| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Laboratory of Cellular Differentiation, Department of Stem Cell Biology, Lund University, Lund, Sweden
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3.1 kb from the predicted ATG. Transient
transfections revealed that this region was able to stimulate
transcription of a reporter gene in B lymphoid and to a lesser extent,
myeloid cells, but not in a pre-T cell line. The promoter was also able
to functionally interact with E47, suggesting that the EBF gene may be
a direct target for activation by E-proteins. In addition, functional
binding of EBF to its own promoter was confirmed by EMSA and
transfection assays indicating that the EBF protein may be involved in
an autoregulatory loop. Finally, a tissue-restricted factor was able to
bind an upstream regulatory region in B-lineage cells, further
supporting the idea that the cloned promoter participates in the
regulation of stage and lineage specific expression of the EBF
gene. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
EBF is expressed in B lymphocytes, adipose tissue (20), and stromal cell lines (M. Sigvardsson, unpublished observations), as well as in neural cells of different origins (21, 22). The rather broad overall expression pattern is contrasted by an apparently restricted expression in hemopoiesis where EBF only appear to be expressed in B lineage cells (20, 23). This expression pattern, in combination with the large number of B cell-restricted target genes (14, 15, 16, 17, 18, 19), and the phenotype of EBF-deficient mice (13) indicate that EBF may be of key importance for the specification of the B lineage. Thus, the resolution of how the EBF gene is transcriptionally controlled might give extended insight into how lineage commitment is achieved in the bone marrow.
The EBF gene has been suggested to be a target for the
basic-helix-loop-helix E-protein E12, encoded by the E2A gene
(24), because stable ectopic expression of this protein in
de-differentiated 70Z/3 pre-B cells resulted in the production of EBF
transcripts (25). To directly investigate how the EBF gene
is transcriptionally controlled, we made 5' rapid amplification of cDNA
end (RACE) experiments and compared the obtained cDNAs with genomic DNA
encompassing the 5' end of the EBF gene. This resulted in the cloning
of an alternatively spliced EBF message and a novel exon located 3.1
kb from the predicted ATG. Primer extension analysis suggested that
transcription was initiated at multiple sites within this region and
two major start sites could be mapped to potential initiator elements.
Cloning of genomic DNA including these start sites in front of a
reporter gene revealed that this region composed a promoter element
able to stimulate initiation of transcription. The promoter harbored
binding sites for both EBF and E47, indicating that the EBF
gene is controlled by autoregulation and is a direct target for
activation by E47 or possibly other E-proteins.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B220+ cells were obtained by homogenization of spleens from C57BL/6 mice, followed by filtering through a 70-µm mesh. The B220+ cells was then purified on an anti-B220 MACS column (Miltenyi Biotec, Auburn, CA).
RT-PCR
RNA was prepared from cells using TRIzol (Life Technologies,
Grand Island, NY), and cDNA was generated by annealing 1 µg of total
RNA to 0.5 µg of random hexamers in 10 µl diethyl
pyrocarbonate-treated water. RT reactions were performed with
200 U of Moloney murine leukemia virus reverse transcriptase
(M-MuLV-RT) (Boehringer Mannheim, Bromma, Sweden) in accordance with
the manufacturer’s recommendations. One-twentieth of the RT reaction
was used in the PCR assays. PCR was performed with 1 U of
Taq polymerase (Life Technologies) in the manufacturer’s
buffer supplemented with 0.2 mM dNTP, in a total volume of 25 µl.
GADPH was amplified by 28 cycles (94°C, 30 s, 55°C, 30 s,
and 72°C, 30 s) while 30 cycles were used to amplify EBF cDNA
(94°C, 30 s, 61°C, 30 s, and 72°C, 30 s). Primers
were added to a final concentration of 1 mM. The PCR products were
blotted onto Hybond N+ nylon membranes (Amersham,
Uppsala, Sweden) using capillary blotting with 0.4 M NaOH. Membranes
were prehybridized in 5x Denhart’s solution, 6x SSC, 0.1% SDS, and
50 µg/ml salmon sperm DNA, at 57°C for 90 min and hybridized with
-32P-labeled random primed cDNAs at 65°C in
the same solution. Membranes were washed at room temperature two times
in 2x SSC supplemented with 0.1% SDS for 15 min.
Oligonucleotides used for RT-PCR were GADPH sense 5'-CACAGGACTAGAACACCTGC; GADPH antisense 5'-GCTGGTGAAAAGGACCTCT; exon 1 sense 5'-GTTCGGCAGTCCCAACACGCATCC; and exon 1 antisense 5'-CCAGCGGCTCTTCCTTCATAC.
Tissue culture conditions
All cells were grown in RPMI medium supplemented with 7.5% FCS, 10 mM HEPES, 2 mM pyruvate, 50 µM 2-ME, and 50 µg gentamicin/ml (complete RPMI medium; all purchased from Life Technologies, Täby, Sweden) at 37°C and 5% CO2.
Transient transfections and luciferase assays
Lymphoid cells were washed twice in TBS (140 mM NaCl, 5 mM KCl, 25 mM Tris, pH 7.4, 0.6 mM Na2HPO4, 0.5 mM MgCl2, 0.7 mM CaCl2). Transfection was performed by incubating 2.5 x 106 cells for 30 min at 20°C in 0.65-ml DEAE-dextran (0.7 mg/ml TBS; Pharmacia, Uppsala, Sweden) containing 2 µg reporter gene construct. The transfected cells were thereafter washed once in TBS and then cultured in 5 ml of complete RPMI medium in six-well plates for 48 h. Preparation of protein extracts and luciferase assays were performed with a dual-luciferase reporter assay system (Promega, Madison, WI) using 20% of the total protein extract. The obtained luciferase activity was normalized against the activity of a cotransfected (0.25 µg) CMV-controlled Renilla luciferase reporter gene.
HeLa cells (500,000) were washed once with serum-free medium (OPTIMEM; Life Technologies) and 800 µl of the medium was added for transfection. Lipofectin (5 µl; Life Technologies) was diluted in 100 µl of serum free medium, incubated for 45 min in room temperature and mixed with the DNA diluted in 100 µl medium. The mixture was incubated for 25 min and the combined volume of 200 µl was added to the cells. The cells were then incubated in a CO2 incubator at 37°C for 12 h, after which the transfection medium was removed and replaced by RPMI supplemented with 10% FCS. The cells were harvested after 40 h and protein extracts were prepared directly in the 24-well plates by adding 80 µl of cell lysis buffer (Promega, Falkenberg, Sweden). The luciferase assay was conducted using 20 µl of the obtained extracts and 200 µl of Luciferase assay reagent (Promega).
Phage library and cloning of genomic DNA
To obtain genomic DNA encompassing the EBF gene, a 
Fix
library containing genomic DNA inserts from I29 mouse liver was
used. PFU (600,000) were plated on 12 14-cm LM-agar plates,
nitrocellulose filters were lifted, and the library was screened by
hybridization of a random primed 32P-labeled cDNA
probe encoding the mouse EBF protein in 5x Denhart’s solution, 6x
SSC, 0.1% SDS, and 50 µg/ml salmon sperm DNA, at 65°C for
16 h. Membranes were washed twice at room temperature in 2x SSC
supplemented with 0.1% SDS for 15 min and twice in a solution
containing 0.1x SSC and 0.1% SDS. Phage DNA was digested with
SalI, and the inserts of genomic EBF DNA were ligated into
the SalI site of a pGEM3Z plasmid.
5' RACE, primer extension, and Northern blot analysis
Poly(A) + RNA was obtained by purification of total RNA,
prepared by TRIzol extraction as above, with a micro mRNA preparation
kit (Amersham) according to the manufacturer’s instructions. mRNA (5
µg) was then used for cDNA synthesis and RACE reaction using a RACE
analysis kit (Life Technologies), according to the manufacturer’s
protocol. Briefly, an oligonucleotide primer located 250 bp into the
cloned EBF gene, was annealed to the mRNA and first strand synthesis
was performed with Expand M-MuLV-RT (Roche, Basel, Switzerland). The
product was purified and the cDNA was modified by TdT-mediated addition
of a 5' oligo G tail. The RACE product was then amplified by PCR using
a second nested EBF specific primer and an oligo C primer. The obtained
PCR product was cloned into a pGEM3Z plasmid and sequenced. RACE primer
1, 5'-AGTGGAAGAAGTTGGATTTCCG; nested RACE primer,
5'-GAAGGCGGCTGCTTCTCAAAGTG.
Primer extension analysis was performed using 5 µg poly(A) RNA to
which a 32P-labeled oligonucleotide was annealed
in 30 µl 40 mM PIPES, pH 7.4, 0.4 M NaCl, 1 mM EDTA and 80%
deionized formamide. The mixture was incubated at 85°C for 10
min followed by an overnight incubation at 42°C. The obtained hybrid
was precipitated by the addition of 70 µl of diethyl
pyrocarbonate-treated H2O and 250 µl ethanol.
After centrifugation, the pellet was washed twice with 80% ethanol.
The dry pellet was then redissolved in 20 µl RT-reaction buffer and
extension was achieved by the addition of 5 U M-MuLV-RT (Boehringer
Mannheim). The obtained extension products were extracted
with phenol and chisam, precipitated by ethanol precipitation,
redissolved in formamide, and loaded on a 7% polyacrylamide
urea sequencing gel. The sequence ladders were obtained by T7-DNA
polymerase primer extension in the presence of
dideoxynucleotides. TS1 was defined based on size and alignment to a
sequence ladder generated by primer extension using the cloned genomic
DNA as template (see Fig. 2
B). TS2 was defined by direct
comparison to a sequence ladder obtained by extension of the same
primer as used for primer extension with genomic DNA as template (see
Fig. 2B). Primer extension 1,
5'-CAAGGCCCTCTGAGAGCTTCTGG; primer extension 2,
5'-CCGAAGCCAGGCCACTATCAAGG.
|
Protein extracts, EMSA
Nuclear extracts were prepared according to Schreiber et al.
(26). DNA probes were labeled with
[
-32P]ATP by incubation with T4
polynucleotide kinase (Boehringer Mannheim), annealed, and purified on
a 5% polyacrylamide Tris-borate-EDTA gel. Nuclear extract, or in
vitro transcribed-translated protein, was incubated with labeled
probe (20,000 cpm, 3 fmol) for 30 min at room temperature in binding
buffer (10 mM HEPES, pH 7.9, 70 mM KCl, 1 mM DTT, 1 mM EDTA, 2.5 mM
MgCl2) with 0.75 µg poly(dI/dC) (Pharmacia).
DNA competitors were added 10 min before the addition of the DNA probe.
The samples were separated on a 6% polyacrylamide Tris-borate-EDTA
gel, which was dried and subjected to autoradiography. Competitors were
added at molar excesses indicated in the respective figure legends.
Oligonucleotides used for electrophoretic mobility shift assays were as
follows: Mb-1 EBF sense, 5'-GAGAGAGACTCAAGGGAATTGTGG; Mb-1 EBF
antisense, 5'-CCACAATTCCCTTGAGTCTCTCTC; 5E sense,
5'-TCTTGTTCCATGGGGCAGGTGTTCAGTTGCTCTCTACGGC; 5E antisense,
5'-GCCGTAGAGAGCAACTGAACACCTGCCCCATGGAACAAGA; OCT sense,
5'-TTCATTGATTTGCATCGCATGAGACGCTAACATCGTACGTTC; OCT antisense,
5'-GAACGTACGATGTTAGCGTCTCATGCGATGCAAATCAATGAA; EBF promoter
E-box sense, 5'-CGTTTCCTCACCTGTACAATGG; EBF promoter E-box
antisense, 5'-CCATTGTACAGGTGAGGAAACG; EBF promoter
EBF site sense,
5'-TCTGGGACGATCCCGGGGGAAACCCGAGAGAGGCCTCAGCTCGT;
EBF promoter EBF site antisense,
5'-ACGAGCTGAGGCCTCTCTCGGGTTTCCCCCGGGATCGTCCCAGA; EBFP E-BOXM sense,
5'-CGTTTCCTCTGCAGTACAATGGGAGTG; EBFP EBOXM antisense,
5'-CATTGTACTGCAGAGGAAACGGAGGG; EBFP EBFM sense,
5'-GGACGATCCATATGGAAACCCGAGAGAGG; EBFP EBFM antisense,
5'-GGTTTCCATATGGATCGTCCCAGACAAT; EBF promoter -536 to -483
sense, 5'-GAATTCTAGTGGTGTTGAATAGCCCTTAGCTGCCTCTGCCGGGTGGAGGTTTGACT;
EBF promoter -536 to -483 antisense,
5'-AGTCAAACCTCCACCCGGCAGAGGCAGCTAAGGGCTAT TCAAC ACCACTAGAATTC; M1
sense, 5'-GAATTCTAGTGGTGTTGAATACAGCGTCACTGCCTCTGCCGGGTGGAGGT; M1
antisense,
5'-AGTCAAACCTCCACCCGGCAGAGGCAGTGACGCTGTATTCAACACCACTA;
M2 sense, 5'-GAATTCTACTCAGTTACGATAGCCCTTAGCTGCCTCT GCCGGGTGGAGGT;
M2 antisense, 5'-AGTCAAACCTCCACCCGGCAGA GGCAGCTAAGGGCTATCGTAACTGA
GTA; M3 sense, 5'-GAATTCTAC
TCATGTTGAATAGCCCTTAGCTGCCTCTGCCGGGTGGAGGT; M3 anti-sense,
5'-ACCTCCACCCGGCAGAGGCAGCTAAGGGCTATTCAACATG AGTAGAATTC; M4 sense,
GAATTCTAGTGGTGTACGATAGCCCTTAGCTGCCTAGGT; M4 antisense,
ACCTCCACCCGGCAGAGGCAGCT AAG GGCTATCGTACACCACTAGAATTC.
Abs used in EMSA analysis were either purchased from Santa Cruz Biotechnology (Santa Cruz, CA); anti-myc 9E10 or anti E47 (N-649) were directed against the E47-specific DNA binding and dimerization domain of E47, therefore abolishing DNA binding activity. The anti-EBF rabbit sera was raised against a peptide from the C-terminal region of EBF (R. Gisler and M. Sigvardsson, unpublished observations).
Plasmids and constructs
The EBF and E47 expression plasmids (16, 27) was
based on the eukaryotic expression vector cDNA3 (Invitrogen, Leek, The
Netherlands) which places the inserted cDNA under the control of a CMV
promoter. The EBF promoter reporter plasmids were based on the
luciferase encoding vector pGl3-basic (Promega). The full-length
promoter construct was obtained by the initial cloning of a PCR product
spanning the region from +299 bp 3' of the TS2 transcription initiation
site up to the EcoRI site, generated by 20 cycles of high
fidelity PCR (Boehringer Mannheim) using primer extension primer 1 and
a T7 promoter primer with a subcloned EcoRI fragment as
template. The obtained fragment was cloned into the SmaI
site of pGl3 to yield the 
RI reporter plasmid. The construct was
verified by sequencing, digested with EcoRI, and extended by
ligation of a 6-kb EcoRI fragment from genomic DNA. The
extended promoter was then digested with SacI and
re-ligated, resulting in the SacI plasmid. The remaining
5' deletions were obtained by nuclease digestions using the
Erase-a-Base system (Promega) after digestion of the full-length
plasmid with NheI followed blunting with thioDNTPs and
Klenow enzyme. The plasmid was then redigested with MluI to
create a nuclease-sensitive 5' overhang. The sizes of the obtained
promoter fragments were estimated by restriction enzyme analysis and
the 1 deletion by sequencing. The P construct was obtained by
cloning of a PCR fragment generated from the RI plasmid using a RV3
(Promega) primer and an antisense E-box oligonucleotide (see above),
into the SmaI site of pGl3. The construct was verified by
sequencing. Point mutations in the EBF promoter E-box and EBF sites
were introduced by PCR amplification of the 5' part of the promoters
using antisense primers where the binding sites had been disrupted by
the insertion of restriction sites (NdeI in the EBF site and
PstI in the E-box) and the RV3 primer, with the RI
construct as template. The 5' end of the promoters were then cloned
into pGl3,redigested, and ligated to the 3' part of the promoter
amplified by use of mutated sense oligonucleotides and Gl-2 primers
with the RI promoter as template. The EBF/E-box double mutant
promoters were obtained by PCR amplification of the E-box mutated
reporter plasmid with the EBF site-mutated antisense oligonucleotide
and a RV3. The obtained fragment was digested with NdeI and
ligated into the EBFM plasmid. All mutations were verified by
sequencing.
EBFp (+299) antisense, 5'-CAAAGGCCCTCTGAGAGCTTCTGG; EBFP E-BOXM sense, 5'-CGTTTCCTCTGCAGTACAATGGGAGTG; EBFP EBOXM antisense, 5'-CATTGTACTGCAGAGGAAACGGAGGG; EBFP EBFM sense, 5'-GGACGATCCATATGGAAACCCGAGAGAGG; EBFP EBFM antisense, 5'-GGTTTCCATATGGATCGTCCCAGACAAT.
The TATA box reporter plasmid was a kind gift from Professor T.
Leanderson and consists of a SP6 
promoter TATA-box cloned into the
polylinker of pGl3 (28).
In vitro transcription and translation
Recombinant proteins were generated by coupled in vitro transcription-translation by using a reticulocyte lysate kit (Promega). Reaction mix (0.5 of 25 µl) was used for EMSAs.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The published EBF cDNA corresponds to a message of 2.3 kb, while
Northern blot analysis from pre-B or B cell lines indicate
thepresence of several messages ranging from 2.7 to 5.6 kb in
size (20). This suggests that the actual transcription
initiation site and promoter of the EBF gene might be located at a
rather large distance from the defined translation start codon. To
obtain a 5' end of the mRNA, we performed 5' RACE analysis using
poly(A) RNA from the EBF expressing pre-B cell line 70Z/3 and
oligonucleotides positioned 200 bp 3' of the ATG in the published
cDNA (20). This resulted in a number of PCR products
containing 5' parts of the EBF mRNA. Several of these represented the
continuation of the published cDNA presenting a perfect correlation
with the genomic DNA while others presented a differentially spliced 5'
end. This mRNA was spliced to a site just 3' of the predicted ATG,
deleting this from the message, extending into a new 5' exon (Fig. 1A). The novel exon contained
two potential translation start codons, but these would produce short
peptides due to in-frame stop codons and therefore, it is more likely
that translation is initiated at the second ATG in the published EBF
cDNA resulting in the truncation of 14 aa (Fig. 1, A
and C). The splicing occurred between a consensus splice
donor at the 3' end of the new exon and a splice acceptor site in the
coding region of EBF (Fig. 1C) suggesting that the EBF mRNA
can be partially spliced. The expression of this splice form was also
verified by RT-PCR analysis using an anti-sense primer located
downstream of the alternative splice site and a sense primer in the
newly defined exon. The resulting PCR product was then hybridized to a
probe covering this new exon. The splice form was detected both in
70Z/3 cells and in primary sorted splenic B cells, but not in EBF
nonexpressing BaF/3 cells (16) (Fig. 1B). The
cDNA analysis was extended to include different primer combinations
hybridizing to the region between the ATG and the novel exon 1. This
resulted in a large number of differently sized PCR products indicating
that this region could give rise to a large number of differently
spliced 5' regions containing the novel exon 1 (data not shown).
Several attempts to obtain a longer message by nested 5'RACE based on
primers in the novel exon were largely in vain, since of 40 cloned
PCR products examined, all but one ended in the same region as the cDNA
defined in the initial RACE analysis (data not shown). To further
investigate this, we hybridized a probe spanning the novel exon to a
Northern Blot of poly(A)-positive 70Z/3 RNA (Fig. 1B). Using
the 16S and 23S RNAs from an ethidium bromide-stained parallel lane of
total RNA as m.w. marker, we obtained data indicating that the novel
exon hybridized to a number of transcripts ranging from 3 to 5.5 kb.
Thus, these data support that the cloned cDNAs represent the 5' end of
the mRNA and that the larger EBF messages are obtained by alternative
splicing of a message extending from the novel exon into the coding
region.
|
Fix phage-library containing genomic
DNA inserts from BALB/c liver. PFU (600,000) were plated and screened
using a random-primed mouse EBF cDNA probe. This resulted in 18
positive clones of which two were able to hybridize with a probe
covering the 5' region of the EBF cDNA. Southern blot analysis of these
phages suggested that one of them carried a 14-kb insert covering a
region of 8 kb upstream of the predicted EBF ATG and 6 kb 3' of the
same region and was thus selected for further analysis and sequencing.
The new exon could be identified in a region of the genomic DNA that
restriction enzyme analysis suggested to be located 3.1 kb from the
previously defined ATG (20) (Fig. 1
C). The 5' region of the EBF gene contains a tissue-restricted promoter
The results of the RACE analyses suggested that transcription was
initiated just 5' of the novel exon 1 and that this region would
contain a promoter region. Sequence analysis of the region 5' of the
new exon (Fig. 2A) revealed
that the GC content was 67% including 20 CG base combinations
indicative of CpG islands known to be involved in
transcriptional regulation of genes (29, 30). No obvious
TATA box was present in the presumed region of transcription
initiation, but several potential initiator elements were found. A
computer aided search using the Transfac-Matinspector V2.2 program
revealed several potential binding sites for transcription factors
including GATA-proteins, NF-B, AP4, and ets-proteins. The
analysis also suggested the existence of two perfect binding sites for
Ikaros proteins (31) and an E-protein binding E-box
(32, 33, 34). The region did also contain a potential binding
site for EBF itself with an 11 of 14 bp match to the consensus binding
site (35).
To identify sites of transcription initiation, we made a primer
extension analysis using two different primers located in the novel EBF
exon 1. No extension products were obtained using tRNA, while poly(A) +
RNA from the pre-B cell line 70Z/3 resulted in several products
including three major species (transcription start sites, TS1, 2, and
3; Fig. 2B). Of these, site 1 and 3 could not be detected
using mRNA from the EBF-negative WEHI3 cells while potential start site
2 was detected at lower levels also in these cells. Thus, to verify the
identity of this site, we made a second round of primer extensions
using another oligonucleotide located 5' of the first. This analysis
verified the existence of start site 2 because this reduced the
background levels obtained in from the WEHI3 cells even further (Fig. 2B). Exact start sites were defined by alignment to sequence
ladders from genomic DNA and revealed that they displayed similarities
to potential initiator (Inr) core sequences
(PyPyA+1NTPyPy) (36), having six of
seven bases match to TS1 and five of seven to TS2 (Fig. 2A).
Both TS1 and TS2 were also defined to the adenosine nucleotide being
the most common start site for Inr-initiated transcription
(36). The size of TS3 hindered us from defining the exact
start site for this transcript but its presence indicates that
transcription also is initiated further 5' of TS1 and TS2.
To investigate the functional properties of the region 5' of the
transcription initiation site, we cloned a 6-kb fragment including the
putative promoter region down to nucleotide +299, as counted from the
TS2 start site (Fig. 2A), into a pGl3 luciferase reporter
vector. Serial 5' deletions were then obtained by exonuclease III or
restriction enzyme digestion and the resulting reporter constructs were
transiently transfected into 70Z/3 pre-B cells (Fig. 3A). A reporter construct
containing 483 bp upstream of TS2 (1) displayed an activity seven
times what could be observed after transfection of the same reporter
gene under the control of a TATA-box alone, suggesting that the defined
region indeed contains a promoter element. This activity was further
increased to 8.5 when another 15 bp (498), or 20-fold when another
53 bp (RI), was added to the promoter suggesting that the 5' part of
this region contained additional positive control elements. A
comparable activity was observed after the addition of another 450 bp
up to the SacI site (Sac). Further extension of the
promoter region resulted in a gradual loss of functional activity
indicating that no more major positive control elements were to be
found in this region (data not shown). We also generated a promoter
(P) lacking the presumed transcriptional start sites but contained
the region from the E-box (-353) to the EcoRI site (-536).
The transfection of this reporter construct resulted in a functional
activity marginally above that obtained with a TATA-box alone,
suggesting that the upstream region by itself was unable to stimulate
expression of the reporter gene and the transcription is initiated in
the region defined by the primer extension analysis. Thus, the region
5' of the EBF gene do contain a promoter capable to stimulate
transcription of a reporter gene in a pre-B cell line.
|
RI) (Fig. 3B). Transfection into BaF/3
cells, representing a non-EBF expressing pro-B cell (16),
revealed that the promoter was active at a level 15-times that of a
TATA-box reporter. When the same reporter genes were transfected into
the EBF expressing pre-B cell lines 70Z/3 and 230–238, this resulted
in 20- and 17-fold higher activity then the TATA-box. Transfection of
the EBF promoter reporter into WEHI231 and K46 cells, representing
mature B cells expressing lower levels of EBF (20),
resulted in a 10- and 9-fold higher activity than the TATA reporter.
When the promoter was transfected into J558 plasmacytoma cells, the
promoter displayed 3-fold higher activity than the control plasmid
while transfection into 2017 pre-T cells suggested that the promoter
activities of the two constructs were essentially the same. The
promoter was active to a low level in WEHI3 macrophage cells where the
RI construct was 3.5 times as active as the TATA-box reporter.
Comparable 4-fold higher activity was also observed for the EBF
promoter after transfection into the human epitheloid HeLa cell line.
This suggests that the promoter displays a degree of restricted
activity and therefore may directly participate in the regulation of
stage and lineage specific transcription of the EBF gene. The EBF promoter is a direct target for transactivation by EBF and E47
EBF has been suggested to be a genetic target for transactivation
by the E2A protein E12 (25), or possibly the alternative
splice form from the E2A gene, E47 (24). E47 and
E12 both appear to bind to the same binding sites as homo- or
heterodimers, even though E12 homodimers appear to do so with lower
affinity than E47/E12 heterodimers or E47 homodimers (33).
Both of these proteins are suggested to participate in a complex and
essential network of transcriptional activators and repressors in the
early B lymphocyte (37, 38). Thus, the presence of a
potential binding site in the EBF promoter indicates that they may be
involved directly in the regulation of the EBF gene. The ability of E2A
proteins to interact with the E-box from the EBF promoter was examined
in an EMSA using in vitro translated syrian hamster E47
(39) bound to the E2 E-box from the 5 promoter
(27) (Fig. 4A,
left panel). The formation of this complex was not competed
for by addition of the EBF site oligonucleotide, while the addition of
EBF promoter E-box prevented the formation of the 5E-box/E47
complex. The promoter also contained a potential binding site for EBF
itself that would indicate that EBF might be involved in an
autoregulatory loop. The ability of EBF to interact with its promoter
was examined in an EMSA using recombinant in vitro-translated mouse EBF
and the mb-1 promoter EBF binding site (14) (Fig. 4A; right panel). This indicated that while the
EBF/mb-1 site complex was competed for by the addition of the potential
EBF site, it remained unaffected by the addition of the EBF-promoter
E-box containing oligonucleotide. These data suggest that both EBF and
E47 have the ability to interact with the EBF promoter. To verify these
findings, we used either the labeled EBF-promoter E-box or EBF site as
probes and in vitro-translated E47 or EBF protein in additional EMSAs
(Fig. 4B). None of the probes reacted to factors in the
unprogrammed reticulocyte lysate while prominent complexes were
detected using E47 programmed lysate and the E-box containing
oligonucleotide from the EBF-promoter. The complex formation was
reduced by the addition of the wild-type double-stranded E-box
oligonucleotide but not by the inclusion of an oligonucleotide
containing point mutations in the E-box. A similar result was found
using rEBF and the EBF-promoter EBF site because a complex was formed
that could be competed for by the inclusion of wild-type, but not
point-mutated, EBF promoter oligonucleotides. These data further
support the idea that both EBF and E47 have the ability to interact
with the promoter element.
|
1)
together with expression plasmids encoding EBF or E47 into epitheloid
HeLa cells (Fig. 4C). Inclusion of 300 ng EBF expression
plasmid resulted in a 2.3-fold induction of reporter activity while
inclusion of 600 ng expression plasmid resulted in a 4.5-fold activity
increase. Cotransfection of the EBF promoter with 300 or 600 ng E47
expression plasmid resulted in a 2- or 6-fold activity increase
respectively. Transfection of a basal fos-promoter together
with either EBF or E47 expression plasmids did not result in any
significant induction of reporter activity. This indicates that the
defined EBF promoter has the ability to functionally interact with both
EBF and E47.
To investigate the binding of proteins to the EBF-promoter EBF site and
E-box in nuclear extracts from a pre-B cell, we used the labeled EBF
site and E-box and nuclear extracts from 70/Z3 cells in additional
EMSAs (Fig. 5A). The
EBF-promoter EBF site formed one major complex (EBF) that was
nonreactive to preimmune sera while the complex was supershifted by the
addition of anti-EBF anti-sera (R. Gisler and M. Sigvardsson,
unpublished observations) suggesting that this site interacts with EBF
in the complex protein mixture in a nuclear extract. The E-box spanning
oligonucleotide formed one prominent complex with factors in the
nuclear extract and this complex was only marginally affected by the
inclusion of anti-myc Ab (9E10), while the addition of
anti-E47 blocking Abs completely abrogated complex formation
suggesting that the observed complex contains E2A proteins.
|
B). The activity obtained using an EBF site-mutated
RI construct was 48% that of the wild type, while the same promoter
with a mutated E-box yielded 52% of this activity. Mutations of both
the sites in the context of the RI promoter resulted in a promoter
with an activity comparable to that of the single mutants (43%). This
suggests that both these elements are important for the full function
of the promoter in a pre-B cell but that other elements still have the
ability to stimulate transcription in the 70Z/3 cells.
Having data supporting the idea that EBF and E-proteins are involved in
the regulation of the promoter in pre-B cells, we wanted to investigate
potential differences in promoter activation in cells representing
different stages of B cell development. To this end, we prepared
nuclear extracts from Ba/F3 pro-B cells, 70/Z3 pre-B cells, WEHI231 B
cells, and also WEHI3 macrophages. The integrity of the nuclear
extracts was investigated by use of a decamer containing labeled
oligonucleotide confirming that all the extracts contained intact Oct
proteins (Fig. 6A). Using the
EBF-promoter EBF site as a probe, we observed one major complex in the
pre-B cells and a less prominent complex of comparable size in the B
cells. The pro-B cell extract did not give rise to any prominent
complex while the nuclear extracts from the macrophages contained a
factor resulting in a prominent complex, but of an apparently different
migration pattern, as compared with the complex in the pre-B and B
cells (Fig. 6A). Two faint complexes were detected using
nuclear extracts from the Ba/F3 pro-B cells and the EBF-promoter E-box,
while an additional more prominent complex was detected in extracts
from the pre-B and B cells (Fig. 6A). No prominent complex
could be detected in extracts from the WEHI3 myeloid cells. These data
suggested that the EBF site and E-box interacted differentially with
nuclear factors from cell lines representing different stages of B cell
development. To investigate the functional consequences of this, we
transiently transfected the EBF site and E-box mutated EBF promoter
reporter plasmids into Ba/F3, 70/Z3 and WEHI231 cells (Fig. 6B). Mutation in the EBF site resulted in a reduced function
of the promoter in the 70/Z3 cells while this did not affect the
function of the promoter in either the Ba/F3 pro-B or WEHI231 B cells.
Mutation in the E-box resulted in a reduced function of the promoter in
all the tested cell lines, but the effect was more pronounced in the
70/Z3 and WEHI231, than in the Ba/F3, cells. This indicates that the
promoter may be regulated by different mechanisms at different stages
of B cell development.
|
The mutation of the EBF site and the E-box together with
transfection experiments in 70Z/3 cells suggested that the 5' region
between the 1 and the RI (-536 to -483) contains a positive
control element. To investigate the presence of nuclear factors with an
ability to interact with this region, we made EMSAs with nuclear
extracts from 70Z/3 pre-B cells and a labeled oligonucleotide spanning
the 53-bp region between the 1 and RI constructs (Fig. 7A). This resulted in several
complexes displaying a rapid migration in the gel but also one
apparently larger complex we denoted EBF promoter binding protein
(EPBP). The formation of this complex could be competed efficiently for
by the addition of a PCR-amplified promoter carrying the same region
(RI) while an amplified 1 promoter was largely inefficient in
this respect. This indicates that the functionally active region
possesses the ability to interact with nuclear factors in 70Z/3 pre-B
cells. EMSA experiments using the downstream region as a probe and
nuclear extracts from BaF/3 pro-B, 70Z/3 pre-B, WEHI231 B, and WEHI3
macrophage cells suggested that the protein only interacted with the
DNA in extracts from WEHI231 and 70Z/3 cells, but not from Ba/F3 or
WEHI3 cells (Fig. 7B). The integrity of the nuclear extracts
was examined by an EMSA using an Oct protein binding consensus decamer.
To further investigate the correlation between the function of the EBF
promoter control element and protein binding, we made a series of
transfections comparing the function of this element by transfections
of the 1 and RI reporter constructs in different cell lines (Fig. 7C). The element was a positive regulator in the 70Z/3 and
WEHI231 cells while no apparent function of this element could be
detected in Ba/F3 or WEHI3 cells suggesting that the function of the
element correlates to binding and presence of EPBP.
|
). In contrast, point mutations in the
5' part of the element (M2–4) greatly impaired the ability of the
corresponding double-stranded oligonucleotides to compete for complex
formation indicating an essence for this part of the element in the
interaction with EPBP. The region has been compared with known
transcription factor binding sites both manually and in the Transfac
database but without finding any homology to known binding sites. We
have also performed supershift experiments using commercially available
Abs against BSAP, ets1 and 2, Pu.1, Egr1, 2 and 3, NF-B
components P50, c-rel and relB, E2A, and E2-2,
but none of these was able to recognize the formed complex (data not
shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A). This is also supported by
restriction enzyme analysis of the promoter, suggesting it to be
resistant to digestion by the methylation sensitive enzyme
HpaII in BaF/3, but not 70Z/3 pre-B cells (E. M.
K. Smith, R. Gisler, and M. Sigvardsson, unpublished observations). It
is also most likely that other control elements are involved in the
regulation of this gene and these may well differ among the varying
cell types that express EBF. One possibly common feature of the
regulation of the promoter in different cell types defined in this
study comes from the finding that EBF may be involved in an
autoregulatory loop. Positive feedback loops can also be found in other
differentiation systems such as myogenesis where the
basic-helix-loop-helix protein MyoD participates in its own regulation
(40). The establishment of such loops may be of large
importance for transcription factors involved in the definition and
progression of a certain lineage. The ability of the EBF promoter to directly interact with E47 is in line with the previous observation that ectopic expression of another E2A protein E12 resulted in expression of EBF in macrophage dedifferentiated 70Z/3 cells (25). This further establishes the suggested functional hierarchy of transcription factors in early B cell development where E2A proteins, and possibly the B cell restricted E47 homodimer (41, 42, 43), appear to play a key role in the absolute earliest stages of B cell development. E2A proteins regulate a number of early genes (44, 45) as well as recombination events (46) and EBF (25) expression. E47 and EBF also collaborate to activate a number of target genes and to promote B cell development in a synergistic manner (16, 19, 27). In addition, EBF appear to participate in the regulation of another set of genes, such as the B29 gene (17) and the BSAP-encoding Pax-5 gene (19). BSAP appear to collaborate with EBF in the activation of, for instance, the mb-1 (14, 47) and Blk genes (18), but also appear to act independent of EBF in the regulation of the CD19 gene (48, 49). BSAP also appear to be crucial for the commitment of the B-lymphoid cell based on the finding that pro-B cells from BSAP-deficient, but not normal, mice, can be differentiated into a large number of hemopoietic lineages (50, 51). Thus, B cell commitment appears to involve a highly ordered sequence of molecular events where transactivating factors participate in the regulation of complementary genes as well as of each other. However, it should be noted that neither of these transcription factors are specifically expressed in B lineage cells suggesting that more has to be learned about transcription factor networks and epigenetics in early B cell development.
Our data suggest that EBF transcripts are initiated in the promoter region defined in this report, but it also becomes apparent that other control elements are crucial to obtain stage- and lineage-specific expression of the EBF gene. Thus, the cloning of this promoter element represents one step against the understanding of how the EBF gene is controlled and its continuation, including identification of EPBP and other regulatory elements, will further aid in the molecular elucidation of lineage initiation and commitment in the bone marrow.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Mikael Sigvardsson, Laboratory for Cellular Differentiation, Department of Stem Cell Biology, Lund University, BMC B12, 281 24 Lund, Sweden. E-mail address: mikael.sigvardsson{at}stemcell.lu.se
3 Abbreviations used in this paper: BSAP, B cell-specific activator protein; EBF, early B cell factor; RACE, rapid amplification of cDNA ends; M-MuLV-RT, Moloney murine leukemia virus reverse transcriptase; EPBP, EBF promoter binding protein.
Received for publication November 13, 2001. Accepted for publication May 1, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain) gene is a genetic target for early B-cell factor. Mol. Cell. Biol. 19:392.5 promoter. Mol. Cell. Biol. 20:3640.This article has been cited by other articles:
|
|
 |
|
  M. A. Thal, T. L. Carvalho, T. He, H.-G. Kim, H. Gao, J. Hagman, and C. A. Klug Ebf1-mediated down-regulation of Id2 and Id3 is essential for specification of the B cell lineage PNAS, January 13, 2009; 106(2): 552 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Walter, C. Bonifer, and H. Tagoh Stem cell-specific epigenetic priming and B cell-specific transcriptional activation at the mouse Cd19 locus Blood, September 1, 2008; 112(5): 1673 - 1682. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kikuchi, H. Kasai, A. Watanabe, A. Y. Lai, and M. Kondo IL-7 Specifies B Cell Fate at the Common Lymphoid Progenitor to Pre-ProB Transition Stage by Maintaining Early B Cell Factor Expression J. Immunol., July 1, 2008; 181(1): 383 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bhalla, C. Spaulding, R. L. Brumbaugh, D. E. Zagort, M. E. Massari, C. Murre, and B. L. Kee Differential Roles for the E2A Activation Domains in B Lymphocytes and Macrophages J. Immunol., February 1, 2008; 180(3): 1694 - 1703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Magnusson, A. C. M. Brun, N. Miyake, J. Larsson, M. Ehinger, J. M. Bjornsson, A. Wutz, M. Sigvardsson, and S. Karlsson HOXA10 is a critical regulator for hematopoietic stem cells and erythroid/megakaryocyte development Blood, May 1, 2007; 109(9): 3687 - 3696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Jimenez, P. Akerblad, M. Sigvardsson, and E. D. Rosen Critical Role for Ebf1 and Ebf2 in the Adipogenic Transcriptional Cascade Mol. Cell. Biol., January 15, 2007; 27(2): 743 - 757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Roessler, I. Gyory, S. Imhof, M. Spivakov, R. R. Williams, M. Busslinger, A. G. Fisher, and R. Grosschedl Distinct Promoters Mediate the Regulation of Ebf1 Gene Expression by Interleukin-7 and Pax5 Mol. Cell. Biol., January 15, 2007; 27(2): 579 - 594. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Akerblad, R. Mansson, A. Lagergren, S. Westerlund, B. Basta, U. Lind, A. Thelin, R. Gisler, D. Liberg, S. Nelander, et al. Gene expression analysis suggests that EBF-1 and PPAR{gamma}2 induce adipogenesis of NIH-3T3 cells with similar efficiency and kinetics Physiol Genomics, October 17, 2005; 23(2): 206 - 216. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Singh, K. L. Medina, and J. M. R. Pongubala Gene Regulatory Networks Special Feature: Contingent gene regulatory networks and B cell fate specification PNAS, April 5, 2005; 102(14): 4949 - 4953. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Seet, R. L. Brumbaugh, and B. L. Kee Early B Cell Factor Promotes B Lymphopoiesis with Reduced Interleukin 7 Responsiveness in the Absence of E2A J. Exp. Med., June 21, 2004; 199(12): 1689 - 1700. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Smith and M. Sigvardsson The roles of transcription factors in B lymphocyte commitment, development, and transformation J. Leukoc. Biol., June 1, 2004; 75(6): 973 - 981. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Liberg, M. Sigvardsson, and P. Akerblad The EBF/Olf/Collier Family of Transcription Factors: Regulators of Differentiation in Cells Originating from All Three Embryonal Germ Layers Mol. Cell. Biol., December 15, 2002; 22(24): 8389 - 8397. [Full Text] [PDF]
|
|
|
|
|
|
S. Greenbaum and Y. Zhuang Identification of E2A target genes in B lymphocyte development by using a gene tagging-based chromatin immunoprecipitation system PNAS, November 12, 2002; 99(23): 15030 - 15035. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
