|
|
||||||||




* DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA 94304; and
Schering-Plough Research Institute, Kenilworth, NJ 07033
| Abstract |
|---|
|
|
|---|
-common knockout mice did not
develop eosinophilia in response to IL-25, nor were IL-5+
cells detected. These findings suggest the existence of a previously
unrecognized cell population that may initiate Th2-like responses by
responding to IL-25 in vivo. Further, these data demonstrate the
heterogeneity of function within the IL-17 cytokine family and suggest
that IL-25 may be an important mediator of allergic disease via
production of IL-4, IL-5, IL-13, and eotaxin. | Introduction |
|---|
|
|
|---|
, IL-1
,
IL-6, IL-8, and G-CSF (5, 6, 7). In contrast, IL-17B and C do
not appear to bind to IL-17R and only promote expression of TNF-
and
IL-1
in vitro (3). Recently, a human sequence of IL-17F
has been described from lymphocytes and patients with asthma (8, 9). These reports also described the production of cytokines
from cells cultured with IL-17F. Also, a human IL-25 sequence has
recently been described with close homology to other members of the
IL-17 family (10). These findings demonstrate that the
currently identified IL-17 family members promote distinct responses
and may bind a variety of receptors on different cell types. In this
report, we describe the in vivo biology of IL-17C as well as two
additional family members, IL-17F and IL-25.
In recent years, a significant number of novel genes have been
identified in sequence databases by their homology to known cytokines.
However, the function of molecules discovered in this manner can be
difficult to determine unless it is very similar to a previously known
homologue. Ectopic overexpression of novel genes in transgenic mice has
proven to be a useful strategy for function determination, but is
laborious and difficult to control; the presented phenotype can often
represent a process quite distal to the primary function of the
transgene. Based on previous work, we have developed an in vivo
screening strategy for the function of novel cytokine homologues based
upon ectopic expression in the lung following adenovirus
(Ad)5-mediated gene
transfer (11, 12, 13). Biological responses to the transferred
gene are indicated by altered cell infiltration into the lung and/or by
changes in mRNA levels, measured by real-time PCR, of a panel of
cytokine, chemokine, and receptor genes. The lung is both a convenient
organ for localized and efficient Ad infection and is one of the most
reactive organs to immune and inflammatory stimuli. This latter
property makes ectopic expression in the lung an especially sensitive
technique. We demonstrate that Ad infection of mouse lungs with the
IL-17 family members IL-17C and IL-17F results in neutrophilia and
inflammatory gene expression such as IL-6 and IFN-
. In contrast,
IL-25 Ad infection of the lung promotes responses similar to those
mediated by Th2 cells, including IL-4, IL-5, IL-13, and eotaxin
production, followed by eosinophil infiltrate, mucus production, and
airway hyperreactivity.
| Materials and Methods |
|---|
|
|
|---|
IL-17B. GenBank database expressed sequence tag (EST) sequences (IMAGE clone 475876 mouse and 783987 human) were identified in an IL-17 computational screen. These clones were ordered (Research Genetics, Huntsville, AL) and the inserts were completely sequenced yielding full-length cDNAs for IL-17B_Mu and IL-17B_Hu.
IL-17C. A partial EST clone (HTGED19R) was identified in a computational screen of the Human Genome Science (Rockville, MD) database by homology to IL-17 family members. Primers based on this partial sequence were used to screen a panel of human cDNA libraries. A clone was identified from a cDNA library of PBMC. The full-length cDNA was PCR amplified from this library using primers GTGTGGCCTCAGGTATAAGAG and CTAAGGCCCCACGGCCTTGG, cloned into the TOPO vector (Invitrogen, Carlsbad, CA), and the sequence was verified by dye terminator chemistry on an ABI 377, 373, or 370 genetic analyzer (Applied Biosystems, Foster City, CA). Murine IL-17C was found by homology tBLASTn search of the GenBank High Throughput Genome Sequence database using the human ortholog. The full-length gene was predicted by homology comparison and gene specific forward and reverse primers were designed from this predicted sequence. The 5' primer TGCTGCCATGGCCACCGTCACCGTCA and 3' primer CACTGTGTAGACCTGGGAAGAACGCAGGT were used to do touch-down PCR using a murine T cell transfer inflammatory bowel disease library.
IL-17D. GenBank nt database entry gi434047 was identified in a computational screen by homology to IL-17 family members. PCR primers were designed based on this sequence and used to clone a partial cDNA from a Marathon ready fetal spleen library (Clontech Laboratories, Palo Alto, CA). The sequence of this fragment identified additional GenBank EST containing the missing 5' sequence and the primers ACCTCGCTCAGTCGGAAGCTTATGTTGGGGGCACTGGTCTGGATGCTGGTAGCCGGCTTCCTGCTGGCGC and GGGGCAGGACCGGCCTCAGGGGCCAGC were used to complete the full-length cloning. Using the full-length human sequence, a rat EST (AI230670) was identified containing the rodent IL-17D leader region. Marathon ready mouse cDNA libraries (Clontech Laboratories) were amplified with primers ATGTTGGGGACACTGGTCTGGATGCTCCTCGTCGGCTTCCT and GGACCTGATGCATGCAGGAAGCTGGGC to obtain the full-length mouse cDNA. PCR fragments were cloned into the TOPO vector (Invitrogen) and the sequence was verified as above.
IL-17F. The IL-17F sequence was identified in the Human Genome Sciences EST database and the cDNA clone (HTXOR44) was supplied by Human Genome Sciences. The sequence was confirmed and completed as above. Murine IL-17F was found by homology BLASTn search of the Ensembl mouse genomic sequences with its human orthologue. The full-length gene was predicted from this genomic sequence and forward and reverse primers were designed. The 5' primer ATGGTCAAGTCTTTGCTACTGTTGATGTT and 3' primer TCAGGCCGCTTGGTGGACAATGGGCT were used to do PCR using a mouse Th2 library.
IL-25. Human IL-25 cDNA was amplified from a human dendritic cell library using mouse IL-25 gene specific primers in a vector-anchored nested PCR. Based on the sequence of this fragment, primers ATGTACCAGGTGGTTGCATTCTTG and CTAAGCCATGACCCGGGGCCGCACACACACACA were used to amplify the cDNA, followed by cloning into TOPO vector and sequence confirmation.
Recombinant Ad and protein production
The full-length cDNAs for IL-17 family members were subcloned
into the Ad transfer vector. The vector and recombinant Ad production
were as described (14). 293 cells (5 x
108) (Quantum Biotechnologies, Montreal, Canada)
were infected with a multiplicity of infection of
10 Ad-mouse
(m) IL-25 in 1 L culture media formulation 1 medium (CellWorks, San
Diego, CA) and incubated for 5 days in a cell factory (Nalge Nunc
International, Naperville, IL). Culture medium was dialyzed (membrane
tubing, m.w. 60008000; Spectrum Laboratories, Rancho
Dominguez, CA) vs 50 mM Tris-HCl, pH 8.0, 1 mM EDTA (Buffer A and
passed-over HiTrap Q; Pharmacia, Uppsala, Sweden) to remove virus and
many contaminating proteins.
Animals
Female BALB/cAnN, 129, 129.RAG2KO, and 129.
cKO-RAG2KO were
obtained from Taconic Farms (Germantown, NY). IL-4KO (15),
B6.SJL-ptprca/BoAiTac-B2 m
(
2MKO) RAG2KO, and NK1.1 congenic
(16) mice on the BALB/c background were maintained at DNAX
(Palo Alto, CA). 129Sv/Ev-IL-13KO (IL-13KO) mice were generated
and maintained at the DNAX Research Institute (17);
WBB6F1/J-KitW/KitW-
(WW/kit), their congenic normal littermates
(W/W+), B6D2F1/J, and C57BL/6 were obtained from
The Jackson Laboratories (Bar Harbor, ME). Mice were between 5 and 7 wk
of age at the beginning of each experiment and were housed under
specific pathogen-free conditions at DNAX.
Nasal administrations
Mice were anesthetized lightly with isofluorane and given 1 x 1010 Ad particles in 50 µl of saline intranasally (i.n.). For i.n. administration of recombinant protein, anesthetized mice were given 5 µg of IL-25 in 50 µl saline. Mice were held upright until breathing was steady.
Bronchiolar lavage fluid (BAL) and lung tissue collection
At specific time points following protein or Ad administration, mice were euthanized and the BAL was harvested via the trachea by flushing with 1 ml of RPMI 1640. Aliquots of the BAL fluid were cytospun onto glass slides, stained with Wright-Giemsa (Sigma-Aldrich, St. Louis, MO) and evaluated for cell types. Data was analyzed using a statistical program, InstatP (GraphPad, San Diego, CA), and numbers of cells were calculated as mean and SEM. In other experiments, the lungs were excised and snap frozen with liquid nitrogen and stored at -80°C until processing for RNA analysis or fixed in formalin and processed for histological staining with H&E and periodic acid-Schiff (PAS) stains (Idexx, West Sacramento, CA).
Infection models
Mice were infected with Aspergillus fumigatus (American Type Culture Collection 201795 (Manassas, VA); 13-day-old cultures grown at room temperature on malt extract agar) in an inhalation chamber using a 30-s exposure as previously described (18, 19). Nippostrongylus brasiliensis larvae were prepared at DNAX and delivered to mice as previously described (20). Briefly, 500 stage 3 larvae were injected s.c. into mice. Mice were sacrificed at the indicated timepoints and their small bowels were excised, flushed of fecal contents with ice-cold PBS, and snap-frozen. Samples were stored at -80°C until processing as described above.
Airway hyperreactivity
Male B6D2F1/J mice were anesthetized lightly and 5 µg of either mIL-25 protein or control protein (BSA) were delivered via the nares daily for 5 days. Mice were then tested for airway hyperresponsiveness to metacholine by the forced oscillation technique as previously described (21). A Students t test was used to determine statistical significance between groups, with p < 0.5 being considered significant.
Antibodies
For cell depletions in vivo, mice were given 1 mg of mAb 1 day before and 2 days after injection of recombinant protein or Ad. Abs used for depletion included anti-Ly-6G (RB68C5) and anti-NK1.1 (PK136) (22). Anti-IL-5 mAb (TRFK5) was used as described above for cell-depleting mAb. mAb used for FACS analysis included anti-mouse Ly-6G, Thy-1, and CD45R/B220. Anti-mouse IL-5-PE mAb was used for intracellular staining as previously described (23). All FACS mAb were obtained from BD PharMingen (San Diego, CA) and were used according to the manufacturers instructions.
Quantitation of cytokine transcripts by real-time PCR
Frozen lung tissue was homogenized and total RNA was extracted using Maxi-prep RNeasy columns according to the manufacturers instructions and stored at -80. For RT-PCR, RNA was incubated with 10 U of DNase I (Boehringer Mannheim, Indianapolis, IN) in the presence of RNasin (Promega, Madison, WI) for 30 min at 37°C. The samples were then heat-inactivated at 70°C for 10 min, chilled, and reverse-transcribed with Superscript II reverse transcriptase (Invitrogen) with random hexamers and poly(dT) oligos according to the manufacturers protocol. Equivalent amounts of individual cDNA reactions from similarly treated mice (six to eight mice per timepoint) were combined to create pooled samples. Primers were either obtained from PerkinElmer (Foster City, CA) or generated with Primer Express software (PerkinElmer) and were synthesized by us. Whenever possible, primer pairs were designed to span intron/exon borders. PCR were performed at 95°C for 15 s followed by 60°C for 1 min using an ABI Geneamp 5700 sequence detection system and SYBR green buffer according to the manufacturer (PerkinElmer). PCR amplification of the housekeeping gene ubiquitin was performed for each sample to control for sample loading and to allow normalization between samples according to the manufacturers instructions (PerkinElmer). Both water and genomic DNA controls were included to insure specificity. Each data point was evaluated for integrity by analysis of the amplification plot and disassociation curves. The ubiquitin normalized data was expressed as the fold induction of gene expression in treated mice compared with that in untreated mice.
| Results |
|---|
|
|
|---|
To identify novel IL-17 homologues, we performed a
position-specific iterated-BLAST search against the GenBank NR
protein database, selected significant hits for iterative searching,
and built an IL-17 position-specific scoring matrix (PSSM). This PSSM
was used to identify additional family members from various proprietary
sequence databases, expanding the IL-17 family to include six members.
The alignment of these sequences shows a highly variable N-terminal
region with 14 cysteine residues present (Fig. 1
). The C-terminal sequence of all IL-17
family members contains a set of five spatially conserved cysteine
residues. However, the total number of cysteine residues varies
considerably within the family: mouse and human IL-25 have 10 and 11
cysteines, respectively, while IL-17 and IL-17F have 6. The expanded
IL-17 family PSSM was used to search the Protein Data Bank
sequence database, where a weak match to nerve growth factor was
identified (data not shown). The conserved C-terminal CXC motif and
four additional cysteine residues with relative spatial conservation
suggest that IL-17 may be related to the so-called cysteine-knot
structural superfamily (24). Among the cysteine-knot
growth factors, negligible sequence identity is seen outside the core
knot structure. The formation of dimers among IL-17 family members is a
common theme seen among the cysteine-knot growth factors. In fact,
recent findings demonstrated that IL-17F belongs to the cysteine-knot
growth factor family (25).
|
Demonstration of function for novel genes that have been
identified by bioinformatics is a critical step in functional genomics.
The use of Ad constructs to ectopically express unknown genes in the
lung epithelium has proven a useful strategy for the expression and
functional evaluation of novel molecules in vivo (12). We
selected mIL-17, human (h) IL-17C, hIL-17F, hIL-25, and mIL-25 from
among the new IL-17 family members described in Fig. 1
for further
analysis. Mice were given 1 x 1010
particles of recombinant Ad i.n., and BAL and lung tissue were
harvested at day 7 following infection. Mice given control Ad developed
mild neutrophilia in the BAL fluid at day 7 consistent with the mild
inflammatory response expected from nonreplicating Ad (Fig. 2
A). However, BAL fluid from
mIL-17, hIL-17C, and IL-17F Ad-infected mice contained far more
neutrophils than were present in control Ad-infected mice. In contrast,
both human and mouse IL-25-infected mice showed large numbers of BAL
fluid eosinophils compared with controls. Human and mouse IL-25 Ad
infections produced similar levels of neutrophils and eosinophils,
demonstrating the species cross-reactivity of human IL-25.
|
IL-17F expression resulted in Th1, while IL-25 produced Th2-like inflammatory gene expression
We have developed a novel approach for evaluating the function of
cytokine-like genes following either gene transfer or administration of
recombinant protein in vivo. This approach uses 96-well real-time PCR
primer arrays to measure changes in mRNA levels for a wide range of
cytokines, chemokines, and chemokine receptors. Following the
identification of cellular infiltrate in the BAL of mice infected with
novel gene Ad, we asked whether gene expression profiling would provide
further insight into the biological activities of the new proteins. We
selected one of the neutrophilia-producing family members, hIL-17F, to
compare and contrast with the eosinophilia-producing IL-25. At day 7
following infection, lung tissue from mice given hIL-17F Ad showed
substantial increases in the mRNA for inflammatory cytokines and
chemokines, including IL-6, IFN-
, inflammatory protein 10,
and monokine induced by IFN-
(Fig. 3
).
The stimulation of this group of inflammatory genes may predict the
influx of neutrophils in the BAL of mice infected with IL-17F
Ad.
|
Mice given IL-25 develop cellular infiltrate and mucus secretion in the lung
To further characterize the response to IL-25, we gave mice one
dose of 5 µg mIL-25 protein i.n. and harvested lung tissue at daily
intervals for 7 days to determine the time course of IL-25-induced
pathologies. IL-5 and IL-13 mRNA were rapidly induced in lung tissue by
IL-25, with peak levels at 72-h postadministration. Interestingly,
normalized expression of IL-13 was much higher throughout the time
course than IL-5. Examination of lung histology after i.n. IL-25
protein administration showed that peak IL-5 and IL-13 mRNA induction
was followed by cellular infiltrate, mucus production, and epithelial
cell hyperplasia (Fig. 4
). Low, but
marked, cellular infiltrate was clearly present in the H&E-stained
section from day 3 post-IL-25 protein treatment mice. This infiltration
increased through day 7 with cells ultimately identifiable in the
lumenal space. High-power examination showed that the majority
of these cells were eosinophils, with some monocytes and lymphocytes
(data not shown). PAS staining identified production of mucus by
epithelial cells as early as day 3 posttreatment while complete airway
occlusion with PAS staining mucus is evident at day 7. These results
demonstrate that IL-25 is capable of inducing the hallmark components
of allergic airway disease, including IL-4, IL-5, and IL-13 expression,
cellular infiltrate, and mucus production.
|
Because the responses described above frequently correlate with
development of airway hyperreactivity, we investigated whether
administration of IL-25 protein alone to naive mice would be sufficient
to induce airway hyperresponsiveness to methacholine. Mice given IL-25
protein i.n. daily for 5 days developed hyperreactivity when challenged
with methacholine in vivo (Fig. 5
).
However, a single dose of IL-25, which produced IL-5, IL-13, and mucus
production, was not sufficient to induce hyperreactivity (data not
shown), corroborating previous work showing that a chronic regimen of
allergic symptom induction is required to develop airway
hyperreactivity (26, 27). Together, these results
demonstrate that exposure of the murine airway to purified IL-25
protein alone is sufficient to promote both the pathological and
physiological features of an allergic response.
|
To understand the regulation and disease association of IL-25, we
tested a number of infection and immune response models from a variety
of murine tissue sources. Among these samples, IL-25 message was
up-regulated in the lung following A. fumigatus infection,
and in the gut following N. brasiliensis infection. In lung
tissue (Fig. 6
), IL-25 message was
up-regulated
10-fold following aerosolized infection with live
A. fumigatus spores. This up-regulation was maximal at 48-h
postinfection, and returned to baseline levels by day 7 postinfection.
Fig. 6
also shows the time course of IL-25 expression in the small
bowel following N. brasiliensis infection. Expression was
up-regulated
6-fold between days 7 and 11 postinfection, and
decreased through day 13. This longer time course closely matches the
arrival of worms into the gastrointestinal tracts of the
infected mice (28). In both systems, however, the
normalized expression of IL-25 message was in the range of other low
expression, high potency Th2 cytokines such as IL-4 and thus may
preclude detection by histological means. However, despite this low
level of expression, the active up-regulation of IL-25 mRNA in tissues
responding to these pathogens suggests that this cytokine may have a
role in the Th2 differentiation of the immune response to fungi and
parasites.
|
Known activities of IL-5 and IL-13 suggested that these cytokines
were key components of the eosinophilic response following IL-25
administration in the lung described in Fig. 2
(29, 30).
To confirm this, 5 µg of IL-25 protein was administered i.n. to
BALB/cAnN, IL-4KO, IL-13KO, and anti-IL-5-treated mice. One week
later, BAL fluid was harvested and evaluated for eosinophils by
cytospin. Wild-type controls and IL-4KO mice showed dramatic
eosinophilic responses to IL-25 protein administration, however,
anti-IL-5 treated mice showed greatly reduced numbers of BAL
eosinophils and IL-13KO produced no eosinophilia in response to IL-25
(Fig. 7
). These results demonstrated that
the eosinophilia in the lungs of mice given IL-25 required both IL-13
and IL-5 as intermediates.
|
The rapid induction of IL-5 and IL-13 message following IL-25
exposure suggested that the responding cell type is resident in the
lung. To identify cells responding to IL-25, recombinant cytokine was
given i.n. to mice made deficient in specific cell types by mAb
depletion or genetic deletions (Fig. 8
A). Strikingly, RAG2KO mice,
deficient in both T and B cells, produced high numbers of lung
eosinophils, demonstrating that lymphocytes were not required for this
response. The induction of IL-5, IL-13, and eotaxin mRNA by IL-25 i.n.
administration was also similar in control and RAG2KO mice,
demonstrating that lymphocytes were not the main source of these
cytokines (data not shown). Furthermore, the depletion of NK1.1 cells
with PK136 mAb did not prevent the development of eosinophilia in the
lungs of mice given mIL-25 protein. Mast cells are another known source
of IL-5 and IL-13, however, eosinophilia was similar between mast
cell-deficient
(WBB6F1/J-KitW/KitW-)
and control mice given IL-25 protein. Finally,
2MKO mice with neither
NK1+ CD4+ T nor
CD8+ T cells responded to IL-25 by producing
similar numbers of BAL eosinophils as did control mice. In all of the
above experiments, groups of treated mice given control 293 cell
supernatant i.n. did not develop eosinophilia (Fig. 8
and data not
shown). Recently, it has been shown that both basophils and mast cells
produce IL-5 and IL-13 in response to IL-18 (31). We
cultured sorted mast cells and basophils with IL-25, IL-18, or IL-25 +
IL-18 and detected both IL-5 and IL-13 from IL-18 cultured cell
supernatants. However, no IL-5 or IL-13 could be detected from
IL-25-cultured cells, nor was there any indication of synergy in IL-5
or IL-13 production from cells cultured with both IL-18 and IL-25 (data
not shown). Taken together, these in vivo and in vitro results
suggested that neither mast cells nor basophils were a significant
source of IL-5 or IL-13 in response to IL-25.
|
cKO-RAG2KO mice.
Fig. 8
cKO-RAG2KO mice did not respond to IL-25 given i.n. IL-25 induces IL-5 from a hemopoietically derived cell type
In a second approach to identifying the cells producing
IL-25-induced IL-5 and IL-13, lung cells from mice given mIL-25 protein
i.n. were activated in vitro with PMA/Iono and brefeldin A and stained
for intracellular cytokine and various lineage-specific cell surface
markers. This approach initially revealed a cell population that was
slightly larger and more granular than lymphocytes and was positive for
intracellular IL-5 (Fig. 9
A).
This distinct population constituted of 14% of the cells in gate 1 and
represented
12% of the total cells in the lung. Importantly, no
IL-5-staining cells could be detected from lung cells of mice given
control protein i.n. even though these cells had been activated in
vitro identically to those from IL-25-treated mice.
|

TCR, and intracellular CD3
(Fig. 9
cKO-RAG2KO mice to
determine whether the unresponsiveness of
c-chain KO mice observed
in Fig. 7
cKO-RAG2KO mice
given IL-25 i.n. did not produce cells that stained for intracellular
IL-5. This finding suggested that the absence of eosinophilia observed
in this mouse strain in Fig. 8| Discussion |
|---|
|
|
|---|
and IL-6 and produce neutrophilia when expressed in the
lung. In contrast, new IL-17 family member IL-25 was found to promote
the expression of prototypical Th2 genes such as IL-4,
IL-5, IL-13, and eotaxin and produce lung
eosinophilia. Following a single i.n. dose of IL-25 protein, expression
of IL-5 and IL-13 peaked at day 3. Accompanying the expression of these
Th2 cytokines, cellular infiltrate, thickening of airway tissue, and
mucus production were readily identifiable through day 7
postadministration. Mice given IL-25 recombinant protein also developed
airway hyperreactivity, suggesting that the cellular infiltrate and
mucus production observed developed into physiological airway
pathology. The finding that IL-25 can promote mucus production and
airway hyperreactivity is not altogether unexpected given the clear
ability of IL-13 to promote these pathologies (32, 33).
Taken together, however, these results show that the production of
IL-25 in the lung can result in all of the prototypical hallmarks of
Th2-mediated airway disease, involving infiltrate, cytokine production,
tissue reorganization, mucus secretion and airway hyperreactivity. This
acute lung response to IL-25 is not mediated by Th2 cells, however, as
T cell-deficient RAG2KO mice respond to IL-25 as well as control mice.
Additional work by members of our group has shown that mice given
systemic IL-25 had increased levels of serum IgE, IgG1 and IgA levels,
as well as blood eosinophilia. These IL-25-treated mice also developed
digestive tract pathologies including epithelial cell hyperplasia,
mucus production, and eosinophilic infiltrate (14). Initially it may seem confusing that molecules with such high sequence homology display such different biological properties. However, a close examination of the IL-17 family sequences shows a conserved cysteine-knot structure with considerable sequence divergence at the N terminus. Primary sequence homology also differs between family members with hIL-17 and hIL-17F having the highest homology (44%), while hIL-17 and hIL-25 have the lowest (15%). In addition to primary sequence, a preliminary relationship between biological function and structure emerges in that IL-17 family members with few cysteines, i.e., IL-17 and IL-17F (both with six) produce Th1-like inflammation while family members with the greatest number of cysteines, i.e., human and mouse IL-25 (10 and 11, respectively), produced Th2-like responses. These findings suggest that a combination of N-terminal region diversity, primary sequence, and cysteine-dependent motifs may be responsible for specific interaction of these molecules with their cognate signaling receptors and thus divergent biological effects. Using a similar bioinformatics approach, we have expanded the IL-17R family to include five related type I membrane proteins (D. M. Gorman, unpublished data). Although the final identification of these IL-17-related receptors to their respective ligands should help reveal the biological differences seen among these related cytokines, at this time we believe that the divergence between IL-25 and the other IL-17 family molecules will prove to be receptor/signaling pathway-mediated and not via other mechanisms.
To determine whether IL-25 might play a role in pathogenic responses, IL-25 mRNA was measured in lung and gut in several models in mice. The expression of IL-25 mRNA was increased during fungal infection of the lung with A. fumigatus and helminth infection of the gut with N. brasiliensis while total normalized expression remained low. This suggested that, while highly potent, either IL-25 or its cell source may be rare, or both. Future experiments using IL-25 blocking Abs or IL-25KO mice may help to define the relationship between IL-25 expression and pathology in these models. Interestingly, no detectable increase in IL-25 mRNA was detected in lung tissue from mice which had been sensitized and aerosol challenged with hen egg OVA (data not shown). A better understanding of the role of IL-25, its cell source and its variable expression in these in vivo model systems should provide points of future intervention for allergic and infectious disease at the epithelial border.
Further analysis of mice given IL-25 protein i.n. demonstrated that IL-5 and IL-13 were critical mediators in the development of pathology. Treatment of mice with a neutralizing anti-IL-5 mAb prevented most of the eosinophilia observed in IL-25 control-treated mice. Our interpretation of this result is that IL-5 may be required for the generation of new eosinophils and that treatment of mice with anti-IL-5 blocked this response, but not the production of IL-4 and IL-13, from these mice. The low numbers of eosinophils observed in the lungs of anti-IL-5-treated mice likely reflected the recruitment of pre-existing eosinophils to the lung. Additional experiments demonstrated that IL-25 protein did not have any eosinophil chemoattractant ability in vitro (data not shown), suggesting that the lung eosinophilia following IL-25 administration may have involved IL-13-induced genes such as eotaxin (34, 35) and VCAM-1 (36). Previous reports have suggested that IL-13 is required for lung eosinophilia and our findings suggested that IL-25 likely caused eosinophils via this previously described mechanism and not via another factor (32, 34, 35, 37).
Despite the typical Th2 cytokine profile induced by IL-25 in vivo, the
principal cell type responding to IL-25 does not appear to be a T cell.
The IL-5, IL-13-producing cell in the lung is present in comparable
numbers in RAG2KO and control mice. Thus, the responding cell is
neither a T nor B cell, although some CD4+
IL-5-positive-staining cells were present in the lungs of IL-25-treated
wild-type mice. In addition, the IL-5-producing cells appeared slightly
larger and more granular than lymphocytes as judged by forward and side
scatter. Double staining of RAG2KO lung cells for intracellular IL-5
and various markers showed low to negative expression of Thy-1 and
CD45R/B220, but no detectable expression of c-kit, Ly6G,
Ly49, CD3, CD4, 
TCR, and intracellular CD3
. Intracellular
staining of IL-13 corroborated the IL-5 staining data and suggested
that the same cell produced both IL-5 and IL-13 following IL-25
exposure. However, IL-13 staining was uniformly dimmer and may reflect
the limitations of the anti-IL-13 mAb (data not shown). This unique
surface staining profile eliminated most cell populations that might
have been expected to produce IL-5 in vivo. IL-25 may act as a growth
or differentiation factor for this cell type and this activity results
in the accumulation of IL-4-, IL-5-, and IL-13-producing cells at
mucosal surfaces of the lung and gut.
We also investigated the response of RAG2KO and
cKO-RAG2KO following
IL-25 administration. We showed that RAG2KO mice possessed a normal
response to IL-25 by up-regulation of cells expressing IL-5. However,
cKO-RAG2KO mice did not respond to IL-25 administration by
production of eosinophils nor did they produce IL-5-staining cells by
FACS. Previous work has demonstrated that mice with targeted mutation
in the common
(
c)-chain locus are deficient in NK,

T, and potentially other poorly characterized hemopoietic cell
populations which require one of the receptors formed by the
c chain subunit for development (38, 39, 40, 41, 42, 43, 44, 45).
Our interpretation of our finding is that the cell type that normally
produces IL-5 following exposure to IL-25 is missing due to the absence
of the
c chain. This suggests that the source for these
cells is hemopoietic, although they are not lymphocytes. Alternative
mechanisms could involve a role for the
c chain in the
IL-25R. However, preliminary receptor-ligand matching data suggests
that the
c chain is not involved in the IL-25R (data not
shown).
Finally, we report that the wide-screen analysis of downstream gene
regulation by real-time PCR following administration of Ad or protein
was effective in identifying the function of novel genes. Large-scale
analysis of gene expression patterns has become an important analytical
tool in many areas of biology. Most current approaches toward gene
expression profiling of in vivo disease states involves the use of DNA
microarray chips. Although this approach is appealing in its ability to
interrogate thousands of gene transcripts for discovery of novel
expression patterns, the technique is limited in sensitivity and by the
quality of the annotations. For the functional analysis of gene
products thought to participate in immune or inflammatory responses, we
have found that RT-PCR measurements of changes in expression of a
limited set of genes with known functions in immunity are much more
useful than microarray analysis. RT-PCR with the Taqman system is
100-fold more sensitive than DNA microarrays (S. D. Hurst and
R. L. Coffman, unpublished data) permitting even rare, but potent,
cytokines to be measured with accuracy. The patterns of change we have
observed in a well-chosen panel of fewer than 100 genes have generally
proven to predict the functional, structural, and cellular changes that
are observed in the same samples, leading to clear, testable hypotheses
about the activities of a novel gene. In contrast, DNA microarray
analysis often failed to detect these expression changes or, more
frequently, identified modulation of uninformative or unknown
ESTs.
Demonstration of function in vivo is a critical, but often elusive, step in the evaluation of the biological role and therapeutic potential of genes identified by homology searching of sequence databases. The ongoing effort to identify new components and regulators of inflammation may ultimately result in future antagonist targets and drugs. Lung administration of recombinant Ad vectors expressing novel secreted genes is both efficient and informative enough to be used as a primary functional screen for cytokine-like molecules. Lung infection produces sustained local secretion of the protein in vivo for many days following infection. As demonstrated in this study, the nature of the infiltrating cells, changes in tissue structure, and alterations in gene expression profiles all give important information about the biological activity of the new molecule, in vivo.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Stephen D. Hurst at the current address: Corgentech, 1651 Page Mill Road, Palo Alto, CA 94304. E-mail address: hurst{at}corgentech.com ![]()
3 Current address: Corgentech, Palo Alto, CA 94304. ![]()
4 Current address: Dynavax Technologies, Emeryville, CA 94710 ![]()
5 Abbreviations used in this paper: Ad, adenovirus; EST, expressed sequence tag; m, mouse; i.n., intranasally; BAL, bronchiolar lavage fluid; PAS, periodic acid-Schiff; PSSM, position-specific scoring matrix; h, human;
c, common
. ![]()
Received for publication December 21, 2001. Accepted for publication April 24, 2002.
| References |
|---|
|
|
|---|
and TNF-
, by human macrophages. J. Immunol. 160:3513.
gene. Am. J. Physiol. 272:L852.
and independent of eosinophil infiltration. Am. J. Respir. Cell Mol. Biol. 16:325.[Abstract]
gene therapy augments pulmonary host defense of ethanol-treated rats. Alcohol. Clin. Exp. Res. 22:157.[Medline]
chain. Immunity 2:223.[Medline]
chain: defining receptor complexes responsible for IL-4 and IL-13 signaling. Eur. J. Immunol. 27:1762.[Medline]
chain. Proc. Natl. Acad. Sci. USA 92:377.
chain. Br. J. Haematol. 103:335.[Medline]
chain-deficient mice. Int. J. Exp. Pathol. 78:133.[Medline]
chain. Blood 87:956.This article has been cited by other articles:
![]() |
E. A. Rickel, L. A. Siegel, B.-R. P. Yoon, J. B. Rottman, D. G. Kugler, D. A. Swart, P. M. Anders, J. E. Tocker, M. R. Comeau, and A. L. Budelsky Identification of Functional Roles for Both IL-17RB and IL-17RA in Mediating IL-25-Induced Activities J. Immunol., September 15, 2008; 181(6): 4299 - 4310. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Wright, F. Bennett, B. Li, J. Brooks, D. P. Luxenberg, M. J. Whitters, K. N. Tomkinson, L. J. Fitz, N. M. Wolfman, M. Collins, et al. The Human IL-17F/IL-17A Heterodimeric Cytokine Signals through the IL-17RA/IL-17RC Receptor Complex J. Immunol., August 15, 2008; 181(4): 2799 - 2805. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. O. Yang, S. H. Chang, H. Park, R. Nurieva, B. Shah, L. Acero, Y.-H. Wang, K. S. Schluns, R. R. Broaddus, Z. Zhu, et al. Regulation of inflammatory responses by IL-17F J. Exp. Med., May 12, 2008; 205(5): 1063 - 1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ma, L. Visser, H. Roelofsen, M. de Vries, A. Diepstra, G. van Imhoff, T. van der Wal, M. Luinge, G. Alvarez-Llamas, H. Vos, et al. Proteomics analysis of Hodgkin lymphoma: identification of new players involved in the cross-talk between HRS cells and infiltrating lymphocytes Blood, February 15, 2008; 111(4): 2339 - 2346. [Abstract] [Full Text] [PDF] |
||||