| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109; and
Department of Microbiology and Immunology, Walther Oncology Center, Indiana University, Indianapolis, IN 46202
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-induced MHC
class II expression (2, 3). These findings were further
confirmed in CIITA-deficient (CIITA-/-) mice
(4). These mice lack MHC class II expression on APCs,
although residual MHC class II expression has been reported on a subset
of dendritic cells (5). However,
CIITA-/- mice have a severe reduction in the
number of CD4 T cells due to the lack of positive selection in the
thymus (4). Other genes have also been shown to be affected by CIITA, including the invariant chain (6, 7), HLA-DM (7), MHC class I (8), and HIV virus long terminal repeat expression (9). We have reported that CIITA inhibits IL-4 gene transcription (10). In CIITA-/- mice, IL-4 was aberrantly expressed in Th1 cells and constitutive expression of CIITA in a Th2 clone-repressed IL-4 gene transcription (10). The inhibition of IL-4 was due to the competition between CIITA and NF-AT for binding to the coactivator p300/CBP (11). Taken together, these data suggest that CIITA plays an important role in immune responses for both B and T cells.
Naive CD4 T cells require activation through the TCR to become effector Th1 or Th2 cells that participate in cellular or humoral immunity, respectively. However, the same TCR activation signals may result in preactivated T cells undergoing activation-induced cell death (AICD) (12). The Fas-Fas ligand cell death pathway has been shown to be critical for AICD, which is the mechanism to maintain homeostasis by eliminating unwanted T cells after an immune response (12). Mice that lack Fas or Fas ligand have a severe combined immune disorder in which lymphocytes proliferate out of control, resulting in autoimmune diseases (13, 14).
Fas ligand (CD95L) is a member of the TNF family and is expressed primarily on activated T cells (15), NK cells (16), and cells at immune privileged sites (17). Interaction between Fas ligand and its receptor, Fas, results in the Fas-bearing cell undergoing apoptosis. We have demonstrated that the constitutive expression of CIITA in CD4 T cell lines resulted in the inhibition of Fas ligand expression (18). CD4 T cell lines expressing CIITA were not able to up-regulate Fas ligand after TCR activation and, as a consequence, were resistant to AICD and could not kill Fas-bearing target cells (18). The inhibition of Fas ligand by CIITA was also mediated via NF-AT (18). In this study, we show that mice deficient in CIITA have enhanced Fas ligand expression on developing Th1 cells and on LPS-stimulated B cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abs specific for CD4 (H129.1.9), Fas ligand (MFL3), B220
(RA3-6B2), MHC class II I-Ab (AF6-120.1), CD44
(IM7), CD45RB (23G2), and recombinant IL-4 and IFN- were obtained
from BD PharMingen (San Diego, CA). The 2C11 (anti-mouse TCR),
2.4-G2 (anti-FcR), 30H12 (anti-Thy-1), 1D3 (anti-CD19), TIB
105 (anti-CD8), and TIB 210 (anti-CD8) were purified from
hybridoma supernatant. LPS was purchased from Sigma-Aldrich (St. Louis,
MO). Guinea pig complement was obtained from Invitrogen (Carlbad, CA).
Anti-mouse Ig- and anti-rat Ig-coated magnetic beads were purchased
from Polysciences (Warrington, PA). Flow cytometry was performed using
BD Biosciences (Mountain View, CA) FACScan.
Mice and cell lines
CIITA-/-,
A
-/-, CIITA-/- I-E,
and A-/- I-E mice were described elsewhere
(4, 10, 19). The AND TCR transgenic mice were kindly
provided by R. Miller (University of Michigan). C57BL/6 mice were
obtained from The Jackson Laboratory (Bar Harbor, ME). All mice were
maintained under specific pathogen-free conditions at the University of
Michigan Medical School animal facility. The Phoenix-Eco cell line was
obtained from American Type Culture Collection (Manassas, VA) with
permission from G. Nolan (Stanford University). The Jurkat T cell line,
Phoenix-Eco cell line, and the primary CD4 T and B cells isolated from
all mice were cultured in Click’s medium supplemented with 10% FBS, 2
mM glutamine, 100 µg/ml penicillin and streptomycin, and
10-5 M 2-ME.
RNA extraction and PCR
Total cytoplasmic RNA preparation, cDNA synthesis, and PCR were
performed, as previously described (18). The following
primers were used in the PCR reactions: mouse CIITA (forward,
5'-CTCAGCCTTAGGGACTGG-3'; reverse, 5'-GACCTGGATCGTCTCGTGCAG-3');
and -actin (forward, 5'-CACCCTGTGCTGCTCACCGAGGCC-3'; reverse,
5'-CCACACAGAGTACTTGCGCTCAGG-3').
Real-time PCR
Real-time PCR was used in analysis of RNA samples. Reverse-transcriptase reactions were done as described previously (18). Real-time PCR was performed on an ABI Prism 7000 Sequence Detection System using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and following manufacturer’s protocols. Primers and concentrations used were: FasL sense (300 nM), TGGGTAGACAGCAGTGCCAC; FasL antisense (300 nM), GCCCACAAGATGGACAGGG; GAPDH sense (50 nM), CCAGGTTGTCTCCTGCGACT; GAPDH antisense (50 nM), ATACCAGGAAATGAGCTTGACAAAGT. Each of these primer sets gave a unique product. PCR assays were triplicated, and the data were pooled. Values obtained for levels of mRNAs were normalized to the levels of GAPDH mRNA.
Preparation of total and naive CD4 T cells
CD4 T cells were enriched using negative selection, as described
(10). To obtain naive CD4 T cells, enriched total CD4 T
cells were further sorted for the CD4+,
CD45RBhigh, and CD44low
population. Memory CD4 T cells were prepared from enriched total CD4 T
cells by sorting the CD4+,
CD45RBlow, and CD44high
population. The sorted naive and memory CD4 T cells were greater than
97% pure. Naive and enriched CD4 T cells were driven to Th1 and Th2 by
incubating cells on plate-bound anti-CD3 (5 µg/ml) in the
presence of IL-2 (20 U/ml), IL-12 (3.5 ng/ml), and anti-IL-4
(11B11, 10 µg/ml) for Th1, and IL-2 (20 U/ml), IL-4 (10 ng/ml), and
anti-IFN- (H22, 10 µg/ml) for Th2 for indicated time periods.
For restimulation, CD4 T cells were reactivated with plate-bound
anti-CD3 (5 µg/ml) and IL-2 (50 U/ml) for indicated time
periods.
Preparation of retroviruses
Retroviral construct expressing GFP (RV-GFP) was generated by modifying the MSCV2.2 vector. An internal ribosome entry site and green fluorescence protein (GFP) were cloned into the EcoRI and SalI sites, respectively. To generate CIITA-expressing retroviruses (RV-CIITA/GFP), the B cell form of CIITA (10) was cloned into the XhoI site of the modified MSCV2.2 vector containing the internal ribosome entry site and GFP. CIITA and GFP were translated as separate proteins. The Phoenix-Eco packaging cells (3.5 x 105 cells) were transfected with either RV-CIITA/GFP (4 µg) or RV-GFP (4 µg) using CaPO4, as described (11). The transfected Phoenix-Eco cells were cultured at 37°C for 24 h, then 32°C for an additional 24 h to allow efficient viral production. The supernatants containing either the GFP or CIITA/GFP viruses were filtered through a 0.45-µM filter and used immediately to infect primary CD4 T cells.
Retroviral infection of primary CD4 T cells
Total splenocytes from AND transgenic mice were stimulated overnight with pigeon cytochrome c (100 µg/ml) and IL-2 (30 U/ml). The activated T cells were infected with 1 part media to 2 parts of viral supernatant and polybrene (8 µg/ml), centrifuged at 1800 rpm for 45 min, then incubated at 37°C for 24 h before the addition of fresh medium containing IL-2 (30 U/ml). Cells were analyzed 6 days after infection.
Preparation of B cells
To prepare B cells, total splenocytes were isolated and RBCs were lysed in hemolysis buffer (NH4Cl, 0.155 M; Tris-HCl, 0.1 M, pH 7.4). Splenocytes were then incubated on ice with anti-Thy-1 (30H12) Ab for 30 min, washed, incubated at 37°C for 45 min in complement media (RPMI medium containing 20 mM HEPES, 3% BSA, and guinea pig complement), and isolated using a Ficoll gradient.
Thymidine release assay
The thymidine release assay was conducted, as previously
described (18), with the following modifications.
T-depleted splenocytes were stimulated with LPS (10 µg/ml), LPS +
IL-4 (10 ng/ml), or LPS + IFN- (300 U/ml), or left untreated for 3
days before culturing with the
[3H]thymidine-labeled target cells
overnight.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have previously demonstrated that the CIITA gene is
expressed in Th1, but not Th2 cells during the differentiation process
(10). To determine the kinetics of CIITA expression, we
examined endogenous CIITA gene expression during the Th1 and
Th2 differentiation process. Naive CD4 T cells from C57BL/6 mice were
sorted, then CIITA expression was analyzed from unstimulated naive CD4
T cells, or cells driven to Th1 or Th2. As shown in Fig. 1
A, the CIITA gene
was expressed in naive CD4 T cells if cells were not stimulated. CIITA
expression was then down-regulated, and the transcripts were barely
detectable during day 1–2 after differentiation. However, the
CIITA gene was reexpressed at day 4 in Th1, but not Th2
cells. We have shown previously that the reexpression of the
CIITA gene in Th1 cells depends on IFN- signaling
(10).
|
B). To exclude the possibility that
the CIITA transcripts were coming from contaminating B cells, we
analyzed the same RNA samples for the presence of CD19. CD19
transcripts were not detected (Fig. 1C). These data indicate
that the CIITA gene is expressed in naive, differentiated
Th1, and memory CD4 T cells. In addition, the initial TCR signaling
down-regulates CIITA gene expression in both naive and
memory CD4 T cells. CD4 T cells lacking CIITA express enhanced levels of Fas ligand during Th1 differentiation
Our previous study showed that the overexpression of CIITA in CD4
T cell lines resulted in an inhibition of Fas ligand expression
(18). We demonstrated in this study that the CIITA gene is
expressed in naive CD4 T cells and during Th1 differentiation (Fig. 1A) (10). Based on these observations, we
explored the possibility that CIITA expression during Th1 cell
differentiation may prevent Fas ligand expression necessary for the
survival of developing effector cells. This hypothesis then predicts
that the lack of CIITA would increase the level of Fas ligand in CD4 T
cells. We tested this by two different approaches.
First, we measured the level of Fas ligand mRNA during Th1 cell
differentiation using RT-PCR and real-time PCR. As expected, Fas ligand
mRNA levels were much lower when CIITA was expressed (Fig. 2A, days 0 and 4). Second, we
compared Fas ligand expression of Th1 cells from the wild-type and
CIITA-/- mice. CIITA-/-
mice do not have the CD4 T cell population in the periphery due to the
lack of MHC class II expression (4). Therefore, to study
CIITA-/- CD4 T cells, we used
CIITA-/- mice expressing the I-E transgene
(CIITA-/- I-E) (10). As a control,
mice that lack the MHC class II structural gene A
(A-/-) carrying the same I-E transgene were
analyzed (A-/- I-E) (10). Using
these mice, we examined Fas ligand expression during Th1
differentiation as well as after reactivation of Th1 cells.
|
-/- I-E mice were enriched, then driven to
Th1 for 5 days, and Fas ligand expression was monitored during this
period by flow cytometry. Fresh CD4 T cells from
CIITA-/- I-E mice expressed a higher level of
Fas ligand compared with that of A-/- I-E
(Fig. 2B). Furthermore, the levels of Fas ligand on CD4 T
cells from CIITA-/- I-E mice were higher than
A-/- I-E mice during the Th1 differentiation
(Fig. 2B). We also observed variable kinetics of Fas ligand
expression during the differentiation, as shown by different mice (Fig. 2B, compare Expts. 1 and 2). The low level of Fas ligand on
CD4 T cells from A-/- I-E mice during the
Th1 differentiation process was similar to that of wild-type C57BL/6
mice (data not shown). We also compared the mRNA level of Fas ligand
between the wild-type and CIITA-/- Th1 cells.
Real-time PCR revealed that CIITA-/- Th1 cells
express a higher level of the Fas ligand gene (Fig. 2C). Constitutive expression of CIITA in primary CD4 T cells inhibits activation-induced apoptosis
When CIITA was overexpressed in CD4 T cell lines, Fas ligand
expression was greatly reduced after TCR activation (18).
To determine whether this was reproducible in primary CD4 T cells and
to provide further evidence in support of CIITA as a negative regulator
of Fas ligand, we employed a retroviral system to introduce CIITA into
primary CD4 T cells. Enriched CD4 T cells from AND TCR transgenic mice
were activated overnight with cytochrome c Ags, followed by
infection with supernatant containing retroviruses expressing GFP
alone, or GFP and CIITA. The CD4 T cells were analyzed at the end of
primary stimulation or after reactivation. As shown in Fig. 3A, the efficiency of
infection was comparable between the CIITA and the control viruses.
However, cells infected with virus expressing GFP with CIITA were MHC
class II positive, indicating that CIITA was functional (Fig. 3B). We next tested Fas ligand levels after 6 h of
secondary stimulation, since longer activation reduces cell survival
significantly. When Fas ligand expression was compared in GFP-negative
cells, the two populations showed similar levels (Fig. 3C,
compare lanes 3 and 4). However, the GFP-positive
cells from CIITA virus-infected cells showed a reduction in the mean
fluorescence intensity (MFI) of Fas ligand compared with the control
GFP-positive cells (Fig. 3C, compare lanes 1 and
2). The MFI on CIITA-expressing cells was consistently lower
over three independent experiments, despite the difference being
small.
|
D). In contrast, the number of annexin V- and GFP-positive
CD4 T cells were significantly reduced if cells were infected with the
virus expressing CIITA (Fig. 3D). To further support the
hypothesis that CIITA regulates cell death processes, we assessed the
number of cells that survived after cells were activated overnight by
anti-CD3. When the GFP-positive cell populations were compared
before and after activation, CIITA virus-infected cells were more
resistant to cell death measured by both propidium iodide (PI) staining
and trypan blue exclusion assays (Fig. 3E). These data
suggest that the small reduction in Fas ligand levels seen by CIITA
resulted in the delayed onset of CD4 T cell apoptosis. B cells from CIITA-/- mice also have enhanced Fas ligand expression
It is well documented that Fas ligand plays an important role for
T cells. However, the role of Fas ligand on B cells is less clear
(20, 21). CIITA is expressed and is critical for the Ag
presentation function of B cells. If CIITA regulates Fas ligand
expression in CD4 T cells, it may have a similar role in B cells. We
examined B cells to determine whether CIITA deficiency
affects Fas ligand expression in B cells. To do this, we
enriched B cells from CIITA-/- or
A-/- mice without the I-E transgene. B cells
were then cultured for 3 days in the presence of LPS, LPS + IL-4,
LPS + IFN-, or left untreated. As previously demonstrated
by other groups (20, 21), Fas ligand was detectable on B
cells upon stimulation with LPS (Fig. 4A). Fas ligand was also
detectable after LPS + IFN- stimulation (Fig. 4A).
However, Fas ligand levels were very low on B cells stimulated with LPS
in the presence of IL-4 (Fig. 4A). Under all conditions, the
percentages of B cells expressing Fas ligand were greater if cells were
deficient in CIITA (Fig. 4A). Furthermore, as shown in Fig. 4B, the level of Fas ligand was also higher on
CIITA-/- B cells regardless of the treatment.
Fas ligand expression on A-/- B cells was
comparable with that of wild-type C57BL/6 mice (data not shown).
|
C shows
that the B cells stimulated with LPS or LPS + IFN- had higher levels
of killing activity. As expected, very little killing was seen by
B cells that were unstimulated or stimulated with LPS + IL-4.
CIITA-/- B cells that express higher levels of
Fas ligand exhibited significantly increased killing activity compared
with A-/- B cells under all conditions.
Similar data were obtained using A20 B cells as a target (data not
shown). Our data suggest that the lack of CIITA expression is at least
partly responsible for the enhanced level of killing activity. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, B and C). Therefore, the
role of CIITA may be to protect differentiating Th1 cells from cell
death by inhibiting Fas ligand expression. It should be noted that the
level of CIITA transcripts in effector and memory cells decreased after
activation (Fig. 1B), which may contribute to the
up-regulation of Fas ligand upon activation. It is possible, therefore,
that CIITA could protect effector CD4 T cells under a certain
environment in vivo. Interestingly, CIITA-/-
I-E mice have fewer mature CD4 T cells in the periphery than
A-/-I-E mice (C.-H. Chang, unpublished
data). It is tempting to speculate that the elevated level of Fas
ligand in CIITA-deficient CD4 T cells is responsible for the decreased
survival of CD4 T cells in vivo. However, we cannot exclude the
possibility that restoring MHC class II expression in the absence of
other CIITA-mediated functions is not sufficient to reconstitute the
entire CD4 T cell compartment in CIITA-/- mice,
whereas the phenotype of A-/- mice can be
completely rescued by I-E transgene expression. Fas ligand expression seems to be regulated at multiple levels consistent with the previous reports (23, 24). As we have shown in this work, the regulation of Fas ligand expression is mediated at the level of transcription. However, developing Th1 cells from the wild-type mice do not express an appreciable amount of Fas ligand on the cell surface, despite the presence of its mRNA. It is possible that Fas ligand mRNA present during Th1 cell differentiation is not sufficient to cause significant cell surface expression. Alternatively, Fas ligand protein may not be exported to the cell surface until cells become the effector. CIITA-/- Th1 cells exhibited an enhanced level of mRNA and earlier expression of Fas ligand proteins on the cell surface. It is likely that elevated mRNA is responsible for enhanced cell surface expression in CIITA-/- Th1 cells, although we cannot rule out the possibility that CIITA regulates both transcription and export processes.
Previously, we showed that CD4 T cell lines stably transfected with
CIITA expressed reduced levels of Fas ligand on the cell surface
(18). These cells were also protected from AICD
(18). Consistent with these observations, introduction of
CIITA to primary CD4 T cells using retroviruses resulted in reduction
in Fas ligand expression and the onset of apoptosis (Fig. 3, C–E). However, the degree of inhibition was much smaller.
At least two possibilities explain the difference. First, the timing of
CIITA expression by retroviral infection may not be ideal to repress
Fas ligand expression. As CIITA gene transcription is a
dynamic process during Th1 cell differentiation (Fig. 1), the kinetics
of CIITA expression could be an important factor to modulate Fas ligand
expression. Since retroviruses cannot infect resting cells, primary
lymphocytes have to be prestimulated to allow infection. It is
conceivable, therefore, that CIITA expression in cells that are already
stimulated is not as effective as in naive cells. The second
possibility is that the level of CIITA protein expressed by the
retroviral system is not sufficient to inhibit the expression of the
endogenous Fas ligand gene. It is well documented that the activation
of MHC class II gene transcription can be initiated by a trace amount
of CIITA protein (22). However, the efficient inhibitory
function of CIITA may require a higher level of CIITA protein. Since
the amount of endogenous CIITA protein is too low to be detected by
Western blot, it is technically challenging to compare CIITA levels
between different systems.
CIITA is transcribed from at least three different promoters, resulting
in three different functional isoforms (25). Each isoform
is preferentially expressed in each type of APC; forms I, III, and IV
are responsible in activating MHC class II genes in dendritic cells, B
cells, and IFN--inducible cells, respectively (25).
When we examined CIITA gene transcription during Th cell
differentiation, we used a primer set that is specific for the exons
common to all isoforms (Fig. 1, A and B).
However, we could not detect the CIITA transcripts using the primer set
specific for each isoform (T. S. Gourley, unpublished data). This
suggests that CD4 T cells express a unique isoform of CIITA.
Furthermore, it raises another possibility that the introduction of the
B cell-specific isoform of CIITA to CD4 T cells may not be relevant in
vivo. Unfortunately, this issue cannot be resolved until the T
cell-specific isoform of CIITA is identified and cloned.
A number of studies reported that B cells express membrane-bound Fas
ligand (20, 21). In agreement with our data, Tian et al.
(21) recently showed that B cells activated by LPS
expressed Fas ligand, which was able to kill both B and T cells. In
their system, adoptive transfer of activated B cells into prediabetic
nonobese diabetic mice prevented spontaneous autoimmunity mediated by
Th1 cells. Our data suggest that the modulation of Fas ligand
expression on B cells is at least partly controlled by CIITA (Fig. 4, A and B). Interestingly, a stimulus that sends a
proliferation signal such as LPS in conjunction with IL-4 did not
induce Fas ligand expression. In contrast, the level of Fas ligand was
enhanced upon treatment with LPS, or LPS in the presence of IFN-,
which are not proliferative signals for B cells. Consistent with these
observations, the level of endogenous CIITA gene transcripts
in B cells increases upon treatment with LPS and IL-4 (C.-H. Chang,
unpublished data).
B cells lacking CIITA expressed a higher level of Fas ligand and killed
the Fas-bearing target cells more efficiently (Fig. 4C).
However, the overall B cell numbers in CIITA-/-
mice are comparable with that of the wild-type mice (C.-H. Chang,
unpublished data). B cells may be protected from cell death by an
unknown mechanism that differs from T cells. It has been reported that
human naive B cells are protected from apoptosis by the sole addition
of IL-4 in culture in the absence of activation (26).
Resting naive B cells also express a high level of the IL-4R 
-chain
(26). It seems that, in addition to CIITA, a signaling
molecule(s) that is induced by IL-4 prevents Fas ligand expression and
cell death.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Cheong-Hee Chang, Department of Microbiology and Immunology, Walther Oncology Center, R4-302, Indiana University Medical School, 1044 West Walnut Street, Indianapolis, IN 46202-5121. E-mail address: chechang{at}iupui.edu
3 Abbreviations used in this paper: CIITA, class II transactivator; AICD, activation-induced cell death; GFP, green fluorescence protein; MFI, mean fluorescence intensity; PI, propidium iodide.
Received for publication September 24, 2001. Accepted for publication February 25, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mediated by the transactivator gene CIITA. Science 265:106. mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 2:533.
This article has been cited by other articles:
|
|
 |
|
  M. Krawczyk, E. Leimgruber, Q. Seguin-Estevez, I. Dunand-Sauthier, E. Barras, and W. Reith Expression of RAB4B, a protein governing endocytic recycling, is co-regulated with MHC class II genes Nucleic Acids Res., January 28, 2007; 35(2): 595 - 605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-J. Kwon, J.-W. Soh, and C.-H. Chang Protein Kinase C{delta} Is Essential to Maintain CIITA Gene Expression in B Cells J. Immunol., July 15, 2006; 177(2): 950 - 956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Litzinger, Y. Su, T. C. Lei, N. Soukhareva, and D. W. Scott Mechanisms of Gene Therapy for Tolerance: B7 Signaling Is Required for Peptide-IgG Gene-Transferred Tolerance Induction J. Immunol., July 15, 2005; 175(2): 780 - 787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Johnnidis, E. S. Venanzi, D. J. Taxman, J. P.-Y. Ting, C. O. Benoist, and D. J. Mathis Chromosomal clustering of genes controlled by the aire transcription factor PNAS, May 17, 2005; 102(20): 7233 - 7238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. K. Yee, Y. Yao, Q. Xu, B. McCarthy, D. Sun-Lin, M. Tone, H. Waldmann, and C.-H. Chang Enhanced Production of IL-10 by Dendritic Cells Deficient in CIITA J. Immunol., February 1, 2005; 174(3): 1222 - 1229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Patel, M. H. Kaplan, and C.-H. Chang Altered Th1 Cell Differentiation Programming by CIITA Deficiency J. Immunol., November 1, 2004; 173(9): 5501 - 5508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Xu, L. Wang, G. Buttice, P. K. Sengupta, and B. D. Smith Major Histocompatibility Class II Transactivator (CIITA) Mediates Repression of Collagen (COL1A2) Transcription by Interferon {gamma} (IFN-{gamma}) J. Biol. Chem., October 1, 2004; 279(40): 41319 - 41332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. S. Park, Y. Bae, D. H. Chung, Y.-L. Choi, B. K. Kim, Y. C. Sung, E. Y. Choi, S. H. Park, and K. C. Jung T cell expression of CIITA represses Th1 immunity Int. Immunol., October 1, 2004; 16(10): 1355 - 1364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. K. Yee, Y. Yao, P. Li, M. J. Klemsz, J. S. Blum, and C.-H. Chang Cathepsin E: A Novel Target for Regulation by Class II Transactivator J. Immunol., May 1, 2004; 172(9): 5528 - 5534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cenci, G. Toraldo, M. N. Weitzmann, C. Roggia, Y. Gao, W. P. Qian, O. Sierra, and R. Pacifici Estrogen deficiency induces bone loss by increasing T cell proliferation and lifespan through IFN-{gamma}-induced class II transactivator PNAS, September 2, 2003; 100(18): 10405 - 10410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Otten, F. Tacchini-Cottier, M. Lohoff, F. Annunziato, L. Cosmi, L. Scarpellino, J. Louis, V. Steimle, W. Reith, and H. Acha-Orbea Deregulated MHC Class II Transactivator Expression Leads to a Strong Th2 Bias in CD4+ T Lymphocytes J. Immunol., February 1, 2003; 170(3): 1150 - 1157. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. V. Acosta Rodriguez, E. Zuniga, C. L. Montes, and A. Gruppi Interleukin-4 biases differentiation of B cells from Trypanosoma cruzi-infected mice and restrains their fratricide: role of Fas ligand down-regulation and MHC class II-transactivator up-regulation J. Leukoc. Biol., January 1, 2003; 73(1): 127 - 136. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
