000), anti-glycogen synthase kinase 3 (R-20, sc-1846, 1:1000), and anti-PKB (D-17, sc-7126, 1:1000) Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phospho-PKB (no. 9271, 1:1000) and anti-phospho-glycogen synthase kinase 3 (no. 9331, 1:1000) Abs were from Cell Signaling Technologies (Calne, U.K.). The rat CD2 mAb (OX34) was purified from hybridoma supernatants by standard protocols. Secondary Abs conjugated to HRP were from DAKO (Cambridge, U.K). The green fluorescent protein (GFP)-tagged PH domain of PKB and its nonlipid binding R25C mutated form were gifts from Dr. J. Downward (Cancer Research U.K., London, U.K.). The GFP-tagged C-terminal PH domain of TAPP-1 and its nonlipid binding R212L mutated form were gifts from Dr. D. Alessi (MRC Protein Phosphorylation Unit, Dundee, U.K.). LY294002 was purchased from Affiniti Biomol (Exeter, U.K.).
Cell lines and cell culture
The human leukemic T cell lines Jurkat, CEM, MOLT-4, and HUT78 as well as the murine B cell lymphoma cell line A20 were cultured in humidified incubators at 37°C, 5% (v/v) CO2 in RPMI 1640 medium supplemented with 10% (v/v) FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen, Paisley, Scotland). Human PBLs were prepared from heparinized blood samples as described previously (27).
RNA extraction and RT-PCR
Cellular RNA was extracted using RNAzol B (AMS Biotechnology,
Oxon, U.K.). This method is based on the acid
guanidium-phenol-chloroform method from Chomczynski et al.
(28). Reverse transcription was performed using an oligo
(dT) primer and Moloney murine leukemia virus reverse
transcriptase on 1 µg of cellular RNA (Advanced Biotechnologies,
Surrey, U.K.) in a 20-µl reaction. Using 2 µl of cDNA as template,
PCR was performed using PTEN (forward: 5'-3'GTACTTTGAGTTCCCTCAGC,
reverse: 5'-3'GGAGAAAAGTATCGGTTGGC), SHIP (forward:
5'-3'TGAACATTCTCCGGTTCCTG, reverse: 5'-3'TAAGACTGACACACCACGTG), and
-actin (forward: 5'-3'CATCACCATTGGCAATGAGC, reverse:
5'-3'ATACTCCTGCTTGCTGATCC) specific primers with 30 cycles of 94°C
for 30 s, 60°C for 30 s, and 72°C for 40 s. Products
were electrophoresed through a 1.5% agarose gel and visualized using
ethidium bromide staining.
Cell lysis and immunoblotting
Cells (1 x 107 cells/ml) were
equilibrated for 60 min at 37°C in serum-free RPMI 1640 and then
stimulated in RPMI 1640 medium as described in the figure legends.
Reactions were terminated by addition of ice-cold lysis buffer (1%
(v/v) Nonidet P-40, 100 mM NaCl, 20 mM Tris (pH 7.4), 10 mM
iodoacetamide, 10 mM NaF, 1 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml
pepstatin, 10 µg/ml -glycerophosphate, and 1 mM sodium
orthovanadate). Immunoprecipitation and immunoblotting were performed
as described in detail elsewhere (13).
Phosphatidylinositol lipid analysis and inositol phosphate 5-phosphatase assays
Leukemic T cells or PBLs (1 x 108) were labeled with 1 mCi [32P]-orthophosphate (8500–9120 Ci/mmol; DuPont Pharmaceuticals, Wilmington, DE) as described (29). 32P-labeled cells were aliquoted at 107/120 µl, stimulated as described in the figure legends, and the phospholipids extracted with 700 µl chloroform:methanol:H2O (32.6%:65.3%:2.1% v/v/v, respectively). The samples were deacylated and analyzed by anion exchange HPLC analysis as described elsewhere (29). Where appropriate, CD2:SHIP immunoprecipitates derived from resting and CD28-stimulated Jurkat cells were washed and assayed for 5-phosphatase activity by determining the in vitro hydrolysis of [3H]-Ins(1, 3, 4, 5)P4 to [3H]Ins(1, 3, 4)P3 as described elsewhere (11, 13).
Cellular localization
Transfection of T cell lines with GFP-tagged PH domain plasmids was conducted using DMRIE-C according to the manufacturer’s instructions (Invitrogen). After 6-h transfections, cells were attached to poly-L-lysine-coated cover slips before fixation in 4% paraformaldehyde/glutaraldehyde for 10 min and mounting in a Mowiol-based media (Calbiochem, Nottingham, U.K.). After drying overnight at 4°C, slides were examined on an Olympus inverted stage confocal microscope (Olympus Optical, Hamburg, Germany) using Fluoview software.
Construction and characterization of chimeric SHIP proteins
A membrane-localized chimeric protein was created by fusing the extracellular and transmembrane domain of rat CD2 molecule with the catalytic core of human SHIP-1. The coding regions of the catalytic core of human SHIP-1 (aa 364–826) were attached to a truncated rat CD2 molecule consisting of the extracellular and transmembrane domain (aa 1–212) (European Molecular Biology Laboratory accession no. X05111). The rCD2 intracellular domain was truncated by a restriction digest using NotI. The human SHIP catalytic core was adapted by PCR to introduce a NotI site at its 5' end and then ligated to the truncated rCD2 via the mutual NotI sites. The CD2:SHIP chimeras were assembled by subcloning the cDNAs into the pEFBos vector, and the construct was verified by nucleotide sequencing and/or restriction enzyme analysis. The CD2:SHIP construct was blunt-end ligated into the pUHD10-3-hygromycin regulatory plasmid containing a Tet-off responsive element. A point-mutated version of the CD2:SHIP protein in which the cysteine residue at position 701 within the catalytic signature motif was mutated to alanine was also constructed by standard PCR procedures (CD2:C701ASHIP).
Screening for Tet-regulated expression
Jurkat cells (2 x 107) expressing
the Tet-controlled transactivator (Clontech Laboratories, Palo Alto,
CA,) were transfected with 10 µg of linearized plasmid by
electroporation and cells were transferred to growth media containing 2
µg/ml Tet and cultured for 48 h in the absence of selection
agents. Following this recovery period, the transfected cells were
washed, resuspended in media containing Tet (2 µg/ml), G418 sulfate
(500 µg/ml), and hygromycin B (300 µg/ml) and aliquoted into
96-well plates at 1 x 104 cells/well. From
2 wk posttransfection, selected colonies were picked, transferred to
selective media, and further expanded. To test for inducible expression
of the CD2:SHIP constructs, clones were washed and incubated for
24 h in media in the presence and absence of Tet, and cell lysates
immunoblotted with the anti-rat CD2 mAb OX34.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous work has shown that the Jurkat leukemic T cell line is
deficient in both SHIP and PTEN at the protein level (25, 26). However, it is not clear whether the lack of SHIP and PTEN
protein expression is a feature peculiar to the Jurkat line, or whether
it is a feature shared by all T leukemic cell lines. Using RT-PCR
analysis, we have shown that both SHIP and PTEN mRNA are constitutively
expressed in PBLs and the Jurkat, CEM, MOLT-4, and HUT78 cell lines
(Fig. 1
A). Equivalent levels
of mRNA were used in each sample as verified by parallel
amplification of the housekeeping gene -actin. Reverse
transcriptase reactions performed in the absence of reverse
transcriptase enzyme verfied that there was no contamination of the RNA
samples with DNA. Immunoblotting of cell lysates with anti-SHIP and
anti-PTEN mAbs (Fig. 1B) confirmed that Jurkat cells
contained no detectable protein for either SHIP or PTEN. Interestingly,
MOLT-4 and CEM cells contained protein for SHIP, but contained no
detectable levels of PTEN. In contrast, PBLs and HUT-78 cells were
positive for the expression of both SHIP and PTEN at the protein
level.
|
Previous evidence has shown that SHIP is a downstream target
following ligation of either CD3 or CD28 in murine hybridoma T cells
(13). Having confirmed protein expression of SHIP in
MOLT-4 and CEM cells, we investigated whether it was also a target for
receptor-activated PTKs in these cells. Accordingly, stimulation of CEM
and MOLT-4 cells with anti-CD28 mAb 9.3 or anti-CD3 mAb UCHT1
resulted in a large increase in SHIP tyrosine phosphorylation compared
with unstimulated controls (Fig. 1
C). These data suggest
that the SHIP expressed in CEM and MOLT-4 is a target for
receptor-activated protein tyrosine kinases.
Comparison of basal and receptor-stimulated levels of 3'phosphorylated PI lipids in leukemic T cells and PBLs
In view of the differing expression of lipid phosphatases, we
hypothesized that accumulation of basal and stimulated levels of D-3 PI
lipids may vary between cell types. Indeed, the leukemic T cell lines
exhibited interesting differences in their relative
PI(3, 4, 5)P3:PI(3, 4)P2
ratios under basal conditions (Table I, column
3). Thus, Jurkat cells
(PTEN-/SHIP-)
consistently exhibited a high basal level of
PI(3, 4, 5)P3 relative to
PI(3, 4)P2, compared with both CEM
(PTEN-/SHIP+) and MOLT-4
cells (PTEN-/SHIP+). In
contrast, a much lower
PI(3, 4, 5)P3:PI(3, 4)P2 ratio
was observed in both CEM and MOLT-4 cells compared with Jurkat cells,
suggesting that SHIP-1 expressed in these cells may be able to at least
partially influence the PI(3, 4, 5)P3 accumulation
in the absence of PTEN expression. This notion was further enhanced by
the observation that very low basal levels of
PI(3, 4, 5)P3 were present in HUT78 cells
(PTEN+/SHIP-1+), while
levels of PI(3, 4)P2 were negligible.
|
15 times above basal levels (Table I, column 8). A small
increase in PI(3, 4)P2 levels was also observed.
Ligation of CD28 resulted in marked elevation of both
PI(3, 4, 5)P3 and PI(3, 4)P2
in CEM cells and MOLT-4 cells. Both cell lines exhibited a similar
PI(3, 4, 5)P3:PI(3, 4)P2 ratio
that was some 20-fold less than that observed for Jurkat cells. This
lower ratio indicates that the relative levels of
PI(3, 4)P2 are much greater in CEM and MOLT-4
compared with Jurkat cells. Ligation of CD28 induced marked
accumulation of PI(3, 4, 5)P3 in HUT78 cells (Table I, columns 4 and 5). Surprisingly, we could detect little or no
PI(3, 4)P2 in this cell line which may reflect the
efficient removal of this lipid by the combined phosphatase action of
PTEN and SHIP-1. Differential expression of lipid phosphatases correlates with PKB phosphorylation levels
The interaction of the PH domain of PKB with
PI(3, 4, 5)P3 and PI(3, 4)P2
plays an important role in the phosphorylation of PKB at
Thr308 and Ser473,
resulting in its subsequent activation (2). Given the
differences seen in regulation of PI(3, 4, 5)P3 and
PI(3, 4)P2 between the cell lines, we sought to
correlate lipid phosphatase expression with PKB phosphorylation in
these cell lines. Immunoblotting using Abs specific to PKB
phosphorylated at Ser473
(pPKBser473) was performed. This revealed that
Jurkat cells have very high levels of basal
pPKBser473 (Fig. 2A), reflecting the high basal
levels of PI(3, 4, 5)P3 measured in vivo and
confirming previous observations from ourselves and others (25, 26). Stimulation of Jurkat cells via CD28 or CD3 did not show an
increase in pPKBser473 levels, probably
indicating that PI3K/PKB signaling is at or near to saturation levels
(Fig. 2B, lanes 8 and 9). However, in
marked contrast, both CEM and MOLT-4 cells exhibited comparatively
lower constitutive levels of pPKBser473 (Fig. 2A). PKB phosphorylation could be further enhanced by
ligation of either CD28 or CD3 in both MOLT-4 and CEM cells (Fig. 2B, lanes 8 and 9), suggesting that
basal pPKBser473 is not saturated in these cells.
Remarkably, no constitutive pPKBser473 levels
could be detected in HUT78 cells or PBLs (Fig. 2A). However,
ligation of CD28 elicited a marked phosphorylation of PKB in both cell
types (Fig. 2B, lane 9). CD3 was also able to
elicit a strong phosphorylation of PKB in PBLs, but in HUT78 cells the
lack of effect of CD3 ligation on PKB phosphorylation (Fig. 2B, lane 8) correlated with our inability to
detect CD3 expression in HUT78 cells by flow cytometry (data not
shown).
|
The ability of active PI3K to sustain PKB membrane localization
and phosphorylation is dependent on its catalytic activity and the
generation of PI(3, 4, 5)P3 and/or
PI(3, 4)P2 (2). Therefore, PKB
phosphorylation is an indicator of the membrane levels of these lipids.
PI3K inhibitors are slow to terminate PKB activation in Jurkat cells
(Fig. 2B), reflecting that constitutive levels of
PI(3, 4, 5)P3 formed before addition of the
inhibitor are maintained at levels sufficient to promote
phosphorylation of PKB (25, 26). In contrast, the rate at
which pPKBser473 phosphorylation is terminated in
the presence of LY294002 in MOLT4 and CEM cells was much more rapid
than observed in Jurkat cells (Fig. 2B, lanes
1–7). This data suggests that both MOLT4 and CEM cells possess
more efficient mechanisms for the removal of
PI(3, 4, 5)P3.
Expression of membrane-localized SHIP-1 in Jurkats
To verify that SHIP-1 expression could indeed influence
constitutive levels of 3'-phosphorylated PI lipids, we constructed a
chimeric protein which contains the phosphatase core of SHIP-1 fused to
the extracellular/transmembrane region of rat CD2 (CD2:SHIP). The
resulting membrane-localized SHIP catalytic domain was predicted to be
a constitutively active 5'-inositol phosphatase. The phosphatase
activity of the expressed CD2:SHIP protein was confirmed using an in
vitro assay of OX34 immunoprecipitates of cell lysates derived from
Jurkat cells transiently transfected with the CD2:SHIP construct (Fig. 3A). The assays revealed
robust catalytic activity in these immunoprecipitates that was
comparable to the activity present in SHIP immunoprecipitates derived
from a murine lymphoma B cell line A20. As a negative control, Jurkat
cells were also transiently transfected with
CD2:C701ASHIP which was predicted to be a
catalytic inactive mutant based on previous observations (30, 31). Our data suggest that this mutant retains some activity, at
least in vitro, although it is at least 10-fold less active than the
CD2:SHIP protein.
|
B shows Tet-regulated expression in independent Jurkat
clones for both CD2:SHIP (clones 1–3) and
CD2:C701ASHIP (clones 4–6). Whole-cell lysates
were Western blotted to show regulated protein expression of CD2:SHIP
(Fig. 3B, upper panel) following overnight
culture of the cells with and without Tet. Blots were stripped and
reprobed with anti-SHP-2 Ab to show similar protein amounts in
all lanes (Fig. 3B, lower panel).
Subsequent experiments were performed using clones 1–6, with
representative data from one clone shown in each case.
The effect of Tet-regulated expression of the CD2:SHIP construct on the
in vivo levels of 3'-phosphorylated PI lipids was investigated under
resting and stimulated conditions. Hence, control empty vector clones,
CD2:SHIP clone 2, and the CD2:C701ASHIP clone 4
Jurkats were cultured overnight in the absence of Tet accompanied by
the metabolic labeling of intact cellular pools of ATP with
32P. It should be noted that the
PI(3, 4, 5)P3:PI(3, 4)P2 ratio
under basal and stimulated conditions, when using the Tet-Off Jurkat
cells, was markedly different to that observed for the Jurkat cells
used in Table I. The reasons for these differences are not clear but
may reflect clonal variations in the Jurkat cell line. Evidently,
Tet-Off Jurkats are less efficient at labeling of their PI lipids,
which may be a consequence of the gene expression systems used in these
cells. Nevertheless, CD28 stimulated a large increase in
PI(3, 4, 5)P3 compared with basal levels in all
clones following CD28 stimulation (Table II, columns 1 and 4). A sharp increase in
PI(3, 4)P2 levels following CD28 stimulation is
only seen in the CD2:SHIP clone as PI(3, 4)P2
levels remain constant in the empty vector clone. These data confirm
that CD2:SHIP is acting as a constitutively active 5' inositol
phosphatase. CD28 also stimulates a modest increase in
PI(3, 4)P2 levels in
CD2:C701ASHIP-expressing cells, albeit to a much
lesser extent than observed in the CD2:SHIP-expressing cells. This
confirms our previous observation from in vitro assays, that the
CD2:C701ASHIP is not completely phosphatase
inactive.
|
The effect of CD2:SHIP expression on CD28-stimulated PKB
phosphorylation was examined. Fig. 4A shows Tet-controlled
expression of CD2:SHIP clone 2 (Fig. 4A, top
panel). In the presence of Tet, no CD2:SHIP protein is
expressed and high constitutive levels of
pPKBser473 are seen (Fig. 4A,
middle panel), similar to those observed earlier in
untransfected Jurkat cells. Stimulation of the cells via CD28 has
little effect on pPKBser473 in the absence of
CD2:SHIP expression (Fig. 4A, middle panel).
However, removal of Tet leads to CD2:SHIP expression (Fig. 4A, top panel), and a major reduction in basal
levels of pPKBser473 (Fig. 4A,
middle panel). Under these conditions of CD2:SHIP expression
and low basal pPKBser473, CD28 ligation
stimulates a robust increase in PKB phosphorylation that is detectable
after 5 min. CD28-stimulated PKBser473
phosphorylation is maintained for up to 45 min and is comparable with
the saturated levels of PKB phosphorylation observed in the absence of
CD2:SHIP expression. Expression of the impaired phosphatase
CD2:C701ASHIP clone 4 (Fig. 4B,
top panel) had no effect on basal PKB phosphorylation and it
was not possible to detect increases in PKB phosphorylation after CD28
ligation in CD2:C701ASHIP-expressing cells (Fig. 4B, middle panel).
|
It is well accepted that PH domain-mediated membrane localization
of PKB is a crucial step in its phosphorylation and activation. Having
established that basal PKB phosphorylation and activation correlated
closely with the expression of SHIP-1 and/or PTEN, we next investigated
whether the expression of CD2:SHIP correlated with changes in
localization of PKB. The PH domain of PKB was expressed with a GFP tag
and transfected into the T cell lines (Fig. 5A). Under basal conditions, a
distinct membrane localization of PKB is seen in Jurkat and CEM cells
although some cytosolic PKB is also evident in the CEM cells. Equal
membrane and cytosolic cellular distribution of PKB is observed in
HUT78 (SHIP-1+/PTEN+)
cells. A GFP-PKB mutant PH domain, which is unable to bind
PI(3, 4, 5)P3 or PI(3, 4)P2
due to a single amino acid substitution (R25C), showed uniform cellular
distribution in all cell lines, confirming the membrane localization
seen in Jurkat and CEM cells is due to a specific binding of the PH
domain with 3'-phosphorylated PI lipids and is not due to nonspecific
GFP localization.
|
B) similar to that seen in untransfected Jurkats
(Fig. 5A). However, expression of CD2:SHIP was sufficient to
substantially reduce membrane association of GFP-PKB-PH and increase
cytosolic localization, while expression of the phosphatase inactive
CD2:C701ASHIP had no effect on PKB-PH domain
cellular localization. No differences in cellular localization were
seen with the PKB-PH domain mutant in either clone.
The effect of CD28 stimulation on PKB cellular localization was also
examined (Fig. 5C). In the presence of Tet, the distinct
membrane localization of GFP-PKB-PH seen under basal conditions is
maintained after CD28 stimulation for at least 15 min in both the
CD2:SHIP clone (Fig. 5C, top panels)
and CD2:C701ASHIP clone (data not shown).
Expression of CD2:SHIP again led to decreased membrane association of
GFP-PKB-PH under basal conditions and was sustained after 2 min of CD28
stimulation. After 5-min of CD28 stimulation, increased membrane
localization of GFP-PKB-PH was seen with a distinct membrane
localization of GFP-PKB-PH visible in the CD2:SHIP clone after 15 min
of CD28 stimulation. Expression of CD2:C701ASHIP
had no effect on GFP-PKB-PH cellular localization (data not shown).
These data correlate well with the PKB phosphorylation time course
shown in Fig. 4 and show that CD2:SHIP is able to decrease both the
constitutive membrane localization and phosphorylation of PKB. However,
it is unable to prevent either event after sustained (e.g., 5 min or
longer) CD28 stimulation. Data from the
CD2:C701ASHIP clones imply that the phosphatase
activity of CD2:SHIP is essential for these changes.
Basal and receptor-stimulated cellular localization of a PI(3, 4)P2-specific PH domain in T cell lines
The recent discovery of adapter proteins with PH domains specific
for PI(3, 4)P2 has raised the possibility that
SHIP-1 may not just function as a negative regulator of PI3K
signaling but may "shunt" signaling toward
PI(3, 4)P2-specific pathways. The
PI(3, 4)P2-specific C-terminal PH domain of the
adapter protein TAPP-1 tagged with GFP was used to study potential
functional consequences of differing PI(3, 4)P2
levels in the various cell lines. Jurkat cells showed uniform cellular
distribution of GFP-TAPP-PH domain in unstimulated cells, with no
significant changes seen after CD28 stimulation. However, a slight
membrane localization of GFP-TAPP-PH was seen in unstimulated CEM
cells, which greatly increased following CD28 stimulation (Fig. 6A). A TAPP-1 PH domain
containing an arginine to leucine substitution at aa 212 (R212L), which
has greatly reduced affinity for PI(3, 4)P2, did
not show membrane localization in any cell type after CD28 stimulation.
Cellular localization of GFP-TAPP-PH domain was examined in the Jurkat
clones expressing CD2:SHIP and CD2:C701ASHIP
(Fig. 6B). In either the absence or presence of CD2:SHIP
expression, an even cellular distribution of GFP-TAPP-PH was observed
in unstimulated cells. However, ligation of CD28 stimulated a robust
membrane localization of the GFP-TAPP-PH domain in the presence (but
not in the absence) of CD2:SHIP expression. No cellular localization
was seen in the presence or absence of
CD2:C701ASHIP in either unstimulated or
CD28-stimulated cells (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Given that PTEN is one of the most commonly mutated genes in human cancer, with >330 somatic point mutations reported in primary metastasis, it is not surprising that its expression is aberrant in a number of human cell lines. In Jurkat cells, several mutations causing premature stop codons have been described which result in truncated proteins that are highly unstable and rapidly degraded (26, 32). In this study, we have demonstrated mRNA expression of both PTEN and SHIP-1 in all the T cell lines investigated, but were unable to show any SHIP-1 protein expression in Jurkat cells or PTEN protein expression in CEM, MOLT-4, and Jurkat cells. The identification of an intronless PTEN pseudogene (33, 34) raises the possibility of genomic DNA contamination, but controls used in this study make it more likely that CEM and MOLT-4 cells contain mutation in the PTEN gene which results in altered protein expression/stability. Mutation of the PTEN gene in CEM cells has been described previously by Sakai et al. (32), but the same study failed to find any alterations in MOLT-4 cells, although this may reflect limited efficiency of the mutation detection system used in this study (33, 35). The inability to detect SHIP-1 protein expression in Jurkat cells despite the presence of mRNA may be due to a similar gene mutation as PTEN. The PCR fragment amplified in this study only covers the catalytic core of SHIP-1; therefore, the possibility of truncated SHIP-1 mRNA transcripts being present cannot be dismissed. Also, the identification of different-sized isoforms of SHIP-1 due to alternative splicing and specific proteolytic degradation from the C-terminal end (36, 37) raises the possibility of Jurkat cells expressing an isoform of SHIP not detected in our study. However, data derived from the lipid labeling experiments support the lack of a functional 5' inositol phosphatase in Jurkat cells. PKB has previously been reported to be overexpressed in several carcinomas (38, 39). Therefore, it will be interesting to investigate whether lack of expression of lipid phosphatases and the resultant dysregulated PKB activity that is observed in T cell leukemic cell lines is also reflected in primary T cell leukemias.
There are several lines of evidence provided by this study which collectively suggest that active SHIP-1 contributes to degradation of PI(3, 4, 5)P3. First, SHIP-1 is expressed by both CEM and MOLT-4 cells, which have high basal levels of PI(3, 4)P2 compared with SHIP-deficient Jurkat cells. Because these CEM and MOLT-4 cells also lack PTEN, PI(3, 4)P2 is at greater levels than would be seen in cells with an active 3'-inositol phosphatase such as HUT78 cells. Second, in CEM and MOLT-4 cells, PKB phosphorylation is unsaturated and terminated faster by PI3K inhibition compared with Jurkat cells, suggesting that cells which express SHIP possess more efficient mechanisms for the removal of PI(3, 4, 5)P3. Although this notion fits well with the expression of SHIP-1 in CEM and MOLT-4, other factors may influence the observed differential rate of termination of PKB phosphorylation in these cells. For instance, there may be different expression of PKB-specific phosphatases. However, it is important to note that expression of a constitutively active SHIP protein in Jurkat cells is sufficient to reduce PKB phosphorylation below saturation levels and relocalizes GFP-tagged PKB PH domains from the plasma membrane to the cytosol.
Results from this study may shed some light on the controversy surrounding the model of PKB activation, concerning whether PI(3, 4)P2 or PI(3, 4, 5)P3 is the critical messenger that attracts PKB and its kinases to the plasma membrane in vivo. Although the PH domain of PKB has been reported to have dual specificity for both PI(3, 4, 5)P3 and PI(3, 4)P2 (5, 6), there are also substantial in vitro data suggesting that PI(3, 4)P2 has a higher affinity than PI(3, 4, 5)P3 for PKB (40, 41, 42). Also, the addition of di-C16-PI(3, 4)P2 to serum-starved NIH3T3 cells stimulates PKB autophosphorylation, while di-C16-PI(3, 4, 5)P3 causes slight inhibition (40). Studies in platelets have also shown that PKB activation correlates with PI(3, 4)P2 rather than PI(3, 4, 5)P3 production following thrombin stimulation (40), while integrin cross-linking has been reported to generate PI(3, 4)P2 but not PI(3, 4, 5)P3, yet still results in PKB activation (43). More recently, it has been suggested that PI(3, 4)P2 is essential for phosphorylation of PKB at Ser473 (44). Our data do not entirely rule out the possibility that low levels of PI(3, 4)P2 detected in the leukemic cell lines may be sufficient to influence PKB activation. However, it does appear that a high ratio of PI(3, 4, 5)P3 relative to PI(3, 4)2 favors PKB activation in T cells, given the robust membrane localization of the PKB-PH domain in unstimulated Jurkats. Importantly, the expression of a constitutively active SHIP protein in Jurkat cells caused large increases in PI(3, 4)P2 levels that correlated with a reduction in Ser473 phosphorylation and relocalization of GFP-tagged PKB PH domains from the plasma membrane to the cytosol. These data correlate well with observations from CEM and MOLT-4 cells that express SHIP-1 and generally exhibit much higher levels of PI(3, 4)P2 than Jurkat cells under both resting and stimulated conditions, but exhibit constitutive phosphorylation of PKB well below saturation levels.
It is important to emphasize that while expression of constitutively active SHIP was able to decrease both constitutive PKBser473phosphorylation and GFP-tagged PKB PH domain plasma membrane localization, neither response is abrogated following prolonged CD28 stimulation. Thus, stimulation of cells expressing CD2:SHIP with anti-CD28 Ab for longer than 5 min led to levels of PKBser473 phosphorylation similar to the saturated levels observed in the absence of CD2:SHIP expression. A distinct membrane localization of PKB was also seen after >5 min of CD28 stimulation despite expression of CD2:SHIP. The reason why CD28-stimulated PKB phosphorylation approaches saturated levels even in the presence of an active SHIP mutant is probably because CD28 stimulates PI(3, 4, 5)P3 formation in excess of the ability of membrane-localized CD2:SHIP to remove it. These observations correlate well with recent evidence from Xu et al. (45), who reported that inducible expression of PTEN in Jurkat cells was able to significantly reduce basal PKBser473 phosphorylation and PKB membrane localization, but was unable to eliminate phosphorylation of PKB following TCR ligation. In this regard, it should be remembered that under physiological conditions, both SHIP and PTEN probably contribute to the regulation of CD28-stimulated PI(3, 4, 5)P3.
The use of a PI(3, 4)P2-specific PH domain also allowed us to demonstrate in vivo the effect of SHIP-1 not only as a negative regulator of PI(3, 4, 5)P3-mediated signaling, but also as a positive regulator of TAPP-1 binding and membrane localization. Stimulation of CEM cells with CD28 was required to cause major membrane localization of the TAPP PH domain despite high basal levels PI(3, 4)P2. Similarly, Jurkat cells expressing CD2:SHIP also required CD28 stimulation before membrane localization of the TAPP PH domain was observed. However, the TAPP-1 C-terminal PH domain used in this study has a 5-fold lower affinity for PI(3, 4)P2 than full-length TAPP-1 (7), and therefore, basal PI(3, 4)P2 in CEM and CD2:SHIP expressing Jurkat cells may exist below the threshold levels required to support PH domain binding and constitutive membrane localization. The biological role of the adapter proteins remains obscure. The last three residues of TAPP-1 and TAPP-2 conform to the minimal sequence motif required for binding to a PDZ domain, and both TAPP-1 and TAPP-2 have recently been reported to interact through their C-terminal residues with a multi-PDZ-containing protein termed MUPP1 (46). Therefore, further work to elucidate the pathways influenced by TAPP is required, but its role in T cell signaling may be easily unraveled with the use of the CEM and MOLT-4 cell lines.
The data presented in this study suggest that SHIP-1 does make an important contribution to the control of PI(3, 4, 5)P3 levels in situations where PTEN is not expressed. The reason why SHIP-1-/- mice (18, 19, 20) exhibit a much less severe T cell phenotype than T cells from PTEN-/+ mice (22, 23, 24) is not clear. However, it is important to note that while the CD2:SHIP mutant increased PI(3, 4)P2, it also actually resulted in slightly enhanced levels of PI(3, 4, 5)P3. The reason for this is not clear, but may reflect increased activity of proximal lipid kinases which act to replenish PI(3, 4, 5)P3. This finding may provide an important clue to the relative roles of SHIP-1. That is to say PTEN may function as the "work horse" phosphatase that provides general clearance of active signaling moieties such as PI(3, 4, 5)P3 that is essential for general homeostasis. In contrast, SHIP-1 may function in a much more subtle way, and in this respect, it is interesting to note that SHIP-1 has been proposed to play a gatekeeper role in IgE-mediated mast cell degranulation by setting the threshold for and limiting the degranulation process (21, 47). Thus, SHIP-1 may function more as a gatekeeper of spatio-temporal signaling after receptor activation in T lymphocytes, shunting signal transduction pathways away from PI(3, 4, 5)P3-dependent effectors toward PI(3, 4)P2-dependent effectors.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Stephen G. Ward, Department of Pharmacy and Pharmacology, University of Bath, Claverton Down, Bath, BA2 7AY, U.K. E-mail address: S.G.Ward{at}bath.ac.uk
3 Abbreviations used in this paper: SHP-2, Src homology 2 domain containing protein tyrosine phosphatase; PI3K, phosphoinositide 3-kinase; PI, phosphoinositide; GFP, green fluorescent protein; PH, pleckstrin homology; PI(3,4)P2, phosphatidylinositol 3,4-bisphosphate; PI(3,4,5)P3, phosphatidylinositol 3,4,5-trisphosphate; PKB, protein kinase B; PTEN, phosphatase and tensin homolog deleted on chromosome ten; SHIP, Src homology 2 domain containing inositol polyphosphate phosphatase; SHP-2, Src homology 2 domain containing protein tyrosine phosphatase; TAPP, tandem PH domain-containing protein; Tet, tetracycline.
Received for publication June 10, 2002. Accepted for publication September 11, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RIIB. Nature 383:263.
subunit common to the GM-CSF, IL-3 and IL-5 receptors is highly polymorphic but pathogenic point mutations in patients with acute myeloid leukemia (AML) are rare. Leukemia 10:123.[Medline]
This article has been cited by other articles:
|
|
 |
|
  Y. Yamanaka, H. Tagawa, N. Takahashi, A. Watanabe, Y.-M. Guo, K. Iwamoto, J. Yamashita, H. Saitoh, Y. Kameoka, N. Shimizu, et al. Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia Blood, October 8, 2009; 114(15): 3265 - 3275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Firaguay and J. A. Nunes Analysis of Signaling Events by Dynamic Phosphoflow Cytometry Sci. Signal., September 1, 2009; 2(86): pl3 - pl3. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Denley, M. Gymnopoulos, S. Kang, C. Mitchell, and P. K. Vogt Requirement of Phosphatidylinositol(3,4,5)Trisphosphate in Phosphatidylinositol 3-Kinase-Induced Oncogenic Transformation Mol. Cancer Res., July 1, 2009; 7(7): 1132 - 1138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Beneteau, M. Pizon, B. Chaigne-Delalande, S. Daburon, P. Moreau, F. De Giorgi, F. Ichas, A. Rebillard, M.-T. Dimanche-Boitrel, J.-L. Taupin, et al. Localization of Fas/CD95 into the Lipid Rafts on Down-Modulation of the Phosphatidylinositol 3-Kinase Signaling Pathway Mol. Cancer Res., April 1, 2008; 6(4): 604 - 613. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Harris, R. V. Parry, J. Westwick, and S. G. Ward Phosphoinositide Lipid Phosphatases: Natural Regulators of Phosphoinositide 3-Kinase Signaling in T Lymphocytes J. Biol. Chem., February 1, 2008; 283(5): 2465 - 2469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tarasenko, H. K. Kole, A. W. Chi, M. M. Mentink-Kane, T. A. Wynn, and S. Bolland T cell-specific deletion of the inositol phosphatase SHIP reveals its role in regulating Th1/Th2 and cytotoxic responses PNAS, July 3, 2007; 104(27): 11382 - 11387. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dong, B. Corre, E. Foulon, E. Dufour, A. Veillette, O. Acuto, and F. Michel T cell receptor for antigen induces linker for activation of T cell-dependent activation of a negative signaling complex involving Dok-2, SHIP-1, and Grb-2 J. Exp. Med., October 30, 2006; 203(11): 2509 - 2518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Buckler, P. T. Walsh, P. M. Porrett, Y. Choi, and L. A. Turka Cutting Edge: T Cell Requirement for CD28 Costimulation Is Due to Negative Regulation of TCR Signals by PTEN J. Immunol., October 1, 2006; 177(7): 4262 - 4266. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Ooms, C. G. Fedele, M. V. Astle, I. Ivetac, V. Cheung, R. B. Pearson, M. J. Layton, A. Forrai, H. H. Nandurkar, and C. A. Mitchell The Inositol Polyphosphate 5-Phosphatase, PIPP, Is a Novel Regulator of Phosphoinositide 3-Kinase-dependent Neurite Elongation Mol. Biol. Cell, February 1, 2006; 17(2): 607 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. V. Parry, G. C. Whittaker, M. Sims, C. E. Edmead, M. J. Welham, and S. G. Ward Ligation of CD28 Stimulates the Formation of a Multimeric Signaling Complex Involving Grb-2-Associated Binder 2 (Gab2), Src Homology Phosphatase-2, and Phosphatidylinositol 3-Kinase: Evidence That Negative Regulation of CD28 Signaling Requires the Gab2 Pleckstrin Homology Domain J. Immunol., January 1, 2006; 176(1): 594 - 602. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R.-i. Fukuda, A. Hayashi, A. Utsunomiya, Y. Nukada, R. Fukui, K. Itoh, K. Tezuka, K. Ohashi, K. Mizuno, M. Sakamoto, et al. Alteration of phosphatidylinositol 3-kinase cascade in the multilobulated nuclear formation of adult T cell leukemia/lymphoma (ATLL) PNAS, October 18, 2005; 102(42): 15213 - 15218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. Tomlinson, V. L. Heath, C. W. Turck, S. P. Watson, and A. Weiss SHIP Family Inositol Phosphatases Interact with and Negatively Regulate the Tec Tyrosine Kinase J. Biol. Chem., December 31, 2004; 279(53): 55089 - 55096. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ikehara, S. K. Ikehara, and J. C. Paulson Negative Regulation of T Cell Receptor Signaling by Siglec-7 (p70/AIRM) and Siglec-9 J. Biol. Chem., October 8, 2004; 279(41): 43117 - 43125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Huang and R. L. Wange T Cell Receptor Signaling: Beyond Complex Complexes J. Biol. Chem., July 9, 2004; 279(28): 28827 - 28830. [Full Text] [PDF]
|
|
|
|
|
|
D. G. Cronshaw, C. Owen, Z. Brown, and S. G. Ward Activation of Phosphoinositide 3-Kinases by the CCR4 Ligand Macrophage-Derived Chemokine Is a Dispensable Signal for T Lymphocyte Chemotaxis J. Immunol., June 15, 2004; 172(12): 7761 - 7770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Bensinger, P. T. Walsh, J. Zhang, M. Carroll, R. Parsons, J. C. Rathmell, C. B. Thompson, M. A. Burchill, M. A. Farrar, and L. A. Turka Distinct IL-2 Receptor Signaling Pattern in CD4+CD25+ Regulatory T Cells J. Immunol., May 1, 2004; 172(9): 5287 - 5296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Krahn, K. Ma, S. Hou, V. Duronio, and A. J. Marshall Two Distinct Waves of Membrane-Proximal B Cell Antigen Receptor Signaling Differentially Regulated by Src Homology 2-Containing Inositol Polyphosphate 5-Phosphatase J. Immunol., January 1, 2004; 172(1): 331 - 339. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Curnock, Y. Sotsios, K. L. Wright, and S. G. Ward Optimal Chemotactic Responses of Leukemic T Cells to Stromal Cell-Derived Factor-1 Requires the Activation of Both Class IA and IB Phosphoinositide 3-Kinases J. Immunol., April 15, 2003; 170(8): 4021 - 4030. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
