| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
,¶,||
* Children’s Foundation Research Center, Le Bonheur Children’s Hospital, and Department of Pediatrics, University of Tennessee Health Science Center, Memphis, TN 38103;
Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN 46202;
Walther Oncology Center, Walther Cancer Institute, Indianapolis, IN 46208;
Interdisciplinary Graduate Program in Immunology and Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA 52242;
¶ Department of Veteran Affairs Medical Center, Iowa City, IA 52246; and
|| Coley Pharmaceutical Group, Wellesley, MA 02481
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CpG DNA induces B cell proliferation, TNF-
, IL-6, IL-10 and Ig
secretion, and apoptosis resistance (2, 6, 7, 8, 9, 10, 11, 12, 13). In
addition to its direct effects on B lymphocytes, CpG DNA also directly
activates monocytes/macrophages and DC to secrete various cytokines,
including type I IFNs, TNF-, IL-1, IL-6, and IL-12 (6, 10, 14, 15, 16). CpG DNA induces maturation of DC as well as
up-regulated expression of costimulatory factors in monocytic cells
(17, 18). In addition, some cytokines, such as IL-12, that
are secreted by monocytic cells after CpG DNA stimulation, act on NK
cells to induce their lytic activity and IFN-
production (19, 20). Overall, CpG DNA induces a Th1-like pattern of cytokine
production dominated by IL-12 and IFN- (19, 20, 21, 22, 23).
The biochemical mechanisms by which CpG DNA activates immune cells to
produce Th1 type cytokines are yet to be fully understood at the
present time. One of the early biochemical signaling events after CpG
DNA stimulation in macrophages is activation of mitogen-activated
protein kinases (MAPKs) including extracellular signal-regulated kinase
(ERK), c-Jun NH2-terminal kinase (JNK), and p38
(24, 25, 26). CpG DNA appears to use a Toll-like receptor
(TLR) signaling pathway for NF-
B and JNKs by recruiting
MyD88, IL-1R-associated kinase and TNFR-associated factor 6, and
TLR-9 (27, 28, 29). In contrast, evidence also exists for a
second pathway in which the DNA-activated protein kinase, DNA-PKcs, has
been suggested to mediate the response to CpG DNA
(30). Before cellular activation through these
pathways, CpG DNA appears to be endocytosed by leukocytes and
acidified in an endosomal compartment, which is coupled to the rapid
generation of intracellular reactive oxygen species (15).
Endosomal acidification of CpG DNA and the CpG DNA-induced reactive
oxygen species generation precedes activation of NF-B and MAPKs
(Refs. 24 and 25 ; A.-K. Yi and A. M.
Krieg, manuscript in preparation). CpG DNA-mediated NF-B has
been demonstrated to be required for all downstream events such as
protooncogene expression, cytokine production, B cell proliferation,
and apoptosis protection (3, 12, 13, 15). In turn, CpG
DNA-mediated MAPK activation has been reported to be involved in
cytokine production (24, 25, 26). However, it is largely
unknown how MAPKs activated by CpG DNA lead to the production of each
cytokine and whether activation of the different MAPK may play
differential roles in the production of Th1-type cytokines by CpG
DNA.
In this study, we show that CpG DNA induces production of IL-10, a prototype Th2-type cytokine, as well as IL-12, a Th1-type cytokine, in RAW264.7, a murine macrophage-like cell line. ERK and p38 MAPKs activated by CpG DNA are found to play differential roles in the regulation of cytokine production in these cells. In addition, we demonstrate that ERK plays a central negative regulatory role in the CpG DNA-mediated Th1 type response by promoting production of IL-10.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Nuclease resistant phosphorothioate oligodeoxynucleotides were supplied by the Coley Pharmaceutical Group (Wellesley, MA) and had no detectable endotoxins by Limulus assay. The sequences of nuclease resistant phosphorothioate oligodeoxynucleotides used are 5'-TCCATGACGTTCCTGACGTT-3' (CpG DNA: 1826) and 5'-TCCAGGACTTCTCTCAGGTT-3' (non-CpG DNA: 1982).
Mice
C57BL/6 and IL-10 gene-disrupted mice (IL-10 knockout (KO)) at 5–10 wk of age were used as a source of lymphocytes. IL-10KO mice were kindly provided by Dr. J. Weinstock (University of Iowa, Iowa City, IA). All other mice were obtained from The Jackson Laboratory (Bar Harbor, ME), and were bred and maintained under specific pathogen-free conditions.
Cell lines, culture conditions, and reagents
Murine spleen cells and RAW264.7 cells (American Type Culture Collection, Rockville, MD) were cultured at 37°C in a 5% CO2 humidified incubator and maintained in RPMI 1640 supplemented with 10% (v/v) heat-inactivated FCS, 1.5 mM L-glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 µg/ml streptomycin. All culture reagents were purchased from Life Technologies (Gaithersburg, MD). LPS (Salmonella typhimurium) was purchased from Sigma Aldrich (St. Louis, MO). SB202190, a p38 inhibitor, and U0126, a mitogen-activated protein kinase kinase (MEK) inhibitor, were purchased from Calbiochem (La Jolla, CA).
Cytokine-specific ELISA
RAW264.7 cells (5 x 105 cells/ml for
TNF- and 2 x 106 cells/ml for IL-10 and
IL-12) or mouse spleen cells (1.6 x 106/ml
for IL-6, IL-10, and IL-12) were treated with medium, CpG DNA (0.06–3
µg/ml), LPS (50 ng/ml), or PMA (50 ng/ml) plus ionomycin (1 µM) in
the presence or absence of DMSO, U0126 (2.5 µM), or SB202190 (2.5
µM) for 6 (for TNF-) or 24 h (for IL-6, IL-10, and IL-12). In
some experiments, cells were stimulated with CpG DNA in the presence or
absence of U0126 and recombinant murine (rm) IL-10 (1–100 ng/ml).
Culture supernatants were analyzed by ELISA for TNF-, IL-6, IL-10,
IL-12p40, or IL-12p70 as described previously (7). All
recombinant murine cytokines and Abs specific for murine cytokines were
purchased from BD PharMingen (San Diego, CA).
Transfections, luciferase assay, and 
-galactosidase assay
RAW264.7 cells (
80% confluent in a 100-mm tissue culture
dish) were transfected with AP1--galactosidase (8 µg), or a
mixture of NF-B-luciferase (4 µg) and pRL-TK-luciferase (1 µg)
constructs using LipofectAMINE PLUS (Life Technologies). Transfected
cells were pooled and washed three times with culture media. A total of
5 x 105 cells/ml were stimulated with
media, CpG DNA (3 µg/ml), LPS (50 ng/ml), or PMA (50 ng/ml) in the
presence or absence of DMSO, U0126 (2.5 µM), or SB202190 (2.5 µM)
for 12 h. -Galactosidase and luciferase activities in cell
extracts were analyzed according to manufacturer’s protocol using
Galacto-Light Plus Reporter gene assay (Tropix, Bedford, MA) and
Dual-Luciferase Reporter Assay System (Promega, Madison, WI),
respectively. Luciferase activity was normalized using
pRL-TK-luciferase activity in each sample. For AP1--galactosidase
assay, equal concentrations of cell lysates were used.
AP1--galactosidase and NF-B-luciferase constructs were kindly
provided by Dr. G. Koretzky (University of Pennsylvania, Philadelphia,
PA) (31).
Preparation of RNA and real-time PCR
RAW264.7 cells (2 x 106 cells/ml)
were stimulated with media or CpG DNA (3 µg/ml) in the presence or
absence of DMSO, U0126 (2.5 µM), or SB202190 (2.5 µM). Cells were
harvested 1 or 4 h after DNA treatments and total RNA was isolated
by using RNeasy Mini kit (Qiagen, Valencia, CA) following the
manufacturer’s protocol. To measure the relative amount of cytokine
mRNAs, amplification of sample cDNA was monitored with the fluorescent
DNA binding dye SYBR Green in combination with the ABI 5700 sequence
detection system (Applied Biosystems, Foster City, CA) according to the
manufacturer’s instructions. Forward and reverse primers were designed
using primerExpress software (Applied Biosystems). GAPDH was used for
endogenous control. The PCR primers used in this study are: TNF-
(forward: CCACCATCAAGGACTCAAATGG, reverse: TTATTTGGAAGGCCGGGGT), IL-10
(forward: GGTTGCCAAGCCTTATCGGA, reverse: ACCTGCTCCACTGCCTTGCT);
IL-12p40 (forward: GGAAGCACGGCAGCAGAATA, reverse:
AACTTGAGGGAGAAGTAGGAATGG), IL-12p35 (forward:
CCTCAGTTTGGCCAGGGTC, reverse: CAGGTTTCGGGACTGGCTAAG), SOCS1
(forward: ACCTTCTTGGTGCGCGAC, reverse: AAGCCATCTTCACGCTGAGC),
SOCS3 (forward: GCGGGCACCTTTCTTATCC, reverse:
TCCCCGACTGGGTCTTGAC), and GAPDH (forward:
TTCACCACCATGGAGAAGGC, reverse: GGCATGGACTGTGGTCATGA).
Preparation of whole-cell lysates and nuclear extracts, Western blot analysis, and EMSA
RAW264.7 cells (2 x 106 cells/ml)
were pretreated with DMSO, U0126 (2.5 µM), or SB202190 (2.5 µM) for
15 min before stimulation with medium, CpG DNA (3 µg/ml), or LPS (50
ng/ml). Cells were harvested at the indicated time points and then
whole-cell lysates or nuclear extracts were prepared as previously
described (15, 25). To detect phosphorylated Raf1, MEK1/2,
ERK, JNK, p38, activating transcription factor (ATF)2, MAPK
activated protein kinase-2 (MAPKAPK-2), CREB, or STAT1, equal
amounts of whole-cell lysates (15 µg/lane) were subjected to
electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS
(SDS-PAGE), and then Western blots were performed as previously
described (25) using a specific Ab against the
phosphorylated form of each protein. Specific Abs against the
phosphorylated form of Raf1, MEK1/2, ERK, JNK, p38, ATF2, MAPKAPK-2,
and CREB were purchased from New England Biolabs (Beverly, MA).
Specific Abs against the phosphorylated form of STAT1 were purchased
from Upstate Biotechnology (Lake Placid, NY). Specific Ab against p38
was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). To detect
DNA binding activity of the transcription factor AP-1, NFAT, NF-IL-6,
NF-B, or Sp1, nuclear extracts (3 g/lane) were analyzed by EMSA as
previously described (15) using
32P-labeled double-stranded oligodeoxynucleotides
containing transcription factor binding sequence as a probe. The
oligonucleotide probes used in this study are: AP-1
(GATCTAGTGATGAGTCAGCCGGATC) (32), NFAT
(TGCCCAAAGAGGAAAATTTGTTTCATACAG) (33), NF-IL-6
(TCGAGACATTGCACAATCTG) (32), NF-B
(GTAGGGGACTTTCCGAGCTCGAGATCCTATG) (34),
IL-10-Sp1 (GAAGAGGGAGGAGCCTGAAT; Sp1 consensus site in IL-10
promoter region) (35), and probe K
(CAGAGATACTAATTTCTGTTTACATCATGCCTAAGGT; a sequence that binds to
the nuclear complex termed F1, which includes IFN regulatory factor
(IRF)-1, c-Rel, and GLp109, in the murine IL-12p40 promoter)
(36).
In vitro kinase assays
RAW264.7 cells (2 x 106 cells/ml) were pretreated with DMSO, or SB202190 (2.5 or 5 µM) for 15 min before stimulation with medium, or CpG DNA (3 µg/ml). After a 30-min stimulation, cells were harvested and whole-cell lysates were prepared. p38 in vitro kinase assay was performed using polyhistidine-tagged rATF2 as a substrate (25). Polyhistidine-tagged ATF2 and Ab against p38 were purchased from Santa Cruz Biotechnology.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CpG DNA can rapidly induce activation of MAPK family members in B
and monocytic cells (24, 25). In RAW264.7 cells, CpG DNA
induces activation of three MAPKs, ERK, JNK, and p38 within 30 min
(Fig. 1
A; Refs.
26 and 37). To investigate whether CpG DNA
induces activation of these three MAPKs in RAW264.7 cells through the
classical MAPK activation pathways, RAW264.7 cells were stimulated with
medium, CpG DNA, LPS, or PMA for 30 min. As an indication of
activation, the phosphorylation status of upstream signaling modulators
of three MAPKs was analyzed by Western blot using specific Abs that
recognize the phosphorylated forms of Raf1, MEK1/2, MAPK kinase
(MKK)3/6, or MKK4. As demonstrated in Fig. 1B, CpG
DNA induced phosphorylation of Raf1 and MEK1/2, upstream modulators of
ERK. CpG DNA also induced phosphorylation of MKK3/6, direct upstream
kinases of p38 MAPK, and MKK4, an upstream kinase of JNK, in RAW264.7
cells (Fig. 1, C and D). These results suggest
that CpG DNA activates ERK, p38, and JNK by activating their direct
upstream modulators in the classical MAPK activation pathway.
|
To insure specificity of U0126 and SB202190, RAW264.7 cells were
stimulated with media or CpG DNA in the presence or absence of U0126 or
SB202190 for 30 min. Phosphorylation of ERK, JNK, p38, ATF2, and
MAPKAPK-2 was analyzed by Western blot, and kinase activities of p38
were analyzed by in vitro kinase assay. MEK1/2 inhibitor U0126 at 2.5
µM inhibited the basal level of ERK phosphorylation as well as that
induced by CpG DNA without affecting phosphorylation of p52 JNK or p38
(Fig. 2A). These results
indicate the specific action of U0126 on MEK1/2 activity and
MEK1/2-dependent ERK activation by CpG DNA in RAW264.7 cells (Fig. 2A). As shown in Fig. 2, B and C, the
p38 kinase inhibitor SB202190 inhibited the CpG DNA-induced
phosphorylation of ATF2 and MAPKAPK-2, which are the known substrates
for p38, but did not affect the phosphorylation of JNK or ERK,
indicating specific inhibitory effects of SB202190 on the p38 activity.
The requirement for p38 activation in the CpG DNA-induced ATF2
activation is also demonstrated by the loss of CpG DNA-induced ATF2
phosphorylation in the presence of SB202190 (Fig. 2C).
|
Previously, we have reported that CpG DNA induces production of
the Th2-type cytokine IL-10 in murine spleen B cells and B cell lines
(10). In the present study, we investigated whether CpG
DNA is capable of inducing IL-10 as well as IL-12 production in
macrophage-like cells. RAW264.7 cells were stimulated with CpG DNA,
LPS, or PMA plus ionomycin for 6 or 24 h, and then levels of
TNF-, IL-10, IL-12p40, and IL-12p70 in culture supernatants were
measured by cytokine-specific ELISA. As demonstrated in Fig. 3, CpG DNA induces production of TNF-,
IL-10, and IL-12p40 in RAW264.7 cells. CpG DNA also induces IL-12p70
(biologically functional IL-12, which is composed of heterodimer of
IL-12p40 subunit and IL-12p35 subunit) in RAW264.7 cells, but induction
of IL-12p70 by CpG DNA alone was minimal (Fig. 3D; only
1-fold increase from the nonstimulated base level). Of interest, unlike
CpG DNA, LPS failed to induce production of IL-10 or IL-12 despite
inducing production of similar levels of TNF- and IL-6 in RAW264.7
cells (Fig. 3 and data not shown) (37, 38).
|
, IL-10, and IL-12 in culture supernatants were
measured by cytokine-specific ELISA. As demonstrated in Fig. 3
A, CpG DNA-induced TNF- production was partially
suppressed by MEK1/2 inhibitor or p38 inhibitor. Inhibition of p38 also
led to the substantial suppression of CpG DNA-mediated IL-10 and
IL-12p40 production in RAW264.7 cells (Fig. 3, B and
C). In contrast to the effects of blocking CpG DNA-induced
p38, prevention of CpG DNA-mediated ERK activation by U0126 almost
completely abolished IL-10 production while enhancing IL-12p40
production by CpG DNA. Surprisingly, in the presence of MEK1/2
inhibitor, IL-12p70 production by CpG DNA was dramatically increased,
by >100-fold from the basal level (Fig. 3D). These results
indicate that ERK and p38 have different regulatory roles in the CpG
DNA-mediated production of different cytokines in macrophages.
Because ERK and p38 can regulate cytokine production at both
transcriptional and posttranscriptional levels (39), we
investigated whether the suppressive and/or enhancing effects of ERK
and p38 on the production of IL-10 and IL-12 induced by CpG DNA were
also related to the levels of those cytokine mRNAs. RAW264.7 cells were
stimulated with CpG DNA in the presence or absence of U0126 or SB202190
at 2.5 µM for 1–4 h. Levels of TNF-, IL-10, IL-12p35, and
IL-12p40 mRNAs were analyzed using a semiquantitative real-time PCR. As
demonstrated in Fig. 4, levels of IL-10
mRNA and IL-12 mRNA were increased within 1 h after CpG DNA
stimulation. In contrast, LPS failed to induce expression of IL-10 and
IL-12p40 within 1 h (data not shown). Prevention of ERK activation
by U0126 greatly inhibited the CpG DNA-induced IL-10 mRNA expression,
but dramatically enhanced the CpG DNA-induced IL-12p40 mRNA expression.
Inhibition of p38 with the specific inhibitor SB202190 showed slight
enhancing effects on the CpG DNA-mediated IL-10 mRNA expression at
early time periods (1–2 h after CpG DNA stimulation), but showed
inhibitory effects at later time periods (Fig. 4, A and
B). SB202190 showed minimal suppressive effects on the CpG
DNA-mediated mRNA expression of IL-12p40 at the 1-h time point, but at
the 4-h time point, CpG DNA-induced IL-12p40 mRNA expression was
substantially diminished (Fig. 4, C and D). CpG
DNA in the presence or absence of U0126 or SB202190 induced little or
no change in the mRNA level of IL-12p35 subunit within 1 h (data
not shown). However, the level of IL-12p35 mRNA was slightly increased
by 4 h after CpG DNA stimulation. Inhibition of the CpG
DNA-mediated ERK activation by U0126 slightly but consistently
increased the mRNA level of IL-12p35 subunit over that induced by CpG
DNA alone (Fig. 4E). Levels of TNF- mRNA were also
increased by CpG DNA stimulation. This CpG DNA-induced TNF- mRNA
expression was suppressed by U0126 or SB202190 (Fig. 4F).
Taken together, these results demonstrate that the suppressive and/or
enhancing effects of ERK and p38 on the production of IL-10 and IL-12
protein induced by CpG DNA are correlated to the levels of those
cytokine mRNAs and that regulatory effects of ERK and p38 on the
production of IL-10 and IL-12 induced by CpG DNA may take place, at
least in part, at the transcriptional level.
|
The transcription of TNF-, IL-10, and IL-12 has been reported
to be regulated by several transcription factors, including AP-1, CREB,
IRF1, NF-B, NF-IL-6, NFAT, and Sp1 (35, 40, 41, 42, 43). CpG
DNA has been shown to induce both nuclear DNA binding activities and
transcriptional activities of AP-1 and NF-B in RAW264.7 cells
(37), but the effects of CpG DNA on CREB, IRF1, NF-IL-6,
NFAT, and Sp1 in RAW264.7 cells have not been reported. To determine
whether the CpG DNA-activated ERK and/or p38 play a functional role in
activation of one or more of these transcription factors, RAW264.7
cells were stimulated with CpG DNA for 1 or 19 h in the presence
or absence of U0126 or SB202190. DNA binding activities of AP-1,
NF-B, NF-IL-6, NFAT, Sp1, or nuclear complex F1 were analyzed by
EMSA. As shown in Fig. 5A, CpG
DNA-induced nuclear DNA binding activity of AP-1 was greatly inhibited
in the presence of either U0126 or SB202190 at 1 h. CpG
DNA-mediated AP-1 activation was sustained even at 19 h after
stimulation, at which time inhibition of MEK activity still resulted in
complete inhibition of CpG DNA-induced AP-1 DNA binding activity, while
inhibition of p38 activity resulted in minimal suppression (Fig. 5B). However, neither U0126 nor SB202190 inhibited nuclear
DNA binding activity of NF-B induced by CpG DNA at early or late
time points (Fig. 5, A and B). In addition, both
CpG DNA and LPS failed to induce nuclear DNA binding activity of
NF-IL-6 and NFAT under our experimental conditions (Fig. 5).
Furthermore, nuclear DNA binding activity of neither NF-IL-6 nor NFAT
was changed in the presence of U0126 or SB202190 (Fig. 5).
|
B-luciferase or AP-1--galactosidase, and then
stimulated with CpG DNA in the presence or absence of U0126 (2.5 µM)
or SB202190 (2.5 µM) for 12 h. As shown in Fig. 6A, inhibition of either
MEK1/2 or p38 resulted in substantial suppression of CpG DNA-induced
NF-B transcriptional activity at 12 h. In contrast,
LPS-mediated NF-B activation was not inhibited by U0126 but was
suppressed in the presence of SB202190. In addition, CpG DNA-induced,
as well as LPS-induced transcriptional activity of AP-1 was completely
blocked by MEK1/2 inhibitor U0126, but was only partially suppressed by
the p38 inhibitor SB202190 at 12 h (Fig. 6B). In
contrast, neither CpG DNA nor LPS induced transcriptional activity of
NFAT and NF-IL-6, and U0126 or SB202190 did not show any effects on
NFAT and NF-IL-6 activity (data not shown). These results indicate that
CpG DNA-mediated AP-1 activation requires ERK at both early and late
time points at the levels of both nuclear DNA binding and
transcriptional activities, but is only partially dependent on
activation of p38 at early time points. In contrast, both ERK and p38
may be involved in CpG DNA-mediated NF-B activation at the
transcriptional level, but not at the nuclear DNA binding level.
|
B and NF-IL-6, IRFs also appear to play a role in
the regulation of IL-12 expression. It has been reported that the
nuclear complex F1, which is composed of multiple nuclear factors
including IRF-1, c-Rel, and GLp109, binds at the Ets site in the
IL-12p40 promoter and plays a key role in the IL-12p40 expression
(36, 41). Therefore, we investigated whether CpG DNA
induces activation of F1 complex and if so, whether it is dependent on
the activation of ERK or p38. CpG DNA did not induce nuclear DNA
binding activity of complex F1 and neither U0126 nor SB202190 showed
any effect on the DNA binding activity of complex F1 (data not
shown).
In addition to AP-1, CREB and Sp1 reportedly participate in regulating
IL-10 gene expression (35, 43). Therefore, we investigated
whether CpG DNA activates CREB or Sp1 in an ERK- and/or a p38-dependent
manner. As shown in Fig. 7, CpG DNA
induces phosphorylation of CREB within 2 h. Interestingly, this
CpG DNA-induced CREB phosphorylation is dependent on activation of p38
but not ERK (Fig. 7). This result indicates that CpG DNA activates CREB
in a p38-dependent pathway in RAW264.7 cells. However, CpG DNA
treatment did not influence Sp1 DNA binding (data not shown).
|
IL-10 inhibits the production of inflammatory cytokines such as
IL-12. Therefore, it is possible that by inhibiting the CpG DNA-induced
IL-10 production, the MEK1/2 inhibitor U0126 could indirectly and
secondarily enhance the IL-12 production in RAW264.7. To test this
hypothesis, we examined whether exogenous IL-10 could suppress the
increased IL-12 production in the presence of MEK inhibitor. RAW264.7
cells were stimulated with CpG DNA in the presence or absence of U0126
and/or rmIL-10 for 24 h, and the levels of IL-12p40 or IL-12p70 in
the culture supernatants were measured by ELISA. As shown in Fig. 8, addition of exogenous rmIL-10
suppressed IL-12p40 and IL-12p70 production enhanced by MEK1/2
inhibition, as well as induced by CpG DNA alone. These results suggest
that IL-10 could contribute to suppression of the CpG DNA-induced IL-12
production and that ERK might act as a negative regulator of the CpG
DNA-mediated IL-12 production by promoting IL-10 production in RAW264.7
cells.
|
To confirm whether suppression of the CpG DNA-induced IL-10
production by MEK1/2 inhibitor is responsible for the enhancement in
the IL-12 production, spleen cells from wild-type or IL-10KO mice were
stimulated with CpG DNA in the presence or absence of MEK1/2 inhibitor
U0126 at 2.5 µM for 24 h. Levels of IL-10, IL-6, IL-12p40, and
IL-12p70 in the culture supernatants were measured by specific ELISA.
As demonstrated in Table I, CpG DNA
induced IL-10 production in wild-type mouse spleen cells, which was
completely abolished by U0126, indicating that as in RAW264.7 cells,
ERK is a positive regulator for IL-10 production in response to CpG
DNA. As expected, IL-10 production was not induced by CpG DNA in spleen
cells from IL-10KO mice. Consistent with the observation made in
RAW264.7 cells, CpG DNA strongly induced production of IL-12p40, and
U0126 pretreatment further enhanced this CpG DNA-induced IL-12p40
production in spleen cells from wild-type mice (Table I). CpG
DNA-induced IL-12p40 production was dramatically increased in spleen
cells from IL-10KO mice compared with that in spleen cells from
wild-type mice, further demonstrating the in vivo negative regulatory
role of IL-10 for IL-12 production. Furthermore, U0126 not only failed
to enhance production of IL-12p40 induced by CpG DNA stimulation in
IL-10KO spleen cells, but actually partially inhibited it (Table I). In
addition, CpG DNA also induced IL-12p70 production, and U0126
pretreatment further enhanced this CpG DNA-induced IL-12p70 production
in spleen cells from wild-type mice (Table I). As for the IL-12p40
production, CpG DNA-induced IL-12p70 production was dramatically
increased in spleen cells from IL-10KO mice compared with that in
spleen cells from wild-type mice, further demonstrating the in vivo
negative regulatory role of IL-10 for IL-12p70 production. Furthermore,
U0126 greatly inhibited production of IL-12p70 induced by CpG DNA
stimulation in IL-10KO spleen cells (Table I). In contrast, CpG
DNA-induced IL-6 production was almost completely inhibited by U0126 in
spleen cells from both wild-type and IL-10KO mice, indicating that CpG
DNA-mediated production of IL-6 in spleen cells is mainly regulated
though an IL-10-independent and ERK-dependent pathway (Table I). Like
IL-12 production, CpG DNA-induced IL-6 production was increased in
spleen cells from IL-10KO mice compared with the spleen cells from
wild-type mice, indicating the presence of an IL-10-dependent pathway
for negative regulation of IL-6 expression. These results indicate that
CpG DNA-mediated ERK activation in macrophages leads to the IL-10
production, which in turn negatively regulates IL-12 production and
that CpG DNA-induced IL-6 production is regulated by a ERK-dependent
pathway.
|
The molecular mechanisms by which IL-10 suppresses CpG DNA-induced
IL-12 expression are currently unknown. IL-10 may induce expression of
suppressive factors, such as SOCS1 and SOCS3, or may inhibit activation
of positive regulatory factors for proinflammatory cytokine production.
Therefore, we investigated whether CpG DNA induces expression of SOCS1
and SOCS3, and induces phosphorylation of STAT1 via an ERK-dependent
pathway. RAW264.7 cells were stimulated with CpG DNA in the presence or
absence of DMSO, U0126, and SB202190 for 2 h, and the levels of
SOCS1 and SOCS3 mRNA were analyzed using a semiquantitative real-time
PCR. As shown in Fig. 9, levels of both
SOCS1 and SOCS3 mRNA were increased upon CpG DNA stimulation. The CpG
DNA-induced SOCS1 expression was not affected by U0126 and SB202190
(Fig. 9A). In contrast, inhibition of ERK showed a minimal
suppressive effect while inhibition of p38 substantially suppressed the
CpG DNA-induced SOCS3 expression (Fig. 9B). These results
indicated that neither SOCS1 nor SOCS3 are the negative factor that
contributes to the enhanced IL-12 expression in the presence of a
MEK1/2 inhibitor.
|
A,
CpG DNA induced phosphorylation of STAT1 at both
Ser727 and Tyr701 residues
with different kinetics. This CpG DNA-induced phosphorylation of STAT1
at Tyr701, but not at
Ser727, was enhanced in the presence of a MEK
inhibitor U0126, but not in the presence of a p38 inhibitor SB202190
(Fig. 10, B and C). Furthermore, addition of
exogenous rIL-10 reversed U0126-induced enhancement of phosphorylation
of STAT1 at Tyr701 (Fig. 10D). These
results indicate that CpG DNA induces phosphorylation of STAT1 directly
or indirectly through IL-10 via an ERK-dependent pathway.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by APCs and NK cells, respectively (19, 20, 21, 22, 23).
Over the past few years, the molecular mechanisms by which CpG DNA
induces innate immunity have been rapidly uncovered, revealing that
recognition of CpG motifs requires TLR-9, and leads to the activation
of MAPKs, with the subsequent activation of NF-B and AP1, and the
induction of new gene expression (reviewed in Refs. 5 ,
47 , and 48). However, the contribution of the
different MAPKs to the CpG DNA-induced Th1 type response has not been
elucidated, and it is yet to be understood how CpG DNA-induced
inflammation is eventually down-regulated. In the present study, we
demonstrate that different MAPKs have distinct positive and negative
functional roles in the CpG DNA-mediated cytokine production in the
macrophage-like cell line RAW264.7. The p38 pathway contributes to the
CpG DNA-induced NF-B transcriptional activity, but not DNA binding
activity, to AP-1 DNA binding and transcriptional activity, to CREB
activation, and to expression of the proinflammatory cytokines TNF-,
IL-6, and IL-12. In contrast, the MEK/ERK pathway is required for CpG
DNA-induced AP-1 DNA binding and transcriptional activity, and for
expression of the anti-inflammatory cytokine IL-10, but opposes CpG
DNA-induced STAT1 activation and IL-12 expression.
CpG DNA activates different sets of MAPKs in different types of
leukocytes (24, 25, 26). CpG DNA activates only JNK and p38 in
murine B cell lines, human primary B cells, a murine monocytic cell
line J774, and primary DCs (24, 25, 26, 49). In contrast, CpG
DNA simultaneously activates all three MAPKs, ERK, JNK, and p38, in RAW
264.7 and primary macrophages (Figs. 1 and 2) (26, 37, 50). CpG DNA not only activates different sets of MAPKs in
different types of cells, but also induces the production of distinct
panels of cytokines. The levels of IL-6 and IL-12 produced by J774
cells and primary DCs after CpG DNA stimulation are robust, but there
is no or only minimal IL-10 or TNF- production (10, 15, 25, 37). Compared with J774 cells, RAW264.7 cells and primary
macrophages secrete substantial amounts of TNF- and IL-10, but very
low levels of IL-6 and IL-12 in response to CpG DNA (26, 37) (Fig. 3B). The current study ties together
several previous observations by confirming that p38 activity induced
by CpG DNA at least partly contributes to the production of TNF-,
IL-6, and IL-12p40 (24, 25, 37), and that in contrast, ERK
activation by CpG DNA promotes the TNF- production, but suppresses
IL-12p40 production in RAW264.7 cells (26, 37) (Fig. 3).
A previous study showed positive and negative effects of p38 and
ERK, respectively, on the LPS-induced IL-12p40 expression in J774 cells
and primary peritoneal macrophages (36). However, our
studies are in agreement with others in confirming that LPS alone does
not induce IL-12 production in RAW264.7 cells (38, 51). We
demonstrate that despite activating all three MAPKs in RAW264.7 cells
(Figs. 1 and 2), LPS, unlike CpG DNA, is in failing to induce IL-10 and
IL-12 production, even in the presence of ERK inhibition (Fig. 3 and
data not shown). CpG DNA and LPS trigger different TLRs, but share
common downstream signaling modulators for NF-B and MAPK activation,
such as MyD88, IL-1R-associated kinase, and TRAF6
(27, 28, 29). The mechanism of this difference between CpG DNA
and LPS on IL-10 and IL-12 production in RAW264.7 cells is not
currently known and of great interest.
Under our experimental conditions, inhibition of ERK or p38 activation
leads to partially reduced TNF- promoter activity and mRNA
expression, indicating that ERK and p38 at least partially contribute
to TNF- expression at the transcriptional level (Fig. 4F;
Ref. 37). In contrast to our findings, Hacker et al.
(26) showed no significant inhibition of the CpG
DNA-induced TNF- transcription by PD98059, another MEK inhibitor, in
RAW264.7 cells. This conflicting result between the study of Hacker et
al. (26) and our study may be due to slightly different
experimental conditions, different methods for analysis, and/or
different effects of inhibitors which block MEK activities through
different mechanisms. Despite this discrepancy regarding
transcriptional regulation of TNF- expression by ERK, as observed
earlier, our result also demonstrates that CpG DNA-induced IL-12p40
expression at both protein and mRNA levels is negatively regulated by
ERK (Figs. 3C, and 4, C and D). In
addition, our data show that inhibition of ERK induces both IL-12p40
and p70 production (Fig. 3D). IL-12p70 is a heterodimer of
the IL-12 p40 and p35 subunits (52). IL-12p35 generally is
expressed constitutively, while IL-12p40 expression is inducible and
limited to certain cell types (53). CpG DNA alone only
slightly induced IL-12p70 production from the basal level in RAW264.7
cells, but dramatically increased it in the absence of activated ERK
(Fig. 3D). This increase in IL-12p70 levels may be due to
increased production of IL-12p40 (Fig. 3C). Interestingly,
our real-time PCR data showed that in the absence of activated ERK, CpG
DNA-induced IL-12p35 expression was slightly increased (Fig. 4E). This result suggests that increases in the CpG
DNA-induced IL-12p70 production by U0126 may, at least in part, be due
to increased expression of IL-12p35 as well as IL-12p40. This
possibility is supported by a previous study demonstrating that
microbial products induce both IL-12p35 and p40 mRNA expression in DCs
and that IL-12p35 mRNA is a limiting factor for production of IL-12p70
(54).
Enhancement or suppression of the CpG DNA-induced cytokine
production by U0126 or SB202190 could be due to inhibitory or
activating effects of transcriptional factors, or it could be due to
posttranscriptional regulation. Our data showed that CpG DNA-induced
changes in the levels of cytokine proteins in the absence of ERK or p38
activation correlate with their mRNA levels (Figs. 3 and 4). Thus,
regulation of the CpG DNA-mediated cytokine production by ERK and p38
takes place at the transcriptional level, at least in part. NF-B is
a key factor in the induction of TNF-, IL-6, and IL-12p40 by CpG DNA
(3, 9, 15, 37, 38). However, neither U0126 nor SB202190
had significant effects on the CpG DNA-induced NF-B activation at
the nuclear DNA binding level (Fig. 5), which is consistent with their
reported failure to affect the LPS response (36).
Interestingly, inhibition of ERK or p38 showed slightly inhibitory
effects on the CpG DNA-induced transcriptional activity of NF-B
(Fig. 6A). The molecular mechanism of this selective
suppression in the CpG DNA-induced transcriptional activity of NF-B
without affecting its DNA binding activity is currently unknown. It is
possible that activated ERK or p38 may contribute to the CpG
DNA-induced transcriptional activity of NF-B by modifying the
RelA/p65 subunit of NF-B and/or inducing phosphorylation of
TATA-binding protein. Of interest, it has been demonstrated that ERK or
p38 regulate transcriptional activity of NF-B without affecting DNA
binding activity by modifying RelA/p65 and/or TATA-binding protein in
response to TNF- or LPS (55, 56).
The transcription factors CREB, Sp1, and NF-IL-6 regulate the
expression of IL-10 and IL-12, respectively (35, 42, 43).
CpG DNA alone failed to activate either NFAT, NF-IL-6, or Sp1 and
neither U0126 nor SB202190 altered nuclear DNA binding activity
or transcriptional activity of NFAT, NF-IL-6, or Sp1 under our
experimental conditions (Fig. 5 and data not shown). Previous studies
have demonstrated that multiple nuclear factor complex F1, which is
composed of IRF-1, c-Rel, and GLp109, acts at the Ets site in the
IL-12p40 promoter (41). Neither U0126 nor SB202190 altered
F1 complex formation (data not shown), suggesting that F1 complex
formation is also not the regulatory target of ERK or p38 on the IL-12
promoter. Previously, we have demonstrated that transcription
factor AP-1 is activated by CpG DNA in a p38-dependent manner
(25). In the present study, we demonstrated that either
U0126 or SB202190 inhibited the CpG DNA-induced AP-1 activation at both
nuclear DNA binding activity and transcriptional activity (Figs. 5, and 6B). In addition, CpG DNA induces CREB activation
through a p38-dependent manner (Fig. 7). Sequence analysis revealed the
presence of a putative AP-1 and CREB binding consensus site in the
IL-10 promoter region (data not shown). In addition, it has been
reported that AP-1 and CREB play a critical role in the IL-10
expression (43, 57). However, whether inhibition of AP-1
or CREB activation by U0126 or SB202190 is a cause of the inhibition of
the CpG DNA-induced IL-10 production is currently unknown, and whether
AP-1 could be a negative regulator of IL-12p40 expression remains a
subject for further study.
Several lines of evidence support our conclusion that CpG DNA-mediated
IL-12 production is, at least in part, regulated by an IL-10-dependent
pathway that is triggered by CpG DNA-mediated ERK activation. First,
the levels of IL-12p40 and IL-12p70 produced by IL-10KO spleen cells
after CpG DNA stimulation were dramatically increased compared with
those by wild-type spleen cells (Table I). Second, CpG DNA-mediated
IL-10 production was inhibited by U0126. Third, UO126 enhanced the CpG
DNA-mediated IL-12p40 and IL-12p70 production in spleen cells from
wild-type mice, but not from IL-10KO mice (Table I). Finally, exogenous
rIL-10 suppressed the U0126-enhanced IL-12p40 and IL-12p70 production
(Fig. 8).
The molecular mechanism of IL-10-mediated inhibition of IL-12
expression is poorly understood. IL-10 suppresses LPS-induced IL-12p35
and IL-12p40 expression at the transcriptional level without affecting
mRNA stability, but this effect requires new protein synthesis
(58). Recently, it has been demonstrated that both ERK and
IL-10 can induce expression of SOCS1 and SOCS3 (44, 45, 59, 60). SOCS3, in turn, has been demonstrated to inhibit IFN
inducible gene expression by suppressing the tyrosine phosphorylation
of STAT1 (59). Phosphorylation and activation of STAT-1
can be induced upon stimulation by type I IFN (61). In
addition, IL-10 also attenuates IFN--activated STAT1 through a
SOCS3-dependent manner (46). Moreover, we have
demonstrated that CpG DNA-mediated IL-12 production is partly dependent
on the CpG DNA-induced type I IFN (19). These observations
suggested the interesting possibility that CpG DNA-activated ERK leads
to the production of IL-10 which may induce SOCS1 and/or SOCS3
expression, thereby inhibiting STAT1 activation. Therefore, inhibition
of ERK activation and IL-10 expression may reduce SOCS3 expression,
thereby potentiating STAT1 phosphorylation and activation, culminating
in increased IL-12 production in response to CpG DNA. CpG DNA indeed
induced SOCS1 and SOCS3 expression (Fig. 9), but this CpG DNA-induced
expression of SOCS3 was dependent on p38 activation rather than ERK
(Fig. 9B). Exogenous addition of IL-10 induced SOCS3
expression and also enhanced the CpG DNA-induced SOCS3 expression,
indicating the presence of an IL-10-mediated regulatory step for SOCS3
expression in RAW264.7 cells (data not shown). However, these data do
not support the possibility that CpG DNA-induced SOCS1 and SOCS3
expression depends on ERK activation and/or IL-10 expression induced by
CpG DNA. During the preparation of this manuscript, Heeg and colleagues
(62) reported that CpG DNA induces expression of SOCS1 and
SOCS3 via an ERK- and p38-dependent but protein synthesis-independent
pathway, and SOCS1 and SOCS3 expressed after CpG DNA stimulation
inhibits cytokine-induced phosphorylation of STAT proteins.
Interestingly, our studies reveal that CpG DNA induces phosphorylation
of STAT1 at both Ser727 and
Tyr701 residues (Fig. 10A). This CpG
DNA-induced phosphorylation of STAT1 at Tyr701
residue was enhanced in the presence of a MEK inhibitor U0126, but not
in the presence of a p38 inhibitor SB202190 (Fig. 10, B and
C). Taken together, regardless of some discrepancy in our
findings, both studies provide evidence for the presence of an
ERK-mediated negative feedback mechanism in the CpG DNA-induced innate
immune activation. Further investigation on the molecular mechanisms by
which ERK, IL-10, SOCS1, and SOCS3 negatively regulate the effects of
CpG DNA is ongoing.
In summary, the present study demonstrates that ERK and p38 MAPKs
activated by CpG DNA play differential regulatory roles in the
production of pro- and anti-inflammatory cytokines in RAW264.7
cells. CpG DNA-induced p38 activity promotes activation of several
transcription factors including NF-B, AP-1, and CREB that may
contribute to the production of TNF-, IL-10, and IL-12p40. ERK
activity partially contributes to the CpG DNA-induced TNF-
production, but is required for IL-10 expression, which in turn
suppresses IL-12 expression. The data demonstrate a central negative
feedback regulatory role for ERK in the CpG DNA-mediated Th1 type
response by promoting production of the Th2 type cytokine, IL-10. ERK
and IL-10-mediated suppression of the CpG DNA-induced Th1 type
cytokines may be at least in part due to suppressed activation of
STAT1. Because of the involvement of multiple signaling pathways and
the cross-talk between multiple signaling modulators, the activation of
the same signaling modulator can result in different physiological
outcomes depending upon each specific innate immune activator.
Therefore, careful studies on the biologic role of each signaling
modulator activated by CpG DNA might provide an effective way to
control the beneficial and/or harmful immune reactions induced by CpG
DNA during infection, vaccination, and allergy or cancer
immunotherapy.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ae-Kyung Yi, Department of Pediatrics, Children’s Foundation Research Center, University of Tennessee Health Science Center, 50 North Dunlap Street, Room 315, Memphis, TN 38103. E-mail address: ayi{at}utmem.edu
3 Abbreviations used in this paper: DC, dendritic cells; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun NH2-terminal kinase; TLR, Toll-like receptor; KO, knockout; rmIL-10, recombinant murine IL-10; MEK, mitogen-activated protein kinase kinase; ATF, activating transcription factor; IRF, IFN regulatory factor; MKK, MAPK kinase; MAPKAPK-2, MAPK activated protein kinase-2.
Received for publication October 29, 2001. Accepted for publication February 20, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Proc. Natl. Acad. Sci. USA 93:2879. promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
B and IB and sustained activation of nuclear factor-B/c-Rel. J. Immunol. 160:1240.B and preventing mitochondrial membrane potential disruption via a chloroquine sensitive pathway. Int. Immunol. 11:2015. in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
B and AP-1 activity in mouse T cell blasts. J. Biol. Chem. 274:14400. is constitutively bound to the NF-B site of the interleukin-6 promoter and acts as a negative regulatory factor. Mol. Cell. Biol. 17:3733.[Abstract]
production through activation of NF-B. Int. Immunol. 13:1391. gene expression in T lymphocytes. J. Biol. Chem. 274:4319. gene in B cells and T cells by NFATp and ATF-2/JUN. Mol. Cell. Biol. 16:5232.[Abstract]
- and interferon -induced genes by suppressing tyrosine phosphorylation of STAT1. Blood 93:1456.-activated STAT1 in the liver: involvement of SOCS2 and SOCS3. FEBS Lett. 480:132.[Medline]
B p65 transactivation mediated by tumor necrosis factor. J. Biol. Chem. 273:3285.B-dependent gene expression: the role of TATA-binding protein (TBP). J. Biol. Chem. 274:30858. activates multiple STAT proteins and upregulates proliferation-associated IL-2R, c-myc, and pim-1 genes in human T cells. Blood 93:1980.This article has been cited by other articles:
|
|
 |
|
  J. Correale and M. Farez Helminth Antigens Modulate Immune Responses in Cells from Multiple Sclerosis Patients through TLR2-Dependent Mechanisms J. Immunol., November 1, 2009; 183(9): 5999 - 6012. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Kaiser, D. Cook, S. Papoutsopoulou, R. Rajsbaum, X. Wu, H.-T. Yang, S. Grant, P. Ricciardi-Castagnoli, P. N. Tsichlis, S. C. Ley, et al. TPL-2 negatively regulates interferon-{beta} production in macrophages and myeloid dendritic cells J. Exp. Med., August 31, 2009; 206(9): 1863 - 1871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-E. Park, Y.-I. Kim, and A.-K. Yi Protein Kinase D1: A New Component in TLR9 Signaling J. Immunol., August 1, 2008; 181(3): 2044 - 2055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. B. Hickey, C. F. Brereton, and K. H. G. Mills Adenylate cycalse toxin of Bordetella pertussis inhibits TLR-induced IRF-1 and IRF-8 activation and IL-12 production and enhances IL-10 through MAPK activation in dendritic cells J. Leukoc. Biol., July 1, 2008; 84(1): 234 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mukherjee and V. S. Chauhan Plasmodium falciparum-free merozoites and infected RBCs distinctly affect soluble CD40 ligand-mediated maturation of immature monocyte-derived dendritic cells J. Leukoc. Biol., July 1, 2008; 84(1): 244 - 254. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-I. Kim, J.-E. Park, A. Martinez-Hernandez, and A.-K. Yi CpG DNA Prevents Liver Injury and Shock-mediated Death by Modulating Expression of Interleukin-1 Receptor-associated Kinases J. Biol. Chem., May 30, 2008; 283(22): 15258 - 15270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. Jarnicki, H. Conroy, C. Brereton, G. Donnelly, D. Toomey, K. Walsh, C. Sweeney, O. Leavy, J. Fletcher, E. C. Lavelle, et al. Attenuating Regulatory T Cell Induction by TLR Agonists through Inhibition of p38 MAPK Signaling in Dendritic Cells Enhances Their Efficacy as Vaccine Adjuvants and Cancer Immunotherapeutics J. Immunol., March 15, 2008; 180(6): 3797 - 3806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Lambert and O. M. Martinez Latent Membrane Protein 1 of EBV Activates Phosphatidylinositol 3-Kinase to Induce Production of IL-10 J. Immunol., December 15, 2007; 179(12): 8225 - 8234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Rui, X. Liu, N. Li, Y. Jiang, G. Chen, X. Cao, and J. Wang PECAM-1 Ligation Negatively Regulates TLR4 Signaling in Macrophages J. Immunol., December 1, 2007; 179(11): 7344 - 7351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Urzainqui, G. Martinez del Hoyo, A. Lamana, H. de la Fuente, O. Barreiro, I. M. Olazabal, P. Martin, M. K. Wild, D. Vestweber, R. Gonzalez-Amaro, et al. Functional Role of P-Selectin Glycoprotein Ligand 1/P-Selectin Interaction in the Generation of Tolerogenic Dendritic Cells J. Immunol., December 1, 2007; 179(11): 7457 - 7465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Lang, M. Hammer, and J. Mages DUSP Meet Immunology: Dual Specificity MAPK Phosphatases in Control of the Inflammatory Response J. Immunol., December 1, 2006; 177(11): 7497 - 7504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jozefowski, T. H. Sulahian, M. Arredouani, and L. Kobzik Role of scavenger receptor MARCO in macrophage responses to CpG oligodeoxynucleotides J. Leukoc. Biol., October 1, 2006; 80(4): 870 - 879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Qian, X. Jiang, H. An, Y. Yu, Z. Guo, S. Liu, H. Xu, and X. Cao TLR agonists promote ERK-mediated preferential IL-10 production of regulatory dendritic cells (diffDCs), leading to NK-cell activation Blood, October 1, 2006; 108(7): 2307 - 2315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Foltz, G.-Y. Ryu, J.-G. Yoon, T. Nelson, J. Fahey, A. Frakes, H. Lee, L. Field, K. Zander, Z. Sibenaller, et al. Genome-Wide Analysis of Epigenetic Silencing Identifies BEX1 and BEX2 as Candidate Tumor Suppressor Genes in Malignant Glioma. Cancer Res., July 1, 2006; 66(13): 6665 - 6674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-N. Zhu, Y.-F. Yang, S. Ono, X.-G. Zhong, Y.-H. Feng, Y.-X. Ren, J. Ni, Y.-F. Fu, W. Tang, and J.-P. Zuo Differential expression of inducible nitric oxide synthase and IL-12 between peritoneal and splenic macrophages stimulated with LPS plus IFN-{gamma} is associated with the activation of extracellular signal-related kinase Int. Immunol., June 1, 2006; 18(6): 981 - 990. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, H. Yoon, J.-E. Park, B.-S. Kim, H. J. Kim, and A. Martinez-Hernandez CpG DNA-mediated Induction of Acute Liver Injury in D-Galactosamine-sensitized Mice: THE MITOCHONDRIAL APOPTOTIC PATHWAY-DEPENDENT DEATH OF HEPATOCYTES J. Biol. Chem., May 26, 2006; 281(21): 15001 - 15012. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Agrawal, S. Dillon, T. L. Denning, and B. Pulendran ERK1-/- Mice Exhibit Th1 Cell Polarization and Increased Susceptibility to Experimental Autoimmune Encephalomyelitis J. Immunol., May 15, 2006; 176(10): 5788 - 5796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Katz, P. Zhang, M. Martin, S. N. Vogel, and S. M. Michalek Toll-Like Receptor 2 Is Required for Inflammatory Responses to Francisella tularensis LVS. Infect. Immun., May 1, 2006; 74(5): 2809 - 2816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Banerjee, R. Gugasyan, M. McMahon, and S. Gerondakis Diverse Toll-like receptors utilize Tpl2 to activate extracellular signal-regulated kinase (ERK) in hemopoietic cells PNAS, February 28, 2006; 103(9): 3274 - 3279. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. F. Tomczak, M. Gadjeva, Y. Y. Wang, K. Brown, I. Maroulakou, P. N. Tsichlis, S. E. Erdman, J. G. Fox, and B. H. Horwitz Defective Activation of ERK in Macrophages Lacking the p50/p105 Subunit of NF-{kappa}B Is Responsible for Elevated Expression of IL-12 p40 Observed after Challenge with Helicobacter hepaticus J. Immunol., January 15, 2006; 176(2): 1244 - 1251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jozefowski, M. Arredouani, T. Sulahian, and L. Kobzik Disparate Regulation and Function of the Class A Scavenger Receptors SR-AI/II and MARCO J. Immunol., December 15, 2005; 175(12): 8032 - 8041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Appel, V. Mirakaj, A. Bringmann, M. M. Weck, F. Grunebach, and P. Brossart PPAR-{gamma} agonists inhibit toll-like receptor-mediated activation of dendritic cells via the MAP kinase and NF-{kappa}B pathways Blood, December 1, 2005; 106(12): 3888 - 3894. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Loscher, E. Draper, O. Leavy, D. Kelleher, K. H. G. Mills, and H. M. Roche Conjugated Linoleic Acid Suppresses NF-{kappa}B Activation and IL-12 Production in Dendritic Cells through ERK-Mediated IL-10 Induction J. Immunol., October 15, 2005; 175(8): 4990 - 4998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Pruett, Q. Zheng, C. Schwab, and R. Fan Sodium Methyldithiocarbamate Inhibits MAP Kinase Activation through Toll-like Receptor 4, Alters Cytokine Production by Mouse Peritoneal Macrophages, and Suppresses Innate Immunity Toxicol. Sci., September 1, 2005; 87(1): 75 - 85. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Senn, S. Burel, and S. P. Henry Non-CpG-Containing Antisense 2'-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88 J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 972 - 979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Zhang, M. Martin, S. M. Michalek, and J. Katz Role of Mitogen-Activated Protein Kinases and NF-{kappa}B in the Regulation of Proinflammatory and Anti-Inflammatory Cytokines by Porphyromonas gingivalis Hemagglutinin B Infect. Immun., July 1, 2005; 73(7): 3990 - 3998. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Lucas, X. Zhang, V. Prasanna, and D. M. Mosser ERK Activation Following Macrophage Fc{gamma}R Ligation Leads to Chromatin Modifications at the IL-10 Locus J. Immunol., July 1, 2005; 175(1): 469 - 477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Artis, C. M. Kane, J. Fiore, C. Zaph, S. Shapira, K. Joyce, A. MacDonald, C. Hunter, P. Scott, and E. J. Pearce Dendritic Cell-Intrinsic Expression of NF-{kappa}B1 Is Required to Promote Optimal Th2 Cell Differentiation J. Immunol., June 1, 2005; 174(11): 7154 - 7159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Waiczies, T. Prozorovski, C. Infante-Duarte, A. Hahner, O. Aktas, O. Ullrich, and F. Zipp Atorvastatin Induces T Cell Anergy via Phosphorylation of ERK1 J. Immunol., May 1, 2005; 174(9): 5630 - 5635. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. McCoy, S. E. Kurtz, C. J. MacArthur, D. R. Trune, and S. H. Hefeneider Identification of a Peptide Derived from Vaccinia Virus A52R Protein That Inhibits Cytokine Secretion in Response to TLR-Dependent Signaling and Reduces In Vivo Bacterial-Induced Inflammation J. Immunol., March 1, 2005; 174(5): 3006 - 3014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Marteau, D. Communi, J.-M. Boeynaems, and N. Suarez Gonzalez Involvement of multiple P2Y receptors and signaling pathways in the action of adenine nucleotides diphosphates on human monocyte-derived dendritic cells J. Leukoc. Biol., October 1, 2004; 76(4): 796 - 803. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, Z. Ma, Z.-L. Tang, T. Stevens, B. Pitt, and S. Li CpG DNA-mediated immune response in pulmonary endothelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L552 - L558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. B. Pruett, C. Schwab, Q. Zheng, and R. Fan Suppression of Innate Immunity by Acute Ethanol Administration: A Global Perspective and a New Mechanism Beginning with Inhibition of Signaling through TLR3 J. Immunol., August 15, 2004; 173(4): 2715 - 2724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tsujimura, T. Tamura, H. J. Kong, A. Nishiyama, K. J. Ishii, D. M. Klinman, and K. Ozato Toll-Like Receptor 9 Signaling Activates NF-{kappa}B through IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein in Dendritic Cells J. Immunol., June 1, 2004; 172(11): 6820 - 6827. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. McCoy, S. E. Kurtz, F. A. Hausman, D. R. Trune, R. M. Bennett, and S. H. Hefeneider Activation of RAW264.7 Macrophages by Bacterial DNA and Lipopolysaccharide Increases Cell Surface DNA Binding and Internalization J. Biol. Chem., April 23, 2004; 279(17): 17217 - 17223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dillon, A. Agrawal, T. Van Dyke, G. Landreth, L. McCauley, A. Koh, C. Maliszewski, S. Akira, and B. Pulendran A Toll-Like Receptor 2 Ligand Stimulates Th2 Responses In Vivo, via Induction of Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase and c-Fos in Dendritic Cells J. Immunol., April 15, 2004; 172(8): 4733 - 4743. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Agrawal, A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, T. Van Dyke, and B. Pulendran Cutting Edge: Different Toll-Like Receptor Agonists Instruct Dendritic Cells to Induce Distinct Th Responses via Differential Modulation of Extracellular Signal-Regulated Kinase-Mitogen-Activated Protein Kinase and c-Fos J. Immunol., November 15, 2003; 171(10): 4984 - 4989. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Martin, R. E. Schifferle, N. Cuesta, S. N. Vogel, J. Katz, and S. M. Michalek Role of the Phosphatidylinositol 3 Kinase-Akt Pathway in the Regulation of IL-10 and IL-12 by Porphyromonas gingivalis Lipopolysaccharide J. Immunol., July 15, 2003; 171(2): 717 - 725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, D. Gravis, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: ROLE OF NF-{kappa}B AND p38 J. Biol. Chem., June 13, 2003; 278(25): 22563 - 22573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, S.-C. Hong, and A.-K. Yi CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression J. Immunol., January 15, 2003; 170(2): 1052 - 1061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. K. Choudhury, J. S. Wild, R. Alam, D. M. Klinman, I. Boldogh, N. Dharajiya, W. J. Mileski, and S. Sur In Vivo Role of p38 Mitogen-Activated Protein Kinase in Mediating the Anti-inflammatory Effects of CpG Oligodeoxynucleotide in Murine Asthma J. Immunol., November 15, 2002; 169(10): 5955 - 5961. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), U0126
(2.5 µM; 
), or SB202190 (2.5 µM; 
). The levels of TNF-
