The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Storm van’s Gravesande, K.
Right arrow Articles by Riese, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Storm van’s Gravesande, K.
Right arrow Articles by Riese, R. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2002, 168: 4488-4494.
Copyright © 2002 by The American Association of Immunologists

IFN Regulatory Factor-1 Regulates IFN-{gamma}-Dependent Cathepsin S Expression1

Karin Storm van’s Gravesande*, Matthew D. Layne*, Qiang Ye*, Louis Le*, Rebecca M. Baron*, Mark A. Perrella*, Laura Santambrogio{dagger}, Eric S. Silverman* and Richard J. Riese2,*

* Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and {dagger} Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA 02115


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cathepsin S is a cysteine protease with potent endoproteolytic activity and a broad pH profile. Cathepsin S activity is essential for complete processing of the MHC class II-associated invariant chain within B cells and dendritic cells, and may also be important in extracellular matrix degradation in atherosclerosis and emphysema. Unique among cysteine proteases, cathepsin S activity is up-regulated by IFN-{gamma}. Given its importance, we sought to elucidate the pathway by which IFN-{gamma} increases cathepsin S expression. Our data demonstrate that the cathepsin S promoter contains an IFN-stimulated response element (ISRE) that is critical for IFN-{gamma}-induced gene transcription in a cell line derived from type II alveolar epithelial (A549) cells. IFN response factor (IRF)-2 derived from A549 nuclear extracts associates with the ISRE oligonucleotide in gel shift assays, but is quickly replaced by IRF-1 following stimulation with IFN-{gamma}. The time course of IRF-1/ISRE complex formation correlates with increased levels of IRF-1 protein and cathepsin S mRNA. Overexpression of IRF-1, but not IRF-2, markedly augments cathepsin S promoter activity in A549 cells. Furthermore, overexpression of IRF-1 increases endogenous cathepsin S mRNA levels in 293T epithelial cells. Finally, freshly isolated bone marrow cells from IRF-1-/- mice fail to up-regulate cathepsin S activity in response to IFN-{gamma}. Thus, IRF-1 is the critical transcriptional mediator of IFN-{gamma}-dependent cathepsin S activation. These data elucidate a new pathway by which IRF-1 may affect MHC class II processing and presentation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cathepsin S is a member of the papain-like family of cysteine proteases that reside within the endosomal compartments and mediate proteolysis of endocytosed proteins and polypeptides (1, 2, 3). Among this family, cathepsin S has unique features pertinent to its biological activity. First, it exhibits a broad pH profile and maintains a significant endoproteolytic activity at neutral pH, suggesting that this enzyme may have important extracellular biological activity (1). Second, its constitutive expression is restricted primarily to bone marrow-derived APCs (4). Third, its mRNA expression, protein, and activity are up-regulated by IFN-{gamma} (3) in several cell types (1, 2).

Cathepsin S plays an essential role in regulation of MHC class II maturation and trafficking within APCs by mediating processing of class II-associated invariant chain (Ii)3 and exogenous Ags (4, 5, 6, 7, 8). In B cells and dendritic cells, cathepsin S uniquely mediates the final cleavage of Ii to generate class II-associated invariant chain peptide (CLIP). This cleavage is necessary to permit subsequent liberation of the Ii remnant from the class II-binding groove and class II-peptide complex formation. The importance of cathepsin S in regulating MHC class II-restricted Ag processing and presentation is well illustrated by the phenotype of cathepsin S-/- mice (6, 7). Inhibition of cathepsin S activity in B cells and dendritic cells results in accumulation of class II-Ii complexes, attenuation of class II-peptide complex formation, and inability of these cells to present certain antigenic determinants. Dendritic cells derived from cathepsin S-/- mice have a marked defect of MHC class II endosomal trafficking (9, 10). Finally, in human dendritic cells, proinflammatory cytokines give rise to a surge of MHC class II-peptide complex formation that is dependent on cathepsin S activity (11). Thus, regulation of cathepsin S expression and activity has important consequences in control of MHC class II function and subsequent CD4+ T cell stimulation.

IFN-{gamma} is a potent regulator of cathepsin S expression in vascular smooth muscle cells and in the lung parenchyma (12). Arterial smooth muscle cells stimulated with IFN-{gamma} exhibit enhanced cathepsin S activity and secretion, with a concomitant increase in supernatant elastolytic activity, which is blocked with a selective cathepsin S inhibitor (13). Furthermore, cathepsin S activity is increased in walls of atheromas and aneurysms as compared with normal arteries, suggesting that this enzyme may be playing a role in breakdown of the extracellular matrix in atherosclerosis (14). Within the lung, transgenic mice generated to overexpress IFN-{gamma} exhibit a chronic inflammatory cell infiltrate, increased cysteine protease activity, and emphysematous-like changes in lung pathology and physiology (15, 16). Analysis of bronchoalveolar lavage fluid of these transgenic mice shows that cathepsin S retains the most activity of the cysteine proteases in the extracellular environment, consistent with its broad pH profile. Thus, IFN-{gamma}-induced activation of cathepsin S has important physiological relevance in several disease processes, and elucidation of this pathway may have direct clinical significance.

IFN-{gamma} signaling involves ligand-induced oligomerization of IFN-{gamma} receptor subunits, leading to phosphorylation and activation of Janus kinase 1 and 2. This in turn leads to activation of the dormant Stat1 molecule. Stat1 homodimers translocate to the nucleus, where they direct transcription of specific target genes (17), including such secondary transcriptional activators as the family of IFN response factors (IRF), class II transactivator (CIITA) promoters III and IV, and CCAAT/enhancing-binding protein-{beta} (18, 19, 20). These transcriptional regulators are intermediaries in a complicated network that produces alterations in gene expression and cellular function.

This study seeks to identify the molecular pathway by which IFN-{gamma} induces up-regulation of the cathepsin S gene. We have identified a functional IFN-stimulated response element (ISRE) in the cathepsin S promoter -100 bp from the transcriptional start site. We show that, in human bronchial epithelial A549 cells, IRF-1 directly binds to this site and mediates IFN-{gamma}-dependent transcriptional activation. These data elucidate a new pathway by which IRF-1 may influence several important biological processes, including maturation and trafficking of MHC class II molecules, vascular remodeling, and elastin degradation within the lung.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and materials

The type II alveolar epithelial (A549) cell line (American Type Culture Collection, Manassas, VA) and the 293T epithelial cell line were cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS (Life Technologies, Rockville, MD), 10 mM glutamine, and penicillin/streptomycin. Cells were maintained at 37°C and 5% CO2 in a humidified incubator and passed at confluence every 4 days.

Plasmids

A 892-bp fragment of the cathepsin S gene, using human genomic DNA as a template, was amplified by the PCR, the product containing 859 bp of the 5' flanking region and the first 32 bp of exon 1. This fragment was subcloned into a pGL3-basic (Promega, Madison, WI) vector at the restriction sites HindIII and KpnI and designated CatS (-859/+32). To localize cis regulatory elements that may be important for IFN-{gamma} induction of cathepsin S, we used CatS (-859/+32) as a template to generate truncated cathepsin S 5' flanking regions by PCR. Constructs containing these 5'-deletion fragments were designated CatS (-597/+32), CatS (-375/+32), CatS (-230/+32), and CatS (-75/+32). The full-length construct, CatS (-859/+32), was also used as a template to mutate the downstream IRSE site (-100 to -90, GAAACTGAAA to GAACTTAGAAT) by site-directed mutagenesis (QuickChange XL site-directed mutagenesis kit; Stratagene, La Jolla, CA). DNA sequencing confirmed the accuracy of all constructs used in this study. pSV-{beta}-galactosidase ({beta}-gal) plasmid containing the {beta}-gal reporter gene was obtained from Promega. Plasmid DNA was purified from Escherichia coli using the Qiagen plasmid purification system according to manufacturer’s instruction (Chatsworth, CA).

Transfection and preparation of cell extracts

Transient transfections were conducted in A549 cells, which were grown to 80% confluence in 60-mm dishes and transfected with LipofectAMINE PLUS (Invitrogen, San Diego, CA) with 2 µg CatS constructs and 2 µg pSV-{beta}-gal plasmid. Coexpression experiments were performed with IRF-1, IRF-2, and empty vector expression constructs. Each experiment was conducted so that the sum of all plasmid concentrations transfected was equal. Transfected cells were stimulated with 50 ng/ml human rIFN-{gamma} (Sigma-Aldrich, St. Louis, MO) for 24 h, placed in lysis buffer (Promega), and subjected to one freeze-and-thaw cycle. Firefly luciferase activity was then assayed in lysates using the luciferase assay method (Promega). Luciferase activity was normalized to {beta}-gal activity to control for transfection efficiency.

In some experiments (Fig. 6GoC), 293T cells were transfected with the IRF-1 expression construct using Fugene (Roche, Indianapolis, IN). Cells were grown to 50–70% confluence in 8.5-cm tissue culture dishes, and growth was arrested overnight in 8 ml serum-free RPMI medium. Transfection was performed by adding 18 µl Fugene reagent to 6 µg IRF-1 DNA (or empty vector). Cells were incubated for 24 h, and Northern analysis was performed as described below.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 6. IRF-1, but not IRF-2, activates cathepsin S promoter. A, A549 cells were transiently cotransfected with the indicated reporter constructs along with an empty control vector (0) or IRF-1 construct at 100 or 200 ng. Results are expressed as fold induction relative to the activity of each reporter in the absence of IRF-1 plasmid, and represent the mean ± SD from three experiments. Luciferase activity was normalized to the {beta}-gal activity for each sample. B, A549 cells were transiently cotransfected with the full-length cathepsin S promoter-reporter construct and with empty vector, IRF-1 (100 ng) or IRF-2 expression vectors (375 ng). Cells were incubated with medium alone or IFN-{gamma} for 24 h. Results are expressed as fold induction relative to the basal activity of the full-length construct. As in A above, luciferase activity was normalized to {beta}-gal activity for each sample. C, Growth-arrested 293T cells were transfected with empty vector (left lane) or IRF-1 expression vector (middle lane), or stimulated with 50 ng/ml IFN-{gamma} (right lane). Cells were incubated for 24 h before Northern analysis for mRNA levels of cathepsin S (upper panel), IRF-1 (middle panel), and {beta}-actin (lower panel). A quantity amounting to 20 µg total RNA was used for this blot.

 
Active site labeling of cysteine proteases and immunoprecipitation

Cells were lysed in 50 µl 1% Triton X-100, 50 mM sodium acetate (pH 4.2), and 1 mM EDTA on ice for 30 min. Postnuclear extracts were normalized to total protein content and incubated with 125I-labeled JPM565 (125I-JPM565; gift of H. Ploegh, Boston, MA) for 1 h at 37°C. Labeled lysates were then either subjected to SDS-PAGE right away (bone marrow cells), or immunoprecipitation, as described below (A549 cells).

Immunoprecipitation was performed, as described previously (21). Following active site labeling of A549 cell lysates with 125I-JPM, SDS was added to bring the final concentration to 1%. Samples were boiled for 3 min, neutralized, and diluted 10-fold with 0.5% Nonidet P-40, 50 mM Tris (pH 7.4), and 5 mM MgCl2. For the immunoprecipitation, samples were precleared initially with 5 µl normal rabbit serum (Sigma-Aldrich) and 100 µl protein A-agarose (Santa Cruz Biotechnology, Santa Cruz, CA), followed by a second preclear with 100 µl protein A-agarose alone. Immunoprecipitation was performed by incubating each sample with 10 µl anti-cathepsin S serum (gift of H. Chapman, San Francisco, CA) and 100 µl protein A-agarose. Both preclears and immunoprecipitation steps were conducted at 4°C for 1 h. Immunoprecipitated pellets were washed five times with 50 mM Tris (pH 7.4), 150 mM NaCl, and 3 mM EDTA. Proteins were eluted from the beads by addition of SDS sample buffer. Samples were boiled for 5 min, analyzed by SDS-PAGE, and visualized by autoradiography.

EMSA

Nuclear extracts from A549 cells were prepared by a modification of the method of Dignam et al. (22, 23) and described elsewhere. A double-stranded oligonucleotide for the IRSE consensus binding site (-110 to -79, GATTTTAAATGAAACTGAAATGAAAGTT) was radiolabeled by filling in a 5' overhang with [{alpha}-32P]deoxycytidine 5'-triphosphate and Klenow fragment (NEB, Beverly, MA) and purified by gel filtration (Chroma Spin +ST-10 columns; Clontech Laboratories, Palo Alto, CA). A mutated probe for the IRSE site was also generated (-110 to -79, GATTTTAAATGAACTTAGAATGAAAGTT).

Protein-DNA-binding reactions were performed with 5–10 µg nuclear extract protein, 1 µl-labeled oligonucleotide (50,000 cpm), 1 µg poly(dI-dC), 1 µl salmon sperm DNA in 100 mM Tris (pH 7.5), 10 mM EDTA, 10 mM DTT, and 50% glycerol in a total volume of 20 µl. After incubation at room temperature for 30 min, protein-DNA complexes were resolved on a 5% nondenaturing acrylamide gel in a 1x Tris-borate-EDTA buffer at room temperature and visualized by autoradiography.

Supershift and cold competition experiments were performed by preincubating nuclear cell extracts with 2 µg specific polyclonal Abs (IRF-1, IRF-2, IRF-4, IFN consensus sequence-binding protein (ICSBP), IFN-stimulated gene factor 3{gamma} (ISGF3{gamma}), p50, p65; Santa Cruz Biotechnology) or 40 molar excess of annealed cold oligonucleotides, respectively, before addition of labeled probes.

Northern blot

Total RNA from 1 x 106 A549 or 293T cells was extracted using the RNeasy mini kit (Qiagen). A quantity amounting to 15–20 µg total RNA was fractionated by electrophoresis on a formaldehyde-agarose gel, transferred to a nylon membrane, and probed with 32P-labeled cDNA probes. The cDNA probe for cathepsin S was generated by RT-PCR from total RNA extracted from A549 cells. The 345-bp cathepsin S cDNA probe, the rat GAPDH probe, the {beta}-actin probe, and IRF-1 probe were labeled with [{alpha}-32P]deoxy cytidine 5'-triphosphate using the Prime-It II Random Primer labeling kit (Stratagene). The membrane was hybridized using QuickHyb solution (Stratagene) at 68°C for 60 min, washed according to manufacturer’s directions, and exposed to Kodak XAR film at -80°C. Equity of sample loading was assessed by stripping and reprobing the membrane with 32P-labeled GAPDH or {beta}-actin cDNA.

Western blot

Nuclear extracts from unstimulated and stimulated A549 cells were used and prepared, as described above. Protein concentrations were measured, and equal amounts of nuclear extracts were subjected to a 15% SDS-PAGE, transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH), and probed with either a specific IRF-1, IRF-2, or Sp3 Ab (Santa Cruz Biotechnology). Membranes were incubated with secondary HRP-conjugated anti-rabbit antiserum (Pierce, Rockford, IL), and detected by chemiluminescence (Amersham, Arlington Heights, IL).

Mice and tissue culture

Mice with a targeted mutation in the IRF-1 gene (B6.129-IRF1tem1Mak) and control mice (C57BL/6) were obtained from The Jackson Laboratory (Bar Harbor, ME). Male and female mice were used between 8 and 12 wk old. All animals were maintained under pathogen-free conditions at the animal facilities of Harvard Medical School (Boston, MA) in compliance with institutional guidelines. Isolation of bone marrow cells was performed, as previously described, following euthanasia with ketamine/xylazine (9).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{gamma} up-regulates cathepsin S activity and mRNA expression in A549 cells

To determine whether cathepsin S activity is up-regulated in A549 cells, cells were stimulated with 50 ng/ml IFN-{gamma} for 4, 12, 24, and 48 h, and lysates were labeled with the cysteine protease suicide inhibitor 125I-JPM565 (21, 24). Subsequent to active site labeling, cathepsin S was immunoprecipitated (Fig. 1Go). In the absence of IFN-{gamma}, no significant cathepsin S activity was evident. Following stimulation with IFN-{gamma}, there was a marked increase in cathepsin S activity at 4 h. The activity levels of this enzyme continued to increase for at least 48 h. Thus, cathepsin S activity is increased in response to IFN-{gamma} in A549 cells.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Cathepsin S activity is up-regulated by IFN-{gamma}. A549 cells were incubated for the indicated time with medium alone or IFN-{gamma} (50 ng/ml). Cell extracts were then solubilized and normalized to protein content. Lysates were then incubated with the cysteine protease active site inhibitor 125I-JPM565 to label the cysteine proteases, and subjected to immunoprecipitation with a specific Ab against cathepsin S.

 
We next determined whether IFN-{gamma} also induced expression of cathepsin S mRNA (Fig. 2Go). A549 cells were growth arrested in serum-free medium for 24 h and subsequently treated with IFN-{gamma} for 1, 2, 3, 4, 12, and 24 h. Expression of cathepsin S mRNA was monitored by Northern blotting. An increase in mRNA levels was observed after 1 h of IFN-{gamma} stimulation, with further increases at 2, 3, 4, and 12 h (Fig. 2Go). The maximum induction was seen at 12 h with an 18-fold increase, as determined by densitometric analysis. Interestingly, cathepsin S mRNA levels decreased at 24 h of IFN-{gamma} stimulation, whereas the protein activity level was maintained for at least 48 h (Fig. 1Go).



View larger version (71K):
[in this window]
[in a new window]
 
FIGURE 2. Cathepsin S mRNA is up-regulated by IFN-{gamma}. Northern blot analysis showing cathepsin S mRNA expression in A549 cells. Cells were incubated with IFN-{gamma} (50 ng/ml) or medium alone for the indicated times. As a control for even loading, the blots were stripped and reprobed for GAPDH.

 
ISRE consensus binding site is critical for IFN-{gamma} up-regulation in A549 cells

To localize the most important IFN-{gamma} response elements found in the cathepsin S promoter, we designed a series of promoter-reporter deletion constructs. A deletion series was made with progressively smaller fragments of the 5' region of the cathepsin S gene, cloned in tandem with the luciferase reporter gene. Constructs were then transiently transfected into A549 cells for determination of transcriptional activity and inducibility following stimulation with IFN-{gamma} (Fig. 3Go). IFN-{gamma} induction of the full-length CatS (-859/+32) construct resulted in a 36-fold increase in luciferase activity. Further deletions of the 5' region moderately decreased the inducibility between 12- and 20-fold, but did not alter basal activity significantly. After the deletion of the IRSE consensus binding site (CatS (-75/+32)), a marked loss of inducibility was observed, suggesting that the IRSE site is critical for IFN-{gamma} induction in the cathepsin S promoter.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3. ISRE is critical for IFN-{gamma}-induced activation of the cathepsin S promoter. A549 cells transiently transfected with deletion series constructs or an ISRE-mutated construct were incubated for 24 h with medium alone ({square}) or 50 ng/ml IFN-{gamma} ({blacksquare}) before luciferase activity assay. Data represent fold induction based on the basal activity of the full-length construct (CatS) from three experiments (±SD). All transfections were normalized to {beta}-gal activity.

 
To further characterize the functional importance of the IRSE binding site within the cathepsin S promoter (-100 to -90), we mutated the consensus sequence site GAAACTGAAA to site GAACTTAGAA. Three independent constructs were verified by DNA sequencing. Although this mutation did not change basal activity (Fig. 3Go), it abolished the IFN-{gamma}-dependent activation of the cathepsin S promoter (Fig. 3Go). Therefore, the ISRE consensus binding site within the cathepsin S promoter is required for up-regulation by IFN-{gamma}.

IRF-1 binds to the IRSE in an IFN-{gamma}-dependent manner

Several members of the IRF family can bind to ISRE and influence transcriptional regulation (25, 26, 27). To determine which IRF family member binds to the cathepsin S ISRE and activates this gene in A549 cells, we performed gel supershift analyses. These experiments were conducted using the cathepsin S ISRE oligonucleotide sequence and Abs specific for IRF-1, IRF-2, IRF-4, ICSBP/IRF-8, and ISGF3{gamma} (p48, IRF-9) in A549 cells stimulated with IFN-{gamma} for 24 h (Fig. 4GoA). Abs against NF-{kappa}B (p50, p65) were also used, because this transcription factor can form complexes with several IRF family members. In nuclear extracts derived from IFN-{gamma}-stimulated A549 cells, IRF-1 binds directly to the ISRE sequence, as shown by a supershift of the IRF-1/ISRE complex following incubation with an Ab against IRF-1 (Fig. 4GoA). The other IRF family members were not supershifted in IFN-{gamma}-stimulated cells. This IRF-1 complex was specific, because a 40-fold molar excess of unlabeled identical oligonucleotide, but not unrelated oligonucleotide, competed for IRF-1 binding and abolished the DNA-protein complex (Fig. 4GoA). Also, incubation of A549 nuclear extracts with a radiolabeled probe containing the mutated IRSE site resulted in complete loss of complex formation (Fig. 4GoA).



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 4. IRF-1 binds to IRSE following IFN-{gamma} stimulation in A549 cells. A, A549 cells were incubated for 24 h with 50 ng/ml IFN-{gamma}. EMSAs were performed on nuclear extracts using a probe containing the IRSE site from the cathepsin S promoter. Supershifts were conducted using Abs against the indicated transcription factors. The supershifted band with the IRF-1 Ab is indicated by the arrow. The probe lane represents probe without nuclear extract. The cold oligo lane represents binding competition with 40x excess cold IRSE. The nonspecific oligo lane denotes binding competition with 40x excess 32P-labeled oligo with an unrelated sequence (Sp1). The mutant oligo lane represents binding of nuclear extracts with the mutated, 32P-labeled IRSE oligonucleotide. B, A549 cells were incubated with medium (-) or IFN-{gamma} (+) for 24 h before EMSA supershift analysis. Analysis was performed as described in A above.

 
To demonstrate further the specificity of IRF-1 in regulating IRSE-dependent gene expression, we compared the binding of IRF-1 and IRF-2 in A549 nuclear extracts derived from unstimulated and IFN-{gamma}-stimulated cells (Fig. 4GoB). In unstimulated A549 cells, the Ab against IRF-2, but not IRF-1, supershifted the protein-DNA complex, implying that, in the absence of IFN-{gamma} stimulation, IRF-2 is able to associate with this oligonucleotide in vitro. However, following activation with IFN-{gamma}, the situation was reversed; the DNA-protein complex was supershifted with the IRF-1 Ab, indicating that IRF-1 had now replaced IRF-2.

As shown in Figs. 1Go and 2Go, the up-regulation of cathepsin S occurs relatively rapidly, with a noticeable increase in mRNA following 1 h of stimulation. If indeed IRF-1 is the key element mediating increased transcription, one would expect IRF-1 binding to occur with a similar time course. A549 cells were stimulated with IFN-{gamma} for 1, 2, 3, 4, and 12 h, and nuclear extracts were prepared (Fig. 5GoA). After 1 h of stimulation with IFN-{gamma}, IRF-1 formed a complex with the IRSE oligonucleotide. This complex, which persisted for at least 24 h, exhibited maximum protein-DNA complex formation at 2–3 h. Following IFN-{gamma} stimulation, we could not supershift the DNA-protein complex with an Ab against IRF-2 at any time point (data not shown).



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 5. IRF-1 expression and binding are rapidly up-regulated by IFN-{gamma}. A549 cells were incubated for the indicated times with medium alone or with IFN-{gamma} before preparation of nuclear extracts. A, Time course of IRF-1 binding to the ISRE probe following incubation of A549 cells with IFN-{gamma} showing complex formation at 1 h. Specificity of binding reaction to the IRSE consensus binding site was tested by supershift of band with IRF-1 Ab (arrow). B, Time course of IRF-1, IRF-2, and Sp3 protein expression in A549 cells following stimulation with IFN-{gamma} showing up-regulation of IRF-1, but not IRF-2, at 1 h. Cell lysates were obtained and normalized to protein content, followed by SDS-PAGE. Lysates were then transferred to nitrocellulose membranes, and proteins were detected by immunoblot analysis with specific Abs. SP3 was used to demonstrate equal loading of protein.

 
The binding of IRF-1 to the ISRE in A549 cells could either result from activation (phosphorylation) of latent IRF-1 or from generation of new IRF-1 protein. Immunoblot analysis of the nuclear extracts for expression of IRF-1 and IRF-2 proteins prior to stimulation of these cells with IFN-{gamma} demonstrated no detectable levels of IRF-1. Activation of these cells with IFN-{gamma} led to a rapid and robust increase in IRF-1 expression (Fig. 5GoB). The time course of IRF-1 expression correlated well with both the temporal increase in cathepsin S mRNA and the time course of IRF-1/IRSE complex formation. In contrast, IRF-2 expression did not change appreciably following administration of IFN-{gamma}. Thus, IFN-{gamma} exerts its IRF-1-mediated effects primarily through augmentation of IRF-1 expression.

IRF-1, but not IRF-2, increases cathepsin S promoter activity

The above data show that the ISRE consensus site is required for IFN-{gamma}-induced cathepsin S expression, and that IRF-1 derived from A549 nuclear extracts is capable of associating with this sequence. We wanted to examine whether IRF-1 expression could increase cathepsin S promoter activity independent of IFN-{gamma}. We cotransfected an IRF-1-containing expression vector into A549 cells and examined cathepsin S promoter activity. Transfection of IRF-1 led to a dose-dependent increase in cathepsin S promoter activity as compared with transfection of empty vector (Fig. 6GoA). Mutation of the ISRE site resulted in a marked reduction of IRF-1-induced cathepsin S promoter activity, indicating that the IRF-1/ISRE complex formation at this site is necessary for promoter activity. In contrast, cotransfection of IRF-2 mildly repressed both constitutive and inducible promoter activity (Fig. 6GoB). Titration of IRF-2 did not significantly inhibit IRF-1-inducible promoter activity in cotransfection experiments (data not shown). Thus, IRF-1, but not IRF-2, is capable of inducing cathepsin S transcription, and this gene activation is dependent on an intact IRSE site.

To determine whether IRF-1 can activate the endogenous cathepsin S gene, Northern analysis of RNA from 293T epithelial cells was performed following transfection of cells with empty expression vector (left lane), IRF-1 expression vector (middle lane), or stimulation with 50 ng/ml IFN-{gamma} (right lane) (Fig. 6GoC). The 293T cells were used for this experiment because the transfection efficiency in A549 cells (2–4%) was too low to detect changes in cathepsin S expression by Northern analysis. The 293T cells, like A549 cells, exhibit an IFN-{gamma}-dependent increase in cathepsin S protein activity (data not shown). Cells were incubated for 24 h following transfection of IRF-1 before RNA extraction. Both transfection of IRF-1 and stimulation with IFN-{gamma} resulted in a clear increase in cathepsin S mRNA in these cells (top panel). As expected, IRF-1 transfection and IFN-{gamma} stimulation also resulted in an increase in IRF-1 mRNA levels (middle panel). Thus, IRF-1 is capable of up-regulating the endogenous expression of cathepsin S.

IRF-1 mediates the IFN-{gamma}-induced up-regulation of cathepsin S in mouse bone marrow cells

The functional significance of cathepsin S has been best elucidated in professional APCs, in which it participates in Ii degradation and class II trafficking and maturation (4, 6, 7). In fact, the delivery of mature class II-peptide complexes to the cell surface of dendritic cells is associated with increased cathepsin S activity, and may even be physiologically regulated by manipulation of enzyme activity (11, 28). To investigate whether IRF-1 also regulates IFN-{gamma}-induced cathepsin S expression in APCs, bone marrow cells from wild-type and IRF-1-/- mice were isolated and incubated overnight in the presence of IFN-{gamma} (50 ng/ml). Analysis of the murine cathepsin S promoter revealed a homologous IRSE consensus site at -26 bp upstream from the transcriptional start site. Bone marrow cells from IRF-1-/- mice displayed normal levels of constitutive cathepsin S expression (Fig. 7Go). This finding of normal constitutive cathepsin S expression also holds true for B cells, dendritic cells, and macrophages derived from IRF-1-/- animals (data not shown). However, stimulation of IRF-1-/- bone marrow cells with IFN-{gamma} failed to significantly increase activity levels of cathepsin S. A similar observation was reproduced in B cells derived from IRF-1-/- animals (data not shown). Thus, IRF-1 is critical for IFN-{gamma}-induced cathepsin S activation in APCs, but does not regulate constitutive cathepsin S expression.



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 7. IRF-1 is required for IFN-{gamma}-induced cathepsin S up-regulation in mouse bone marrow cells. Freshly isolated bone marrow cells from wild-type (WT) and IRF-1-/- mice were incubated with 50 ng/ml IFN-{gamma} overnight. Lysates were obtained (6 x 106 cells/sample), and cysteine proteases were labeled with 125I-JPM565. Samples were then analyzed by SDS-PAGE, and cysteine protease activity was quantitated by autoradiography. The band corresponding to cathepsin S is indicated by the arrow.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This is the first study investigating the transcriptional regulation of cathepsin S, an enzyme that is critical for MHC class II processing and presentation. Our data demonstrate that IFN-{gamma}-induced activation of cathepsin S is mediated by IRF-1 binding to a single IRSE site 100 bp upstream from the transcriptional start site of the cathepsin S promoter. The fact that IRF-1 is widely distributed among different cell types and tissues, and that APCs from IRF-1-/- mice do not up-regulate cathepsin S expression in response to IFN-{gamma}, suggests that this pathway is more generally applicable to other cell types (26). The link between cathepsin S and IRF-1 has several important implications.

Cathepsin S is highly expressed in alveolar macrophages and other bone marrow-derived APCs (1). Our data demonstrate that cathepsin S can also be expressed in A549 cells, which are derived from an epithelial alveolar type II cell, following induction with IFN-{gamma} (29). A549 cells are capable of expressing the necessary MHC class II and class II-related machinery to act as effective APCs when stimulated with IFN-{gamma}, implicating a role for cathepsin S in processing of Ii and exogenous Ags for MHC class II-dependent presentation in these cells (30). Furthermore, lung epithelial cells, including type II epithelial cells, are potential sources for production and secretion of elastinolytic proteases within the lung (31). Consistent with this concept, selective overexpression of IFN-{gamma} within the lung results in a production of chronic inflammatory cell infiltrate and emphysema in a murine model of irreversible obstructive airway disease (15, 16).

IFN-{gamma} regulates both MHC class I and class II expression. However, the pathways by which IFN-{gamma} stimulates expression of these proteins, and related molecules, are not identical. Similar to cathepsin S, IRF-1 mediates the IFN-{gamma}-stimulated MHC class II response, but does not appear to influence constitutive expression in professional APCs (32). Unlike cathepsin S, MHC class II expression is regulated by CIITA, the master transactivating regulatory element for MHC class II, Ii, and HLA-DM (18, 19, 33). The cathepsin S promoter does not contain an X box consensus site, nor does transfection of CIITA significantly alter cathepsin S expression (data not shown). In contrast to MHC class II and cathepsin S, both constitutive and IFN-{gamma}-induced expression of MHC class I is markedly reduced in IRF-1-/- animals, presumably from attenuated expression of TAP1 and low molecular mass polypeptide 2. TAP1 and low molecular mass polypeptide 2 are regulated by IRF-1 binding directly to an IRSE element within their promoter segments (34). The transcriptional regulation of constitutive cathepsin S expression in APCs remains to be elucidated.

Initial studies on transcriptional regulation of the IFN-{alpha} and IFN-{beta} genes suggested that IRF-1 and IRF-2 act as transcriptional activators and repressors of gene expression, respectively (35, 36). This conclusion was based on studies showing that cotransfection of IRF-1 increased expression of IFN-{alpha}{beta}, whereas cotransfection of IRF-2 reduced this IRF-1-mediated activation. A more recent study showed that IRF-1 mediated the activation of cyclooxygenase 2 expression, whereas IRF-2 inhibited both the constitutive and IRF-1-induced activation of this gene (37). Macrophages from IRF-2-/- mice exhibited an increase in both basal and IFN-{gamma}-induced cylooxygenase 2 expression, consistent with the paradigm that IRF-2 acts as a transcriptional repressor for this molecule. However, IRF-2 has also been shown to up-regulate expression of other genes, including histone 4 and VCAM-1 (38, 39).

Our data from investigation of transcriptional regulation of cathepsin S show that in the absence of significant IRF-1 expression, IRF-2 is able to associate in vitro with the ISRE oligonucleotide derived from the cathepsin S promoter. We cannot find any evidence that IRF-2 stimulates transcription of the cathepsin S gene. When present following stimulation with IFN-{gamma}, IRF-1 may exhibit a higher affinity for the cathepsin S IRSE oligonucleotide than IRF-2, and thus IRF-2 binding is not detected in vitro (Figs. 5Go and 6Go). Overexpression of IRF-2 in the A549 cells moderately attenuates both the IFN-{gamma}-induced and basal expression levels of cathepsin S, although the degree of inhibition is lower than that observed for other genes (37).

These data show that regulation of IFN-{gamma}-stimulated cathepsin S expression in A549 cells is largely controlled by IRF-1 binding to the ISRE in the cathepsin S promoter. Other members of the IRF family, such as ICSBP, IRF-4, or ISGF3{gamma} (p48), did not associate with this site. However, subtler pieces of evidence suggest that other factors may also influence transcriptional activation of this protease. In the deletion series, we consistently observe an ~2-fold decrement in promoter activity with the first deletion construct (CatS -596/+32) as compared with the full-length construct (CatS -859/+32). Thus, the ISRE site is necessary, but not sufficient for full activation of the cathepsin S promoter. In fact, this region contains five CCAAT/enhancing-binding protein-{beta} consensus elements and potential binding sites for high mobility group protein I/Y, which might facilitate the IFN-{gamma} response through formation of higher order complexes (20). The exact pathway by which these enhancer elements may augment IFN-{gamma}-induced cathepsin S transcription deserves further investigation.

In summary, IFN-{gamma} stimulates cathepsin S expression via direct association of IRF-1 with the cathepsin S promoter. Given the recent interest in cathepsin S regulation in several physiologic and pathologic processes, the elucidation of the transcriptional pathway controlling expression of this enzyme may give rise to novel therapeutic strategies.


    Acknowledgments
 
We thank Dr. Jeffrey Drazen for his guidance and support, and Drs. Harold Chapman, Hidde Ploegh, and Irvith Carvajal for their critical review of this manuscript.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants 1UO1 HL65899 and KO8 AI01555 (to R.J.R.). K.S.v.G. is the recipient of a grant from the Deutsche Forschungsgemeinschaft (STO 420/1-1). Back

2 Address correspondence and reprint requests to Dr. Richard J. Riese, Division of Pulmonary and Critical Care Medicine, Brigham and Women’s Hospital, Tower 4B, 75 Francis Street, Boston, MA 02115. E-mail address: rriese{at}rics.bwh.harvard.edu Back

3 Abbreviations used in this paper: Ii, invariant chain; CIITA, class II transactivator; CLIP, class II-associated invariant chain peptide; 125I-JPM565, 125I-labeled JPM565; ICSBP, IFN consensus sequence-binding protein; IRF, IFN regulatory factor; ISGF3{gamma}, IFN-stimulated gene factor 3{gamma}; ISRE, IFN-stimulated response element; {beta}-gal, {beta}-galactosidase. Back

Received for publication October 23, 2001. Accepted for publication February 28, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Shi, G. P., J. S. Munger, J. P. Meara, D. H. Rich, H. A. Chapman. 1992. Molecular cloning and expression of human alveolar macrophage cathepsin S, an elastinolytic cysteine protease. J. Biol. Chem. 267:7258.[Abstract/Free Full Text]
  2. Shi, G. P., A. C. Webb, K. E. Foster, J. H. Knoll, C. A. Lemere, J. S. Munger, H. A. Chapman. 1994. Human cathepsin S: chromosomal localization, gene structure, and tissue distribution. J. Biol. Chem. 269:11530.[Abstract/Free Full Text]
  3. Chapman, H. A., R. J. Riese, G. P. Shi. 1997. Emerging roles for cysteine proteases in human biology. Annu. Rev. Physiol. 59:63.[Medline]
  4. Riese, R. J., P. R. Wolf, D. Bromme, L. R. Natkin, J. A. Villadangos, H. L. Ploegh, H. A. Chapman. 1996. Essential role for cathepsin S in MHC class II-associated invariant chain processing and peptide loading. Immunity 4:357.[Medline]
  5. Villadangos, J. A., R. J. Riese, C. Peters, H. A. Chapman, H. L. Ploegh. 1997. Degradation of mouse invariant chain: roles of cathepsins S and D and the influence of major histocompatibility complex polymorphism. J. Exp. Med. 186:549.[Abstract/Free Full Text]
  6. Shi, G. P., J. A. Villadangos, G. Dranoff, C. Small, L. Gu, K. J. Haley, R. Riese, H. L. Ploegh, H. A. Chapman. 1999. Cathepsin S required for normal MHC class II peptide loading and germinal center development. Immunity 10:197.[Medline]
  7. Nakagawa, T. Y., W. H. Brissette, P. D. Lira, R. J. Griffiths, N. Petrushova, J. Stock, J. D. McNeish, S. E. Eastman, E. D. Howard, S. R. Clarke, et al 1999. Impaired invariant chain degradation and antigen presentation and diminished collagen-induced arthritis in cathepsin S null mice. Immunity 10:207.[Medline]
  8. Riese, R. J., R. N. Mitchell, J. A. Villadangos, G. P. Shi, J. T. Palmer, E. R. Karp, G. T. De Sanctis, H. L. Ploegh, H. A. Chapman. 1998. Cathepsin S activity regulates antigen presentation and immunity. J. Clin. Invest. 101:2351.[Medline]
  9. Driessen, C., R. A. Bryant, A. M. Lennon-Dumenil, J. A. Villadangos, P. W. Bryant, G. P. Shi, H. A. Chapman, H. L. Ploegh. 1999. Cathepsin S controls the trafficking and maturation of MHC class II molecules in dendritic cells. J. Cell Biol. 147:775.[Abstract/Free Full Text]
  10. Riese, R. J., G. P. Shi, J. Villadangos, D. Stetson, C. Driessen, A. M. Lennon-Dumenil, C. L. Chu, Y. Naumov, S. M. Behar, H. L. Ploegh, et al 2001. Regulation of CD1 function and NK1.1+ T cell selection and maturation by cathepsin S. Immunity 15:909.[Medline]
  11. Fiebiger, E., P. Meraner, E. Weber, I. F. Fang, G. Stingl, H. Ploegh, D. Maurer. 2001. Cytokines regulate proteolysis in major histocompatibility complex class II-dependent antigen presentation by dendritic cells. J. Exp. Med. 193:881.[Abstract/Free Full Text]
  12. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular responses to interferon-{gamma}. Annu. Rev. Immunol. 15:749.[Medline]
  13. Sukhova, G. K., G. P. Shi, D. I. Simon, H. A. Chapman, P. Libby. 1998. Expression of the elastolytic cathepsins S and K in human atheroma and regulation of their production in smooth muscle cells. J. Clin. Invest. 102:576.[Medline]
  14. Shi, G. P., G. K. Sukhova, A. Grubb, A. Ducharme, L. H. Rhode, R. T. Lee, P. M. Ridker, P. Libby, H. A. Chapman. 1999. Cystatin C deficiency in human atherosclerosis and aortic aneurysms. J. Clin. Invest. 104:1191.[Medline]
  15. Wang, Z., T. Zheng, Z. Zhu, R. J. Homer, R. J. Riese, H. A. Chapman, S. D. Shapiro, J. A. Elias. 2000. Interferon {gamma} induction of pulmonary emphysema in the adult murine lung. J. Exp. Med. 192:1587.[Abstract/Free Full Text]
  16. Zheng, T., Z. Zhu, Z. Wang, R. J. Homer, B. Ma, R. J. Riese, H. A. Chapman, S. D. Shapiro, J. A. Elias. 2000. Inducible targeting of IL-13 to the adult lung causes matrix metalloproteinase- and cathepsin-dependent emphysema. J. Clin. Invest. 106:1081.[Medline]
  17. Ramana, C. V., M. Chatterjee-Kishore, H. Nguyen, G. R. Stark. 2000. Complex roles of Stat1 in regulating gene expression. Oncogene 19:2619.[Medline]
  18. Muhlethaler-Mottet, A., L. A. Otten, V. Steimle, B. Mach. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J. 16:2851.[Medline]
  19. Piskurich, J. F., M. W. Linhoff, Y. Wang, J. P. Ting. 1999. Two distinct {gamma} interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor {beta}. Mol. Cell. Biol. 19:431.[Abstract/Free Full Text]
  20. Roy, S. K., S. J. Wachira, X. Weihua, J. Hu, D. V. Kalvakolanu. 2000. CCAAT/enhancer-binding protein-{beta} regulates interferon-induced transcription through a novel element. J. Biol. Chem. 275:12626.[Abstract/Free Full Text]
  21. Shi, G. P., R. A. Bryant, R. Riese, S. Verhelst, C. Driessen, Z. Li, D. Bromme, H. L. Ploegh, H. A. Chapman. 2000. Role for cathepsin F in invariant chain processing and major histocompatibility complex class II peptide loading by macrophages. J. Exp. Med. 191:1177.[Abstract/Free Full Text]
  22. Silverman, E. S., L. M. Khachigian, V. Lindner, A. J. Williams, T. Collins. 1997. Inducible PDGF A-chain transcription in smooth muscle cells is mediated by Egr-1 displacement of Sp1 and Sp3. Am. J. Physiol. 273:H1415.[Abstract/Free Full Text]
  23. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  24. Meara, J. P., D. H. Rich. 1996. Mechanistic studies on the inactivation of papain by epoxysuccinyl inhibitors. J. Med. Chem. 39:3357.[Medline]
  25. Taniguchi, T., K. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623.[Medline]
  26. Nguyen, H., J. Hiscott, P. M. Pitha. 1997. The growing family of interferon regulatory factors. Cytokine Growth Factor Rev. 8:293.[Medline]
  27. Mamane, Y., C. Heylbroeck, P. Genin, M. Algarte, M. J. Servant, C. LePage, C. DeLuca, H. Kwon, R. Lin, J. Hiscott. 1999. Interferon regulatory factors: the next generation. Gene 237:1.[Medline]
  28. Pierre, P., I. Mellman. 1998. Developmental regulation of invariant chain proteolysis controls MHC class II trafficking in mouse dendritic cells. Cell 93:1135.[Medline]
  29. Lieber, M., B. Smith, A. Szakal, W. Nelson-Rees, G. Todaro. 1976. A continuous tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int. J. Cancer 17:62.[Medline]
  30. Salik, E., M. Tyorkin, S. Mohan, I. George, K. Becker, E. Oei, T. Kalb, K. Sperber. 1999. Antigen trafficking and accessory cell function in respiratory epithelial cells. Am. J. Respir. Cell Mol. Biol. 21:365.[Abstract/Free Full Text]
  31. Chapman, H. A., G. P. Shi. 2000. Protease injury in the development of COPD: Thomas A. Neff lecture. Chest 117:295S.[Free Full Text]
  32. Hobart, M., V. Ramassar, N. Goes, J. Urmson, P. F. Halloran. 1997. IFN regulatory factor-1 plays a central role in the regulation of the expression of class I and II MHC genes in vivo. J. Immunol. 158:4260.[Abstract]
  33. Muhlethaler-Mottet, A., W. Di Berardino, L. A. Otten, B. Mach. 1998. Activation of the MHC class II transactivator CIITA by interferon-{gamma} requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
  34. White, L. C., K. L. Wright, N. J. Felix, H. Ruffner, L. F. Reis, R. Pine, J. P. Ting. 1996. Regulation of LMP2 and TAP1 genes by IRF-1 explains the paucity of CD8+ T cells in IRF-1-/- mice. Immunity 5:365.[Medline]
  35. Harada, H., K. Willison, J. Sakakibara, M. Miyamoto, T. Fujita, T. Taniguchi. 1990. Absence of the type I IFN system in EC cells: transcriptional activator (IRF-1) and repressor (IRF-2) genes are developmentally regulated. Cell 63:303.[Medline]
  36. Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata, T. Taniguchi. 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF- 2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58:729.[Medline]
  37. Blanco, J. C., C. Contursi, C. A. Salkowski, D. L. DeWitt, K. Ozato, S. N. Vogel. 2000. Interferon regulatory factor (IRF)-1 and IRF-2 regulate interferon {gamma}-dependent cyclooxygenase 2 expression. J. Exp. Med. 191:2131.[Abstract/Free Full Text]
  38. Jesse, T. L., R. LaChance, M. F. Iademarco, D. C. Dean. 1998. Interferon regulatory factor-2 is a transcriptional activator in muscle where it regulates expression of vascular cell adhesion molecule-1. J. Cell Biol. 140:1265.[Abstract/Free Full Text]
  39. Vaughan, P. S., F. Aziz, A. J. van Wijnen, S. Wu, H. Harada, T. Taniguchi, K. J. Soprano, J. L. Stein, G. S. Stein. 1995. Activation of a cell-cycle-regulated histone gene by the oncogenic transcription factor IRF-2. Nature 377:362.[Medline]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. de Nooijer, I. Bot, J.H. von der Thusen, M.A. Leeuwenburgh, H.S. Overkleeft, A.O. Kraaijeveld, R. Dorland, P.J. van Santbrink, S.H. van Heiningen, M.M. Westra, et al.
Leukocyte Cathepsin S Is a Potent Regulator of Both Cell and Matrix Turnover in Advanced Atherosclerosis
Arterioscler. Thromb. Vasc. Biol., February 1, 2009; 29(2): 188 - 194.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Hirakawa, R. A. Pierce, G. Bingol-Karakoc, C. Karaaslan, M. Weng, G.-P. Shi, A. Saad, E. Weber, T. J. Mariani, B. Starcher, et al.
Cathepsin S Deficiency Confers Protection from Neonatal Hyperoxia-induced Lung Injury
Am. J. Respir. Crit. Care Med., October 15, 2007; 176(8): 778 - 785.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
N. Rodriguez, J. Mages, H. Dietrich, N. Wantia, H. Wagner, R. Lang, and T. Miethke
MyD88-dependent changes in the pulmonary transcriptome after infection with Chlamydia pneumoniae
Physiol Genomics, July 18, 2007; 30(2): 134 - 145.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
X. W. Cheng, K. Obata, M. Kuzuya, H. Izawa, K. Nakamura, E. Asai, T. Nagasaka, M. Saka, T. Kimata, A. Noda, et al.
Elastolytic Cathepsin Induction/Activation System Exists in Myocardium and Is Upregulated in Hypertensive Heart Failure
Hypertension, November 1, 2006; 48(5): 979 - 987.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
O. Altiok, R. Yasumatsu, G. Bingol-Karakoc, R. J. Riese, M. T. Stahlman, W. Dwyer, R. A. Pierce, D. Bromme, E. Weber, and S. Cataltepe
Imbalance between Cysteine Proteases and Inhibitors in a Baboon Model of Bronchopulmonary Dysplasia
Am. J. Respir. Crit. Care Med., February 1, 2006; 173(3): 318 - 326.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y. Huang, J. Yan, R. Lubet, T. W. Kensler, and T. R. Sutter
Identification of novel transcriptional networks in response to treatment with the anticarcinogen 3H-1,2-dithiole-3-thione
Physiol Genomics, January 12, 2006; 24(2): 144 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Wang, R. M. Baron, G. Zhu, M. Joo, J. W. Christman, E. S. Silverman, M. A. Perrella, R. J. Riese, and M. Cernadas
PU.1 Regulates Cathepsin S Expression in Professional APCs
J. Immunol., January 1, 2006; 176(1): 275 - 283.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Liu, E. Shue, K. L. Ewalt, and P. Schimmel
A new {gamma}-interferon-inducible promoter and splice variants of an anti-angiogenic human tRNA synthetase
Nucleic Acids Res., February 2, 2004; 32(2): 719 - 727.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R.-L. Xie, S. Gupta, A. Miele, D. Shiffman, J. L. Stein, G. S. Stein, and A. J. van Wijnen
The Tumor Suppressor Interferon Regulatory Factor 1 Interferes with SP1 Activation to Repress the Human CDK2 Promoter
J. Biol. Chem., July 11, 2003; 278(29): 26589 - 26596.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Bania, E. Gatti, H. Lelouard, A. David, F. Cappello, E. Weber, V. Camosseto, and P. Pierre
Human cathepsin S, but not cathepsin L, degrades efficiently MHC class II-associated invariant chain in nonprofessional APCs
PNAS, May 27, 2003; 100(11): 6664 - 6669.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Beers, K. Honey, S. Fink, K. Forbush, and A. Rudensky
Differential Regulation of Cathepsin S and Cathepsin L in Interferon {gamma}-treated Macrophages
J. Exp. Med., January 20, 2003; 197(2): 169 - 179.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Storm van’s Gravesande, K.
Right arrow Articles by Riese, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Storm van’s Gravesande, K.
Right arrow Articles by Riese, R. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS