|
|
||||||||

TCR Derived from a Polymyositis Lesion1




* Max Planck Institute of Neurobiology, Martinsried, Germany;
Institute for Clinical Neuroimmunology, Klinikum Gro
hadern, Ludwig Maximilians University, Munich, Germany;
Max Planck Institute for Immunobiology, Freiburg, Germany; and
Department of Neurology, University of Tübingen, Tübingen, Germany
| Abstract |
|---|
|
|
|---|

T cells in human autoimmune
disease we expressed and characterized a 
TCR from an autoimmune
tissue lesion. The TCR was first identified in a rare form of
polymyositis characterized by a monoclonal infiltrate of 
T cells
which invaded and destroyed skeletal muscle fibers. The
V
1.3-J
1-C
1/V
2-J
3 TCR cDNA of the original muscle
invasive 
T cell clone was reconstructed from unrelated cDNA and
transfected into the mouse hybridoma
BW58
-
-. Appropriate anti-human

TCR Abs stimulated the TCR transfectants to produce IL-2, thus
demonstrating that the human 
TCR functionally interacted with
murine signaling components. The transfected V
1.3/V
2 TCR
recognized a cytosolic protein expressed in cultured human myoblasts
and TE671 rhabdomyosarcoma cells. The Ag was recognized in the absence
of presenting cells. Using a panel of control 
TCR transfectants
with defined exchanges in different positions of both TCR chains, we
showed that the 
TCR recognized its Ag in a TCR
complementarity-determining region 3-dependent way. To our knowledge,
this is the first example of a molecularly defined 
TCR directly
derived from an autoimmune tissue lesion. The strategy used in this
study may be applicable to other autoimmune
diseases. | Introduction |
|---|
|
|
|---|
To our knowledge, these two postulates have not yet been met by any
human autoimmune disorder. For example, TCR-
and
chains have
been cloned from whole polyclonal infiltrates of multiple sclerosis
brain lesions (1), but the T cells from which these
sequences were derived were not characterized morphologically, nor was
it possible to relate the corresponding TCR-
and
chains in these
polyclonal infiltrates. Very recently, single-cell PCR techniques have
allowed the amplification of rearranged TCR genes from morphologically
defined T cells, but thus far, it has only been possible to identify
the TCR-
chains from genomic DNA of single infiltrating T cells
(2).
We report on the reconstruction and functional expression of the TCR of
a 
T cell clone first identified in a rare form of polymyositis
(3). Our paradigm offers two significant advantages that
help meet the above postulates. First, there is strong morphological
evidence for a direct pathogenic contribution of the 
T cells,
and second, the putatively autoaggressive 
T cells are
essentially monoclonal, thus allowing the identification of both chains
of their TCR.
The form of polymyositis in our patient was characterized by severe
mononuclear infiltrates in skeletal muscle tissue. Numerous muscle
fibers were surrounded and deeply invaded by
CD4-CD8- 
T cells,
which exclusively expressed an unusual V
1.3 and V
2 combination
(Fig. 1
; Ref. 4). In the
present study, we reconstructed the complete sequences of both
receptor chains of the muscle invasive 
T cell clone and
functionally expressed them in a mouse lymphoma line lacking intrinsic
TCR expression. The V
1.3/V
2 receptor recognized a
muscle-associated protein in a complementarity-determining region
(CDR)33-dependent,
MHC-nonrestricted way.
|
| Materials and Methods |
|---|
|
|
|---|
TE671 human rhabdomyosarcoma and LTK-
mouse fibroblasts were obtained from American Type Culture Collection
(Manassas, VA). The following Abs were used (all anti-TCR Abs were
directed against human molecules): anti-pan-
, IMMU510;
anti-V
1.3, 23D12; anti-V
2, IMMU389; anti-V
9,
IMMU360; anti-V
1, R9.12; and anti-V
9, FIN9 were from
Immunotech (Marseille, France); anti-mouse-CD3
, 145-2C11; and
anti-CD56 (neural cell adhesion molecule), MY31 were from BD
PharMingen (San Diego, CA). As secondary Ab we used the
dichlorotriazinyl-fluoresceine (DTAF)-labeled goat-anti-mouse
F(ab')2 115-016-068 (Dianova, Hamburg, Germany).
The myelin basic protein (MBP) peptide
MBP139151 (KGFKGVDAQGTLS) was synthesized by
F-moc chemistry and purified by HPLC. Integrity was verified by mass
spectrometry. Polymyositis and connective tissue disease-associated
Ags, which normally are used for Ab detection in patient sera, were
obtained from Varelisa ReCombi kit (Pharmacia & Upjohn, Freiburg,
Germany). Titin was kindly donated by S. Labeit (European Molecular
Biology Laboratory, Heidelberg, Germany).
Reconstruction of the muscle invasive 
TCR
In Table I
, the sequences of the
previously described
- and
-chains
(V
1.3-J
1-C
1/V
2-J
3-C
; nomenclature used in this study
V
1.3+V
2+) from the
muscle invasive TCR clone (4) and control chains are
listed (the
-chain, now designated V
1.3, has formerly been
designated as V
3). Because no original material of the patient was
accessible anymore and only a cDNA fragment of the
-chain was left
(received from Dr. G. Pluschke, Swiss Tropical Institute, Basel,
Switzerland), we reconstructed the rest of the
-chain and the
full-length sequence of the
-chain by PCR using lymphocyte cDNA of
unrelated donors as template. Missing or inappropriate base pairs were
corrected by site-directed mutagenesis. All constructs were verified by
full-length sequencing in both directions.
|
-chain (V
1.3(GV1S3A1N1T)-J
1-C
1) was reconstructed from
two DNA fragments as PCR templates. One was a TCR-
chain PCR product
of the original cDNA covering the V-, J-, and parts of the C-region.
The second was unrelated lymphocyte cDNA. Three fragments were derived
from those two templates by PCR and subsequently ligated for
full-length reconstruction of the
-chain. The following three primer
pairs were used: V
1.3-SalI-for
(5'-GATGTCGACATGCGGTGGGCCCTAGCGGTGCTTCTAGCTTTCCTGTCTC) and
V
-Bsi-rev (5'-GCACAGTAATAGACTCCGGAATCATTTTC),
V
-Bsi-for (5'-GAAAATGATTCCGGAGTCTATTACTGTGC) and
C
-Aat-rev (5'-GCTTGGGGGAGACGTCTGCATC), and
C
-Aat-for (5'-GATGCAGACGTCTCCCCCAAGC) and
C
-BglII-rev (5'-GGAAGATCTTTATGATTTCTCTCCATTGC). The
fragments were ligated via BsiMI and AatII
restriction sites and inserted into pRSVneo via SalI and
BglII.
The
-chain (DV102S1A1T, V
2-J
3-C
) was reconstructed from two
unrelated lymphocyte cDNA using the primer pairs
V
2-SalI-for (5'-GATGTCGACATGCAGAGGATCTCCTCCC) and
nDn-V
2-Kpn-rev
(5'-GAGGTACCCCAGACAGTGTCACAGGCACAGTAGTAAG),
nDn-V
2-Kpn-for
(5'-TGGGGTACCTCAAAGAGCTCCTGGGACACCCGACAGATG) and
C
-BamHI-rev (5'-CGCGGATCCTTACAAGAAAAATAACTTGGC).
After digestion with SalI, KpnI, and
BamHI, the two
-chain fragments and the expression vector
pRSVhygro were ligated.
Mutated control TCR chains
To confirm Ag specificity of the muscle invasive 
TCR,
-,
-,
-, and
-control chains were cloned 1) from the human
T cell line BBC9
(V
22+V
9+ TCR), which
recognizes the MBP peptide 139151 in the context of HLA-DRB1*0101 and
-DRB5*0101 (5); 2) from unrelated cDNA; or 3) were
established by mutagenesis from the
- and
-chains described above
and cloned into pRSVneo or pRSVhygro. The amino acid sequences of all
- and
-chains are given in Table I
. Amino acids differing from
the original
- and
-chain are underlined and bold. Transfection
and establishment of clones was performed as described below.
TCR transfection
The plasmids were transfected into a subclone (6)
of the mouse T cell hybridoma
BW58
-
- which lacks
endogenous TCR chains, but expresses all CD3 molecules (7, 8). A total of 1 x 107 cells/ml in
RPMI medium were electroporated at 260 V, 960 µF with 30 µg of each
plasmid in Gene Pulse cuvettes (Bio-Rad, Hercules, CA). Transfectants
were sequentially selected with 1.5 mg/ml G418 and 0.3 mg/ml Hygromycin
B (Sigma-Aldrich, St. Louis, MO), and clones were established by
picking single colonies. Several independent clones exhibiting TCR
surface expression and capable of IL-2 production were established for
each transfection.
L cell transfectants
L cell transfectants expressing either DRA1*0101/DRB1*0101 (DR1) or DRA1*0101/DRB5*0101 (DR2a) were established by transfecting LTK- cells with appropriate cDNA clones of the HLA molecules in pRSVneo or pRSVhygro and selection with G418 and Hygromycin B, respectively.
Flow cytometric analysis of TCR transfectants
Surface expression of TCR-CD3 complexes was monitored by FACS
analysis. G418 and Hygromycin-resistant clones
(
105 cells) were incubated with primary Ab for
30 min at 4°C in FACS buffer (PBS containing 0.5% BSA and 0.1%
NaN3). After two washes with FACS buffer,
secondary DTAF-labeled Abs were added for 30 min at 4°C. Controls
were treated only with DTAF-labeled secondary goat anti-mouse Ab.
Cells were analyzed on a FACSort flow cytometer using CellQuest
software (BD Biosciences, Heidelberg, Germany). A total of 10,000
cells per sample were analyzed. Viable cells were gated after
adding 1 µg/ml propidium iodide. All transfectants showed comparable
levels of TCR-CD3 complex expression as judged from the FACS staining
efficiency with the anti-CD3 Ab 145-2C11.
Functional TCR stimulation of transfectants
The transfectants were stimulated in different ways, namely with
1) immobilized anti-TCR Abs; 2) living target cells; 3) target cell
lysates; 4) purified or recombinantly expressed proteins; or 5)
nonpeptidic Ags. For activation of transfectants by Abs against TCR or
CD3 molecules, activating and control Abs were coated for 16 h at
4°C at 1 µg/ml in PBS onto 96-well flat-bottom plates (Costar,
Corning, NY). Target cell lysates (see Preparation of target
Ags) were coated at 0.11.0 mg total protein/ml for 2 h at
37°C. In some experiments, 5090% confluent living cells were
tested for their Ag presentation capability to 
TCR transfectants
directly. For stimulation of MBP139153-specific

TCR control transfectants, HLA-DRA/B1*0101 or
DRA/B5*0101-transfected LTK- cells (1 x
105) were loaded with peptides (0.1100 mM) for
10 h and washed twice before adding TCR transfectants. To all
samples, 50,000 transfectants in 150 µl RPMI with 10% FCS
were added per well and incubated for 16 h at 37°C. Supernatants
were tested for mouse IL-2 by ELISA (Endogen, Woburn, MA).
Autopresentation of the Ag by the transfectants was excluded, because
first the transfectants were diluted so that direct cell-cell contacts
were unlikely. Second, some of the samples were negative. This would
not be expected if the transfected cells presented an endogenous Ag to
each other.
Preparation of target Ags
All target cells except human myoblasts were maintained in RPMI
1640 supplemented with 10% FCS, 2 mM L-glutamine. Human
myoblasts were isolated from normal subjects and patients with
inflammatory myopathy, purified for CD56 by magnetic bead separation,
and cultured with skeletal muscle growth medium (Promocell, Heidelberg,
Germany) as described (9). Myoblasts used in our
experiments stained >95% positive for the neural cell adhesion
molecule (CD56) by FACS analysis. Spodoptera
frugiperda cells were grown in TMN-FH medium, 10% FCS
(Invitrogen, San Diego, CA). Adherent cells were detached with
trypsin-EDTA (Life Technologies, Karlsruhe, Germany). All cells were
washed twice with PBS, and resuspended at
1071.5 x 107
cells/ml in sterile H2O for osmotic lysis.
Alternatively, cells were resuspended in 1 ml PBS and disrupted by one
freeze/thaw step (freezing for at least 12 h at -20°C). The
lysates were centrifuged first at 1,200 x g for 10
min, then at 10,000 x g for 1 h, and finally at
100,000 x g for 1 h. Both lysis methods
resulted in comparable results concerning the yield of total protein
(
1 mg/ml) and content of the TCR-stimulating Ag as measured by T
cell activation.
TE671 ultracentrifugation supernatant and control protein (BSA, 10 µg/ml; Sigma-Aldrich) were digested with 50 µg/ml proteinase K (Boehringer-Mannheim, Mannheim, Germany) in 10 mM Tris-HCl/5 mM EDTA (pH 7.4) or Trypsin-EDTA one time in HBSS (pH 7.4; Life Technologies) for 2 h at 37°C. Digestion efficiency was confirmed by SDS-PAGE. For heat denaturation, TE671 ultracentrifugation supernatant or BSA was incubated at elevated temperatures for 4 min each, or for different periods of time at 95°C and immediately cooled on ice. Samples were adsorbed to microtiter plates as described above.
| Results |
|---|
|
|
|---|

TCR of the previously described
V
1.3+V
2+ T cell clone
(3, 4). The expanded, muscle invasive 
T cells were
originally identified in muscle biopsy sections of a patient with
polymyositis (3). Combined immunohistochemical and RT-PCR
analysis revealed that the inflammatory 
T cells were essentially
monoclonal and expressed an unusual
V
1.3+/V
2+ TCR
(4). As shown in Fig. 1
2+ muscle invasive

T cells (stained yellow in Fig. 1
2-

T cells (stained red).
Because the patient had died in the meantime and biopsy and cDNA
material were not available, we relied on PCR mutagenesis to
reconstruct the cDNA for the full-length
and
TCR chains from
normal PBMC (see Materials and Methods). The reconstructed
- and
-chain protein sequences were completely identical with the
previously identified sequences (3, 4).
We transfected the reconstructed cDNA of the 
TCR into the mouse
T hybridoma BW58
-
-.
As shown by flow cytometry, the transfectants displayed the same
staining pattern as the 
T cells in the original muscle biopsy
specimen. The
V
1.3+/V
2+
transfectants stained positive with anti-CD3, anti-pan 
TCR, anti-V
1.3 and -V
2 mAbs, but not with Abs to V
9 or
V
1. Fig. 2
a shows clone B5
as a representative of three independent clones of identical staining
pattern. Control cells transfected with an 
TCR (BBC9, clone 5-1)
specific for HLA-DR/MBP complexes were stained by the specific
anti-V
9 Ab, but not by a control Ab to V
2 (Fig. 2
a).
|
- and
-chains precisely
correlated with the functional response to TCR stimulation with various
mAbs immobilized to microtiter plates (Fig. 2
TCR, anti-V
1.3, and
anti-V
2-Abs, but not with Abs to V
9 or
V
1 (Fig. 2
TCR) control transfectants
were activated by anti-V
9 Ab but not by V
2 Abs. In addition,
the BBC9 cells could be stimulated by the same peptide/MHC combination
recognized by its parent human T cell line
(DRB1*0101/MBP139151) (Ref. 5 ;
Fig. 2
as well as 
TCR chains into mouse
BW58
-
- yields
functional TCR/CD3 complexes, indicating that the human conserved TCR
regions of human 
as well as the 
TCR can interact with the
murine CD3 molecules for signaling.
Our functional 
T cell transfectants were tested for reactivity
against two types of human muscle cells: myoblasts cultured from normal
or inflammatory human muscle, and the human rhabdomyosarcoma cell line
TE671 as the source of Ag(s). The myoblasts were lysed by osmotic shock
or repeated freeze-thaw cycles, subjected to consecutive centrifugation
steps of increasing centrifugal force, and the supernatants were used
for stimulation of the 
TCR transfectants. The 
TCR
transfectants were incubated in the absence of APCs in microtiter
plates preadsorbed with the human muscle cell preparations. As read out
for stimulation of the TCR transfectants, we determined the amount of
IL-2 secreted into the supernatant by ELISA.
Whereas intact muscle cells did not stimulate the transfectants, the
supernatants triggered IL-2 production (Fig. 3
a). The ultracentrifuge
supernatants yielded strong signals, indicating that the 
TCR
recognized a soluble Ag, which was enriched in the cytosol. Further
characterization of the putative target Ag(s) indicated that it was a
protein, or at least associated with a protein, because it was
sensitive to proteinase K and trypsin digestion, as well as to heat
denaturation (Fig. 3
b). Although the human muscle cell line
TE671 yielded the strongest stimulatory signal, small amounts of the
same (or a cross-reactive) Ag seemed to be present in other cell lines,
including S. frugiperda insect cells. However, the
transfectants could not be stimulated by control proteins such as BSA
(Fig. 3
a), nonspecific Abs (Fig. 2
b), or
denatured proteins (Fig. 3
b), indicating that the response
was specific.
|

T cell Ags (10), such as
MHC and CD1 molecules, various heat-shock proteins (hsp) (hsp70, hsp73,
hsp90, hsp65, hsp38, GroEl), and nonpeptidic alkylphosphates
(monoethylphosphate, isopentenylpyrophosphate) all failed to stimulate
our V
1.3+/V
2+ TCR
transfectants (negative data not shown). Other known targets of 
T cells, such as intact EBV-transformed B cells and Daudi lymphoma
cells, also did not stimulate our transfectants (data not shown).
MHC-nonrestricted Ag recognition was observed previously with other

T cells (reviewed in Refs. 11, 12, 13). For further
evidence that our
V
1.3+V
2+
transfectants were indeed stimulated by a TCR-dependent, Ag-specific
recognition mechanism, a set of control transfectants was constructed
that had either altered
or
TCR chains, or single amino acid
exchanges in the CDR3 regions of either chain. In Table I
, the mutated
TCR chains are marked by an asterisk and the type of alteration is
indicated as a superscript. The set of altered TCR molecules includes
untransfected 58
-
-
recipient cells, an 
TCR (BBC9), two transfectants with either an
altered
- or
-chain
(V
9*altVJ
V
2+,
V
1.3+V
1*altVDJ
),
three transfectants with defined amino acid exchanges in CDR3 regions
of either the
- or
-chain
(V
1.3*alt
CDR3V
2+,
V
1.3+V
2*alt
CDR3,
V
1.3+V
2*alt
CDR3J),
and a transfectant in which only the constant region of the
-chain
C
1 is changed to C
2, but the V- and J-regions are unchanged
(V
1.3*alt
CV
2+).
All transfectants expressed a functional 
TCR heterodimer on the
cell surface, as determined by FACS analysis after staining with
appropriate Abs (data not shown) and by IL-2 production after
stimulation with immobilized chain-specific Abs. The levels of IL-2
production were comparable among different clones of the different
transfections (Fig. 4
a).
|

TCR
and control transfectants were added, and IL-2 was measured in the
supernatant (Fig. 4
1.3*alt
CV
2+,
i.e., the one with altered C
-region (Fig. 4
transfectants is nevertheless TCR CDR3-dependent and
therefore highly unlikely to be mediated by a superantigen
effect. | Discussion |
|---|
|
|
|---|

TCR
repertoire (19, 20). The muscle-attached
CD8+ T cells direct perforin vesicles toward the
muscle fiber membrane, suggesting a perforin-dependent mechanism of
muscle fiber injury (21). All in all, these features
strongly suggest, but do not prove, the autoaggressive function of the
invading T cells. To prove their autoimmune nature, it is especially
important to demonstrate T cell recognition of a muscle
autoantigen.
To demonstrate that autoinvasive T cells in polymyositis can indeed
recognize muscle-associated Ag(s), we used a specific paradigm. Several
years ago, we discovered an unusual form of 
T cell-mediated
polymyositis (3), in which
CD4-CD8-CD3+ 
T
cells surrounded and invaded the muscle fibers in exactly the same way
as CD8+ 
T cells in the more commonly
occurring form of polymyositis (Fig. 1
). This finding strongly
suggested the myocytotoxic nature of these 
T cells. Furthermore,
invading 
T cells have been shown to be essentially monoclonal,
thus allowing us to identify both chains of their receptor by RT-PCR
(4). We reconstructed this unusual V
1.3/V
2 TCR
rearrangement essentially from the published sequences, because no
biological material was available from the demised patient. We
functionally expressed this human TCR in a mouse hybridoma lacking
endogenous TCR, and thus, demonstrated that the human 
TCR
recognizes a muscle-associated protein in a CDR3-dependent,
MHC-nonrestricted way. The target Ag was found in normal human
myoblasts from an unrelated donor and in the human rhabdomyosarcoma
cell line TE671, suggesting that the pathogenic 
TCR recognizes a
muscle-associated autoantigen and not a viral, bacterial, or
superantigen. Thus, in this particular case, not only do we have strong
(but indirect) histological evidence for the pathogenic contribution of
the 
T cells (Fig. 1
), but we have demonstrated that the
reconstructed TCR recognizes a muscle-associated Ag. However, it seems
that the Ag is not only expressed in human muscle but also in other
cells, even from other species. Therefore, we assume that the unknown
Ag has been widely conserved during evolution. Alternatively, our

TCR recognizes different Ag(s), perhaps in a form of molecular
mimicry (reviewed in Refs. 22 and 23).
Indeed, some degree of degeneracy has been well-established for 
TCR-mediated Ag recognition (24, 25, 26), but it is presently
unknown whether Ag recognition by 
TCR has a similar degree of
degeneracy. Our TCR transfectants obviously recognize an intracellular
Ag in vitro (Fig. 3
a). In contrast, the histological
pictures (Fig. 1
) strongly suggest that in the patients muscle, the

T cells likely recognize an Ag on the cell surface. One could
speculate that the Ag is normally intracellular, perhaps expressed in
other tissues as well. In our patients muscle, an unknown initial
trigger might have induced an up-regulation and surface expression of
the Ag. The nature of the initiating event, leading to local
up-regulation of the autoantigen, remains unknown. It could be an
inflammatory stimulus, perhaps some form of local infection, or some
form of paraneoplastic reaction. In this regard, it may be noteworthy
that the patient died from cancer several years after his polymyositis
was diagnosed and successfully treated.
In principle, a similar strategy should be useful for the
characterization of autoreactive T cells in 
T cell-mediated
polymyositis, and in other diseases, such as multiple sclerosis.
However, the T cell infiltrates in other diseases are usually
oligoclonal rather than strictly monoclonal as in our case of
polymyositis (27, 28, 29). Thus, it will be necessary to
identify the TCR-
and
chains from individual T cells by
single-cell manipulation and PCR techniques. Recently, this was partly
achieved in multiple sclerosis brain lesions, but only for the TCR-
chain, not for the
-chain (2). Functional expression of
candidate 
TCRs is possible in the
BW58
-
- hybridoma,
as shown by several groups and with our control transfectants (Fig. 2
a). However, in contrast to our 
transfectants, which
seem to recognize their Ag like Abs, 
TCR transfectants need to
be stimulated with Ag presented by appropriate MHC molecules (Fig. 2
b). MHC-nonrestricted yet CDR3-dependent Ag recognition was
previously described for other 
T cells (30, 31).
This "Ab-like" behavior is consistent with the CDR3-length
distribution of
- and
-chains (reviewed in Ref. 11).
Recently, the crystal structure of a V
9/V
2 TCR was determined
(32) and again, the overall conformation of the complete
V
9/V
2 TCR looks more Ab-like than "TCR-like."
To our knowledge, the
V
1.3+/V
2+ TCR
investigated in this study is the only example of a molecularly defined
human 
TCR that was directly derived from a morphologically
characterized tissue lesion. Under physiological conditions, 
T
cells are thought to function as effectors of host defenses and
modulators of innate and adaptive immune responses, which possibly
function as important regulatory cells (reviewed in Refs.
13 and 33). They may be involved in certain
immunopathological conditions (reviewed in Refs. 13 and
34, 35, 36). However, except for circumstantial evidence,
little is known about the role of 
T cells in human (auto)immune
diseases. One can speculate in our case that the
V
1.3+/V
2+ T cells
normally recognize a stress or tumor-related Ag and may have
physiological functions in tissue repair or tumor defense, perhaps in
the context of the "immunological homunculus" (37, 38).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Klaus Dornmair, Department of Neuroimmunology, Max Planck Institute of Neurobiology, D-82152 Martinsried, Germany. E-mail address: dornmair{at}neuro.mpg.de ![]()
3 Abbreviations used in this paper: CDR, complementarity-determining region; MBP, myelin basic protein; DTAF, dichlorotriazinyl-fluoresceine; hsp, heat shock protein. ![]()
Received for publication February 20, 2002. Accepted for publication April 30, 2002.
| References |
|---|
|
|
|---|
-D
-J
gene rearrangements with specificity for a myelin basic protein peptide in brain lesions of multiple sclerosis. Nature 362:68.[Medline]

receptor. N. Engl. J. Med. 324:877.[Abstract]

T cell receptor. J. Exp. Med. 176:1785.
and
chain genes expressed by human T cells specific for similar myelin basic protein peptide/major histocompatibility complexes. Eur. J. Immunol. 22:753.[Medline]
chains. Eur. J. Immunol. 26:179.[Medline]
and
chain transcripts reveals a nonfunctional
-mRNA of BW5147 origin. Eur. J. Immunol. 19:2269.[Medline]

T cells: non-classical ligands for non-classical cells. Curr. Biol. 10:R282.[Medline]

cells. Annu. Rev. Immunol. 14:511.[Medline]

T cells: pattern recognition by the adaptive immune system. Springer Semin. Immunopathol. 22:191.[Medline]
/
T cells. Adv. Immunol. 71:77.[Medline]
/
rearrangements may indicate antigen-driven selection. J. Clin. Invest. 91:2880.
2V
2 TCR-dependent recognition of non-peptide antigens and Daudi cells analyzed by TCR gene transfer. J. Immunol. 154:998.[Abstract]
chain junctional region in prenyl pyrophosphate antigen recognition by 
T cells. J. Immunol. 161:286.
T-cell antigen receptor. Nature 411:820.[Medline]

cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18:975.[Medline]

T cells in tumour immunity and autoimmunity. Immunol. Today 21:187.[Medline]

T-cells, their T-cell receptor usage and role in human diseases. Springer Semin. Immunopathol. 21:55.[Medline]

cells regulate autoimmunity. Curr. Opin. Immunol. 9:884.[Medline]
This article has been cited by other articles:
![]() |
N. Schwab, C. G. Bien, A. Waschbisch, A. Becker, G. H. Vince, K. Dornmair, and H. Wiendl CD8+ T-cell clones dominate brain infiltrates in Rasmussen encephalitis and persist in the periphery Brain, May 1, 2009; 132(5): 1236 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Salajegheh, G. Rakocevic, R. Raju, A. Shatunov, L. G. Goldfarb, and M. C. Dalakas T cell receptor profiling in muscle and blood lymphocytes in sporadic inclusion body myositis Neurology, October 23, 2007; 69(17): 1672 - 1679. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Seitz, C. K. Schneider, J. Malotka, X. Nong, A. G. Engel, H. Wekerle, R. Hohlfeld, and K. Dornmair Reconstitution of paired T cell receptor {alpha}- and beta-chains from microdissected single cells of human inflammatory tissues PNAS, August 8, 2006; 103(32): 12057 - 12062. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Bradl and R Hohlfeld Molecular pathogenesis of neuroinflammation J. Neurol. Neurosurg. Psychiatry, October 1, 2003; 74(10): 1364 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dornmair, N. Goebels, H.-U. Weltzien, H. Wekerle, and R. Hohlfeld T-Cell-Mediated Autoimmunity: Novel Techniques to Characterize Autoreactive T-Cell Receptors Am. J. Pathol., October 1, 2003; 163(4): 1215 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wiendl, M. Mitsdoerffer, D. Schneider, A. Melms, H. Lochmuller, R. Hohlfeld, and M. Weller Muscle fibres and cultured muscle cells express the B7.1/2-related inducible co-stimulatory molecule, ICOSL: implications for the pathogenesis of inflammatory myopathies Brain, May 1, 2003; 126(5): 1026 - 1035. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |