|
|
||||||||
-Dependent Cathepsin S Expression1

* Department of Medicine, Brigham and Womens Hospital and Harvard Medical School, Boston, MA 02115; and
Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
. Given its importance, we sought to elucidate the pathway by
which IFN-
increases cathepsin S expression. Our data
demonstrate that the cathepsin S promoter contains an IFN-stimulated
response element (ISRE) that is critical for IFN-
-induced gene
transcription in a cell line derived from type II alveolar epithelial
(A549) cells. IFN response factor (IRF)-2 derived from A549 nuclear
extracts associates with the ISRE oligonucleotide in gel shift assays,
but is quickly replaced by IRF-1 following stimulation with IFN-
.
The time course of IRF-1/ISRE complex formation correlates with
increased levels of IRF-1 protein and cathepsin S mRNA. Overexpression
of IRF-1, but not IRF-2, markedly augments cathepsin S promoter
activity in A549 cells. Furthermore, overexpression of IRF-1 increases
endogenous cathepsin S mRNA levels in 293T epithelial cells. Finally,
freshly isolated bone marrow cells from IRF-1-/- mice
fail to up-regulate cathepsin S activity in response to IFN-
. Thus,
IRF-1 is the critical transcriptional mediator of IFN-
-dependent
cathepsin S activation. These data elucidate a new pathway by which
IRF-1 may affect MHC class II processing and
presentation. | Introduction |
|---|
|
|
|---|
(3) in several cell types (1, 2). Cathepsin S plays an essential role in regulation of MHC class II maturation and trafficking within APCs by mediating processing of class II-associated invariant chain (Ii)3 and exogenous Ags (4, 5, 6, 7, 8). In B cells and dendritic cells, cathepsin S uniquely mediates the final cleavage of Ii to generate class II-associated invariant chain peptide (CLIP). This cleavage is necessary to permit subsequent liberation of the Ii remnant from the class II-binding groove and class II-peptide complex formation. The importance of cathepsin S in regulating MHC class II-restricted Ag processing and presentation is well illustrated by the phenotype of cathepsin S-/- mice (6, 7). Inhibition of cathepsin S activity in B cells and dendritic cells results in accumulation of class II-Ii complexes, attenuation of class II-peptide complex formation, and inability of these cells to present certain antigenic determinants. Dendritic cells derived from cathepsin S-/- mice have a marked defect of MHC class II endosomal trafficking (9, 10). Finally, in human dendritic cells, proinflammatory cytokines give rise to a surge of MHC class II-peptide complex formation that is dependent on cathepsin S activity (11). Thus, regulation of cathepsin S expression and activity has important consequences in control of MHC class II function and subsequent CD4+ T cell stimulation.
IFN-
is a potent regulator of cathepsin S expression in vascular
smooth muscle cells and in the lung parenchyma (12).
Arterial smooth muscle cells stimulated with IFN-
exhibit enhanced
cathepsin S activity and secretion, with a concomitant increase in
supernatant elastolytic activity, which is blocked with a selective
cathepsin S inhibitor (13). Furthermore, cathepsin S
activity is increased in walls of atheromas and aneurysms as compared
with normal arteries, suggesting that this enzyme may be playing a role
in breakdown of the extracellular matrix in atherosclerosis
(14). Within the lung, transgenic mice generated to
overexpress IFN-
exhibit a chronic inflammatory cell infiltrate,
increased cysteine protease activity, and emphysematous-like changes in
lung pathology and physiology (15, 16). Analysis of
bronchoalveolar lavage fluid of these transgenic mice shows that
cathepsin S retains the most activity of the cysteine proteases in the
extracellular environment, consistent with its broad pH profile. Thus,
IFN-
-induced activation of cathepsin S has important physiological
relevance in several disease processes, and elucidation of this pathway
may have direct clinical significance.
IFN-
signaling involves ligand-induced oligomerization of IFN-
receptor subunits, leading to phosphorylation and activation of Janus
kinase 1 and 2. This in turn leads to activation of the dormant Stat1
molecule. Stat1 homodimers translocate to the nucleus, where they
direct transcription of specific target genes (17),
including such secondary transcriptional activators as the family of
IFN response factors (IRF), class II transactivator (CIITA) promoters
III and IV, and CCAAT/enhancing-binding protein-
(18, 19, 20). These transcriptional regulators are
intermediaries in a complicated network that produces alterations in
gene expression and cellular function.
This study seeks to identify the molecular pathway by which IFN-
induces up-regulation of the cathepsin S gene. We have
identified a functional IFN-stimulated response element (ISRE) in the
cathepsin S promoter -100 bp from the transcriptional start site. We
show that, in human bronchial epithelial A549 cells, IRF-1 directly
binds to this site and mediates IFN-
-dependent transcriptional
activation. These data elucidate a new pathway by which IRF-1 may
influence several important biological processes, including maturation
and trafficking of MHC class II molecules, vascular remodeling, and
elastin degradation within the lung.
| Materials and Methods |
|---|
|
|
|---|
The type II alveolar epithelial (A549) cell line (American Type Culture Collection, Manassas, VA) and the 293T epithelial cell line were cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS (Life Technologies, Rockville, MD), 10 mM glutamine, and penicillin/streptomycin. Cells were maintained at 37°C and 5% CO2 in a humidified incubator and passed at confluence every 4 days.
Plasmids
A 892-bp fragment of the cathepsin S gene, using
human genomic DNA as a template, was amplified by the PCR, the product
containing 859 bp of the 5' flanking region and the first 32 bp of exon
1. This fragment was subcloned into a pGL3-basic (Promega, Madison, WI)
vector at the restriction sites HindIII and KpnI
and designated CatS (-859/+32). To localize cis regulatory
elements that may be important for IFN-
induction of cathepsin S, we
used CatS (-859/+32) as a template to generate truncated cathepsin S
5' flanking regions by PCR. Constructs containing these 5'-deletion
fragments were designated CatS (-597/+32), CatS (-375/+32), CatS
(-230/+32), and CatS (-75/+32). The full-length construct, CatS
(-859/+32), was also used as a template to mutate the downstream IRSE
site (-100 to -90, GAAACTGAAA to GAACTTAGAAT) by site-directed
mutagenesis (QuickChange XL site-directed mutagenesis kit; Stratagene,
La Jolla, CA). DNA sequencing confirmed the accuracy of all constructs
used in this study. pSV-
-galactosidase (
-gal) plasmid containing
the
-gal reporter gene was obtained from Promega.
Plasmid DNA was purified from Escherichia coli using the
Qiagen plasmid purification system according to manufacturers
instruction (Chatsworth, CA).
Transfection and preparation of cell extracts
Transient transfections were conducted in A549 cells, which were
grown to 80% confluence in 60-mm dishes and transfected with
LipofectAMINE PLUS (Invitrogen, San Diego, CA) with 2 µg CatS
constructs and 2 µg pSV-
-gal plasmid. Coexpression experiments
were performed with IRF-1, IRF-2, and empty vector expression
constructs. Each experiment was conducted so that the sum of all
plasmid concentrations transfected was equal. Transfected cells were
stimulated with 50 ng/ml human rIFN-
(Sigma-Aldrich, St. Louis, MO)
for 24 h, placed in lysis buffer (Promega), and subjected to one
freeze-and-thaw cycle. Firefly luciferase activity was then assayed in
lysates using the luciferase assay method (Promega). Luciferase
activity was normalized to
-gal activity to control for transfection
efficiency.
In some experiments (Fig. 6
C), 293T cells were transfected
with the IRF-1 expression construct using Fugene (Roche, Indianapolis,
IN). Cells were grown to 5070% confluence in 8.5-cm tissue
culture dishes, and growth was arrested overnight in 8 ml serum-free
RPMI medium. Transfection was performed by adding 18 µl Fugene
reagent to 6 µg IRF-1 DNA (or empty vector). Cells were incubated for
24 h, and Northern analysis was performed as described below.
|
Cells were lysed in 50 µl 1% Triton X-100, 50 mM sodium acetate (pH 4.2), and 1 mM EDTA on ice for 30 min. Postnuclear extracts were normalized to total protein content and incubated with 125I-labeled JPM565 (125I-JPM565; gift of H. Ploegh, Boston, MA) for 1 h at 37°C. Labeled lysates were then either subjected to SDS-PAGE right away (bone marrow cells), or immunoprecipitation, as described below (A549 cells).
Immunoprecipitation was performed, as described previously (21). Following active site labeling of A549 cell lysates with 125I-JPM, SDS was added to bring the final concentration to 1%. Samples were boiled for 3 min, neutralized, and diluted 10-fold with 0.5% Nonidet P-40, 50 mM Tris (pH 7.4), and 5 mM MgCl2. For the immunoprecipitation, samples were precleared initially with 5 µl normal rabbit serum (Sigma-Aldrich) and 100 µl protein A-agarose (Santa Cruz Biotechnology, Santa Cruz, CA), followed by a second preclear with 100 µl protein A-agarose alone. Immunoprecipitation was performed by incubating each sample with 10 µl anti-cathepsin S serum (gift of H. Chapman, San Francisco, CA) and 100 µl protein A-agarose. Both preclears and immunoprecipitation steps were conducted at 4°C for 1 h. Immunoprecipitated pellets were washed five times with 50 mM Tris (pH 7.4), 150 mM NaCl, and 3 mM EDTA. Proteins were eluted from the beads by addition of SDS sample buffer. Samples were boiled for 5 min, analyzed by SDS-PAGE, and visualized by autoradiography.
EMSA
Nuclear extracts from A549 cells were prepared by a modification
of the method of Dignam et al. (22, 23) and described
elsewhere. A double-stranded oligonucleotide for the IRSE consensus
binding site (-110 to -79, GATTTTAAATGAAACTGAAATGAAAGTT)
was radiolabeled by filling in a 5' overhang with
[
-32P]deoxycytidine 5'-triphosphate
and Klenow fragment (NEB, Beverly, MA) and purified by gel filtration
(Chroma Spin +ST-10 columns; Clontech Laboratories, Palo Alto, CA). A
mutated probe for the IRSE site was also generated (-110 to -79,
GATTTTAAATGAACTTAGAATGAAAGTT).
Protein-DNA-binding reactions were performed with 510 µg nuclear extract protein, 1 µl-labeled oligonucleotide (50,000 cpm), 1 µg poly(dI-dC), 1 µl salmon sperm DNA in 100 mM Tris (pH 7.5), 10 mM EDTA, 10 mM DTT, and 50% glycerol in a total volume of 20 µl. After incubation at room temperature for 30 min, protein-DNA complexes were resolved on a 5% nondenaturing acrylamide gel in a 1x Tris-borate-EDTA buffer at room temperature and visualized by autoradiography.
Supershift and cold competition experiments were performed by
preincubating nuclear cell extracts with 2 µg specific polyclonal Abs
(IRF-1, IRF-2, IRF-4, IFN consensus sequence-binding protein
(ICSBP), IFN-stimulated gene factor 3
(ISGF3
), p50, p65;
Santa Cruz Biotechnology) or 40 molar excess of annealed cold
oligonucleotides, respectively, before addition of labeled probes.
Northern blot
Total RNA from 1 x 106 A549 or 293T
cells was extracted using the RNeasy mini kit (Qiagen). A quantity
amounting to 1520 µg total RNA was fractionated by electrophoresis
on a formaldehyde-agarose gel, transferred to a nylon membrane, and
probed with 32P-labeled cDNA probes. The cDNA
probe for cathepsin S was generated by RT-PCR from total RNA extracted
from A549 cells. The 345-bp cathepsin S cDNA probe, the rat GAPDH
probe, the
-actin probe, and IRF-1 probe were labeled with
[
-32P]deoxy cytidine 5'-triphosphate using
the Prime-It II Random Primer labeling kit (Stratagene). The membrane
was hybridized using QuickHyb solution (Stratagene) at 68°C for 60
min, washed according to manufacturers directions, and exposed to
Kodak XAR film at -80°C. Equity of sample loading was assessed by
stripping and reprobing the membrane with
32P-labeled GAPDH or
-actin cDNA.
Western blot
Nuclear extracts from unstimulated and stimulated A549 cells were used and prepared, as described above. Protein concentrations were measured, and equal amounts of nuclear extracts were subjected to a 15% SDS-PAGE, transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH), and probed with either a specific IRF-1, IRF-2, or Sp3 Ab (Santa Cruz Biotechnology). Membranes were incubated with secondary HRP-conjugated anti-rabbit antiserum (Pierce, Rockford, IL), and detected by chemiluminescence (Amersham, Arlington Heights, IL).
Mice and tissue culture
Mice with a targeted mutation in the IRF-1 gene (B6.129-IRF1tem1Mak) and control mice (C57BL/6) were obtained from The Jackson Laboratory (Bar Harbor, ME). Male and female mice were used between 8 and 12 wk old. All animals were maintained under pathogen-free conditions at the animal facilities of Harvard Medical School (Boston, MA) in compliance with institutional guidelines. Isolation of bone marrow cells was performed, as previously described, following euthanasia with ketamine/xylazine (9).
| Results |
|---|
|
|
|---|
up-regulates cathepsin S activity and mRNA expression in
A549 cells
To determine whether cathepsin S activity is up-regulated in A549
cells, cells were stimulated with 50 ng/ml IFN-
for 4, 12, 24, and
48 h, and lysates were labeled with the cysteine protease suicide
inhibitor 125I-JPM565 (21, 24).
Subsequent to active site labeling, cathepsin S was immunoprecipitated
(Fig. 1
). In the absence of IFN-
, no
significant cathepsin S activity was evident. Following stimulation
with IFN-
, there was a marked increase in cathepsin S activity at
4 h. The activity levels of this enzyme continued to increase for
at least 48 h. Thus, cathepsin S activity is increased in response
to IFN-
in A549 cells.
|
also induced expression of cathepsin
S mRNA (Fig. 2
for 1, 2, 3, 4, 12, and 24 h. Expression of cathepsin
S mRNA was monitored by Northern blotting. An increase in mRNA levels
was observed after 1 h of IFN-
stimulation, with further
increases at 2, 3, 4, and 12 h (Fig. 2
stimulation, whereas the protein
activity level was maintained for at least 48 h (Fig. 1
|
up-regulation
in A549 cells
To localize the most important IFN-
response elements found in
the cathepsin S promoter, we designed a series of promoter-reporter
deletion constructs. A deletion series was made with progressively
smaller fragments of the 5' region of the cathepsin S gene,
cloned in tandem with the luciferase reporter gene. Constructs were
then transiently transfected into A549 cells for determination of
transcriptional activity and inducibility following stimulation with
IFN-
(Fig. 3
). IFN-
induction of
the full-length CatS (-859/+32) construct resulted in a 36-fold
increase in luciferase activity. Further deletions of the 5' region
moderately decreased the inducibility between 12- and 20-fold, but did
not alter basal activity significantly. After the deletion of the IRSE
consensus binding site (CatS (-75/+32)), a marked loss of inducibility
was observed, suggesting that the IRSE site is critical for IFN-
induction in the cathepsin S promoter.
|
-dependent activation of the cathepsin S promoter (Fig. 3
.
IRF-1 binds to the IRSE in an IFN-
-dependent manner
Several members of the IRF family can bind to ISRE and influence
transcriptional regulation (25, 26, 27). To determine which
IRF family member binds to the cathepsin S ISRE and activates this gene
in A549 cells, we performed gel supershift analyses. These experiments
were conducted using the cathepsin S ISRE oligonucleotide sequence and
Abs specific for IRF-1, IRF-2, IRF-4, ICSBP/IRF-8, and ISGF3
(p48,
IRF-9) in A549 cells stimulated with IFN-
for 24 h (Fig. 4
A). Abs against NF-
B (p50,
p65) were also used, because this transcription factor can form
complexes with several IRF family members. In nuclear extracts derived
from IFN-
-stimulated A549 cells, IRF-1 binds directly to the ISRE
sequence, as shown by a supershift of the IRF-1/ISRE complex following
incubation with an Ab against IRF-1 (Fig. 4
A). The other IRF
family members were not supershifted in IFN-
-stimulated cells. This
IRF-1 complex was specific, because a 40-fold molar excess of unlabeled
identical oligonucleotide, but not unrelated oligonucleotide, competed
for IRF-1 binding and abolished the DNA-protein complex (Fig. 4
A). Also, incubation of A549 nuclear extracts with a
radiolabeled probe containing the mutated IRSE site resulted in
complete loss of complex formation (Fig. 4
A).
|
-stimulated cells (Fig. 4
stimulation, IRF-2 is able to associate with this oligonucleotide in
vitro. However, following activation with IFN-
, the situation was
reversed; the DNA-protein complex was supershifted with the IRF-1 Ab,
indicating that IRF-1 had now replaced IRF-2.
As shown in Figs. 1
and 2
, the up-regulation of cathepsin S occurs
relatively rapidly, with a noticeable increase in mRNA following 1
h of stimulation. If indeed IRF-1 is the key element mediating
increased transcription, one would expect IRF-1 binding to occur with a
similar time course. A549 cells were stimulated with IFN-
for 1, 2,
3, 4, and 12 h, and nuclear extracts were prepared (Fig. 5
A). After 1 h of
stimulation with IFN-
, IRF-1 formed a complex with the IRSE
oligonucleotide. This complex, which persisted for at least 24 h,
exhibited maximum protein-DNA complex formation at 23 h. Following
IFN-
stimulation, we could not supershift the DNA-protein complex
with an Ab against IRF-2 at any time point (data not shown).
|
demonstrated no detectable levels of IRF-1.
Activation of these cells with IFN-
led to a rapid and robust
increase in IRF-1 expression (Fig. 5
. Thus, IFN-
exerts its IRF-1-mediated
effects primarily through augmentation of IRF-1 expression. IRF-1, but not IRF-2, increases cathepsin S promoter activity
The above data show that the ISRE consensus site is required for
IFN-
-induced cathepsin S expression, and that IRF-1 derived from
A549 nuclear extracts is capable of associating with this sequence. We
wanted to examine whether IRF-1 expression could increase cathepsin S
promoter activity independent of IFN-
. We cotransfected an
IRF-1-containing expression vector into A549 cells and examined
cathepsin S promoter activity. Transfection of IRF-1 led to a
dose-dependent increase in cathepsin S promoter activity as compared
with transfection of empty vector (Fig. 6
A). Mutation of the ISRE site
resulted in a marked reduction of IRF-1-induced cathepsin S promoter
activity, indicating that the IRF-1/ISRE complex formation at this site
is necessary for promoter activity. In contrast, cotransfection of
IRF-2 mildly repressed both constitutive and inducible promoter
activity (Fig. 6
B). Titration of IRF-2 did not significantly
inhibit IRF-1-inducible promoter activity in cotransfection experiments
(data not shown). Thus, IRF-1, but not IRF-2, is capable of inducing
cathepsin S transcription, and this gene activation is dependent on an
intact IRSE site.
To determine whether IRF-1 can activate the endogenous cathepsin
S gene, Northern analysis of RNA from 293T epithelial cells was
performed following transfection of cells with empty expression vector
(left lane), IRF-1 expression vector (middle
lane), or stimulation with 50 ng/ml IFN-
(right
lane) (Fig. 6
C). The 293T cells were used for this
experiment because the transfection efficiency in A549 cells (24%)
was too low to detect changes in cathepsin S expression by Northern
analysis. The 293T cells, like A549 cells, exhibit an IFN-
-dependent
increase in cathepsin S protein activity (data not shown). Cells were
incubated for 24 h following transfection of IRF-1 before RNA
extraction. Both transfection of IRF-1 and stimulation with IFN-
resulted in a clear increase in cathepsin S mRNA in these cells
(top panel). As expected, IRF-1 transfection and
IFN-
stimulation also resulted in an increase in IRF-1 mRNA levels
(middle panel). Thus, IRF-1 is capable of up-regulating the
endogenous expression of cathepsin S.
IRF-1 mediates the IFN-
-induced up-regulation of cathepsin S in
mouse bone marrow cells
The functional significance of cathepsin S has been best
elucidated in professional APCs, in which it participates in Ii
degradation and class II trafficking and maturation (4, 6, 7). In fact, the delivery of mature class II-peptide complexes
to the cell surface of dendritic cells is associated with increased
cathepsin S activity, and may even be physiologically regulated by
manipulation of enzyme activity (11, 28). To investigate
whether IRF-1 also regulates IFN-
-induced cathepsin S expression in
APCs, bone marrow cells from wild-type and
IRF-1-/- mice were isolated and incubated
overnight in the presence of IFN-
(50 ng/ml). Analysis of the murine
cathepsin S promoter revealed a homologous IRSE consensus site at -26
bp upstream from the transcriptional start site. Bone marrow cells from
IRF-1-/- mice displayed normal levels of
constitutive cathepsin S expression (Fig. 7
). This finding of normal constitutive
cathepsin S expression also holds true for B cells, dendritic cells,
and macrophages derived from IRF-1-/- animals
(data not shown). However, stimulation of
IRF-1-/- bone marrow cells with IFN-
failed
to significantly increase activity levels of cathepsin S. A similar
observation was reproduced in B cells derived from
IRF-1-/- animals (data not shown). Thus, IRF-1
is critical for IFN-
-induced cathepsin S activation in APCs, but
does not regulate constitutive cathepsin S expression.
|
| Discussion |
|---|
|
|
|---|
-induced
activation of cathepsin S is mediated by IRF-1 binding to a single IRSE
site 100 bp upstream from the transcriptional start site of the
cathepsin S promoter. The fact that IRF-1 is widely distributed among
different cell types and tissues, and that APCs from
IRF-1-/- mice do not up-regulate cathepsin S
expression in response to IFN-
, suggests that this pathway is more
generally applicable to other cell types (26). The link
between cathepsin S and IRF-1 has several important implications.
Cathepsin S is highly expressed in alveolar macrophages and other bone
marrow-derived APCs (1). Our data demonstrate that
cathepsin S can also be expressed in A549 cells, which are derived from
an epithelial alveolar type II cell, following induction with IFN-
(29). A549 cells are capable of expressing the necessary
MHC class II and class II-related machinery to act as effective APCs
when stimulated with IFN-
, implicating a role for cathepsin S in
processing of Ii and exogenous Ags for MHC class II-dependent
presentation in these cells (30). Furthermore, lung
epithelial cells, including type II epithelial cells, are potential
sources for production and secretion of elastinolytic proteases within
the lung (31). Consistent with this concept, selective
overexpression of IFN-
within the lung results in a production of
chronic inflammatory cell infiltrate and emphysema in a murine model of
irreversible obstructive airway disease (15, 16).
IFN-
regulates both MHC class I and class II expression. However,
the pathways by which IFN-
stimulates expression of these proteins,
and related molecules, are not identical. Similar to cathepsin S, IRF-1
mediates the IFN-
-stimulated MHC class II response, but does not
appear to influence constitutive expression in professional APCs
(32). Unlike cathepsin S, MHC class II expression is
regulated by CIITA, the master transactivating regulatory element for
MHC class II, Ii, and HLA-DM (18, 19, 33). The cathepsin S
promoter does not contain an X box consensus site, nor does
transfection of CIITA significantly alter cathepsin S expression (data
not shown). In contrast to MHC class II and cathepsin S, both
constitutive and IFN-
-induced expression of MHC class I is markedly
reduced in IRF-1-/- animals, presumably from
attenuated expression of TAP1 and low molecular mass polypeptide 2.
TAP1 and low molecular mass polypeptide 2 are regulated by IRF-1
binding directly to an IRSE element within their promoter segments
(34). The transcriptional regulation of constitutive
cathepsin S expression in APCs remains to be elucidated.
Initial studies on transcriptional regulation of the IFN-
and IFN-
genes suggested that IRF-1 and IRF-2 act as
transcriptional activators and repressors of gene expression,
respectively (35, 36). This conclusion was based on
studies showing that cotransfection of IRF-1 increased expression of
IFN-
, whereas cotransfection of IRF-2 reduced this IRF-1-mediated
activation. A more recent study showed that IRF-1 mediated the
activation of cyclooxygenase 2 expression, whereas IRF-2 inhibited both
the constitutive and IRF-1-induced activation of this gene
(37). Macrophages from IRF-2-/-
mice exhibited an increase in both basal and IFN-
-induced
cylooxygenase 2 expression, consistent with the paradigm that IRF-2
acts as a transcriptional repressor for this molecule. However, IRF-2
has also been shown to up-regulate expression of other genes, including
histone 4 and VCAM-1 (38, 39).
Our data from investigation of transcriptional regulation of cathepsin
S show that in the absence of significant IRF-1 expression, IRF-2 is
able to associate in vitro with the ISRE oligonucleotide derived from
the cathepsin S promoter. We cannot find any evidence that IRF-2
stimulates transcription of the cathepsin S gene. When
present following stimulation with IFN-
, IRF-1 may exhibit a higher
affinity for the cathepsin S IRSE oligonucleotide than IRF-2, and thus
IRF-2 binding is not detected in vitro (Figs. 5
and 6
). Overexpression
of IRF-2 in the A549 cells moderately attenuates both the
IFN-
-induced and basal expression levels of cathepsin S, although
the degree of inhibition is lower than that observed for other genes
(37).
These data show that regulation of IFN-
-stimulated cathepsin S
expression in A549 cells is largely controlled by IRF-1 binding to the
ISRE in the cathepsin S promoter. Other members of the IRF family, such
as ICSBP, IRF-4, or ISGF3
(p48), did not associate with this site.
However, subtler pieces of evidence suggest that other factors may also
influence transcriptional activation of this protease. In the deletion
series, we consistently observe an
2-fold decrement in promoter
activity with the first deletion construct (CatS -596/+32) as compared
with the full-length construct (CatS -859/+32). Thus, the ISRE site is
necessary, but not sufficient for full activation of the cathepsin S
promoter. In fact, this region contains five CCAAT/enhancing-binding
protein-
consensus elements and potential binding sites for high
mobility group protein I/Y, which might facilitate the IFN-
response
through formation of higher order complexes (20). The
exact pathway by which these enhancer elements may augment
IFN-
-induced cathepsin S transcription deserves further
investigation.
In summary, IFN-
stimulates cathepsin S expression via direct
association of IRF-1 with the cathepsin S promoter. Given the recent
interest in cathepsin S regulation in several physiologic and
pathologic processes, the elucidation of the transcriptional pathway
controlling expression of this enzyme may give rise to novel
therapeutic strategies.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Richard J. Riese, Division of Pulmonary and Critical Care Medicine, Brigham and Womens Hospital, Tower 4B, 75 Francis Street, Boston, MA 02115. E-mail address: rriese{at}rics.bwh.harvard.edu ![]()
3 Abbreviations used in this paper: Ii, invariant chain; CIITA, class II transactivator; CLIP, class II-associated invariant chain peptide; 125I-JPM565, 125I-labeled JPM565; ICSBP, IFN consensus sequence-binding protein; IRF, IFN regulatory factor; ISGF3
, IFN-stimulated gene factor 3
; ISRE, IFN-stimulated response element;
-gal,
-galactosidase. ![]()
Received for publication October 23, 2001. Accepted for publication February 28, 2002.
| References |
|---|
|
|
|---|
. Annu. Rev. Immunol. 15:749.[Medline]
induction of pulmonary emphysema in the adult murine lung. J. Exp. Med. 192:1587.
interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor
. Mol. Cell. Biol. 19:431.
regulates interferon-induced transcription through a novel element. J. Biol. Chem. 275:12626.
requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
-dependent cyclooxygenase 2 expression. J. Exp. Med. 191:2131.This article has been cited by other articles:
![]() |
R. de Nooijer, I. Bot, J.H. von der Thusen, M.A. Leeuwenburgh, H.S. Overkleeft, A.O. Kraaijeveld, R. Dorland, P.J. van Santbrink, S.H. van Heiningen, M.M. Westra, et al. Leukocyte Cathepsin S Is a Potent Regulator of Both Cell and Matrix Turnover in Advanced Atherosclerosis Arterioscler. Thromb. Vasc. Biol., February 1, 2009; 29(2): 188 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hirakawa, R. A. Pierce, G. Bingol-Karakoc, C. Karaaslan, M. Weng, G.-P. Shi, A. Saad, E. Weber, T. J. Mariani, B. Starcher, et al. Cathepsin S Deficiency Confers Protection from Neonatal Hyperoxia-induced Lung Injury Am. J. Respir. Crit. Care Med., October 15, 2007; 176(8): 778 - 785. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rodriguez, J. Mages, H. Dietrich, N. Wantia, H. Wagner, R. Lang, and T. Miethke MyD88-dependent changes in the pulmonary transcriptome after infection with Chlamydia pneumoniae Physiol Genomics, July 18, 2007; 30(2): 134 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. W. Cheng, K. Obata, M. Kuzuya, H. Izawa, K. Nakamura, E. Asai, T. Nagasaka, M. Saka, T. Kimata, A. Noda, et al. Elastolytic Cathepsin Induction/Activation System Exists in Myocardium and Is Upregulated in Hypertensive Heart Failure Hypertension, November 1, 2006; 48(5): 979 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Altiok, R. Yasumatsu, G. Bingol-Karakoc, R. J. Riese, M. T. Stahlman, W. Dwyer, R. A. Pierce, D. Bromme, E. Weber, and S. Cataltepe Imbalance between Cysteine Proteases and Inhibitors in a Baboon Model of Bronchopulmonary Dysplasia Am. J. Respir. Crit. Care Med., February 1, 2006; 173(3): 318 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang, J. Yan, R. Lubet, T. W. Kensler, and T. R. Sutter Identification of novel transcriptional networks in response to treatment with the anticarcinogen 3H-1,2-dithiole-3-thione Physiol Genomics, January 12, 2006; 24(2): 144 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, R. M. Baron, G. Zhu, M. Joo, J. W. Christman, E. S. Silverman, M. A. Perrella, R. J. Riese, and M. Cernadas PU.1 Regulates Cathepsin S Expression in Professional APCs J. Immunol., January 1, 2006; 176(1): 275 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, E. Shue, K. L. Ewalt, and P. Schimmel A new {gamma}-interferon-inducible promoter and splice variants of an anti-angiogenic human tRNA synthetase Nucleic Acids Res., February 2, 2004; 32(2): 719 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-L. Xie, S. Gupta, A. Miele, D. Shiffman, J. L. Stein, G. S. Stein, and A. J. van Wijnen The Tumor Suppressor Interferon Regulatory Factor 1 Interferes with SP1 Activation to Repress the Human CDK2 Promoter J. Biol. Chem., July 11, 2003; 278(29): 26589 - 26596. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bania, E. Gatti, H. Lelouard, A. David, F. Cappello, E. Weber, V. Camosseto, and P. Pierre Human cathepsin S, but not cathepsin L, degrades efficiently MHC class II-associated invariant chain in nonprofessional APCs PNAS, May 27, 2003; 100(11): 6664 - 6669. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Beers, K. Honey, S. Fink, K. Forbush, and A. Rudensky Differential Regulation of Cathepsin S and Cathepsin L in Interferon {gamma}-treated Macrophages J. Exp. Med., January 20, 2003; 197(2): 169 - 179. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |