|
|
||||||||
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037
| Abstract |
|---|
|
|
|---|
production from RAW264.7 and THP-1 cells in a TLR2-dependent manner.
However, neither Lip19 nor Lip12 activated HUVECs, which lack
endogenous TLR2. Additionally, I
B kinase
and c-Jun
N-terminal kinase 1 activation in THP-1 cells induced by Lip19 or Lip12
was observed. TLR2 activation by Lip19 and Lip12 in HEK293 cells was
blocked by inhibitory anti-TLR2 mAbs. The unlipidated mutants,
Lip19-C19S and Lip12-C21S, in which the NH2-terminal
cysteine was substituted by serine, lost their ability to activate
TLR2-transfected HEK 293 cells. Taken together, these results
demonstrate that two lipoproteins constitute the major contaminants
responsible for TLR2-mediated cell activation in E. coli
LCD25 LPS. | Introduction |
|---|
|
|
|---|
-primed C3H/HeJ
(Lpsd) macrophages.
In the short time since mammalian Toll-like receptors
(TLRs)4 were
identified (4), the LPS hyporesponsiveness of C3H/HeJ and
C57BL/10ScCr mice was shown to result from mutations in the gene
encoding TLR4 (5, 6). Although these data demonstrated
that TLR4 is the principal mediator of cellular responses to LPS, TLR2
also appeared to mediate LPS-induced cell activation of NF-
B
(7, 8). Numerous studies have demonstrated that TLR2
mediates inflammatory signals induced by various pathogenic components,
including bacterial lipoproteins/lipopeptides, peptidoglycan, yeast
cell wall particle zymosan, and whole bacteria including
Staphylococcus aureus and Mycobacterium
tuberculosis (9, 10, 11, 12, 13, 14).
Recent studies in TLR2-deficient mice and hamsters demonstrate that TLR2 is not required for LPS-mediated signal transduction when TLR4 is present (15, 16). Indeed, TLR2 does not mediate cellular responses by commercial preparations of LPS when these are repurified (17, 18). Thus, this TLR2-mediated LPS signaling seemed to arise from contaminants associated with the LPS, although the agonists in the contaminants were not identified.
In response to this, we attempted to identify the molecules responsible for TLR2-mediated signaling associated with a commercial preparation of LPS. In this study we identified two major active lipoproteins associated with LCD25 LPS, which are responsible for activation of TLR2. We cloned these two lipoproteins and constructed mutants to further characterize the nature of their inflammatory effects.
| Materials and Methods |
|---|
|
|
|---|
Polymyxin B was obtained from Sigma-Aldrich (St. Louis, MO).
Heat-killed S. aureus (HKSA) was a gift from Dr. C. Fearns
(The Scripps Research Institute, La Jolla, CA). Soluble peptidoglycan
(sPGN) purified from S. aureus was a gift from Dr. R.
Dziarski (Indiana University School of Medicine, Gary, IN).
Macrophage-activating lipopeptide-2 (MALP-2) was a gift from Dr.
P. F. Mühlradt (Gesellschaft für Biotechnologische
Forschung, Braunschweig, Germany). FITC-labeled anti-TNF-
,
PE-labeled anti-IL-6, anti-I
B kinase (IKK)
, and
anti-c-Jun N-terminal kinase 1 (anti-JNK1) Abs were purchased
from BD PharMingen (San Diego, CA). Anti-CD14 mAbs 28C5 and 63D3 were
previously described (17). Anti-TLR2 mAbs 2380 and 2392
were previously described (9). Anti-TLR4 mAb HTA1216 was a
gift from Dr. K. Miyake (Saga Medical School, Tokyo, Japan).
Anti-TLR2 mAb TL2.1 was purchased from BD Biosciences (San Diego,
CA).
Cell culture
RAW264.7 and HEK293 cells were grown in DMEM (Life Technologies, Gaithersburg, MD) with 10% FCS, while THP-1 cells were maintained in RPMI 1640 (Life Technologies) with 10% FCS. HUVECs were cultured in endothelial cell growth medium (Clonetics, Walkersville, MD).
Protein extraction from LPS and NH2-terminal sequencing
LCD25 LPS from Escherichia coli K-12 was purchased from List Biological Laboratories (Campbell, CA). Protein extraction from 40 mg of LCD25 LPS was performed according to the LPS repurification method previously described (19). The phenol phase was dialyzed in PBS and separated on a 12% SDS-PAGE gel. The gel was fractionated by slicing. Each gel piece of 10 x 2 mm2 was then soaked in PBS overnight for protein elution. For NH2-terminal sequencing, proteins were in-gel digested by trypsin and sequenced at the Core Facility of The Scripps Research Institute. For proteinase K treatments, proteinase K-conjugated beads (Sigma-Aldrich) were mixed with the phenol phase eluate of LCD25 LPS or lipoproteins in microtubes and incubated for 6 h with gentle shaking. The mixtures were centrifuged at 12,000 rpm for 5 min, and the supernatants were used for cell stimulation.
Cloning and expression
E. coli K-12 strain MG1655 was purchased from American Type Culture Collection (Manassas, VA). Genomic DNA from E. coli K-12 was isolated as described previously (20) and used as template to PCR amplify the Lip19 and Lip12 genes. The oligonucleotide primers used for PCR were: for Lip19, GAGAAATCCATGGAACTCGTGCACATGGCCAGTGGTTTAGCG and TAACGTCTCGAGATATTGCGTAGGAGCTGGAACTGCCGAAGA; and for Lip12, GGACGGACCATGGACAAGAATATGGAGGAATTCTGAGTGC and ACGAATCTCGAGCTTCGCAGCCTGTGGATCAGTGTCG. The amplified products were cloned into the pET28b vector (Novagen, Madison, WI) at NcoI and XhoI. The cysteine mutants of Lip19 and Lip12, in which the cysteine residue at positions 19 and 21, respectively, were substituted by serine, were made using a QuickChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). The oligonucleotide primers used for point mutation were: for Lip19-C19S, ATTGCGTTGGCGGCTAGTGCAGATAAAAGCGCG and GCTTTTATCTGCACTAGCCGCCAACGCAATCGC; and for Lip12-C21S, ACCATGCTGGCGGGTAGCACGGCTTATGATCG and TACGATCATAAGCCGTGCTACCCGCCAGCATGG. All of the PCR clones were fully sequenced to confirm that no PCR errors occurred. Each recombinant DNA was transformed into E. coli BL21(DE3) strain, and the expressed proteins with a COOH-terminal 6x histidine tag were purified using nickel affinity chromatography according to the manufacturers instructions (Novagen). Contamination with bacterial endotoxin in all of the protein preparations was <0.5 EU (endotoxin units)/µg as determined by a Limulus amebocyte lysate assay (BioWhittaker, Walkersville, MD).
NF-
B reporter assay
HEK293 cells (1.5 x 105) were plated
in 12-well plates with DMEM and 10% FCS. On the following day, cells
were transiently transfected with 0.25 µg/ml human TLR2 expression
vector or empty vector along with 0.075 µg/ml pNF-
B-Luc vector
(Stratagene) and 0.15 µg/ml pSV-
-galactosidase vector (Promega,
Madison, WI). After 24 h, cells were stimulated for 6 h with
the ligands as noted in the figures, and then cell extracts were
prepared. NF-
B-induced luciferase activity was measured using a
Luciferase Reporter Assay System (Promega), and
-galactosidase
activity was measured using
O-nitrophenyl-
-D-galactopyranoside
as substrate (Promega). For the Ab blocking experiments, cells were
preincubated for 1 h with the Abs before stimulation. Luciferase
activity reported in the figures is normalized for transfection
efficiency using the
-galactosidase activity.
Flow cytometric analysis
HUVECs, RAW264.7 cells, or THP-1 cells were stimulated for
5 h with 0.2 µg/ml Lip19, Lip12, or TLR2-specific agonists in
the presence of 0.5 µg/ml brefeldin A (Sigma-Aldrich). Cells were
harvested and washed in PBS. Cells were fixed in 4% paraformaldehyde
for 10 min and permeabilized in 0.1% Triton X-100/0.1% sodium citrate
for 2 min. After washing in PBS, THP-1 and RAW264.7 cells were
incubated for 20 min with FITC-labeled anti-TNF-
Ab, while
HUVECs were incubated with PE-labeled anti-IL-6 Ab. The cells were
washed and resuspended in PBS, and the production of cytokines was
analyzed by flow cytometry using a FACScan flow cytometry (BD
Biosciences).
EMSA and in vitro kinase assays
THP-1 cells (3 x 105) were plated in six-well plates with RPMI 1640 with 10% FCS and stimulated with 100 ng/ml lipoproteins at the different time points as indicated in the figure legends. Cells were harvested and treated with buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM PMSF) followed by centrifugation. The supernatant was used for kinase assay, and the pellet was further treated with buffer B (20 mM HEPES (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, and 0.1 mM PMSF) to prepare nuclear extracts. EMSA and kinase assay were performed as previously described (21, 22).
| Results |
|---|
|
|
|---|
Previous studies have shown that commercially prepared LPS
products, when repurified by phenol extraction, no longer induce
cellular activation through TLR2 (17, 18). This implies
that impurities in those LPS preparations are responsible for
TLR2-mediated cell activation. We found that one commercial LPS
preparation derived from E. coli K-12 strain LCD25 strongly
activated TLR2-transfected HEK293 cells (Fig. 1
A). The activation of HEK293
cells through TLR2 by this LPS, however, was completely abolished when
this LPS was repurified by phenol extraction. In contrast, the phenol
phase, which contains impurities, induced TLR2-transfected cell
activation (Fig. 1
A). The phenol phase was preincubated with
polymyxin B or proteinase K beads and used to stimulate HEK293 cells
transfected with TLR2. Although polymyxin B did not inhibit cell
activation by the phenol phase, proteinase K abolished most of the
activity of the phenol phase (Fig. 1
B). The results indicate
that the activating molecules in the phenol phase are protein. To
identify the proteins responsible for cell activation, the phenol phase
was fractionated by SDS-PAGE. Each gel slice eluate was tested for cell
activation (data not shown). Among the fractions, two proteins that
strongly induced TLR2-mediated HEK293 cell activation were apparent.
These two proteins showed a mobility of
19 and 12 kDa, respectively
(Fig. 2
A). After trypsin
digestion, conventional sequencing yielded the sequences shown (Fig. 4
). These sequences were searched for in the GenBank database. The two
sequences were identified as E. coli lipoproteins: a
hypothetical lipoprotein of 19.4 kDa in the TESB-HHA intergenic region
precursor and an osmotically inducible lipoprotein E precursor of 12
kDa (23, 24). In this study, these lipoproteins are named
Lip19 and Lip12, respectively (Fig. 4
). The gel-purified Lip19 and
Lip12 proteins activated TLR2-transfected HEK293 cells (Fig. 2
B). Neither Lip19 nor Lip12 activated nontransfected HEK293
cells (data not shown). Each purified Lip19 or Lip12 induced TNF-
production in the murine macrophage cell line RAW264.7 as well as THP-1
cells (Fig. 3
, A and
B, respectively). In contrast, HUVECs, which do not appear
to express TLR2 (25), were not activated by either Lip19
or Lip12 (Fig. 3
C).
|
|
|
|
To confirm the activities of the isolated lipoproteins, they were
cloned, expressed, and purified. Additionally, we investigated whether
the active moiety of Lip19 or Lip12 was the lipidated
NH2-terminal cysteine. To this end we constructed
cysteine mutants of Lip19 and Lip12 in which the amino-terminal
cysteine residues of the mature proteins at amino acid positions 19 and
21, respectively, were substituted by serine (Fig. 4
). The recombinant lipoproteins, rLip19
and rLip12, as well as their mutants rLip19-C19S and rLip12-C21S, were
expressed in E. coli strain BL21(DE3). The expressed
proteins were purified using nickel affinity chromatography, and each
resulting preparation was of >95% purity (Fig. 5
). The wild types of rLip19 and rLip12
were able to induce cell activation in TLR2-transfected HEK293 cells,
while the C
S mutants had lost their ability to activate cells. (Fig. 6
). These results demonstrate that the
lipidated amino-terminal cysteine of the lipoproteins is the portion
that mediates TLR2 signaling. Interestingly, the expressed rLip19
always yielded two bands by SDS-PAGE (Fig. 5
). When these two bands
were purified by electroelution from the gel and tested, only the lower
band activated TLR2-transfected HEK293 cells (data not shown). Since
lipidation is a posttranslational modification, the upper band may be
an unlipidated form of rLip19, as it has same SDS-PAGE migration as
rLip19-C19S (Fig. 5
).
|
|
The role of TLR2 in mediating cell activation by Lip19 or Lip12
was further tested using TLR2-specific mAbs. Two known antagonistic
anti-TLR2 mAbs, mAbs 2392 and TL2.1 (9, 26), blocked
TLR2-mediated HEK293 cell activation induced by rLip12, rLip19, or a
sPGN control. In contrast, a nonblocking anti-TLR2 Ab, mAb 2380, or
an antagonistic anti-TLR4 Ab, HTA1216, which is a known
LPS-blocking Ab (27), had no effect (Fig. 7
). Interestingly, rLip12-mediated cell
activation was inhibited only 40% by mAb 2392, while rLip19- or
sPGN-mediated cell activation was inhibited by >80% by mAb 2392. The
reason for the differential efficiency of mAb 2392 with these agonists
is unknown.
|
We next addressed the activation patterns of downstream protein
kinases in the NF-
B pathway, which were induced by cell stimulation
of rLip19 or rLip12. Recombinant Lip12 induced IKK
and JNK1
activation in THP-1 cells within 10 min of addition, with maximum
induction observed after 30 min (Fig. 8
).
Recombinant Lip19 induced the activation of IKK
and JNK1
within 30 min of addition, with maximum induction observed after 60 min
(Fig. 8
). The kinetics of NF-
B nuclear translocation followed the
kinetics of kinase activation (Fig. 8
).
|
| Discussion |
|---|
|
|
|---|
A number of studies indicate that many different infectious pathogens and their components mediate TLR2-dependent cell activation. These include lipoprotein/lipopeptide (9, 10, 11), whole mycobacteria (28), whole Gram-positive bacteria (13, 29), yeast cell wall components (13), and PGN (12). Among these, lipoprotein has long been regarded as a potent inflammatory factor. In general, all membrane-anchored lipoproteins contain a lipidated N-terminal cysteinyl residue often accompanied by N-acylation (30). The significance of the lipidation on the N-terminal cysteine has been indicated by several studies. In an early study Bessler and Ottenbreit (31) demonstrated that hydrolysis of N-terminal fatty acids of E. coli-derived lipoprotein abolished mitogenicity in mouse spleen cells. Similarly, the lipoprotein from the E. coli outer membrane lost its mitogenic activity in mouse B cells after delipidation by alkaline hydrolysis (32). Recently, the importance of the Cys-terminal lipidation of Mycoplasma fermentans lipoprotein in TLR2-mediated cell activation was also addressed (33). Our study demonstrates that the unlipidated mutants of Lip19 and Lip12 are incapable of inducing TLR2-mediated HEK293 cell activation. Since Cys-terminal lipidation is the only obvious common structural feature among bacterial lipoproteins, this is probably the portion that mediates activation through TLR2 (33, 34). At present we do not know whether lipoprotein-induced TLR2 activation arises from direct binding or involves an indirect secondary mediator between TLR2 and lipoprotein. Interestingly, since TLR2-antagonistic Abs similarly inhibit a variety of TLR2 agonists (9, 17, 26, 35, 36), as also observed here, there probably exists a common mechanism of interaction between TLR2 and its various agonists; the simplest and most likely such mechanism is, of course, direct binding.
An intracellular mechanism initiated by bacterial lipoprotein is not
well distinguished from that initiated by LPS, nor are the final
biological consequences (37), involving activation of
various kinase cascades leading to NF-
B or AP-1 activation (reviewed
in Refs. 38 and 39). Early studies indicate
that lipoproteins stimulate extracellular signal-regulated kinase, JNK,
and p38 kinases in murine macrophages (40). The IKK
subunit of I
B kinase has been known to be essential for NF-
B
activation (41), and in the present study the activation
of IKK
and JNK by Lip19 or Lip12 correlates with nuclear
translocation of NF-
B. Not surprisingly, cytokine production upon
NF-
B activation induced by Lip19 or Lip12 was dependent on cellular
TLR2 expression. Taken together, these results demonstrate that two
lipoproteins, Lip19 and Lip12, are the major components retained in
E. coli LCD25 LPS responsible for TLR2-mediated cell
activation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Medicine, Mail Code 0663, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093. ![]()
3 Address correspondence and reprint requests to Dr. Peter S. Tobias, Department of Immunology, IMM-12, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: tobias{at}scripps.edu ![]()
4 Abbreviations used in this paper: TLR, Toll-like receptor; HKSA, heat-killed Staphylococcus aureus; IKK, I
B kinase; JNK, c-Jun amino-terminal kinase; MALP-2, macrophage-activating lipopeptide-2; sPGN, soluble peptidoglycan. ![]()
Received for publication November 20, 2001. Accepted for publication February 15, 2002.
| References |
|---|
|
|
|---|
-primed C3H/HeJ (Lpsd) macrophages requires the presence of lipid A-associated proteins. J. Immunol. 141:4196.[Abstract]
B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells. J. Biol. Chem. 275:11058.
subunit of I
B kinase (IKK) is essential for nuclear factor
B activation and prevention of apoptosis. J. Exp. Med. 189:1839.This article has been cited by other articles:
![]() |
M. Alhawi, J. Stewart, C. Erridge, S. Patrick, and I. R. Poxton Bacteroides fragilis signals through Toll-like receptor (TLR) 2 and not through TLR4 J. Med. Microbiol., August 1, 2009; 58(8): 1015 - 1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. J. O'Neill, C. E. Bryant, and S. L. Doyle Therapeutic Targeting of Toll-Like Receptors for Infectious and Inflammatory Diseases and Cancer Pharmacol. Rev., June 1, 2009; 61(2): 177 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thakran, H. Li, C. L. Lavine, M. A. Miller, J. E. Bina, X. R. Bina, and F. Re Identification of Francisella tularensis Lipoproteins That Stimulate the Toll-like Receptor (TLR) 2/TLR1 Heterodimer J. Biol. Chem., February 15, 2008; 283(7): 3751 - 3760. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Spiller, S. Dreher, G. Meng, A. Grabiec, W. Thomas, T. Hartung, K. Pfeffer, H. Hochrein, H. Brade, W. Bessler, et al. Cellular Recognition of Trimyristoylated Peptide or Enterobacterial Lipopolysaccharide via Both TLR2 and TLR4 J. Biol. Chem., May 4, 2007; 282(18): 13190 - 13198. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, M. Furuyashiki, R. Kaseya, Y. Fukada, M. Akimaru, K. Aoyama, T. Okuno, T. Tamura, T. Kirikae, F. Kirikae, et al. Evidence of Immunostimulating Lipoprotein Existing in the Natural Lipoteichoic Acid Fraction Infect. Immun., April 1, 2007; 75(4): 1926 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tirsoaga, A. Novikov, M. Adib-Conquy, C. Werts, C. Fitting, J.-M. Cavaillon, and M. Caroff Simple Method for Repurification of Endotoxins for Biological Use Appl. Envir. Microbiol., March 15, 2007; 73(6): 1803 - 1808. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Kim, V. P. Rao, Y.-S. Park, V. M. Miller, H. D. Tazelaar, and C. G.A. McGregor Pulmonary arterial reactivity during induced infection of single lung allografts Eur. J. Cardiothorac. Surg., March 1, 2007; 31(3): 475 - 481. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jayachandran, G. J. Brunn, K. Karnicki, R. S. Miller, W. G. Owen, and V. M. Miller In vivo effects of lipopolysaccharide and TLR4 on platelet production and activity: implications for thrombotic risk J Appl Physiol, January 1, 2007; 102(1): 429 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, K. Tawaratsumida, H. Kariya, A. Kiyohara, Y. Suda, F. Krikae, T. Kirikae, and F. Gotz Not Lipoteichoic Acid but Lipoproteins Appear to Be the Dominant Immunobiologically Active Compounds in Staphylococcus aureus. J. Immunol., September 1, 2006; 177(5): 3162 - 3169. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gao, Y. Wang, and M.-F. Tsan The heat sensitivity of cytokine-inducing effect of lipopolysaccharide J. Leukoc. Biol., August 1, 2006; 80(2): 359 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Pecora, A. J. Gehring, D. H. Canaday, W. H. Boom, and C. V. Harding Mycobacterium tuberculosis LprA Is a Lipoprotein Agonist of TLR2 That Regulates Innate Immunity and APC Function J. Immunol., July 1, 2006; 177(1): 422 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zacharowski, P. A. Zacharowski, A. Koch, A. Baban, N. Tran, R. Berkels, C. Papewalis, K. Schulze-Osthoff, P. Knuefermann, U. Zahringer, et al. Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome PNAS, April 18, 2006; 103(16): 6392 - 6397. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Yang, H. J. Kim, Y. H. Ryu, C.-H. Yun, D. K. Chung, and S. H. Han Endotoxin contamination in commercially available pokeweed mitogen contributes to the activation of murine macrophages and human dendritic cell maturation. Clin. Vaccine Immunol., March 1, 2006; 13(3): 309 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Berguer, J. Mundinano, I. Piazzon, and F. A. Goldbaum A Polymeric Bacterial Protein Activates Dendritic Cells via TLR4 J. Immunol., February 15, 2006; 176(4): 2366 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, K. Tawaratsumida, H. Kariya, K. Aoyama, T. Tamura, and Y. Suda Lipoprotein is a predominant Toll-like receptor 2 ligand in Staphylococcus aureus cell wall components Int. Immunol., February 1, 2006; 18(2): 355 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Meyer, E. van Liempt, A. Imberty, Y. van Kooyk, H. Geyer, R. Geyer, and I. van Die DC-SIGN Mediates Binding of Dendritic Cells to Authentic Pseudo-LewisY Glycolipids of Schistosoma mansoni Cercariae, the First Parasite-specific Ligand of DC-SIGN J. Biol. Chem., November 11, 2005; 280(45): 37349 - 37359. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-A. Nahori, E. Fournie-Amazouz, N. S. Que-Gewirth, V. Balloy, M. Chignard, C. R. H. Raetz, I. Saint Girons, and C. Werts Differential TLR Recognition of Leptospiral Lipid A and Lipopolysaccharide in Murine and Human Cells J. Immunol., November 1, 2005; 175(9): 6022 - 6031. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cohen-Sfady, G. Nussbaum, M. Pevsner-Fischer, F. Mor, P. Carmi, A. Zanin-Zhorov, O. Lider, and I. R. Cohen Heat Shock Protein 60 Activates B Cells via the TLR4-MyD88 Pathway J. Immunol., September 15, 2005; 175(6): 3594 - 3602. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mancuso, A. Midiri, C. Biondo, C. Beninati, M. Gambuzza, D. Macri, A. Bellantoni, A. Weintraub, T. Espevik, and G. Teti Bacteroides fragilis-Derived Lipopolysaccharide Produces Cell Activation and Lethal Toxicity via Toll-Like Receptor 4 Infect. Immun., September 1, 2005; 73(9): 5620 - 5627. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sen, A. Q. Khan, Q. Chen, and C. M. Snapper In Vivo Humoral Immune Responses to Isolated Pneumococcal Polysaccharides Are Dependent on the Presence of Associated TLR Ligands J. Immunol., September 1, 2005; 175(5): 3084 - 3091. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Steiner, S. Chakravarty, J. R. Robbins, A. S. Dragic, J. Pan, M. Herkenham, and A. A. Romanovsky Thermoregulatory responses of rats to conventional preparations of lipopolysaccharide are caused by lipopolysaccharide per se-- not by lipoprotein contaminants Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R348 - R352. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Fournier and D. J. Philpott Recognition of Staphylococcus aureus by the Innate Immune System Clin. Microbiol. Rev., July 1, 2005; 18(3): 521 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zanin-Zhorov, G. Tal, S. Shivtiel, M. Cohen, T. Lapidot, G. Nussbaum, R. Margalit, I. R. Cohen, and O. Lider Heat Shock Protein 60 Activates Cytokine-Associated Negative Regulator Suppressor of Cytokine Signaling 3 in T Cells: Effects on Signaling, Chemotaxis, and Inflammation J. Immunol., July 1, 2005; 175(1): 276 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Elsasser, J. W. Blum, and S. Kahl Characterization of calves exhibiting a novel inheritable TNF-{alpha} hyperresponsiveness to endotoxin: associations with increased pathophysiological complications J Appl Physiol, June 1, 2005; 98(6): 2045 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rounioja, J. Rasanen, M. Ojaniemi, V. Glumoff, H. Autio-Harmainen, and M. Hallman Mechanism of Acute Fetal Cardiovascular Depression after Maternal Inflammatory Challenge in Mouse Am. J. Pathol., June 1, 2005; 166(6): 1585 - 1592. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Asai, M. Hashimoto, H. M. Fletcher, K. Miyake, S. Akira, and T. Ogawa Lipopolysaccharide Preparation Extracted from Porphyromonas gingivalis Lipoprotein-Deficient Mutant Shows a Marked Decrease in Toll-Like Receptor 2-Mediated Signaling Infect. Immun., April 1, 2005; 73(4): 2157 - 2163. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zanin-Zhorov, R. Bruck, G. Tal, S. Oren, H. Aeed, R. Hershkoviz, I. R. Cohen, and O. Lider Heat Shock Protein 60 Inhibits Th1-Mediated Hepatitis Model via Innate Regulation of Th1/Th2 Transcription Factors and Cytokines J. Immunol., March 15, 2005; 174(6): 3227 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Zamboni, M. A. Campos, A. C. T. Torrecilhas, K. Kiss, J. E. Samuel, D. T. Golenbock, F. N. Lauw, C. R. Roy, I. C. Almeida, and R. T. Gazzinelli Stimulation of Toll-like Receptor 2 by Coxiella burnetii Is Required for Macrophage Production of Pro-inflammatory Cytokines and Resistance to Infection J. Biol. Chem., December 24, 2004; 279(52): 54405 - 54415. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Osterloh, F. Meier-Stiegen, A. Veit, B. Fleischer, A. von Bonin, and M. Breloer Lipopolysaccharide-free Heat Shock Protein 60 Activates T Cells J. Biol. Chem., November 12, 2004; 279(46): 47906 - 47911. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, Y. Asai, and T. Ogawa Separation and structural analysis of lipoprotein in a lipopolysaccharide preparation from Porphyromonas gingivalis Int. Immunol., October 1, 2004; 16(10): 1431 - 1437. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dunzendorfer, H.-K. Lee, and P. S. Tobias Flow-Dependent Regulation of Endothelial Toll-Like Receptor 2 Expression Through Inhibition of SP1 Activity Circ. Res., October 1, 2004; 95(7): 684 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Darveau, T.-T. T. Pham, K. Lemley, R. A. Reife, B. W. Bainbridge, S. R. Coats, W. N. Howald, S. S. Way, and A. M. Hajjar Porphyromonas gingivalis Lipopolysaccharide Contains Multiple Lipid A Species That Functionally Interact with Both Toll-Like Receptors 2 and 4 Infect. Immun., September 1, 2004; 72(9): 5041 - 5051. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-F. Tsan and B. Gao Endogenous ligands of Toll-like receptors J. Leukoc. Biol., September 1, 2004; 76(3): 514 - 519. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1 J. Immunol., August 15, 2004; 173(4): 2736 - 2745. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-F. Tsan and B. Gao Cytokine function of heat shock proteins Am J Physiol Cell Physiol, April 1, 2004; 286(4): C739 - C744. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-K. Lee, S. Dunzendorfer, and P. S. Tobias Cytoplasmic Domain-mediated Dimerizations of Toll-like Receptor 4 Observed by {beta}-Lactamase Enzyme Fragment Complementation J. Biol. Chem., March 12, 2004; 279(11): 10564 - 10574. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Alcorn and J. R. Wright Surfactant protein A inhibits alveolar macrophage cytokine production by CD14-independent pathway Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L129 - L136. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Coats, R. A. Reife, B. W. Bainbridge, T.-T. T. Pham, and R. P. Darveau Porphyromonas gingivalis Lipopolysaccharide Antagonizes Escherichia coli Lipopolysaccharide at Toll-Like Receptor 4 in Human Endothelial Cells Infect. Immun., December 1, 2003; 71(12): 6799 - 6807. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujita, T. Into, M. Yasuda, T. Okusawa, S. Hamahira, Y. Kuroki, A. Eto, T. Nisizawa, M. Morita, and K.-i. Shibata Involvement of Leucine Residues at Positions 107, 112, and 115 in a Leucine-Rich Repeat Motif of Human Toll-Like Receptor 2 in the Recognition of Diacylated Lipoproteins and Lipopeptides and Staphylococcus aureus Peptidoglycans J. Immunol., October 1, 2003; 171(7): 3675 - 3683. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Van Amersfoort, T. J. C. Van Berkel, and J. Kuiper Receptors, Mediators, and Mechanisms Involved in Bacterial Sepsis and Septic Shock Clin. Microbiol. Rev., July 1, 2003; 16(3): 379 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gao and M.-F. Tsan Recombinant Human Heat Shock Protein 60 Does Not Induce the Release of Tumor Necrosis Factor {alpha} from Murine Macrophages J. Biol. Chem., June 13, 2003; 278(25): 22523 - 22529. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Girardin, I. G. Boneca, L. A. M. Carneiro, A. Antignac, M. Jehanno, J. Viala, K. Tedin, M.-K. Taha, A. Labigne, U. Zathringer, et al. Nod1 Detects a Unique Muropeptide from Gram-Negative Bacterial Peptidoglycan Science, June 6, 2003; 300(5625): 1584 - 1587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muroi, T. Ohnishi, S. Azumi-Mayuzumi, and K.-i. Tanamoto Lipopolysaccharide-Mimetic Activities of a Toll-Like Receptor 2-Stimulatory Substance(s) in Enterobacterial Lipopolysaccharide Preparations Infect. Immun., June 1, 2003; 71(6): 3221 - 3226. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Inohara, Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K. Fukase, S. Inamura, S. Kusumoto, M. Hashimoto, et al. Host Recognition of Bacterial Muramyl Dipeptide Mediated through NOD2. IMPLICATIONS FOR CROHN'S DISEASE J. Biol. Chem., February 14, 2003; 278(8): 5509 - 5512. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Andonegui, S. M. Goyert, and P. Kubes Lipopolysaccharide-Induced Leukocyte-Endothelial Cell Interactions: A Role for CD14 Versus Toll-Like Receptor 4 Within Microvessels J. Immunol., August 15, 2002; 169(4): 2111 - 2119. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |