The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hurst, S. D.
Right arrow Articles by Coffman, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hurst, S. D.
Right arrow Articles by Coffman, R. L.
The Journal of Immunology, 2002, 169: 443-453.
Copyright © 2002 by The American Association of Immunologists

New IL-17 Family Members Promote Th1 or Th2 Responses in the Lung: In Vivo Function of the Novel Cytokine IL-251

Stephen D. Hurst2,*, Tony Muchamuel3,*, Daniel M. Gorman*, Jonathan M. Gilbert*, Theresa Clifford*, Sylvia Kwan*, Satish Menon*, Brian Seymour*, Craig Jackson{dagger}, Ted T. Kung{dagger}, Joan K. Brieland{dagger}, Sandra M. Zurawski*, Richard W. Chapman{dagger}, Gerard Zurawski* and Robert L. Coffman4,*

* DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA 94304; and {dagger} Schering-Plough Research Institute, Kenilworth, NJ 07033


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have biologically characterized two new members of the IL-17 cytokine family: IL-17F and IL-25. In contrast to conventional in vitro screening approaches, we have characterized the activity of these new molecules by direct in vivo analysis and have compared their function to that of other IL-17 family members. Intranasal administration of adenovirus expressing IL-17, IL-17C, or IL-17F resulted in bronchoalveolar lavage neutrophilia and inflammatory gene expression in the lung. In contrast, intranasal administration of IL-25-expressing adenovirus or IL-25 protein resulted in the production of IL-4, IL-5, IL-13, and eotaxin mRNA in the lung and marked eosinophilia in the bronchoalveolar lavage and lung tissue. Mice given intranasal IL-25 also developed epithelial cell hyperplasia, increased mucus secretion, and airway hyperreactivity. IL-25 gene expression was detected following Aspergillus and Nippostrongylus infection in the lung and gut, respectively. IL-25-induced eosinophilia required IL-5 and IL-13, but not IL-4 or T cells. Following IL-25 administration, the IL-5+ staining cells were CD45R/B220+, Thy-1+/-, but were NK1.1-, Ly-6G(GR-1)-, CD4-, CD3-, and c-kit-negative. {gamma}-common knockout mice did not develop eosinophilia in response to IL-25, nor were IL-5+ cells detected. These findings suggest the existence of a previously unrecognized cell population that may initiate Th2-like responses by responding to IL-25 in vivo. Further, these data demonstrate the heterogeneity of function within the IL-17 cytokine family and suggest that IL-25 may be an important mediator of allergic disease via production of IL-4, IL-5, IL-13, and eotaxin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-17 is a CD4+ T cell-derived cytokine that promotes inflammatory responses in cell lines and is elevated in rheumatoid arthritis, asthma, multiple sclerosis, psoriasis, and transplant rejection. Human IL-17 exists as glycosylated 20- to 30-kDa homodimers. IL-17 was initially recognized for its similarity to a sequence belonging to Herpesvirus saimiri, but it had little relatedness to any other known cytokines or other mammalian proteins (1, 2). More recently, two additional members of the IL-17 family have been described: IL-17B and IL-17C (3, 4). Although all three family members may promote inflammation and hemopoiesis, some of the responses of IL-17B and C are distinct from those described for IL-17. For example, IL-17 has been shown to signal through the IL-17R molecule and promote production of TNF-{alpha}, IL-1{beta}, IL-6, IL-8, and G-CSF (5, 6, 7). In contrast, IL-17B and C do not appear to bind to IL-17R and only promote expression of TNF-{alpha} and IL-1{beta} in vitro (3). Recently, a human sequence of IL-17F has been described from lymphocytes and patients with asthma (8, 9). These reports also described the production of cytokines from cells cultured with IL-17F. Also, a human IL-25 sequence has recently been described with close homology to other members of the IL-17 family (10). These findings demonstrate that the currently identified IL-17 family members promote distinct responses and may bind a variety of receptors on different cell types. In this report, we describe the in vivo biology of IL-17C as well as two additional family members, IL-17F and IL-25.

In recent years, a significant number of novel genes have been identified in sequence databases by their homology to known cytokines. However, the function of molecules discovered in this manner can be difficult to determine unless it is very similar to a previously known homologue. Ectopic overexpression of novel genes in transgenic mice has proven to be a useful strategy for function determination, but is laborious and difficult to control; the presented phenotype can often represent a process quite distal to the primary function of the transgene. Based on previous work, we have developed an in vivo screening strategy for the function of novel cytokine homologues based upon ectopic expression in the lung following adenovirus (Ad)5-mediated gene transfer (11, 12, 13). Biological responses to the transferred gene are indicated by altered cell infiltration into the lung and/or by changes in mRNA levels, measured by real-time PCR, of a panel of cytokine, chemokine, and receptor genes. The lung is both a convenient organ for localized and efficient Ad infection and is one of the most reactive organs to immune and inflammatory stimuli. This latter property makes ectopic expression in the lung an especially sensitive technique. We demonstrate that Ad infection of mouse lungs with the IL-17 family members IL-17C and IL-17F results in neutrophilia and inflammatory gene expression such as IL-6 and IFN-{gamma}. In contrast, IL-25 Ad infection of the lung promotes responses similar to those mediated by Th2 cells, including IL-4, IL-5, IL-13, and eotaxin production, followed by eosinophil infiltrate, mucus production, and airway hyperreactivity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of mouse and human IL-17 family members

IL-17B. GenBank database expressed sequence tag (EST) sequences (IMAGE clone 475876 mouse and 783987 human) were identified in an IL-17 computational screen. These clones were ordered (Research Genetics, Huntsville, AL) and the inserts were completely sequenced yielding full-length cDNAs for IL-17B_Mu and IL-17B_Hu.

IL-17C. A partial EST clone (HTGED19R) was identified in a computational screen of the Human Genome Science (Rockville, MD) database by homology to IL-17 family members. Primers based on this partial sequence were used to screen a panel of human cDNA libraries. A clone was identified from a cDNA library of PBMC. The full-length cDNA was PCR amplified from this library using primers GTGTGGCCTCAGGTATAAGAG and CTAAGGCCCCACGGCCTTGG, cloned into the TOPO vector (Invitrogen, Carlsbad, CA), and the sequence was verified by dye terminator chemistry on an ABI 377, 373, or 370 genetic analyzer (Applied Biosystems, Foster City, CA). Murine IL-17C was found by homology tBLASTn search of the GenBank High Throughput Genome Sequence database using the human ortholog. The full-length gene was predicted by homology comparison and gene specific forward and reverse primers were designed from this predicted sequence. The 5' primer TGCTGCCATGGCCACCGTCACCGTCA and 3' primer CACTGTGTAGACCTGGGAAGAACGCAGGT were used to do touch-down PCR using a murine T cell transfer inflammatory bowel disease library.

IL-17D. GenBank nt database entry gi434047 was identified in a computational screen by homology to IL-17 family members. PCR primers were designed based on this sequence and used to clone a partial cDNA from a Marathon ready fetal spleen library (Clontech Laboratories, Palo Alto, CA). The sequence of this fragment identified additional GenBank EST containing the missing 5' sequence and the primers ACCTCGCTCAGTCGGAAGCTTATGTTGGGGGCACTGGTCTGGATGCTGGTAGCCGGCTTCCTGCTGGCGC and GGGGCAGGACCGGCCTCAGGGGCCAGC were used to complete the full-length cloning. Using the full-length human sequence, a rat EST (AI230670) was identified containing the rodent IL-17D leader region. Marathon ready mouse cDNA libraries (Clontech Laboratories) were amplified with primers ATGTTGGGGACACTGGTCTGGATGCTCCTCGTCGGCTTCCT and GGACCTGATGCATGCAGGAAGCTGGGC to obtain the full-length mouse cDNA. PCR fragments were cloned into the TOPO vector (Invitrogen) and the sequence was verified as above.

IL-17F. The IL-17F sequence was identified in the Human Genome Sciences EST database and the cDNA clone (HTXOR44) was supplied by Human Genome Sciences. The sequence was confirmed and completed as above. Murine IL-17F was found by homology BLASTn search of the Ensembl mouse genomic sequences with its human orthologue. The full-length gene was predicted from this genomic sequence and forward and reverse primers were designed. The 5' primer ATGGTCAAGTCTTTGCTACTGTTGATGTT and 3' primer TCAGGCCGCTTGGTGGACAATGGGCT were used to do PCR using a mouse Th2 library.

IL-25. Human IL-25 cDNA was amplified from a human dendritic cell library using mouse IL-25 gene specific primers in a vector-anchored nested PCR. Based on the sequence of this fragment, primers ATGTACCAGGTGGTTGCATTCTTG and CTAAGCCATGACCCGGGGCCGCACACACACACA were used to amplify the cDNA, followed by cloning into TOPO vector and sequence confirmation.

Recombinant Ad and protein production

The full-length cDNAs for IL-17 family members were subcloned into the Ad transfer vector. The vector and recombinant Ad production were as described (14). 293 cells (5 x 108) (Quantum Biotechnologies, Montreal, Canada) were infected with a multiplicity of infection of ~10 Ad-mouse (m) IL-25 in 1 L culture media formulation 1 medium (CellWorks, San Diego, CA) and incubated for 5 days in a cell factory (Nalge Nunc International, Naperville, IL). Culture medium was dialyzed (membrane tubing, m.w. 6000–8000; Spectrum Laboratories, Rancho Dominguez, CA) vs 50 mM Tris-HCl, pH 8.0, 1 mM EDTA (Buffer A and passed-over HiTrap Q; Pharmacia, Uppsala, Sweden) to remove virus and many contaminating proteins.

Animals

Female BALB/cAnN, 129, 129.RAG2KO, and 129.{gamma}cKO-RAG2KO were obtained from Taconic Farms (Germantown, NY). IL-4KO (15), B6.SJL-ptprca/BoAiTac-B2 m ({beta}2MKO) RAG2KO, and NK1.1 congenic (16) mice on the BALB/c background were maintained at DNAX (Palo Alto, CA). 129Sv/Ev-IL-13KO (IL-13KO) mice were generated and maintained at the DNAX Research Institute (17); WBB6F1/J-KitW/KitW- (WW/kit), their congenic normal littermates (W/W+), B6D2F1/J, and C57BL/6 were obtained from The Jackson Laboratories (Bar Harbor, ME). Mice were between 5 and 7 wk of age at the beginning of each experiment and were housed under specific pathogen-free conditions at DNAX.

Nasal administrations

Mice were anesthetized lightly with isofluorane and given 1 x 1010 Ad particles in 50 µl of saline intranasally (i.n.). For i.n. administration of recombinant protein, anesthetized mice were given 5 µg of IL-25 in 50 µl saline. Mice were held upright until breathing was steady.

Bronchiolar lavage fluid (BAL) and lung tissue collection

At specific time points following protein or Ad administration, mice were euthanized and the BAL was harvested via the trachea by flushing with 1 ml of RPMI 1640. Aliquots of the BAL fluid were cytospun onto glass slides, stained with Wright-Giemsa (Sigma-Aldrich, St. Louis, MO) and evaluated for cell types. Data was analyzed using a statistical program, InstatP (GraphPad, San Diego, CA), and numbers of cells were calculated as mean and SEM. In other experiments, the lungs were excised and snap frozen with liquid nitrogen and stored at -80°C until processing for RNA analysis or fixed in formalin and processed for histological staining with H&E and periodic acid-Schiff (PAS) stains (Idexx, West Sacramento, CA).

Infection models

Mice were infected with Aspergillus fumigatus (American Type Culture Collection 201795 (Manassas, VA); 13-day-old cultures grown at room temperature on malt extract agar) in an inhalation chamber using a 30-s exposure as previously described (18, 19). Nippostrongylus brasiliensis larvae were prepared at DNAX and delivered to mice as previously described (20). Briefly, 500 stage 3 larvae were injected s.c. into mice. Mice were sacrificed at the indicated timepoints and their small bowels were excised, flushed of fecal contents with ice-cold PBS, and snap-frozen. Samples were stored at -80°C until processing as described above.

Airway hyperreactivity

Male B6D2F1/J mice were anesthetized lightly and 5 µg of either mIL-25 protein or control protein (BSA) were delivered via the nares daily for 5 days. Mice were then tested for airway hyperresponsiveness to metacholine by the forced oscillation technique as previously described (21). A Student’s t test was used to determine statistical significance between groups, with p < 0.5 being considered significant.

Antibodies

For cell depletions in vivo, mice were given 1 mg of mAb 1 day before and 2 days after injection of recombinant protein or Ad. Abs used for depletion included anti-Ly-6G (RB6–8C5) and anti-NK1.1 (PK136) (22). Anti-IL-5 mAb (TRFK5) was used as described above for cell-depleting mAb. mAb used for FACS analysis included anti-mouse Ly-6G, Thy-1, and CD45R/B220. Anti-mouse IL-5-PE mAb was used for intracellular staining as previously described (23). All FACS mAb were obtained from BD PharMingen (San Diego, CA) and were used according to the manufacturer’s instructions.

Quantitation of cytokine transcripts by real-time PCR

Frozen lung tissue was homogenized and total RNA was extracted using Maxi-prep RNeasy columns according to the manufacturer’s instructions and stored at -80. For RT-PCR, RNA was incubated with 10 U of DNase I (Boehringer Mannheim, Indianapolis, IN) in the presence of RNasin (Promega, Madison, WI) for 30 min at 37°C. The samples were then heat-inactivated at 70°C for 10 min, chilled, and reverse-transcribed with Superscript II reverse transcriptase (Invitrogen) with random hexamers and poly(dT) oligos according to the manufacturer’s protocol. Equivalent amounts of individual cDNA reactions from similarly treated mice (six to eight mice per timepoint) were combined to create pooled samples. Primers were either obtained from PerkinElmer (Foster City, CA) or generated with Primer Express software (PerkinElmer) and were synthesized by us. Whenever possible, primer pairs were designed to span intron/exon borders. PCR were performed at 95°C for 15 s followed by 60°C for 1 min using an ABI Geneamp 5700 sequence detection system and SYBR green buffer according to the manufacturer (PerkinElmer). PCR amplification of the housekeeping gene ubiquitin was performed for each sample to control for sample loading and to allow normalization between samples according to the manufacturer’s instructions (PerkinElmer). Both water and genomic DNA controls were included to insure specificity. Each data point was evaluated for integrity by analysis of the amplification plot and disassociation curves. The ubiquitin normalized data was expressed as the fold induction of gene expression in treated mice compared with that in untreated mice.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification and structural motif analysis of new IL-17 family members

To identify novel IL-17 homologues, we performed a position-specific iterated-BLAST search against the GenBank NR protein database, selected significant hits for iterative searching, and built an IL-17 position-specific scoring matrix (PSSM). This PSSM was used to identify additional family members from various proprietary sequence databases, expanding the IL-17 family to include six members. The alignment of these sequences shows a highly variable N-terminal region with 1–4 cysteine residues present (Fig. 1Go). The C-terminal sequence of all IL-17 family members contains a set of five spatially conserved cysteine residues. However, the total number of cysteine residues varies considerably within the family: mouse and human IL-25 have 10 and 11 cysteines, respectively, while IL-17 and IL-17F have 6. The expanded IL-17 family PSSM was used to search the Protein Data Bank sequence database, where a weak match to nerve growth factor was identified (data not shown). The conserved C-terminal CXC motif and four additional cysteine residues with relative spatial conservation suggest that IL-17 may be related to the so-called cysteine-knot structural superfamily (24). Among the cysteine-knot growth factors, negligible sequence identity is seen outside the core knot structure. The formation of dimers among IL-17 family members is a common theme seen among the cysteine-knot growth factors. In fact, recent findings demonstrated that IL-17F belongs to the cysteine-knot growth factor family (25).



View larger version (107K):
[in this window]
[in a new window]
 
FIGURE 1. Alignment of amino acid sequence of IL-17 family members. Mature IL-17 family member protein sequences were aligned using ClustalX and hand adjustment. An amino acid coloring scheme correlates chemically similar residues as follows: green (hydrophobic), red (acidic), blue (basic), yellow (C), orange (aromatic), black (structure breaking), purple (amido), and gray (small). Conserved cysteine-knot residues I-VI are labeled accordingly. The predicted N-linked glycosylation site is marked with a caret ({wedge}). Conserved and identical residues are marked by a colon (:) and an asterisk (*), respectively.

 
Adenoviral expression of IL-17, IL-17C, and IL-17F produces neutrophilia, while IL-25 produces eosinophilia in the lung

Demonstration of function for novel genes that have been identified by bioinformatics is a critical step in functional genomics. The use of Ad constructs to ectopically express unknown genes in the lung epithelium has proven a useful strategy for the expression and functional evaluation of novel molecules in vivo (12). We selected mIL-17, human (h) IL-17C, hIL-17F, hIL-25, and mIL-25 from among the new IL-17 family members described in Fig. 1Go for further analysis. Mice were given 1 x 1010 particles of recombinant Ad i.n., and BAL and lung tissue were harvested at day 7 following infection. Mice given control Ad developed mild neutrophilia in the BAL fluid at day 7 consistent with the mild inflammatory response expected from nonreplicating Ad (Fig. 2GoA). However, BAL fluid from mIL-17, hIL-17C, and IL-17F Ad-infected mice contained far more neutrophils than were present in control Ad-infected mice. In contrast, both human and mouse IL-25-infected mice showed large numbers of BAL fluid eosinophils compared with controls. Human and mouse IL-25 Ad infections produced similar levels of neutrophils and eosinophils, demonstrating the species cross-reactivity of human IL-25.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 2. Lung administration of IL-17, IL-17C, and IL-17F produced neutrophilia while IL-25 produced eosinophilia in the BAL. A, BALB/cAnN mice (n = 5) were given 1 x 1010 adenoviral particles (Ad) i.n. B, Recombinant control protein or mIL-25 protein (5 µg) was given to mice (n = 5) i.n. Seven days postinfection or post-protein administration, mice were sacrificed and BAL fluid was harvested. BAL cells were cytospun, stained with Wright-Giemsa and relative cell types were determined microscopically with a grid-marked eyepiece. Data shown are the relative cell types within the grid square. Results shown are representative of over five experiments.

 
To confirm that the eosinophil response was due to ectopically expressed adenoviral IL-25, we gave mice mIL-25 protein purified from 293 cell supernatants infected with mIL-25 Ad. Mice given 5 µg of purified IL-25 protein i.n. produced eosinophilia at day 7 without the neutrophilia observed with IL-25 Ad (Fig. 2GoB). Additional experiments to further characterize this response showed that as little as 0.5 µg of IL-25 protein i.n. resulted in lung eosinophilia and that, regardless of the amount of IL-25 given, a minimum of three days following IL-25 protein administration was required for this result (data not shown). These results suggested that IL-25 promoted eosinophil development and not simply eosinophil recruitment from the blood. Interestingly, expression of IL-25 by Ad caused neutrophil infiltrate as well as eosinophilia, while administration of mIL-25 protein resulted in a distinct eosinophilic response. This suggested that IL-25 may support neutrophil recruitment in the context of adenoviral infection.

IL-17F expression resulted in Th1, while IL-25 produced Th2-like inflammatory gene expression

We have developed a novel approach for evaluating the function of cytokine-like genes following either gene transfer or administration of recombinant protein in vivo. This approach uses 96-well real-time PCR primer arrays to measure changes in mRNA levels for a wide range of cytokines, chemokines, and chemokine receptors. Following the identification of cellular infiltrate in the BAL of mice infected with novel gene Ad, we asked whether gene expression profiling would provide further insight into the biological activities of the new proteins. We selected one of the neutrophilia-producing family members, hIL-17F, to compare and contrast with the eosinophilia-producing IL-25. At day 7 following infection, lung tissue from mice given hIL-17F Ad showed substantial increases in the mRNA for inflammatory cytokines and chemokines, including IL-6, IFN-{gamma}, inflammatory protein 10, and monokine induced by IFN-{gamma} (Fig. 3Go). The stimulation of this group of inflammatory genes may predict the influx of neutrophils in the BAL of mice infected with IL-17F Ad.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 3. IL-17F expressed in the lung up-regulated Th1 response genes, while IL-25 up-regulated Th2 response genes. BALB/cAnN mice were given either 1 x 1010 particles of control, hIL-17F, or mIL-25 Ad, or 5 µg of recombinant control or mIL-25 protein i.n. Seven days later, mice were sacrificed and lungs were harvested, snap-frozen, and processed for RNA. Reverse-transcribed samples were analyzed on 96-well plate arrays of Taqman PCR primers for cytokines, chemokines, or chemokine receptors as described in Materials and Methods. Data shown is the fold increase over the control group of ubiquitin-normalized values. Data is representative of over five experiments.

 
In contrast, expression of mIL-25 via Ad in the lung produced a Th2-like response with elevations in mRNA for IL-4, IL-5, and IL-13 and the chemokines LIX, TARC, and eotaxin. Similar to the results observed with IL-25 Ad, mice given purified IL-25 protein produced high levels of IL-5 and even higher levels of IL-13, suggesting that these cytokines may have been somewhat inhibited by the concurrent response to adenoviral infection. It is interesting to note that while both IL-5 (80-fold) and IL-13 (>500-fold) were stimulated to a greater extent than IL-4 (20-fold) by IL-25 administration, mice given either mIL-25 Ad or protein also showed substantially increased levels of CCR3, most likely as a result of infiltrating eosinophils. As assessed by the responses in mouse lung, the biological activity of IL-25 differed markedly from the other IL-17-related molecules and the phenotype suggested that IL-25 may play a role in the establishment of Th2-like responses in vivo.

Mice given IL-25 develop cellular infiltrate and mucus secretion in the lung

To further characterize the response to IL-25, we gave mice one dose of 5 µg mIL-25 protein i.n. and harvested lung tissue at daily intervals for 7 days to determine the time course of IL-25-induced pathologies. IL-5 and IL-13 mRNA were rapidly induced in lung tissue by IL-25, with peak levels at 72-h postadministration. Interestingly, normalized expression of IL-13 was much higher throughout the time course than IL-5. Examination of lung histology after i.n. IL-25 protein administration showed that peak IL-5 and IL-13 mRNA induction was followed by cellular infiltrate, mucus production, and epithelial cell hyperplasia (Fig. 4Go). Low, but marked, cellular infiltrate was clearly present in the H&E-stained section from day 3 post-IL-25 protein treatment mice. This infiltration increased through day 7 with cells ultimately identifiable in the lumenal space. High-power examination showed that the majority of these cells were eosinophils, with some monocytes and lymphocytes (data not shown). PAS staining identified production of mucus by epithelial cells as early as day 3 posttreatment while complete airway occlusion with PAS staining mucus is evident at day 7. These results demonstrate that IL-25 is capable of inducing the hallmark components of allergic airway disease, including IL-4, IL-5, and IL-13 expression, cellular infiltrate, and mucus production.



View larger version (70K):
[in this window]
[in a new window]
 
FIGURE 4. Lung administration of IL-25 caused eosinophilic infiltrate and mucus production. BALB/cAnN mice were given 5 µg of mIL-25 protein i.n. At timepoints from days 0 to 7 post-IL-25 administration, mice were sacrificed, and lungs were harvested and assayed for cytokine production or fixed and stained for mucus and cellular infiltrate. Data shown are H&E- and PAS-stained lung sections. Solid arrowheads indicate cellular infiltrate. Open arrowheads indicate mucus accumulation.

 
Mice given IL-25 develop airway hyperreactivity

Because the responses described above frequently correlate with development of airway hyperreactivity, we investigated whether administration of IL-25 protein alone to naive mice would be sufficient to induce airway hyperresponsiveness to methacholine. Mice given IL-25 protein i.n. daily for 5 days developed hyperreactivity when challenged with methacholine in vivo (Fig. 5Go). However, a single dose of IL-25, which produced IL-5, IL-13, and mucus production, was not sufficient to induce hyperreactivity (data not shown), corroborating previous work showing that a chronic regimen of allergic symptom induction is required to develop airway hyperreactivity (26, 27). Together, these results demonstrate that exposure of the murine airway to purified IL-25 protein alone is sufficient to promote both the pathological and physiological features of an allergic response.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. Lung administration of IL-25 caused airway hyperreactivity. B6D2F1/J mice were given 5 µg of IL-25 or control (BSA) protein daily for 5 days. On day 5, mice were assayed of hyperreactivity by methacholine challenge as described in Materials and Methods. Data shown is the Raw (% increase) for increasing dosages of methacholine. *, p < 0.05.

 
IL-25 mRNA is increased during infection in the lung and gut

To understand the regulation and disease association of IL-25, we tested a number of infection and immune response models from a variety of murine tissue sources. Among these samples, IL-25 message was up-regulated in the lung following A. fumigatus infection, and in the gut following N. brasiliensis infection. In lung tissue (Fig. 6Go), IL-25 message was up-regulated ~10-fold following aerosolized infection with live A. fumigatus spores. This up-regulation was maximal at 48-h postinfection, and returned to baseline levels by day 7 postinfection. Fig. 6Go also shows the time course of IL-25 expression in the small bowel following N. brasiliensis infection. Expression was up-regulated ~6-fold between days 7 and 11 postinfection, and decreased through day 13. This longer time course closely matches the arrival of worms into the gastrointestinal tracts of the infected mice (28). In both systems, however, the normalized expression of IL-25 message was in the range of other low expression, high potency Th2 cytokines such as IL-4 and thus may preclude detection by histological means. However, despite this low level of expression, the active up-regulation of IL-25 mRNA in tissues responding to these pathogens suggests that this cytokine may have a role in the Th2 differentiation of the immune response to fungi and parasites.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 6. IL-25 is expressed in the lung and gut during pathogen infections. BALB/cAnN mice were infected with either (A) A. fumigatus spores via inhalation or (B) N. brasiliensis larvae via s.c. injection as described in Materials and Methods. At timepoints following infection, mice were sacrificed and their lungs or small bowel were harvested, snap-frozen, and processed for RNA as described in Materials and Methods. IL-25 RNA levels were assayed by real-time PCR and normalized to ubiquitin RNA levels for each timepoint. Data shown are the ubiquitin-normalized values of mIL-25 RNA at each timepoint. Results are representative of two experiments.

 
IL-25 generates eosinophilia via IL-5 and IL-13

Known activities of IL-5 and IL-13 suggested that these cytokines were key components of the eosinophilic response following IL-25 administration in the lung described in Fig. 2Go (29, 30). To confirm this, 5 µg of IL-25 protein was administered i.n. to BALB/cAnN, IL-4KO, IL-13KO, and anti-IL-5-treated mice. One week later, BAL fluid was harvested and evaluated for eosinophils by cytospin. Wild-type controls and IL-4KO mice showed dramatic eosinophilic responses to IL-25 protein administration, however, anti-IL-5 treated mice showed greatly reduced numbers of BAL eosinophils and IL-13KO produced no eosinophilia in response to IL-25 (Fig. 7Go). These results demonstrated that the eosinophilia in the lungs of mice given IL-25 required both IL-13 and IL-5 as intermediates.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 7. IL-25-mediated eosinophilia requires IL-13. BALB/cAnN, IL-4KO, and IL-13KO mice were given IL-25 protein (5 µg) i.n. Additional BALB/cAnN mice were given 1 mg of anti-IL-5 mAb on day -1 and on day 2 after IL-25 protein administration; n = 5 for each treatment group. Seven days later, mice were sacrificed and BAL fluid was harvested and evaluated as described in Fig. 2Go. Data shown are the eosinophils in the BAL for each treatment group. Results shown are representative of three experiments.

 
Lymphocytes, NK cells, mast cells, basophils, and granulocytes are not required for IL-25 responsiveness

The rapid induction of IL-5 and IL-13 message following IL-25 exposure suggested that the responding cell type is resident in the lung. To identify cells responding to IL-25, recombinant cytokine was given i.n. to mice made deficient in specific cell types by mAb depletion or genetic deletions (Fig. 8GoA). Strikingly, RAG2KO mice, deficient in both T and B cells, produced high numbers of lung eosinophils, demonstrating that lymphocytes were not required for this response. The induction of IL-5, IL-13, and eotaxin mRNA by IL-25 i.n. administration was also similar in control and RAG2KO mice, demonstrating that lymphocytes were not the main source of these cytokines (data not shown). Furthermore, the depletion of NK1.1 cells with PK136 mAb did not prevent the development of eosinophilia in the lungs of mice given mIL-25 protein. Mast cells are another known source of IL-5 and IL-13, however, eosinophilia was similar between mast cell-deficient (WBB6F1/J-KitW/KitW-) and control mice given IL-25 protein. Finally, {beta}2MKO mice with neither NK1+ CD4+ T nor CD8+ T cells responded to IL-25 by producing similar numbers of BAL eosinophils as did control mice. In all of the above experiments, groups of treated mice given control 293 cell supernatant i.n. did not develop eosinophilia (Fig. 8Go and data not shown). Recently, it has been shown that both basophils and mast cells produce IL-5 and IL-13 in response to IL-18 (31). We cultured sorted mast cells and basophils with IL-25, IL-18, or IL-25 + IL-18 and detected both IL-5 and IL-13 from IL-18 cultured cell supernatants. However, no IL-5 or IL-13 could be detected from IL-25-cultured cells, nor was there any indication of synergy in IL-5 or IL-13 production from cells cultured with both IL-18 and IL-25 (data not shown). Taken together, these in vivo and in vitro results suggested that neither mast cells nor basophils were a significant source of IL-5 or IL-13 in response to IL-25.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 8. IL-25 promotes eosinophilia in the absence of lymphocytes, NK cells, and mast cells. A, BALB/cAnN mice and mice deficient in lymphocytes (RAG2KO), CD8+ T cells ({beta}2MKO), mast cells (WW/kit), or NK cells (anti-NK1.1-treated) were given control or mIL-25 protein on day 0. Seven days later, lung BAL fluid was assayed as described in Fig. 2Go. B, 129.RAG2KO and 129.c{gamma}KO-RAG2KO mice were given control or mIL-25 protein on day 0 and assayed on day 7 as described above; n = 5 mice per treatment group. Data shown are representative of three experiments.

 
In addition to testing the IL-25 responsiveness of BALB/c RAG2KO mice, we tested the responsiveness of 129.RAG2KO and 129.{gamma}cKO-RAG2KO mice. Fig. 8GoB shows that eosinophilia was strongly induced in the 129 background RAG2KO mice, although these levels were lower than in the BALB/cAnN background RAG2KO strain. Interestingly, 129.{gamma}cKO-RAG2KO mice did not respond to IL-25 given i.n.

IL-25 induces IL-5 from a hemopoietically derived cell type

In a second approach to identifying the cells producing IL-25-induced IL-5 and IL-13, lung cells from mice given mIL-25 protein i.n. were activated in vitro with PMA/Iono and brefeldin A and stained for intracellular cytokine and various lineage-specific cell surface markers. This approach initially revealed a cell population that was slightly larger and more granular than lymphocytes and was positive for intracellular IL-5 (Fig. 9GoA). This distinct population constituted of 14% of the cells in gate 1 and represented ~1–2% of the total cells in the lung. Importantly, no IL-5-staining cells could be detected from lung cells of mice given control protein i.n. even though these cells had been activated in vitro identically to those from IL-25-treated mice.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 9. IL-25 induced IL-5 production from a distinct cell type in the lung. Mice were given 5 µg of control or mIL-25 i.n. on day 0 and sacrificed on day 7. Lungs were harvested, mechanically disassociated into a single cell suspension, and incubated with PMA/Iono and brefeldin A as described in Materials and Methods. Cells were stained for intracellular IL-5 or control Ig and analyzed by FACS. A, Lung cells from control protein or mIL-25 protein-treated mice were gated by forward and side scatter (Gate1) and intracellular IL-5-positive cells were displayed (solid line). Isotype Ig control is also shown (broken line). B, BALB/cAnN and BALB/cAnN-RAG2KO mice were given 5 µg of mIL-25 protein i.n. on day 0 and analyzed on day 7 as described above. C, 129.RAG2KO and 129.c{gamma}KO-RAG2KO mice were given 5 µg of mIL-25 protein i.n. and analyzed as described above. Quadrants were set by staining of control isotype Ig. Surface stains were performed before cell permeabilization. Data shown is representative of at least three experiments.

 
We also gave IL-25 to BALB/cAnN background RAG2KO mice to determine whether the BAL eosinophilia observed in these mice (in Fig. 7GoA) was accompanied by IL-5-producing cells. In BALB/cAnN mice most of the cells that stained for intracellular IL-5 were CD4-, although some CD4+ cells were detected. In contrast, RAG2KO mice contained cells that stained for intracellular IL-5 but were not CD4+. This finding confirmed that the cell population responding to IL-25 in the lung need not be lymphocytic in origin. Further analysis showed that the IL-5-producing cells in RAG2KO mice are low to negative for Thy-1 and CD45R/B220, and negative for c-kit, Ly6G, Ly49, CD3, CD4, {gamma}{delta} TCR, and intracellular CD3{epsilon} (Fig. 9GoB and data not shown). In addition, depletion of Ly6G+ granulocytes in vivo with RB6–8C5 mAb did not deplete IL-5-positive cells in the lung by FACS (data not shown). Together these results confirmed the results in Fig. 7Go that the cell type responsible for IL-5 and, most likely, IL-13 production following IL-25 exposure is of a nonlymphocyte, non-NK, nongranulocyte lineage. Finally, we stained cells from 129.RAG2KO and 129.{gamma}cKO-RAG2KO mice to determine whether the unresponsiveness of {gamma}c-chain KO mice observed in Fig. 7GoB was due to the absence of a responding cell population. Fig. 9GoC shows that cells from lungs of 129.RAG2KO mice given IL-25 i.n. clearly stained positive for intracellular IL-5, whereas lung tissue from 129.{gamma}cKO-RAG2KO mice given IL-25 i.n. did not produce cells that stained for intracellular IL-5. This finding suggested that the absence of eosinophilia observed in this mouse strain in Fig. 8Go was due to the absence of an IL-5-producing cell type and not due to a defect in the eosinophil lineage. Future experiments involving more complex depletions and in vitro reconstitutions may ultimately identify this distinct cell subset.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we describe a novel approach for the analysis of biological activity of new molecules discovered by homology to known cytokines. Using this approach, we show that IL-17, and two newly described members of the IL-17 family, IL-17C and IL-17F, functionally resemble one another in their potential to induce inflammatory genes such as IFN-{gamma} and IL-6 and produce neutrophilia when expressed in the lung. In contrast, new IL-17 family member IL-25 was found to promote the expression of prototypical Th2 genes such as IL-4, IL-5, IL-13, and eotaxin and produce lung eosinophilia. Following a single i.n. dose of IL-25 protein, expression of IL-5 and IL-13 peaked at day 3. Accompanying the expression of these Th2 cytokines, cellular infiltrate, thickening of airway tissue, and mucus production were readily identifiable through day 7 postadministration. Mice given IL-25 recombinant protein also developed airway hyperreactivity, suggesting that the cellular infiltrate and mucus production observed developed into physiological airway pathology. The finding that IL-25 can promote mucus production and airway hyperreactivity is not altogether unexpected given the clear ability of IL-13 to promote these pathologies (32, 33). Taken together, however, these results show that the production of IL-25 in the lung can result in all of the prototypical hallmarks of Th2-mediated airway disease, involving infiltrate, cytokine production, tissue reorganization, mucus secretion and airway hyperreactivity. This acute lung response to IL-25 is not mediated by Th2 cells, however, as T cell-deficient RAG2KO mice respond to IL-25 as well as control mice. Additional work by members of our group has shown that mice given systemic IL-25 had increased levels of serum IgE, IgG1 and IgA levels, as well as blood eosinophilia. These IL-25-treated mice also developed digestive tract pathologies including epithelial cell hyperplasia, mucus production, and eosinophilic infiltrate (14).

Initially it may seem confusing that molecules with such high sequence homology display such different biological properties. However, a close examination of the IL-17 family sequences shows a conserved cysteine-knot structure with considerable sequence divergence at the N terminus. Primary sequence homology also differs between family members with hIL-17 and hIL-17F having the highest homology (44%), while hIL-17 and hIL-25 have the lowest (15%). In addition to primary sequence, a preliminary relationship between biological function and structure emerges in that IL-17 family members with few cysteines, i.e., IL-17 and IL-17F (both with six) produce Th1-like inflammation while family members with the greatest number of cysteines, i.e., human and mouse IL-25 (10 and 11, respectively), produced Th2-like responses. These findings suggest that a combination of N-terminal region diversity, primary sequence, and cysteine-dependent motifs may be responsible for specific interaction of these molecules with their cognate signaling receptors and thus divergent biological effects. Using a similar bioinformatics approach, we have expanded the IL-17R family to include five related type I membrane proteins (D. M. Gorman, unpublished data). Although the final identification of these IL-17-related receptors to their respective ligands should help reveal the biological differences seen among these related cytokines, at this time we believe that the divergence between IL-25 and the other IL-17 family molecules will prove to be receptor/signaling pathway-mediated and not via other mechanisms.

To determine whether IL-25 might play a role in pathogenic responses, IL-25 mRNA was measured in lung and gut in several models in mice. The expression of IL-25 mRNA was increased during fungal infection of the lung with A. fumigatus and helminth infection of the gut with N. brasiliensis while total normalized expression remained low. This suggested that, while highly potent, either IL-25 or its cell source may be rare, or both. Future experiments using IL-25 blocking Abs or IL-25KO mice may help to define the relationship between IL-25 expression and pathology in these models. Interestingly, no detectable increase in IL-25 mRNA was detected in lung tissue from mice which had been sensitized and aerosol challenged with hen egg OVA (data not shown). A better understanding of the role of IL-25, its cell source and its variable expression in these in vivo model systems should provide points of future intervention for allergic and infectious disease at the epithelial border.

Further analysis of mice given IL-25 protein i.n. demonstrated that IL-5 and IL-13 were critical mediators in the development of pathology. Treatment of mice with a neutralizing anti-IL-5 mAb prevented most of the eosinophilia observed in IL-25 control-treated mice. Our interpretation of this result is that IL-5 may be required for the generation of new eosinophils and that treatment of mice with anti-IL-5 blocked this response, but not the production of IL-4 and IL-13, from these mice. The low numbers of eosinophils observed in the lungs of anti-IL-5-treated mice likely reflected the recruitment of pre-existing eosinophils to the lung. Additional experiments demonstrated that IL-25 protein did not have any eosinophil chemoattractant ability in vitro (data not shown), suggesting that the lung eosinophilia following IL-25 administration may have involved IL-13-induced genes such as eotaxin (34, 35) and VCAM-1 (36). Previous reports have suggested that IL-13 is required for lung eosinophilia and our findings suggested that IL-25 likely caused eosinophils via this previously described mechanism and not via another factor (32, 34, 35, 37).

Despite the typical Th2 cytokine profile induced by IL-25 in vivo, the principal cell type responding to IL-25 does not appear to be a T cell. The IL-5, IL-13-producing cell in the lung is present in comparable numbers in RAG2KO and control mice. Thus, the responding cell is neither a T nor B cell, although some CD4+ IL-5-positive-staining cells were present in the lungs of IL-25-treated wild-type mice. In addition, the IL-5-producing cells appeared slightly larger and more granular than lymphocytes as judged by forward and side scatter. Double staining of RAG2KO lung cells for intracellular IL-5 and various markers showed low to negative expression of Thy-1 and CD45R/B220, but no detectable expression of c-kit, Ly6G, Ly49, CD3, CD4, {gamma}{delta} TCR, and intracellular CD3{epsilon}. Intracellular staining of IL-13 corroborated the IL-5 staining data and suggested that the same cell produced both IL-5 and IL-13 following IL-25 exposure. However, IL-13 staining was uniformly dimmer and may reflect the limitations of the anti-IL-13 mAb (data not shown). This unique surface staining profile eliminated most cell populations that might have been expected to produce IL-5 in vivo. IL-25 may act as a growth or differentiation factor for this cell type and this activity results in the accumulation of IL-4-, IL-5-, and IL-13-producing cells at mucosal surfaces of the lung and gut.

We also investigated the response of RAG2KO and {gamma}cKO-RAG2KO following IL-25 administration. We showed that RAG2KO mice possessed a normal response to IL-25 by up-regulation of cells expressing IL-5. However, {gamma}cKO-RAG2KO mice did not respond to IL-25 administration by production of eosinophils nor did they produce IL-5-staining cells by FACS. Previous work has demonstrated that mice with targeted mutation in the common {gamma} ({gamma}c)-chain locus are deficient in NK, {gamma}{delta} T, and potentially other poorly characterized hemopoietic cell populations which require one of the receptors formed by the {gamma}c chain subunit for development (38, 39, 40, 41, 42, 43, 44, 45). Our interpretation of our finding is that the cell type that normally produces IL-5 following exposure to IL-25 is missing due to the absence of the {gamma}c chain. This suggests that the source for these cells is hemopoietic, although they are not lymphocytes. Alternative mechanisms could involve a role for the {gamma}c chain in the IL-25R. However, preliminary receptor-ligand matching data suggests that the {gamma}c chain is not involved in the IL-25R (data not shown).

Finally, we report that the wide-screen analysis of downstream gene regulation by real-time PCR following administration of Ad or protein was effective in identifying the function of novel genes. Large-scale analysis of gene expression patterns has become an important analytical tool in many areas of biology. Most current approaches toward gene expression profiling of in vivo disease states involves the use of DNA microarray chips. Although this approach is appealing in its ability to interrogate thousands of gene transcripts for discovery of novel expression patterns, the technique is limited in sensitivity and by the quality of the annotations. For the functional analysis of gene products thought to participate in immune or inflammatory responses, we have found that RT-PCR measurements of changes in expression of a limited set of genes with known functions in immunity are much more useful than microarray analysis. RT-PCR with the Taqman system is ~100-fold more sensitive than DNA microarrays (S. D. Hurst and R. L. Coffman, unpublished data) permitting even rare, but potent, cytokines to be measured with accuracy. The patterns of change we have observed in a well-chosen panel of fewer than 100 genes have generally proven to predict the functional, structural, and cellular changes that are observed in the same samples, leading to clear, testable hypotheses about the activities of a novel gene. In contrast, DNA microarray analysis often failed to detect these expression changes or, more frequently, identified modulation of uninformative or unknown ESTs.

Demonstration of function in vivo is a critical, but often elusive, step in the evaluation of the biological role and therapeutic potential of genes identified by homology searching of sequence databases. The ongoing effort to identify new components and regulators of inflammation may ultimately result in future antagonist targets and drugs. Lung administration of recombinant Ad vectors expressing novel secreted genes is both efficient and informative enough to be used as a primary functional screen for cytokine-like molecules. Lung infection produces sustained local secretion of the protein in vivo for many days following infection. As demonstrated in this study, the nature of the infiltrating cells, changes in tissue structure, and alterations in gene expression profiles all give important information about the biological activity of the new molecule, in vivo.


    Acknowledgments
 
We thank Yvette Crawley for expert technical assistance.


    Footnotes
 
1 The IL-25 designation has been approved by the International Union of Immunological Societies Subcommittee on IL Nomenclature. DNAX Research Institute is supported by Schering-Plough (Kenilworth, NJ). Back

2 Address correspondence and reprint requests to Dr. Stephen D. Hurst at the current address: Corgentech, 1651 Page Mill Road, Palo Alto, CA 94304. E-mail address: hurst{at}corgentech.com Back

3 Current address: Corgentech, Palo Alto, CA 94304. Back

4 Current address: Dynavax Technologies, Emeryville, CA 94710 Back

5 Abbreviations used in this paper: Ad, adenovirus; EST, expressed sequence tag; m, mouse; i.n., intranasally; BAL, bronchiolar lavage fluid; PAS, periodic acid-Schiff; PSSM, position-specific scoring matrix; h, human; {gamma}c, common {gamma}. Back

Received for publication December 21, 2001. Accepted for publication April 24, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155:5483.[Abstract]
  2. Yao, Z., W. C. Fanslow, M. F. Seldin, A. M. Rousseau, S. L. Painter, M. R. Comeau, J. I. Cohen, M. K. Spriggs. 1995. Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 3:811.[Medline]
  3. Li, H., J. Chen, A. Huang, J. Stinson, S. Heldens, J. Foster, P. Dowd, A. L. Gurney, W. I. Wood. 2000. Cloning and characterization of IL-17B and IL-17C, two new members of the IL-17 cytokine family. Proc. Natl. Acad. Sci. USA 97:773.[Abstract/Free Full Text]
  4. Shi, Y., S. J. Ullrich, J. Zhang, K. Connolly, K. J. Grzegorzewski, M. C. Barber, W. Wang, K. Wathen, V. Hodge, C. L. Fisher, et al 2000. A novel cytokine receptor-ligand pair: identification, molecular characterization, and in vivo immunomodulatory activity. J. Biol. Chem. 275:19167.[Abstract/Free Full Text]
  5. Jovanovic, D. V., J. A. Di Battista, J. Martel-Pelletier, F. C. Jolicoeur, Y. He, M. Zhang, F. Mineau, J. P. Pelletier. 1998. IL-17 stimulates the production and expression of proinflammatory cytokines, IL-{beta} and TNF-{alpha}, by human macrophages. J. Immunol. 160:3513.[Abstract/Free Full Text]
  6. Fossiez, F., J. Banchereau, R. Murray, C. Van Kooten, P. Garrone, S. Lebecque. 1998. Interleukin-17. Int. Rev. Immunol. 16:541.[Medline]
  7. Chabaud, M., F. Fossiez, J. L. Taupin, P. Miossec. 1998. Enhancing effect of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. J. Immunol. 161:409.[Abstract/Free Full Text]
  8. Starnes, T., M. J. Robertson, G. Sledge, S. Kelich, H. Nakshatri, H. E. Broxmeyer, R. Hromas. 2001. IL-17F, a novel cytokine selectively expressed in activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine production. J. Immunol. 167:4137.[Abstract/Free Full Text]
  9. Kawaguchi, M., L. F. Onuchic, X. Li, D. M. Essayman, J. Schroeder, H. Xiao, M. C. Liu, G. Krishnaswamy, G. Germano, S. Huang. 2001. Identification of a novel cytokine, ML-1, and its expression in subjects with asthma. J. Immunol. 167:4430.[Abstract/Free Full Text]
  10. Lee, J., W. H. Ho, M. Maruoka, R. T. Corpuz, D. T. Baldwin, J. S. Foster, A. D. Goddard, D. G. Yansura, R. L. Vandlen, W. I. Wood, A. L. Gurney. 2001. IL-17E, a novel proinflammatory ligand for the IL-17 receptor homolog IL-17Rh1. J. Biol. Chem. 276:1660.[Abstract/Free Full Text]
  11. Lei, D., Jr J. R. Lancaster, M. S. Joshi, S. Nelson, D. Stoltz, G. J. Bagby, G. Odom, J. E. Shellito, J. K. Kolls. 1997. Activation of alveolar macrophages and lung host defenses using transfer of the interferon-{gamma} gene. Am. J. Physiol. 272:L852.[Abstract/Free Full Text]
  12. Schwarzenberger, P., V. La Russa, A. Miller, P. Ye, W. Huang, A. Zieske, S. Nelson, G. J. Bagby, D. Stoltz, R. L. Mynatt, et al 1998. IL-17 stimulates granulopoiesis in mice: use of an alternate, novel gene therapy-derived method for in vivo evaluation of cytokines. J. Immunol. 161:6383.[Abstract/Free Full Text]
  13. Kolls, J. K., D. Lei, S. Nelson, W. R. Summer, J. E. Shellito. 1997. Pulmonary cytokine gene therapy: adenoviral-mediated murine interferon gene transfer compartmentally activates alveolar macrophages and enhances bacterial clearance. Chest 111:104S.[Medline]
  14. Fort, M. M., J. Cheung, D. Yen, J. Li, S. M. Zurawski, S. Lo, S. Menon, T. Clifford, B. Hunte, R. Lesley, et al 2001. IL-25, a novel molecule that induces IL-4, IL-5 and IL-13 and Th2-associated pathologies in vivo. Immunity 15:985.[Medline]
  15. Kuhn, R., K. Rajewsky, W. Muller. 1991. Generation and analysis of interleukin-4 deficient mice. Science 254:707.[Abstract/Free Full Text]
  16. von der Weid, T., A. Beebe, D. C. Roopenian, R. L. Coffman. 1996. Early production of IL-4 and induction of Th2 responses in the lymph node originate from a MHC class I-independent CD4+ NK1.1- T cell population. J. Immunol. 157:4421.[Abstract]
  17. Bancroft, A. J., A. N. McKenzie, R. K. Grencis. 1998. A critical role for IL-13 in resistance to intestinal nematode infection. J. Immunol. 160:3453.[Abstract/Free Full Text]
  18. Loebenberg, D., A. Cacciapuoti, R. Parmegiani, Jr E. L. Moss, Jr F. Menzel, B. Antonacci, C. Norris, T. Yarosh-Tomaine, R. S. Hare, G. H. Miller. 1992. In vitro and in vivo activities of SCH 42427, the active enantiomer of the antifungal agent SCH 39304. Antimicrob. Agents Chemother. 36:498.[Abstract/Free Full Text]
  19. Piggot, W. a. C. E.. 1960. Device for inhalation exposure of animals to spores. Proc. Soc. Exp. Biol. Med. 103:805.
  20. Coffman, R. L., B. W. P. Seymour, S. Hudak, J. Jackson, D. Rennick. 1989. Antibody to interleukin-5 inhibits helminth-induced eosinophilia in mice. Science 245:308.[Abstract/Free Full Text]
  21. Kung, T. T., Y. Crawley, B. Luo, S. Young, W. Kreutner, R. W. Chapman. 2000. Inhibition of pulmonary eosinophilia and airway hyperresponsiveness in allergic mice by rolipram: involvement of endogenously released corticosterone and catecholamines. Br. J. Pharmacol. 130:457.[Medline]
  22. Koo, G. C., J. R. Peppard. 1984. Establishment of monoclonal anti-Nk-1.1 antibody. Hybridoma 3:301.[Medline]
  23. Openshaw, P., E. E. Murphy, N. A. Hosken, V. Maino, K. Davis, K. Murphy. 1995. Heterogeneity of intracellular cytokine synthesis at the single-cell level in polarized T helper 1 and T helper 2 populations. J. Exp. Med. 182:1357.[Abstract/Free Full Text]
  24. Sun, P. D., D. R. Davies. 1995. The cystine-knot growth-factor superfamily. Annu. Rev. Biophys. Biomol. Struct. 24:269.[Medline]
  25. Hymowitz, S. G., E. H. Filvaroff, J. Yin, J. Lee, L. Cai, P. Risser, M. Maruoka, W. Mao, J. Foster, R. F. Kelley, et al 2001. IL-17s adopt a cystine knot fold: structure and activity of a novel cytokine, IL-17F, and implications for receptor binding. EMBO J. 20:5332.[Medline]
  26. Hessel, E. M., A. J. Van Oosterhout, C. L. Hofstra, J. J. De Bie, J. Garssen, H. Van Loveren, A. K. Verheyen, H. F. Savelkoul, F. P. Nijkamp. 1995. Bronchoconstriction and airway hyperresponsiveness after ovalbumin inhalation in sensitized mice. Eur. J. Pharmacol. 293:401.[Medline]
  27. Hessel, E. M., A. J. Van Oosterhout, I. Van Ark, B. Van Esch, G. Hofman, H. Van Loveren, H. F. Savelkoul, F. P. Nijkamp. 1997. Development of airway hyperresponsiveness is dependent on interferon-{gamma} and independent of eosinophil infiltration. Am. J. Respir. Cell Mol. Biol. 16:325.[Abstract]
  28. Rennick, D. M., L. Thompson-Snipes, R. L. Coffman, B. W. Seymour, J. D. Jackson, S. Hudak. 1990. In vivo administration of antibody to interleukin-5 inhibits increased generation of eosinophils and their progenitors in bone marrow of parasitized mice. Blood 76:312.[Abstract/Free Full Text]
  29. Karlen, S., M. L. De Boer, R. J. Lipscombe, W. Lutz, V. A. Mordvinov, C. J. Sanderson. 1998. Biological and molecular characteristics of interleukin-5 and its receptor. Int. Rev. Immunol. 16:227.[Medline]
  30. Roboz, G. J., S. Rafii. 1999. Interleukin-5 and the regulation of eosinophil production. Curr. Opin. Hematol. 6:164.[Medline]
  31. Yoshimoto, T., H. Tsutsui, K. Tominaga, K. Hoshino, H. Okamura, S. Akira, W. E. Paul, K. Nakanishi. 1999. IL-18, although antiallergic when administered with IL-12, stimulates IL-4 and histamine release by basophils. Proc. Natl. Acad. Sci. USA 96:13962.[Abstract/Free Full Text]
  32. Grunig, G., M. Warnock, A. E. Wakil, R. Venkayya, F. Brombacher, D. M. Rennick, D. Sheppard, M. Mohrs, D. D. Donaldson, R. M. Locksley, D. B. Corry. 1998. Requirement for IL-13 independently of IL-4 in experimental asthma. Science 282:2261.[Abstract/Free Full Text]
  33. Wills-Karp, M., J. Luyimbazi, X. Xu, B. Schofield, T. Y. Neben, C. L. Karp, D. D. Donaldson. 1998. Interleukin-13: central mediator of allergic asthma. Science 282:2258.[Abstract/Free Full Text]
  34. Li, L., Y. Xia, A. Nguyen, Y. H. Lai, L. Feng, T. R. Mosmann, D. Lo. 1999. Effects of Th2 cytokines on chemokine expression in the lung: IL-13 potently induces eotaxin expression by airway epithelial cells. J. Immunol. 162:2477.[Abstract/Free Full Text]
  35. Zhu, Z., R. J. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J. Clin. Invest. 103:779.[Medline]
  36. Bochner, B. S., D. A. Klunk, S. A. Sterbinsky, R. L. Coffman, R. P. Schleimer. 1995. IL-13 selectively induces vascular cell adhesion molecule-1 expression in human endothelial cells. J. Immunol. 154:799.[Abstract]
  37. Kolls, J. K., D. Lei, D. Stoltz, P. Zhang, P. O. Schwarzenberger, P. Ye, G. Bagby, W. R. Summer, J. E. Shellito, S. Nelson. 1998. Adenoviral-mediated interferon-{gamma} gene therapy augments pulmonary host defense of ethanol-treated rats. Alcohol. Clin. Exp. Res. 22:157.[Medline]
  38. Cao, X., E. W. Shores, J. Hu-Li, M. R. Anver, B. L. Kelsall, S. M. Russell, J. Drago, M. Noguchi, A. Grinberg, E. T. Bloom, et al 1995. Defective lymphoid development in mice lacking expression of the common cytokine receptor {gamma} chain. Immunity 2:223.[Medline]
  39. Andersson, A., S. M. Grunewald, A. Duschl, A. Fischer, J. P. DiSanto. 1997. Mouse macrophage development in the absence of the common {gamma} chain: defining receptor complexes responsible for IL-4 and IL-13 signaling. Eur. J. Immunol. 27:1762.[Medline]
  40. DiSanto, J. P., W. Muller, D. Guy-Grand, A. Fischer, K. Rajewsky. 1995. Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor {gamma} chain. Proc. Natl. Acad. Sci. USA 92:377.[Abstract/Free Full Text]
  41. Croy, B. A., A. A. Ashkar, R. A. Foster, J. P. DiSanto, J. Magram, D. Carson, S. J. Gendler, M. J. Grusby, N. Wagner, W. Muller, M. J. Guimond. 1997. Histological studies of gene-ablated mice support important functional roles for natural killer cells in the uterus during pregnancy. J. Reprod. Immunol. 35:111.[Medline]
  42. Rodewald, H. R., T. Brocker, C. Haller. 1999. Developmental dissociation of thymic dendritic cell and thymocyte lineages revealed in growth factor receptor mutant mice. Proc. Natl. Acad. Sci. USA 96:15068.[Abstract/Free Full Text]
  43. Goldman, J. P., M. P. Blundell, L. Lopes, C. Kinnon, J. P. Di Santo, A. J. Thrasher. 1998. Enhanced human cell engraftment in mice deficient in RAG2 and the common cytokine receptor {gamma} chain. Br. J. Haematol. 103:335.[Medline]
  44. Ikebe, M., K. Miyakawa, K. Takahashi, K. Ohbo, M. Nakamura, K. Sugamura, T. Suda, K. Yamamura, K. Tomita. 1997. Lymphohaematopoietic abnormalities and systemic lymphoproliferative disorder in interleukin-2 receptor {gamma} chain-deficient mice. Int. J. Exp. Pathol. 78:133.[Medline]
  45. Ohbo, K., T. Suda, M. Hashiyama, A. Mantani, M. Ikebe, K. Miyakawa, M. Moriyama, M. Nakamura, M. Katsuki, K. Takahashi, et al 1996. Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor {gamma} chain. Blood 87:956.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
E. A. Rickel, L. A. Siegel, B.-R. P. Yoon, J. B. Rottman, D. G. Kugler, D. A. Swart, P. M. Anders, J. E. Tocker, M. R. Comeau, and A. L. Budelsky
Identification of Functional Roles for Both IL-17RB and IL-17RA in Mediating IL-25-Induced Activities
J. Immunol., September 15, 2008; 181(6): 4299 - 4310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. F. Wright, F. Bennett, B. Li, J. Brooks, D. P. Luxenberg, M. J. Whitters, K. N. Tomkinson, L. J. Fitz, N. M. Wolfman, M. Collins, et al.
The Human IL-17F/IL-17A Heterodimeric Cytokine Signals through the IL-17RA/IL-17RC Receptor Complex
J. Immunol., August 15, 2008; 181(4): 2799 - 2805.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
X. O. Yang, S. H. Chang, H. Park, R. Nurieva, B. Shah, L. Acero, Y.-H. Wang, K. S. Schluns, R. R. Broaddus, Z. Zhu, et al.
Regulation of inflammatory responses by IL-17F
J. Exp. Med., May 12, 2008; 205(5): 1063 - 1075.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Ma, L. Visser, H. Roelofsen, M. de Vries, A. Diepstra, G. van Imhoff, T. van der Wal, M. Luinge, G. Alvarez-Llamas, H. Vos, et al.
Proteomics analysis of Hodgkin lymphoma: identification of new players involved in the cross-talk between HRS cells and infiltrating lymphocytes
Blood, February 15, 2008; 111(4): 2339 - 2346.
[Abstract] [Full Text] [PDF]