| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
-Dependent Inflammatory Responses in Human Keratinocytes Overexpressing the Suppressor of Cytokine Signaling 11
Laboratory of Immunology, Istituto Dermopatico dell’ Immacolata, Istituto di Ricovero e Cura a Carattere Scientifico, Rome, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
being the most potent
keratinocyte activator. Suppressor of cytokine signaling (SOCS)1 and
SOCS3 are negative regulators of IFN- signaling and are induced in
many cell types by IFN- itself or by other cytokines. We show in
this work that SOCS1, SOCS2, SOCS3, and cytokine-inducible
SH2-containing protein mRNA were up-regulated by IFN- in normal
human keratinocytes, whereas only SOCS1 or SOCS1 and cytokine-inducible
SH2-containing protein were induced by TNF-
or IL-4, respectively.
SOCS1, SOCS2, and SOCS3 proteins were undetectable in healthy skin and
highly expressed in the epidermis of psoriasis and allergic contact
dermatitis, but were only weakly expressed in atopic dermatitis skin.
In keratinocytes transiently transfected with SOCS1 or SOCS3 the
IFN--induced transactivation of an IFN--responsive reporter gene
was markedly inhibited. SOCS1 and SOCS3 overexpression in keratinocyte
stable clones inhibited IFN--induced phosphorylation of
IFN-R and activation of STAT1 and STAT3. Furthermore, SOCS1 and,
to a lesser extent, SOCS3 reduced membrane expression of ICAM-1 and
HLA-DR, and release of IFN--inducible protein-10, monokine induced
by IFN-, and monocyte chemoattractant protein-1 by
keratinocyte clones promoted by IFN-. SOCS1-expressing keratinocytes
showed constitutively higher, but not IFN--inducible, IL-8 levels
compared with SOCS2 and SOCS3 clones, and were resistant to
IFN--mediated growth inhibition. Targeting keratinocyte SOCS1 may
represent a novel therapeutic approach to IFN--dependent skin
diseases. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is the
most potent activator of the proinflammatory functions of
keratinocytes. In fact, IFN--activated keratinocytes express a broad
array of chemokines, cytokines, and membrane molecules that direct the
recruitment, activation, and retention of specific leukocyte
subpopulations in the skin (4, 5, 6). Although less potently
than IFN-, TNF- and IL-4 can also activate keratinocytes. The
reciprocal activation of T lymphocytes and keratinocytes has a primary
role in the amplification of skin inflammation during immune-mediated
skin diseases.
In the last five years, a large number of studies has focused on the
mechanisms by which cytokine actions are negatively regulated.
Suppressors of cytokine signaling (SOCS) are a family of intracellular
molecules comprising at least eight members, SOCS1 to SOCS7 and
cytokine-inducible SH2-containing protein (CIS), which share structural
similarities and are characterized by a central SH2 domain and a unique
motif, the SOCS box, in their C-terminal region. SOCS molecules have
been detected in various tissues and are produced in response to
different cytokines. SOCS regulate the magnitude and duration of
responses triggered by various cytokines by inhibiting their signal
transduction pathway in a classic negative feedback loop
(7, 8, 9). At the molecular level, SOCS/CIS bind directly to
cytokine receptors or to the catalytic domain of Janus kinase (Jak)
proteins and impede the recruitment and phosphorylation of STAT
(10). SOCS1 induction by IFN- and negative regulation
of the IFN- signaling by SOCS1 have been well documented in a wide
variety of cell types, including M1, HeLa, bone marrow cells, and
monocytes (11, 12, 13). In particular, SOCS1 inhibits IFN-
signaling by binding as a pseudosubstrate to Jak1 and Jak2, which are
associated, respectively, with the IFN-R and 
subunits.
Disabled Jak1 and Jak2 cannot mediate STAT1 phosphorylation, which is
necessary for activation of -activated sequences (GAS) in the
promoters of target genes (8, 10, 14). Moreover,
constitutive activation of STAT1 and hyperresponsiveness to IFN-
were found in SOCS1-deficient mice (15). Also, SOCS3
represses signaling induced by IFN-, although its inhibitory
activity toward STAT1 activation is weaker than that exhibited by SOCS1
(12).
Although the molecular bases of SOCS molecule activity have been
extensively investigated, limited information exists on inflammatory
mediators affected by SOCS (16, 17) and on SOCS expression
in human pathologic conditions (18). In this study, we
sought to determine whether SOCS family members are expressed by normal
human keratinocytes in vitro and in vivo during immune-mediated
diseases. Furthermore, through establishment of SOCS1-, SOCS2-, and
SOCS3-expressing keratinocyte clones, we investigated the potential
role of SOCS molecules in inhibiting IFN- signal transduction as
well as IFN--induced production of chemokines and adhesion
molecules.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Normal human keratinocytes were prepared from plastic surgery
skin obtained from healthy individuals (n = 3), as
described previously (4). Second- or third-passage
keratinocytes were used in all experiments, with cells cultured in
six-well plates in the serum-free medium, keratinocyte growth medium
(Clonetics, San Diego, CA), for at least 3–5 days (at 60–80%
confluence) before performing cytokine treatment. Stimulation with 200
U/ml human rIFN-, 50 ng/ml rTNF-, or 50 ng/ml rIL-4 (R&D Systems,
Abingdon, Oxon, U.K.) was performed in keratinocyte growth medium
devoid of hydrocortisone and bovine pituitary extract, and supplemented
with 0.1% BSA (Sigma-Aldrich, Milan, Italy). The HaCaT human
keratinocyte cell line was a gift from N. E. Fusenig (Deutsches
Krebsforschungszentrum, Heidelberg, Germany) and was grown in DMEM
(Biochrom, Berlin, Germany) supplemented with 10% Fetalclone II serum
(HyClone Laboratories, Logan, UT). When 60–80% confluence was
achieved, HaCaT cells were stimulated with 200 U/ml IFN-.
RNase protection and Northern blot analysis
Total RNA was extracted from cultured keratinocytes using the
TRIzol reagent (Invitrogen, Carlsbad, CA). The human SOCS multiprobe
template set and the complete kit for RNase protection assay were
purchased from BD PharMingen (San Diego, CA).
-32P-Labeled antisense riboprobes were generated from
DNA corresponding to CIS, SOCS7, SOCS6, SOCS5, SOCS3, SOCS2, and SOCS1,
as well as the housekeeping genes L32 and GAPDH, and were in vitro
transcribed in the presence of a GACU nucleotide pool precursors
using a T7 RNA polymerase. Hybridization of riboprobes with 10 µg of
each RNA sample was performed overnight, followed by digestion with
RNase A and T1. The samples were treated with proteinase K, extracted
with Tris-saturated phenol plus chloroform:isoamyl alcohol (50:1), and
finally precipitated in the presence of ammonium acetate. Protected
fragments were resolved by electrophoresis on 4.5% polyacrylamide-urea
gel. For Northern analysis, 5 µg of total RNA was fractionated on 1%
formaldehyde-agarose denaturing gels, blotted on nylon membrane
(Amersham Pharmacia Biotech, Milan, Italy), and fixed by UV
irradiation. SOCS2 probe was obtained by RT-PCR performed on RNA
isolated from IFN--stimulated keratinocyte cultures, and using the
following primer pairs: TATCAGGATGGTACTGGGGAAGTA (5')
andCTTGTTGGTAAAGGCAGTCCCCAG (3') (GenBank accession no.
AF037989). SOCS2 amplificate was gel purified, cloned into pCR-TOPO
vector (Invitrogen), and then subjected to an automated sequence
analysis using a PerkinElmer Sequencer (model ABI Prism 377 XL;
PerkinElmer, Roche Molecular Systems, Branchburg, NJ). SOCS2 probe was
labeled with [32P]dCTP and used for
hybridization conducted for 1 h at 68°C in QuickHyb solution
(Stratagene, La Jolla, CA), as per the manufacturer’s protocol. The
filters were washed two times at room temperature and once at 60°C
under high-stringency conditions (0.1x SSC, 0.1% SDS) and finally
exposed at -80°C to Kodak Biomax MS-1 films (Kodak, Rochester,
NY).
Immunohistochemistry
Four-millimeter punch biopsies were taken from skin of adult patients with chronic plaque psoriasis (n = 5) and chronic AD (n = 5) and from healthy control subjects (n = 3). Skin biopsies were also taken from 48-h positive patch test reactions to NiSO4 from four patients with ACD to nickel. Patients were not receiving any systemic or topical therapy before sampling. Five-micrometer cryostatic sections were fixed with 5% paraformaldehyde for 10 min, treated with 0.3% hydrogen peroxide to quench endogenous peroxidase activity, incubated with normal horse serum (Vectastain ABC kit; Vector Laboratories, Burlingame, CA) for 20 min, and finally permeabilized with 0.05% Triton X-100. Staining was performed with goat polyclonal anti-SOCS1 (15 µg/ml; C-20; Santa Cruz Biotechnology, Santa Cruz, CA) and anti-SOCS2 (10 µg/ml; M-19; Santa Cruz Biotechnology), and rabbit anti-SOCS3 (5 µg/ml; Immuno-Biological Laboratories, Hamburg, Germany). Immunoreactivity was revealed using avidin-biotin-peroxidase system and 3-amino-9-ethylcarbazole chromogen (Vector Laboratories). Sections were counterstained with Mayer’s hematoxylin. As negative controls, primary Abs were omitted or replaced with control serum.
SOCS plasmids
Myc-tagged full-length murine JAK-binding protein/SOCS1 and human SOCS2 or SOCS3 in pcDNA3 plasmid (pcDNA-myc/SOCS1-2-3) were a generous gift of Dr. A. Yoshimura (Kyushu University, Fukuoka, Japan). FLAG epitope-tagged murine SOCS1, SOCS2, and SOCS3 in pEF-BOS expression vector (pEF-FLAG/SOCS1-2-3) were kindly provided by Dr. D. J. Hilton (Walter and Eliza Hall Institute for Medical Research, Parkville, Victoria, Australia).
Transient and stable transfectants
Normal human keratinocytes and HaCaT cells were transiently
transfected in duplicate using Lipofectin and LipofectAMINE PLUS
reagents (Invitrogen), respectively. Typically, 1.5–2 x
105 cells were seeded in six-well plates 24–48 h
before transfection (60–80% confluence). For each well, 0.5 µg
pCMV · SPORT--galactosidase plasmid (Invitrogen) and 0.5
µg pGAS-Luc or pNF-
B-Luc vectors (Stratagene) were cotransfected
with increasing concentrations (0.1–2 µg) of
pcDNA3-myc/SOCS1-2-3 or pEF-FLAG/SOCS1-2-3 plasmid sets.
Increasing concentrations of pcDNA3 and pEF-BOS empty vectors were also
used as controls. After overnight culture, the cells were incubated for
24 h with 200 U/ml IFN- in serum-free medium and then lysed.
-galactosidase and luciferase activities were measured using the
-Gal ELISA kit (Boehringer Mannheim, Mannheim, Germany) and
luciferase assay system (Promega, Madison, WI), respectively.
Luciferase activity of each sample was normalized to the
-galactosidase activity, and its basal level, in the absence of
IFN- and the different SOCS constructs, was given the value of 1. To
confirm that increasing the concentration of transfected SOCS plasmids
resulted in an increased expression of SOCS proteins, lysates were
analyzed by Western blot using anti-c-myc 9E10 mAb
(Santa Cruz Biotechnology) or anti-FLAG M2 mAb (Sigma-Aldrich).
SOCS HaCaT cells were permanently transfected with
pcDNA-myc/SOCS1-2-3 or empty pcDNA3 plasmids linearized by
ScaI restriction endonuclease (Boehringer Mannheim).
Genetycin-resistant clones were selected after 
20 days by adding 0.4
mg/ml G418 (Invitrogen) to the culture medium. HaCaT clones expressing
SOCS1-2 or -3 proteins were selected by Western blot analysis with the
anti-c-myc Ab.
Western blot and immunoprecipitation
Protein extracts were prepared by solubilizing cells in RIPA
buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS in PBS)
containing a mixture of protease and phosphatase inhibitors. Proteins
were subjected to SDS-PAGE and transferred to polyvinylidene
difluoride membrane. Membranes were then blocked and probed with
various primary Abs diluted in PBS containing 5% nonfat dried milk or
3% BSA. The latter were as follows: anti-STAT1 (E-23; Santa Cruz
Biotechnology), anti-STAT3 (C20; Santa Cruz Biotechnology),
anti-phosphotyrosine (PY) STAT1 (Tyr701) and
STAT3 (Tyr705) (both from New England Biolabs,
Beverly, MA), anti-phosphoserine (PS) STAT1
(Ser727; Upstate Biotechnology, Lake Placid, NY),
anti-SOCS1 and anti-SOCS3 (both from Immuno-Biological
Laboratories), anti-SOCS2 (M-19; Santa Cruz Biotechnology), and
HRP-conjugated anti-c-myc (9E10; Santa Cruz
Biotechnology). Filters were properly developed with anti-mouse,
anti-goat, or anti-rabbit Ig Abs conjugated to HRP using the
ECL-plus detection system (Amersham Pharmacia Biotech), followed by
autoradiography. For immunoprecipitation, protein extracts were
incubated with protein G-Sepharose beads (Amersham Pharmacia Biotech)
and anti-Jak1, anti-Jak2 (Upstate Biotechnology), and
anti-IFN-R subunit (C-20; Santa Cruz Biotechnology)
polyclonal Abs. Immunoprecipitates were run on 8% SDS-PAGE and probed
on polyvinylidene difluoride filters with the 4G10 anti-PY (Upstate
Biotechnology) or with anti-c-myc Abs.
ELISA
IFN--inducible protein-10 (IP-10)/CXCL10 was assayed using
the purified 4D5/A7/C5 and the biotinylated 6D4/D6/G2 Abs (BD
PharMingen). Monokine induced by IFN- (Mig)/CXCL9 was determined
using the Ab pair, 2310D mAb for coating and biotinylated B8-6 (BD
PharMingen) for detection. Human recombinant chemokines (BD
PharMingen) were used as standards. IL-8 (CXCL8) and monocyte
chemoattractant protein (MCP)-1/CCL2 were measured with OptEIA kits (BD
PharMingen), as per the manufacturer’s protocol. The plates were
analyzed in an ELISA reader (model 3550 UV; Bio-Rad, Valencia, CA).
Cultures were conducted in triplicate for each condition. Results are
given as nanograms/106 cells ± SD.
Flow cytometry analysis
HaCaT clones were stained with FITC-conjugated anti-CD54 (84H10; Immunotech, Marseille, France) and anti-HLA-DR (L243; BD PharMingen) mAbs. In control samples, staining was performed using isotype-matched control Abs. Cells were analyzed with a FACScan equipped with CellQuest software (BD Biosciences, Mountain View, CA).
Cell proliferation analysis
A total of 104 cells were seeded in
24-well plates in triplicate for each condition, and after 3 days
medium was changed with fresh medium with or without 200 U/ml IFN-.
Clones were cultured for 1–7 days and the number of viable cells was
determined by a trypan blue exclusion test. Experiments were performed
on three SOCS1, SOCS2, SOCS3, or control clones.
Statistical analysis
Wilcoxon’s signed rank test (SigmaStat; Jandel, San Rafael, CA)
was used to compare differences in luciferase activity of transiently
transfected keratinocytes and chemokine release from SOCS clones.
Values of p 
0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The presence of SOCS mRNA was analyzed in normal human
keratinocytes in resting conditions and upon IFN-, TNF-, or IL-4
treatment (Fig. 1
A). Low
levels of SOCS1, SOCS2, SOCS5, SOCS6, SOCS7, and CIS mRNA were found to
be constitutively expressed by keratinocytes. Expression of SOCS1,
SOCS2, SOCS3, and CIS was markedly increased following IFN-
stimulation, whereas only SOCS1 or SOCS1 and CIS were significantly
up-regulated in keratinocytes exposed to TNF- or IL-4, respectively.
In contrast, SOCS5–7 were not affected by cytokine treatments.
Induction of SOCS1 mRNA by IFN-, TNF-, or IL-4 was increased soon
after a 1-h activation and was maintained at a high level for at least
48 h. Because riboprobe for RNase protection did not permit clear
evaluation of SOCS2 expression in keratinocytes, mRNA was also analyzed
by Northern blot using a SOCS2-specific probe. As shown in Fig. 1B, keratinocytes transiently up-regulated SOCS2 only after
IFN- stimulation, with mRNA peaking at 2 h after treatment and
returning to basal levels within 10 h. Similarly, IFN--induced
expression of SOCS3 and CIS was detectable as early as 30 min after
stimulation, peaked at 2 h, and decreased thereafter. Finally,
IL-4 strongly increased CIS mRNA expression, which persisted for at
least 48 h upon treatment.
|
To see whether keratinocytes express SOCS molecules in vivo, we
examined the presence of SOCS1, SOCS2, and SOCS3 proteins in normal
skin from healthy subjects and in the skin affected with psoriasis, ACD
to nickel and AD. As shown in Fig. 2, A–C, keratinocytes of healthy skin did not stain
for SOCS1, SOCS2, or SOCS3, although rare and scattered immunoreactive
cells were present in the epidermis. In contrast, psoriatic epidermis
showed a diffuse and intense SOCS1, SOCS2, and SOCS3 reactivity, with
keratinocytes displaying a cytoplasmic staining more evident in the
basal and suprabasal epidermal layers (Fig. 2, D–F). Keratinocytes in ACD reactions also
stained for SOCS1, SOCS2, and SOCS3 molecules, with the staining more
intense in discrete areas of the basal and suprabasal layers (Fig. 2, G–I). Finally, epidermis of chronic AD skin
showed only some restricted areas of faint positivity for SOCS
molecules (Fig. 2, J–L). A portion of leukocytes
infiltrating the dermis in all three diseases was also immunoreactive
for SOCS1, SOCS2, and SOCS3. Nonlesional skin from patients with
psoriasis or AD did not stain for SOCS molecules (data not shown).
|
-induced transactivation of a STAT1-binding promoter in
keratinocytes
Although SOCS molecules may also be involved in TNF- or
IL-4-mediated keratinocyte activation, we concentrated on the role of
SOCS molecules in the regulation of IFN- signaling, because IFN-
is the most powerful proinflammatory cytokine on keratinocytes. To this
end, keratinocytes were cotransfected with the IFN--inducible
reporter plasmid, pGAS-Luc, in the absence or presence of increasing
concentrations (0.1–2 µg/well) of pcDNA3-myc/SOCS1-2-3 or
empty pcDNA3 vectors. The pGAS-Luc reporter gene contains the
luciferase reporter gene driven by a basic promoter element (TATA box)
joined to tandem repeats of the GAS, which are a prototypical
STAT1-binding site (14). Keratinocytes transfected with
the pGAS-Luc and stimulated with IFN- showed a 20-fold increase in
luciferase activity (Fig. 3).
Transfection of SOCS1 decreased the luciferase activity of
pGAS-Luc plasmid very efficiently and in a dose-dependent manner (Fig. 3B; p < 0.002). Also, SOCS3 overexpression
reduced IFN- signaling in keratinocytes, although less potently than
SOCS1 (Fig. 3C; p < 0.03). In contrast,
SOCS2 or pcDNA3 empty vector did not affect the activation of
luciferase gene transcription by IFN- (Fig. 3, A and
D). An identical inhibitory pattern by SOCS on IFN-
signaling was obtained when the pEF-FLAG/SOCS1-2-3 plasmid set was used
to transfect keratinocytes (data not shown). To test whether the SOCS1-
or SOCS3-dependent inhibition of IFN- signaling was exerted
specifically on STAT1-activated pathway, we also used the pNF-B-Luc
reporter plasmid that is activated specifically by NF-B
transcription factor. Luciferase levels resulting from transfection of
IFN--treated keratinocytes with pNF-B-Luc were lower (6-fold
induction) compared with that obtained with pGAS-Luc, and, more
importantly, did not change in keratinocytes overexpressing SOCS1,
SOCS2, or SOCS3 (Fig. 3E). Thus, SOCS1 and SOCS3, but not
SOCS2, impair the ability of IFN- to transactivate luciferase gene
expression from STAT1- but not NF-B-binding promoters in
keratinocytes.
|
in HaCaT cells, and
establishment of SOCS-expressing HaCaT clones
To study the functional role of SOCS proteins in IFN- signaling
in keratinocytes, the keratinocyte-like cell line HaCaT was stably
transfected with SOCS1, SOCS2, or SOCS3 cDNAs. HaCaT clones permanently
expressing SOCS were generated by transfecting cells with linearized
pcDNA3-myc/SOCS1-2-3 and, as control, empty pcDNA3 vector.
Genetycin-resistant clones were screened for SOCS expression by Western
blot analysis with the anti-c-myc Ab, and 20 SOCS1 and
SOCS2 clones and nine SOCS3 clones were obtained and included in this
study. Before establishing clones, HaCaT cells were analyzed and
compared with normal keratinocytes in SOCS expression and
IFN--induced Jak/STAT signaling pathways. IFN- promoted the same
pattern of SOCS gene expression in HaCaT cells and normal
keratinocytes, and IFN- signaling was inhibited in transiently
transfected HaCaT by SOCS1 and SOCS3, but not by SOCS2 (data not
shown). Like normal keratinocytes, 5 min after IFN- treatment HaCaT
cells showed Jak1, Jak2, and IFN-R subunit phosphorylated in
tyrosine residues (Fig. 4). In both
keratinocytes and HaCaT cells, STAT1 and, to a lesser degree, STAT3
proteins became phosphorylated 15 min after IFN- stimulation (Fig. 4). Therefore, the proximal steps of IFN- signaling appear to be
identical in normal keratinocytes and HaCaT cells.
|
-dependent phosphorylation of IFN-R
subunit, STAT1, and STAT3 in keratinocytes overexpressing SOCS1 and
SOCS3
SOCS1 and SOCS3 have been demonstrated to inhibit signaling
induced by IFN- by inactivating Jak-mediated phosphorylation and
homodimerization of STAT proteins (19, 20). After a 5-min
stimulation with IFN-, Jak1 and Jak2 became phosphorylated in
control keratinocyte clones, as assessed by immunoprecipitation
experiments (Fig. 5). Unexpectedly, only
a slight reduction of Jak1 phosphorylation was observed in SOCS1 and
SOCS3 clones compared with controls or SOCS2 clones (Fig. 5A). Consistently, Jak2 phosphorylation was unaffected in
SOCS1 and SOCS3 clones (Fig. 5B). Although we did not
observe a significant down-regulation of Jak activation, SOCS molecules
bound tightly to Jak1 and Jak2 because they were coimmunoprecipitated
by anti-Jak1 or Jak2 Abs (Fig. 5). The molecular mechanisms by
which SOCS inhibit Jak activity are not fully understood. It has been
hypothesized that SOCS molecules can function as pseudosubstrates for
Jaks, which in turn cannot phosphorylate their natural substrates
(20). A strong inhibition of IFN-R phosphorylation
was observed in SOCS1 and, to a lower extent, in SOCS3 clones. In
contrast, we could not detect any changes in the phosphorylation of
IFN-R of SOCS2 clones (Fig. 6).
These data were confirmed in four SOCS1 and three SOCS2 or SOCS3
clones. As a consequence of the inhibition of IFN-R
phosphorylation, STAT1 and STAT3 proteins cannot be recruited and
activated in IFN--stimulated SOCS1 and SOCS3 transfectants (Fig. 7). Following IFN- stimulation,
control and SOCS2 keratinocyte clones phosphorylated latent STAT1 at
both tyrosine 701 and serine 727 residues. While tyrosine
phosphorylation of STAT1 occurred in keratinocytes only upon treatment
with IFN- (Fig. 7A), serine phosphorylation of STAT1 was
constitutive and up-regulated by IFN- (Fig. 7B). Low
amounts of tyrosine phosphorylated STAT3 were also detected in
keratinocytes following IFN- stimulation (Fig. 7C). The
IFN--induced STAT1 and STAT3 activation was greatly inhibited in all
keratinocyte clones expressing SOCS1 (Fig. 7, A–C). Six of nine SOCS3 stable clones showed a
significant reduction of STAT1 and STAT3 phosphorylation in response to
IFN-, whereas no differences with controls were observed for cells
permanently transfected with SOCS2 (Fig. 7, A–C). Keratinocyte clones expressed comparable
levels of SOCS1, SOCS2, and SOCS3 proteins (Fig. 7D). Taken
together, these results indicate that SOCS1 and, less efficiently,
SOCS3 block the IFN--dependent phosphorylation of IFN-R by
binding to Jak1 and Jak2, and thus prevent STAT1 and STAT3 activation
in keratinocytes.
|
|
|
-induced ICAM-1 and HLA-DR membrane molecules and chemokine
production are inhibited in SOCS1 keratinocyte clones
IFN--activated keratinocytes express membrane Ags, such as
ICAM-1 and HLA-DR (5, 21), and a broad array of
chemokines, including MCP-1, IP-10, Mig, and IL-8 (4, 5, 6).
Because many of the IFN--induced genes in keratinocytes are
transcriptionally regulated by STAT1 (22, 23) and STAT1 is
disabled in SOCS1 and SOCS3 keratinocyte clones, we tested whether SOCS
clones could still express inflammatory mediators in response to
IFN-. Flow cytometry analysis revealed that all 20 SOCS1 clones
examined showed a significant reduction (50–65%) of ICAM-1 and an
almost complete abrogation of HLA-DR expression (Fig. 8). Although less efficiently, ICAM-1 and
HLA-DR were reduced also in some (four of nine) SOCS3 clones, whereas
SOCS2 expressed ICAM-1 and HLA-DR levels comparable to that of control
(Fig. 8). Interestingly, in some SOCS2-expressing clones (4 of 20) a
superinduction of ICAM-1 and HLA-DR was revealed (data not shown).
Similar results were obtained when we tested chemokine content in
supernatants from IFN--activated keratinocyte clones. IP-10, Mig,
and MCP-1 release was greatly impaired in all SOCS1 clones, with
86–90% reduction for IP-10 and 75–80% reduction for Mig and MCP-1
(Fig. 9; p < 0.002). A
50–80% and 44–80% reduction of IP-10 and Mig, respectively, was
observed in five of nine IFN--stimulated SOCS3 clones
(p < 0.05). In contrast, MCP-1 release by
SOCS3 clones was similar to that of controls. Chemokine release was not
affected in the majority of IFN--stimulated SOCS2 clones (Fig. 9).
Similar to what we observed for ICAM-1 and HLA-DR expression, four
SOCS2-expressing clones showed an enhanced release of IP-10, Mig, and
MCP-1 compared with controls (data not shown). SOCS clones not exposed
to IFN- secreted very limited amounts of IP-10, Mig, and MCP-1 (data
not shown). Unexpectedly, IL-8 release was higher in IFN--stimulated
SOCS1 clones compared with control and SOCS2 or SOCS3 clones (Fig. 10A). However, a more
detailed study of IL-8 revealed that unstimulated SOCS1 clones secreted
higher levels of IL-8 compared with control, SOCS2, or SOCS3 clones
(3.2–6 vs0.6–1.6 ng/106 cells;
p < 0.01). After IFN- stimulation, IL-8 secretion
was not up-regulated in SOCS1 clones, whereas it was significantly
enhanced in control, SOCS2, or SOCS3 clones (Fig. 10B).
Therefore, SOCS1 overexpression in keratinocytes can enhance IL-8
production through a STAT1-independent mechanism, and, at the same
time, can block the IFN--induced IL-8 up-regulation in a
STAT1-dependent manner.
|
|
|
-induced inhibition of keratinocyte
growth
Other than inducing proinflammatory genes, IFN- exerts an
antiproliferative activity on a number of cell types including
keratinocytes, and STAT1 activation is required for mediating this
effect (24). The antiproliferative activity of IFN- was
completely abolished in SOCS1 clones. In fact, the number of
unstimulated and IFN--stimulated SOCS1-expressing keratinocytes was
comparable over all the time points of experiments (Fig. 11). In contrast, a dramatic and
progressive reduction of cell number was observed in control, SOCS2,
and SOCS3 clones following IFN- stimulation (Fig. 11).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-driven activation of keratinocytes.
Understanding the mechanisms by which IFN- signaling is switched off
in keratinocytes is fundamental because this cytokine potently
transforms keratinocytes in strong producers of inflammatory mediators
during immune-mediated skin diseases (4, 5, 6). That IFN-
activates keratinocytes in a dominant fashion compared with TNF- and
IL-4 becomes evident also from SOCS mRNA analysis upon cytokine
treatment. IFN- induced SOCS1, SOCS2, SOCS3, and CIS in
keratinocytes, whereas TNF- promoted only SOCS1 and IL-4 promoted
only SOCS1 and CIS. A high expression of SOCS1, SOCS2, and SOCS3
molecules was also found in epidermal keratinocytes of psoriasis and
ACD lesions, whereas chronic AD skin showed only a faint epidermal
staining. These differences are likely due to the prominent
infiltration of IFN--producing type 1 lymphocytes in ACD and
psoriasis compared with AD (1, 3). Indeed, studies
performed on IFN--stimulated keratinocytes cultured from
normal-appearing skin of healthy subjects and patients with psoriasis
or AD demonstrated no significant differences in SOCS1, SOCS2, and
SOCS3 mRNA induction (data not shown). Therefore, the reduced
keratinocyte expression of SOCS molecules in the epidermis of AD
compared with psoriasis or ACD cannot be attributed to altered
properties of keratinocytes to respond to IFN- but rather to the
lower amount of IFN- produced locally by activated T
lymphocytes.
Key events in IFN- signal transduction in keratinocytes involve Jak1
and Jak2 activation followed by IFN-R phosphorylation and
triggering of STAT1 and small amounts of STAT3. Once phosphorylated in
tyrosine 701 and serine 727 residues, STAT1 is fully active and can
thus induce a variety of inflammatory genes. For instance, ICAM-1,
class II transactivator, IP-10, Mig, and MCP-1 genes are all strongly
expressed by IFN--treated keratinocytes and tightly regulated at the
transcriptional level by STAT1 (22, 23, 25, 26, 27).
Regulation by STAT1 was also observed for several cell cycle and
proapoptotic genes, including cyclin kinase inhibitor p21 (WAF1),
c-myc, and caspase 1 (28, 29, 30), modulating the
IFN--induced antiproliferative effect. In transiently transfected
keratinocytes, IFN--induced STAT1-dependent gene activation was
impaired in the presence of SOCS1 and SOCS3, but not of SOCS2. SOCS1-
and SOCS3-dependent inhibition of IFN- signaling was exerted
specifically on the STAT1 and not the NF-B pathway. A discrete
portion of SOCS1 and SOCS3, called kinase inhibitory region,
contributes to high-affinity binding to the Jak2 tyrosine kinase domain
and is required for the inhibition of Jak2 activity by preventing the
access of substrates and/or ATP in the catalytic pocket (20, 31). As a result of Jak1 and Jak2 inactivation, the
phosphorylation in tyrosine 440 residue of IFN-R subunit induced
by IFN- was impaired in keratinocyte clones overexpressing SOCS1 and
reduced in SOCS3, but not in SOCS2 clones. Therefore, we could not
observe a direct reduction of Jak1 and Jak2 phosphorylation, but rather
a decrease of Jak1 and Jak2 intrinsic activities in IFN--treated
SOCS1 and SOCS3 clones. In contrast, SOCS1 binds to the catalytic
domain of Jak2 specifically in the phosphorylated tyrosine 1007
residue, known as one of the major sites of autophosphorylation of Jak2
(20). The reduced IFN-R phosphorylation in SOCS1 and
SOCS3 keratinocyte clones led to a substantial inhibition of STAT1 and
STAT3 activation. In particular, SOCS1 overexpression in keratinocytes
markedly inhibited the IFN--induced STAT1 phosphorylation on both
tyrosine 701 and serine 727 residues. Although the mechanisms through
which STAT1 is phosphorylated on serine are not yet fully understood,
it is known that Jak2 is required for STAT1 serine phosphorylation in
response to IFN- (32). Therefore, the inhibition of the
IFN--induced serine phosphorylation of STAT1 by SOCS1 and SOCS3 can
occur indirectly through the abrogation of Jak2 activity. Inhibition of
STAT1 and STAT3 phosphorylation was observed in all the
SOCS1-expressing keratinocytes clones, in six of nine SOCS3 clones, and
in none of the 20 SOCS2 clones examined, although the expression of
SOCS2 protein was comparable with those of SOCS1 and SOCS3. Compared
with SOCS1, SOCS3 appears to be a weaker inhibitor of IFN-
signaling, possibly because SOCS3 is not very efficient in binding and
inhibiting the catalytic domain of Jak proteins (20). As a
direct consequence of inhibition of STAT1 activation, we found a
significant reduction of ICAM-1 and HLA-DR expression and IP-10 and Mig
production in IFN--activated SOCS1 clones and in four of nine SOCS3
clones. Moreover, SOCS1, but not SOCS3, overexpression inhibited
IFN--induced MCP-1 release in keratinocytes. Consistent with these
results, mice lacking SOCS1 die of a complex disease characterized by a
massive T cell, macrophage, and eosinophil infiltration of visceral
organs and the skin (15, 33). Membrane molecule and
chemokine production was not affected by SOCS2 constitutive expression.
Interestingly, in a small percentage of SOCS2 clones (4 of 20) a
superinduction of ICAM-1, HLA-DR, IP-10, Mig, and MCP-1 was observed.
These findings can be explained by considering SOCS2 as a negative
regulator of SOCS1 and SOCS3. Indeed, previous works showed the SOCS2
capacity of restoring sensitivity of 293 cells to prolactin and growth
hormone suppressed by SOCS1 (34, 35). Because SOCS2
protein does not contain kinase inhibitory region domain
(10) but can interact with Jak1 and Jak2 (Fig. 5
), it is
possible that SOCS2 functions as an inefficacious pseudosubstrate for
Jak1 and Jak2 or as a competitor of SOCS1 or SOCS3. Another interesting
feature of SOCS1 clones was their capacity to produce higher amounts of
IL-8 compared with SOCS2 and SOCS3 clones and to actively proliferate
even in the presence of IFN-. Despite the higher constitutive
production of IL-8, SOCS1 clones did not up-regulate this chemokine in
response to IFN-. We are currently investigating the mechanisms by
which SOCS1 influences IL-8 production, and whether enhanced IL-8
production and abrogated IFN--induced growth inhibition in SOCS1
clones are related.
Targeting of SOCS molecules can be an important strategy for the
control of cytokine-induced disorders. Indeed, SOCS3 overexpression
with blockade of the IL-6/STAT3 pathway improved experimental
intestinal inflammation and arthritis (18, 36). Our study
provides the first evidences of SOCS expression in human keratinocytes
and in immune-mediated skin diseases. Keratinocytes overexpressing
SOCS1 are particularly resistant to the proinflammatory effect of
IFN-. Interestingly, this resistance is achieved at the most
proximal step of IFN- pathway, namely at the receptor level, and it
is effective in preventing downstream expression of relevant
inflammatory genes. These findings identify SOCS1 as a potential
molecular target for the treatment of IFN--dependent skin
diseases.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 M.F., M.L.G., and C.S. contributed equally to this paper.
3 Address correspondence and reprint requests to Dr. Cristina Albanesi, Laboratory of Immunology, Istituto Dermopatico dell’Immacolata, Via Monti di Creta, 104, 00167 Rome, Italy. E-mail address: c.albanesi{at}idi.it
4 Abbreviations used in this paper: ACD, allergic contact dermatitis; AD, atopic dermatitis; PS, phosphoserine; MCP, monocyte chemoattractant protein; Mig, monokine induced by IFN-; SOCS, suppressor of cytokine signaling; CIS, cytokine-inducible SH2 protein; Jak, Janus kinase; GAS, -activated sequence; IP-10, IFN--inducible protein-10; PY, phosphotyrosine.
Received for publication February 8, 2002. Accepted for publication April 19, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and TNF-. J. Immunol. 162:494.-inducible gene and confers resistance to interferons. Blood 92:1668. signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98:597.[Medline]
cell insulin gene transcription and secretion in response to interferon-. J. Biol. Chem. 276:25862.-cells against interleukin-1- and interferon--mediated toxicity. Proc. Natl. Acad. Sci. USA 98:12191.-stimulated human keratinocytes express the genes necessary for the production of peptide-loaded MHC class II molecules. J. Invest. Dermatol. 110:138.[Medline]
-dependent intercellular adhesion molecule-1 (ICAM-1) expression using dominant-negative Stat1. J. Biol. Chem. 272:28582. requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
and interferon . Proc. Natl. Acad. Sci. USA 93:7673.-containing complexes play a predominant role in induction of IFN--inducible protein, 10 kDa (IP-10) by IFN- alone or in synergy with TNF-. J. Immunol. 161:4736. (IFN-)-inducible chemokine Mig in IFN--deficient mice. J. Biol. Chem. 276:7568.-stimulated monocyte chemoattractant protein-1 gene transcription. J. Immunol. 161:3719. through Stat1-dependent and -independent pathways. EMBO J. 19:263.[Medline]
and lacking SOCS-1 gene. Proc. Natl. Acad. Sci. USA 97:9174.This article has been cited by other articles:
|
|
 |
|
  S. Madonna, C. Scarponi, O. De Pita, and C. Albanesi Suppressor of cytokine signaling 1 inhibits IFN-{gamma} inflammatory signaling in human keratinocytes by sustaining ERK1/2 activation FASEB J, September 1, 2008; 22(9): 3287 - 3297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wang, M. Zhou, J. Brand, and L. Huang Inflammation Activates the Interferon Signaling Pathways in Taste Bud Cells J. Neurosci., October 3, 2007; 27(40): 10703 - 10713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Isomaki, T. Alanara, P. Isohanni, A. Lagerstedt, M. Korpela, T. Moilanen, T. Visakorpi, and O. Silvennoinen The expression of SOCS is altered in rheumatoid arthritis Rheumatology, October 1, 2007; 46(10): 1538 - 1546. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Albanesi, H. R. Fairchild, S. Madonna, C. Scarponi, O. De Pita, D. Y. M. Leung, and M. D. Howell IL-4 and IL-13 Negatively Regulate TNF-{alpha}- and IFN-{gamma}-Induced beta-Defensin Expression through STAT-6, Suppressor of Cytokine Signaling (SOCS)-1, and SOCS-3 J. Immunol., July 15, 2007; 179(2): 984 - 992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Balabanov, K. Strand, A. Kemper, J. Y. Lee, and B. Popko Suppressor of cytokine signaling 1 expression protects oligodendrocytes from the deleterious effects of interferon-gamma. J. Neurosci., May 10, 2006; 26(19): 5143 - 5152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Scotton, F. O. Martinez, M. J. Smelt, M. Sironi, M. Locati, A. Mantovani, and S. Sozzani Transcriptional Profiling Reveals Complex Regulation of the Monocyte IL-1{beta} System by IL-13 J. Immunol., January 15, 2005; 174(2): 834 - 845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Travagli, M. Letourneur, J. Bertoglio, and J. Pierre STAT6 and Ets-1 Form a Stable Complex That Modulates Socs-1 Expression by Interleukin-4 in Keratinocytes J. Biol. Chem., August 20, 2004; 279(34): 35183 - 35192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Klunker, A. Trautmann, M. Akdis, J. Verhagen, P. Schmid-Grendelmeier, K. Blaser, and C. A. Akdis A Second Step of Chemotaxis After Transendothelial Migration: Keratinocytes Undergoing Apoptosis Release IFN-{gamma}-Inducible Protein 10, Monokine Induced by IFN-{gamma}, and IFN-{gamma}-Inducible {alpha}-Chemoattractant for T Cell Chemotaxis Toward Epidermis in Atopic Dermatitis J. Immunol., July 15, 2003; 171(2): 1078 - 1084. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
MFI)
for ICAM-1 and HLA-DR expression of two control, four SOCS1, three
SOCS2, and three SOCS3 clones after IFN-
), SOCS2 (
),
and SOCS3 (
) clones were cultured for the indicated time periods in
medium with or without 200 U/ml IFN-