The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, H.-K.
Right arrow Articles by Tobias, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, H.-K.
Right arrow Articles by Tobias, P. S.
The Journal of Immunology, 2002, 168: 4012-4017.
Copyright © 2002 by The American Association of Immunologists

Two Lipoproteins Extracted from Escherichia coli K-12 LCD25 Lipopolysaccharide Are the Major Components Responsible for Toll-Like Receptor 2-Mediated Signaling1

Hyun-Ku Lee, Jongdae Lee2 and Peter S. Tobias3

Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Toll-like receptor 2 (TLR2)-mediated cell activation induced by commercial preparations of LPS was recently shown to arise from impurities whose identities are not known. In this work, we determined the molecules responsible for TLR2-mediated cell activation in LPS derived from Escherichia coli K-12 strain LCD25. When LCD25 LPS was phenol extracted, two proteins capable of TLR2-mediated cell activation were purified and identified as E. coli lipoproteins. We cloned, expressed, and purified these two lipoproteins, Lip19 and Lip12. Lip19 or Lip12 activated TNF-{alpha} production from RAW264.7 and THP-1 cells in a TLR2-dependent manner. However, neither Lip19 nor Lip12 activated HUVECs, which lack endogenous TLR2. Additionally, I{kappa}B kinase {beta} and c-Jun N-terminal kinase 1 activation in THP-1 cells induced by Lip19 or Lip12 was observed. TLR2 activation by Lip19 and Lip12 in HEK293 cells was blocked by inhibitory anti-TLR2 mAbs. The unlipidated mutants, Lip19-C19S and Lip12-C21S, in which the NH2-terminal cysteine was substituted by serine, lost their ability to activate TLR2-transfected HEK 293 cells. Taken together, these results demonstrate that two lipoproteins constitute the major contaminants responsible for TLR2-mediated cell activation in E. coli LCD25 LPS.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Since the existence of endotoxin-associated protein was confirmed and shown to be mitogenic for spleen cells of the lipid A-resistant C3H/HeJ mouse (1, 2), these LPS-associated proteins have been known to have diverse biological activities. Vogel and colleague (3) showed that purified lipid A-associated proteins obtained by phenol-water extraction of LPS were required for TNF production in IFN-{gamma}-primed C3H/HeJ (Lpsd) macrophages.

In the short time since mammalian Toll-like receptors (TLRs)4 were identified (4), the LPS hyporesponsiveness of C3H/HeJ and C57BL/10ScCr mice was shown to result from mutations in the gene encoding TLR4 (5, 6). Although these data demonstrated that TLR4 is the principal mediator of cellular responses to LPS, TLR2 also appeared to mediate LPS-induced cell activation of NF-{kappa}B (7, 8). Numerous studies have demonstrated that TLR2 mediates inflammatory signals induced by various pathogenic components, including bacterial lipoproteins/lipopeptides, peptidoglycan, yeast cell wall particle zymosan, and whole bacteria including Staphylococcus aureus and Mycobacterium tuberculosis (9, 10, 11, 12, 13, 14).

Recent studies in TLR2-deficient mice and hamsters demonstrate that TLR2 is not required for LPS-mediated signal transduction when TLR4 is present (15, 16). Indeed, TLR2 does not mediate cellular responses by commercial preparations of LPS when these are repurified (17, 18). Thus, this TLR2-mediated LPS signaling seemed to arise from contaminants associated with the LPS, although the agonists in the contaminants were not identified.

In response to this, we attempted to identify the molecules responsible for TLR2-mediated signaling associated with a commercial preparation of LPS. In this study we identified two major active lipoproteins associated with LCD25 LPS, which are responsible for activation of TLR2. We cloned these two lipoproteins and constructed mutants to further characterize the nature of their inflammatory effects.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and Abs

Polymyxin B was obtained from Sigma-Aldrich (St. Louis, MO). Heat-killed S. aureus (HKSA) was a gift from Dr. C. Fearns (The Scripps Research Institute, La Jolla, CA). Soluble peptidoglycan (sPGN) purified from S. aureus was a gift from Dr. R. Dziarski (Indiana University School of Medicine, Gary, IN). Macrophage-activating lipopeptide-2 (MALP-2) was a gift from Dr. P. F. Mühlradt (Gesellschaft für Biotechnologische Forschung, Braunschweig, Germany). FITC-labeled anti-TNF-{alpha}, PE-labeled anti-IL-6, anti-I{kappa}B kinase (IKK) {beta}, and anti-c-Jun N-terminal kinase 1 (anti-JNK1) Abs were purchased from BD PharMingen (San Diego, CA). Anti-CD14 mAbs 28C5 and 63D3 were previously described (17). Anti-TLR2 mAbs 2380 and 2392 were previously described (9). Anti-TLR4 mAb HTA1216 was a gift from Dr. K. Miyake (Saga Medical School, Tokyo, Japan). Anti-TLR2 mAb TL2.1 was purchased from BD Biosciences (San Diego, CA).

Cell culture

RAW264.7 and HEK293 cells were grown in DMEM (Life Technologies, Gaithersburg, MD) with 10% FCS, while THP-1 cells were maintained in RPMI 1640 (Life Technologies) with 10% FCS. HUVECs were cultured in endothelial cell growth medium (Clonetics, Walkersville, MD).

Protein extraction from LPS and NH2-terminal sequencing

LCD25 LPS from Escherichia coli K-12 was purchased from List Biological Laboratories (Campbell, CA). Protein extraction from 40 mg of LCD25 LPS was performed according to the LPS repurification method previously described (19). The phenol phase was dialyzed in PBS and separated on a 12% SDS-PAGE gel. The gel was fractionated by slicing. Each gel piece of 10 x 2 mm2 was then soaked in PBS overnight for protein elution. For NH2-terminal sequencing, proteins were in-gel digested by trypsin and sequenced at the Core Facility of The Scripps Research Institute. For proteinase K treatments, proteinase K-conjugated beads (Sigma-Aldrich) were mixed with the phenol phase eluate of LCD25 LPS or lipoproteins in microtubes and incubated for 6 h with gentle shaking. The mixtures were centrifuged at 12,000 rpm for 5 min, and the supernatants were used for cell stimulation.

Cloning and expression

E. coli K-12 strain MG1655 was purchased from American Type Culture Collection (Manassas, VA). Genomic DNA from E. coli K-12 was isolated as described previously (20) and used as template to PCR amplify the Lip19 and Lip12 genes. The oligonucleotide primers used for PCR were: for Lip19, GAGAAATCCATGGAACTCGTGCACATGGCCAGTGGTTTAGCG and TAACGTCTCGAGATATTGCGTAGGAGCTGGAACTGCCGAAGA; and for Lip12, GGACGGACCATGGACAAGAATATGGAGGAATTCTGAGTGC and ACGAATCTCGAGCTTCGCAGCCTGTGGATCAGTGTCG. The amplified products were cloned into the pET28b vector (Novagen, Madison, WI) at NcoI and XhoI. The cysteine mutants of Lip19 and Lip12, in which the cysteine residue at positions 19 and 21, respectively, were substituted by serine, were made using a QuickChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). The oligonucleotide primers used for point mutation were: for Lip19-C19S, ATTGCGTTGGCGGCTAGTGCAGATAAAAGCGCG and GCTTTTATCTGCACTAGCCGCCAACGCAATCGC; and for Lip12-C21S, ACCATGCTGGCGGGTAGCACGGCTTATGATCG and TACGATCATAAGCCGTGCTACCCGCCAGCATGG. All of the PCR clones were fully sequenced to confirm that no PCR errors occurred. Each recombinant DNA was transformed into E. coli BL21(DE3) strain, and the expressed proteins with a COOH-terminal 6x histidine tag were purified using nickel affinity chromatography according to the manufacturer’s instructions (Novagen). Contamination with bacterial endotoxin in all of the protein preparations was <0.5 EU (endotoxin units)/µg as determined by a Limulus amebocyte lysate assay (BioWhittaker, Walkersville, MD).

NF-{kappa}B reporter assay

HEK293 cells (1.5 x 105) were plated in 12-well plates with DMEM and 10% FCS. On the following day, cells were transiently transfected with 0.25 µg/ml human TLR2 expression vector or empty vector along with 0.075 µg/ml pNF-{kappa}B-Luc vector (Stratagene) and 0.15 µg/ml pSV-{beta}-galactosidase vector (Promega, Madison, WI). After 24 h, cells were stimulated for 6 h with the ligands as noted in the figures, and then cell extracts were prepared. NF-{kappa}B-induced luciferase activity was measured using a Luciferase Reporter Assay System (Promega), and {beta}-galactosidase activity was measured using O-nitrophenyl-{beta}-D-galactopyranoside as substrate (Promega). For the Ab blocking experiments, cells were preincubated for 1 h with the Abs before stimulation. Luciferase activity reported in the figures is normalized for transfection efficiency using the {beta}-galactosidase activity.

Flow cytometric analysis

HUVECs, RAW264.7 cells, or THP-1 cells were stimulated for 5 h with 0.2 µg/ml Lip19, Lip12, or TLR2-specific agonists in the presence of 0.5 µg/ml brefeldin A (Sigma-Aldrich). Cells were harvested and washed in PBS. Cells were fixed in 4% paraformaldehyde for 10 min and permeabilized in 0.1% Triton X-100/0.1% sodium citrate for 2 min. After washing in PBS, THP-1 and RAW264.7 cells were incubated for 20 min with FITC-labeled anti-TNF-{alpha} Ab, while HUVECs were incubated with PE-labeled anti-IL-6 Ab. The cells were washed and resuspended in PBS, and the production of cytokines was analyzed by flow cytometry using a FACScan flow cytometry (BD Biosciences).

EMSA and in vitro kinase assays

THP-1 cells (3 x 105) were plated in six-well plates with RPMI 1640 with 10% FCS and stimulated with 100 ng/ml lipoproteins at the different time points as indicated in the figure legends. Cells were harvested and treated with buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM PMSF) followed by centrifugation. The supernatant was used for kinase assay, and the pellet was further treated with buffer B (20 mM HEPES (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, and 0.1 mM PMSF) to prepare nuclear extracts. EMSA and kinase assay were performed as previously described (21, 22).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of activating lipoproteins in LCD25 LPS

Previous studies have shown that commercially prepared LPS products, when repurified by phenol extraction, no longer induce cellular activation through TLR2 (17, 18). This implies that impurities in those LPS preparations are responsible for TLR2-mediated cell activation. We found that one commercial LPS preparation derived from E. coli K-12 strain LCD25 strongly activated TLR2-transfected HEK293 cells (Fig. 1GoA). The activation of HEK293 cells through TLR2 by this LPS, however, was completely abolished when this LPS was repurified by phenol extraction. In contrast, the phenol phase, which contains impurities, induced TLR2-transfected cell activation (Fig. 1GoA). The phenol phase was preincubated with polymyxin B or proteinase K beads and used to stimulate HEK293 cells transfected with TLR2. Although polymyxin B did not inhibit cell activation by the phenol phase, proteinase K abolished most of the activity of the phenol phase (Fig. 1GoB). The results indicate that the activating molecules in the phenol phase are protein. To identify the proteins responsible for cell activation, the phenol phase was fractionated by SDS-PAGE. Each gel slice eluate was tested for cell activation (data not shown). Among the fractions, two proteins that strongly induced TLR2-mediated HEK293 cell activation were apparent. These two proteins showed a mobility of ~19 and 12 kDa, respectively (Fig. 2GoA). After trypsin digestion, conventional sequencing yielded the sequences shown (Fig. 4Go). These sequences were searched for in the GenBank database. The two sequences were identified as E. coli lipoproteins: a hypothetical lipoprotein of 19.4 kDa in the TESB-HHA intergenic region precursor and an osmotically inducible lipoprotein E precursor of 12 kDa (23, 24). In this study, these lipoproteins are named Lip19 and Lip12, respectively (Fig. 4Go). The gel-purified Lip19 and Lip12 proteins activated TLR2-transfected HEK293 cells (Fig. 2GoB). Neither Lip19 nor Lip12 activated nontransfected HEK293 cells (data not shown). Each purified Lip19 or Lip12 induced TNF-{alpha} production in the murine macrophage cell line RAW264.7 as well as THP-1 cells (Fig. 3Go, A and B, respectively). In contrast, HUVECs, which do not appear to express TLR2 (25), were not activated by either Lip19 or Lip12 (Fig. 3GoC).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. Proteinaceous impurities from LCD25 LPS induce NF-{kappa}B activity in HEK293 cells. Cells were transiently transfected with 0.25 µg/ml empty vector or TLR2 expression vector along with 0.075 µg/ml pNF-{kappa}B-Luc vector and 0.15 µg/ml pSV-{beta}-galactosidase vector. LCD25 LPS was phenol extracted, and the aqueous and phenol phases were purified. Cells were stimulated with 0.1 µg/ml crude LCD25 LPS, aqueous phase or phenol phase, and with 10 ng/ml IL-1 as a control (A). Before cell stimulation, the phenol phase was preincubated with polymyxin B or proteinase K beads (B). After a 6-h stimulation, luciferase activity was measured and normalized with {beta}-galactosidase activity. The experiment was performed twice with similar results.

 


View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Two apparent proteins isolated from LCD25 LPS impurities induce TLR2-mediated cell activation. The phenol phase from LCD25 LPS extraction was fractionated to 25 fractions (data not shown), from which two proteins were isolated. The two proteins, Lip19 and Lip12, were run on a 12% SDS-PAGE gel, transferred to a polyvinylidene difluoride membrane, and stained with colloidal gold (A). HEK293 cells were transiently transfected with 0.25 µg/ml empty vector or TLR2 expression vector along with 0.075 µg/ml pNF-{kappa}B-Luc vector and 0.15 µg/ml pSV-{beta}-galactosidase vector. Cells were stimulated with 0.2 µg/ml crude LCD25 LPS or 0.1 µg/ml Lip19 or Lip12. After a 6-h stimulation, luciferase activity was measured and normalized with {beta}-galactosidase assay (B). The luciferase assay was performed twice with similar results. Crude, Crude phenol phase.

 


View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 4. Amino acid sequence analysis and deduced amino acid sequences of Lip19 and Lip12. The gel-eluted proteins of 19 and 12 kDa (Fig. 2GoA) were trypsin digested and sequenced. The identified sequences (underlined) were used to search for the proteins in the GenBank database (GenBank no. P77717 for Lip19 and P23933 for Lip12). The predicted lipidation sites are boxed. The asterisks indicated the substitution of serine for cysteine.

 


View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 3. Lip19 or Lip12 mediates cytokine induction in RAW264.7 and THP-1 cells, but not in HUVECs. Cells were stimulated with 0.1 µg/ml Lip19 or Lip12, 5 x 106/ml HKSA, or 10 ng/ml repurified LCD25 LPS. After a 5-h stimulation, cells were fixed, permeabilized, and incubated with FITC-anti-TNF-{alpha} (for RAW264.7 and THP-1) or PE-anti-IL-6 (for HUVECs). Cytokine production was analyzed by FACS.

 
Cloning and expression of Lip19 and Lip12

To confirm the activities of the isolated lipoproteins, they were cloned, expressed, and purified. Additionally, we investigated whether the active moiety of Lip19 or Lip12 was the lipidated NH2-terminal cysteine. To this end we constructed cysteine mutants of Lip19 and Lip12 in which the amino-terminal cysteine residues of the mature proteins at amino acid positions 19 and 21, respectively, were substituted by serine (Fig. 4Go). The recombinant lipoproteins, rLip19 and rLip12, as well as their mutants rLip19-C19S and rLip12-C21S, were expressed in E. coli strain BL21(DE3). The expressed proteins were purified using nickel affinity chromatography, and each resulting preparation was of >95% purity (Fig. 5Go). The wild types of rLip19 and rLip12 were able to induce cell activation in TLR2-transfected HEK293 cells, while the C->S mutants had lost their ability to activate cells. (Fig. 6Go). These results demonstrate that the lipidated amino-terminal cysteine of the lipoproteins is the portion that mediates TLR2 signaling. Interestingly, the expressed rLip19 always yielded two bands by SDS-PAGE (Fig. 5Go). When these two bands were purified by electroelution from the gel and tested, only the lower band activated TLR2-transfected HEK293 cells (data not shown). Since lipidation is a posttranslational modification, the upper band may be an unlipidated form of rLip19, as it has same SDS-PAGE migration as rLip19-C19S (Fig. 5Go).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 5. Expression and purification of the recombinant lipoproteins. The recombinant wild-type rLip19 and rLip12 as well as cysteine mutants rLip19-C19S and rLip12-C21S were expressed in E. coli BL21(DE3) and purified by nickel affinity chromatography. Purified proteins were run on a 15% SDS-PAGE gel. The gel was stained with Coomassie blue (left) or was transferred onto nitrocellulose membrane. The membrane was probed with anti-histidine mAb (right). Lane 1, rLip19; lane 2, rLip19-C19S; lane 3, rLip12; lane 4, rLip12-C21S; and lane 5, vector expression.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. Unlipidated proteins do not induce TLR2-mediated HEK293 cell activation. Cells were transiently transfected with 0.25 µg/ml empty vector or TLR2 expression vector along with 0.075 µg/ml pNF-{kappa}B-Luc vector and 0.15 µg/ml pSV-{beta}-galactosidase vector. Cells were stimulated with the indicated amount of protein (nanograms per milliliter). After a 6-h stimulation, luciferase activity was measured and normalized with {beta}-galactosidase activity. Vect Exp, Vector mock expression eluate that was used in same volume as rLips used in the experiment (MALP-2, 1 ng/ml). Results are shown as the mean ± SD, and determinations were made in triplicate. The experiment was performed twice with similar results.

 
TLR2-mediated activation by Lip19 or Lip12

The role of TLR2 in mediating cell activation by Lip19 or Lip12 was further tested using TLR2-specific mAbs. Two known antagonistic anti-TLR2 mAbs, mAbs 2392 and TL2.1 (9, 26), blocked TLR2-mediated HEK293 cell activation induced by rLip12, rLip19, or a sPGN control. In contrast, a nonblocking anti-TLR2 Ab, mAb 2380, or an antagonistic anti-TLR4 Ab, HTA1216, which is a known LPS-blocking Ab (27), had no effect (Fig. 7Go). Interestingly, rLip12-mediated cell activation was inhibited only 40% by mAb 2392, while rLip19- or sPGN-mediated cell activation was inhibited by >80% by mAb 2392. The reason for the differential efficiency of mAb 2392 with these agonists is unknown.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 7. TLR2-blocking Abs inhibit TLR2-mediated cell activation induced by Lip19 or Lip12. HEK293 cells were transiently transfected with 0.25 µg/ml TLR2 expression vector, 0.075 µg/ml pNF-{kappa}B-Luc vector, and 0.15 µg/ml pSV-{beta}-galactosidase vector. Cells were preincubated with 10 µg/ml Abs, as indicated, for 1 h and stimulated with 0.2 µg/ml rLip12 or rLip19 or 10 µg/ml sPGN. After a 6-h stimulation, luciferase activity was measured and normalized with {beta}-galactosidase activity. Results are shown as the mean ± SD, and determinations were made in triplicate. The experiment was performed twice with similar results.

 
Kinase activity in THP-1 cells induced by the stimulation of rLip19 or rLip12

We next addressed the activation patterns of downstream protein kinases in the NF-{kappa}B pathway, which were induced by cell stimulation of rLip19 or rLip12. Recombinant Lip12 induced IKK{beta} and JNK1 activation in THP-1 cells within 10 min of addition, with maximum induction observed after 30 min (Fig. 8Go). Recombinant Lip19 induced the activation of IKK{beta} and JNK1 within 30 min of addition, with maximum induction observed after 60 min (Fig. 8Go). The kinetics of NF-{kappa}B nuclear translocation followed the kinetics of kinase activation (Fig. 8Go).



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 8. Lip19 or Lip12 induces activation of IKK{beta} and JNK1 in THP-1 cells. Cells were stimulated with 0.1 µg/ml rLip19 or rLip12. IKK{beta} and JNK1 kinase activities (KA) were determined at 10, 30, 60, and 120 min, as indicated. The recovery of IKK{beta} and JNK1 was determined by immunoblotting (IB). The nuclear translocation of NF-{kappa}B was determined by EMSA. C, Ligand negative control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Commercial preparations of LPS have been shown to activate cells through TLR2 as well as TLR4. However, when these LPS are repurified through phenol-water extraction, they no longer activate through TLR2 (17, 18). Although it had been known that the molecules responsible for TLR2-mediated cell activation are retained in impurities associated with commercial LPS preparations, the nature of the impurities responsible for this activity had not been characterized. In this study, we demonstrate that the molecules responsible for TLR2-mediated cell activation in one commercial LPS preparation, LCD25 LPS, are lipoproteins.

A number of studies indicate that many different infectious pathogens and their components mediate TLR2-dependent cell activation. These include lipoprotein/lipopeptide (9, 10, 11), whole mycobacteria (28), whole Gram-positive bacteria (13, 29), yeast cell wall components (13), and PGN (12). Among these, lipoprotein has long been regarded as a potent inflammatory factor. In general, all membrane-anchored lipoproteins contain a lipidated N-terminal cysteinyl residue often accompanied by N-acylation (30). The significance of the lipidation on the N-terminal cysteine has been indicated by several studies. In an early study Bessler and Ottenbreit (31) demonstrated that hydrolysis of N-terminal fatty acids of E. coli-derived lipoprotein abolished mitogenicity in mouse spleen cells. Similarly, the lipoprotein from the E. coli outer membrane lost its mitogenic activity in mouse B cells after delipidation by alkaline hydrolysis (32). Recently, the importance of the Cys-terminal lipidation of Mycoplasma fermentans lipoprotein in TLR2-mediated cell activation was also addressed (33). Our study demonstrates that the unlipidated mutants of Lip19 and Lip12 are incapable of inducing TLR2-mediated HEK293 cell activation. Since Cys-terminal lipidation is the only obvious common structural feature among bacterial lipoproteins, this is probably the portion that mediates activation through TLR2 (33, 34). At present we do not know whether lipoprotein-induced TLR2 activation arises from direct binding or involves an indirect secondary mediator between TLR2 and lipoprotein. Interestingly, since TLR2-antagonistic Abs similarly inhibit a variety of TLR2 agonists (9, 17, 26, 35, 36), as also observed here, there probably exists a common mechanism of interaction between TLR2 and its various agonists; the simplest and most likely such mechanism is, of course, direct binding.

An intracellular mechanism initiated by bacterial lipoprotein is not well distinguished from that initiated by LPS, nor are the final biological consequences (37), involving activation of various kinase cascades leading to NF-{kappa}B or AP-1 activation (reviewed in Refs. 38 and 39). Early studies indicate that lipoproteins stimulate extracellular signal-regulated kinase, JNK, and p38 kinases in murine macrophages (40). The IKK{beta} subunit of I{kappa}B kinase has been known to be essential for NF-{kappa}B activation (41), and in the present study the activation of IKK{beta} and JNK by Lip19 or Lip12 correlates with nuclear translocation of NF-{kappa}B. Not surprisingly, cytokine production upon NF-{kappa}B activation induced by Lip19 or Lip12 was dependent on cellular TLR2 expression. Taken together, these results demonstrate that two lipoproteins, Lip19 and Lip12, are the major components retained in E. coli LCD25 LPS responsible for TLR2-mediated cell activation.


    Acknowledgments
 
We are grateful to Dr. Richard I. Tapping of The Scripps Research Institute for helpful discussion and reviewing this manuscript.


    Footnotes
 
1 This work was supported by National Institute of Health Grants AI32021 and HL23584. This is publication 14710-IMM from the Department of Immunology, The Scripps Research Institute. Back

2 Current address: Department of Medicine, Mail Code 0663, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093. Back

3 Address correspondence and reprint requests to Dr. Peter S. Tobias, Department of Immunology, IMM-12, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: tobias{at}scripps.edu Back

4 Abbreviations used in this paper: TLR, Toll-like receptor; HKSA, heat-killed Staphylococcus aureus; IKK, I{kappa}B kinase; JNK, c-Jun amino-terminal kinase; MALP-2, macrophage-activating lipopeptide-2; sPGN, soluble peptidoglycan. Back

Received for publication November 20, 2001. Accepted for publication February 15, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sultzer, B. M., G. W. Goodman. 1976. Endotoxin protein: a B-cell mitogen and polyclonal activator of C3H/HeJ lymphocytes. J. Exp. Med. 144:821.[Abstract/Free Full Text]
  2. Morrison, D. C., S. J. Betz, D. M. Jacobs. 1976. Isolation of a lipid A bound polypeptide responsible for "LPS-initiated" mitogenesis of C3H/HeJ spleen cells. J. Exp. Med. 144:840.[Abstract/Free Full Text]
  3. Hogan, M. M., S. N. Vogel. 1988. Production of tumor necrosis factor by rIFN-{gamma}-primed C3H/HeJ (Lpsd) macrophages requires the presence of lipid A-associated proteins. J. Immunol. 141:4196.[Abstract]
  4. Medzhitov, R., P. Preston-Hurlburt, Jr C. A. Janeway. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394.[Medline]
  5. Poltorak, A., X. He, I. Smirnova, M.-Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.[Abstract/Free Full Text]
  6. Qureshi, S. T., L. Lariviere, G. Leveque, S. K. J. Clermont, P. Gros Moore, D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189:615.[Abstract/Free Full Text]
  7. Yang, R. B., M. R. Mark, A. Gray, A. Huang, M. H. Xie, M. Zhang, A. Goddard, W. I. Wood, A. L. Gurney, P. J. Godowski. 1998. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling. Nature 395:284.[Medline]
  8. Kirschning, C. J., H. Wesche, T. M. Ayres, M. Rothe. 1999. Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J. Exp. Med. 188:2091.[Abstract/Free Full Text]
  9. Aliprantis, A. O., R.-B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor 2. Science 285:736.[Abstract/Free Full Text]
  10. Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, J. J. Weis. 1999. Inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2. J. Immunol. 163:2382.[Abstract/Free Full Text]
  11. Takeuchi, O., A. Kaufmann, K. Grote, T. Kawai, K. Hoshino, M. Morr, P. F. Mühlradt, S. Akira. 2000. Preferentially the R-stereoisomer of the mycoplasmal lipopeptide macrophage-activating lipopeptide-2 activates immune cells through a Toll-like receptor 2- and MyD88-dependent signaling pathway. J. Immunol. 164:554.[Abstract/Free Full Text]
  12. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning. 1999. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2. J. Biol. Chem. 274:17406.[Abstract/Free Full Text]
  13. Underhill, D. M., A. Ozinsky, A. M. Hajar, A. Stevens, C. B. Wilson, M. Bassetti, A. Aderem. 1999. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401:811.[Medline]
  14. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton. 1999. The CD14 ligands lipoarabinomannan and lipopolysaccharide differ in their requirement for Toll-like receptors. J. Immunol. 163:3920.[Abstract/Free Full Text]
  15. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Different roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11:443.[Medline]
  16. Heine, H., C. J. Kirschning, E. Lien, B. G. Monke, M. Rothe, D. T. Golenbock. 1999. Cells that carry a null allele for Toll-like receptor 2 are capable of responding to endotoxin. J. Immunol. 162:6971.[Abstract/Free Full Text]
  17. Tapping, R. I., S. Akashi, K. Miyake, P. J. Godowski, P. S. Tobias. 2000. Toll-like receptor 4, but not Toll-like receptor 2, is a signaling receptor for Escherichia and Salmonella lipopolysaccharides. J. Immunol. 165:5780.[Abstract/Free Full Text]
  18. Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, J. J. Weis. 2000. Repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2. J. Immunol. 165:618.[Abstract/Free Full Text]
  19. Manthey, C. L., S. N. Vogel. 1994. Elimination of trace endotoxin protein from rough chemotype LPS. J. Endotoxin Res. 1:84.
  20. Sambrook, J., E. F. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual 2nd Ed. Cold Spring Harbor Lab. Press, Cold Spring Harbor.
  21. Kravchenko, V. V., S. Steinemann, L. Kline, L. Feng, R. J. Ulevitch. 1996. Endotoxin tolerance is induced in chinese hamster ovary cell lines expressing human CD14. Shock 5:194.[Medline]
  22. Lee, J., L. Mira-Arbibe, R. J. Ulevitch. 2000. TAK1 regulates multiple protein kinase cascades activated by bacterial lipopolysaccharide. J. Leukocyte Biol. 68:909.[Abstract/Free Full Text]
  23. Blattner, F. R., III G. Plunkett, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, et al 1997. The complete genome sequence of Escherichia coli K-12. Nature 277:1453.
  24. Gutierrez, C., S. Gordia, S. Bonnassie. 1995. Characterization of the osmotically inducible gene osmE of Escherichia coli K-12. Mol. Microbiol. 16:553.[Medline]
  25. Faure, E., O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio, M. Arditi. 2000. Bacterial lipopolysaccharide activates NF-{kappa}B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells. J. Biol. Chem. 275:11058.[Abstract/Free Full Text]
  26. Flo, T. H., Ø. Halaas, E. Lien, L. Ryan, G. Teti, D. T. Golenbock, A. Sundan, T. Espevik. 2000. Human Toll-like receptor 2 mediates monocyte activation by Listeria monocytogenes, but not by group B streptococci or lipopolysaccharide. J. Immunol. 164:2064.[Abstract/Free Full Text]
  27. Viriyakosol, S., P. S. Tobias, R. L. Kitchens, T. N. Kirkland. 2001. MD-2 binds to bacterial lipopolysaccharides. J. Biol. Chem. 276:38044.[Abstract/Free Full Text]
  28. Underhill, D. M., A. Ozinsky, K. D. Smith, A. Aderem. 1999. Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signalling in macrophages. Proc. Natl. Acad. Sci. USA 96:14459.[Abstract/Free Full Text]
  29. Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, D. Golenbock. 1999. Recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. 163:1.[Abstract/Free Full Text]
  30. Chambaud, I., H. Wróblewski, A. Blanchard. 1999. Interactions between mycoplasma lipoproteins and the host immune system. Trends Microbiol. 7:493.[Medline]
  31. Bessler, W. G., B. P. Ottenbreit. 1977. Studies on the mitogenic principle of lipoprotein from the outer membrane of Escherichia coli. Biochem. Biophys. Res. Commun. 76:239.
  32. Melchers, F., V. Braun, C. Galanos. 1975. The lipoprotein of the outer membrane of Escherichia coli: a B-lymphocyte mitogen. J. Exp. Med. 142:473.[Abstract/Free Full Text]
  33. Nishiguchi, M., M. Matsumoto, T. Takao, M. Hoshino, Y. Shimonishi, S. Tsuji, N. A. Begum, O. Takeuchi, S. Akira, K. Toyoshima, et al 2001. Mycoplasma fermentans lipoprotein M161Ag-induced cell activation is mediated by Toll-like receptor 2: role of N-terminal hydrophobic portion in its multiple functions. J. Immunol. 166:2610.[Abstract/Free Full Text]
  34. Mühlradt, P. F., M. Kiess, H. Meyer, R. Süssmuth, G. Jung. 1998. Structure and specific activity of macrophage-stimulating lipopeptides from Mycoplasma hyorhinis. Infect. Immun. 66:4804.[Abstract/Free Full Text]
  35. Lien, E., T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, et al 1999. Toll-like receptor 2 functions as a pattern recognition receptor for diverse bacterial products. J. Biol. Chem. 274:33419.[Abstract/Free Full Text]
  36. Sugawara, S., S. Yang, K. Iki, J. Hatakeyama, R. Tamai, O. Takeuchi, S. Akashi, T. Espevik, S. Akira, H. Takada. 2001. Monocytic cell activation by nonendotoxic glycoprotein from Prevotella intermedia ATCC 25611 is mediated by Toll-like receptor 2. Infect. Immun. 69:4951.[Abstract/Free Full Text]
  37. Galanos, C., M. Gumenscheimer, P. Mühlradt, E. Jirillo, M. Freudenberg. 2000. MALP-2, a mycoplasma lipopeptide with classical endotoxic properties: end of an era of LPS monopoly?. J. Enodotoxin Res. 6:471.
  38. Anderson, K. V.. 2000. Toll signaling pathways in the innate immune response. Curr. Opin. Immunol. 12:13.[Medline]
  39. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2:675.[Medline]
  40. Rawadi, G., V. Ramez, B. Lemercier, S. Roman-Roman. 1998. Activation of mitogen-activated protein kinase pathways by Mycoplasma fermentans membrane lipoproteins in murine macrophages: involvement in cytokine synthesis. J. Immunol. 160:1330.[Abstract/Free Full Text]
  41. Li, Z. W., W. Chu, Y. Hu, M. Delhase, T. Deerinck, M. Ellisman, R. Johnson, M. Karin. 1999. The IKK{beta} subunit of I{kappa}B kinase (IKK) is essential for nuclear factor {kappa}B activation and prevention of apoptosis. J. Exp. Med. 189:1839.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Med MicrobiolHome page
M. Alhawi, J. Stewart, C. Erridge, S. Patrick, and I. R. Poxton
Bacteroides fragilis signals through Toll-like receptor (TLR) 2 and not through TLR4
J. Med. Microbiol., August 1, 2009; 58(8): 1015 - 1022.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
L. A. J. O'Neill, C. E. Bryant, and S. L. Doyle
Therapeutic Targeting of Toll-Like Receptors for Infectious and Inflammatory Diseases and Cancer
Pharmacol. Rev., June 1, 2009; 61(2): 177 - 197.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Thakran, H. Li, C. L. Lavine, M. A. Miller, J. E. Bina, X. R. Bina, and F. Re
Identification of Francisella tularensis Lipoproteins That Stimulate the Toll-like Receptor (TLR) 2/TLR1 Heterodimer
J. Biol. Chem., February 15, 2008; 283(7): 3751 - 3760.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Spiller, S. Dreher, G. Meng, A. Grabiec, W. Thomas, T. Hartung, K. Pfeffer, H. Hochrein, H. Brade, W. Bessler, et al.
Cellular Recognition of Trimyristoylated Peptide or Enterobacterial Lipopolysaccharide via Both TLR2 and TLR4
J. Biol. Chem., May 4, 2007; 282(18): 13190 - 13198.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Hashimoto, M. Furuyashiki, R. Kaseya, Y. Fukada, M. Akimaru, K. Aoyama, T. Okuno, T. Tamura, T. Kirikae, F. Kirikae, et al.
Evidence of Immunostimulating Lipoprotein Existing in the Natural Lipoteichoic Acid Fraction
Infect. Immun., April 1, 2007; 75(4): 1926 - 1932.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. Tirsoaga, A. Novikov, M. Adib-Conquy, C. Werts, C. Fitting, J.-M. Cavaillon, and M. Caroff
Simple Method for Repurification of Endotoxins for Biological Use
Appl. Envir. Microbiol., March 15, 2007; 73(6): 1803 - 1808.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
H. K. Kim, V. P. Rao, Y.-S. Park, V. M. Miller, H. D. Tazelaar, and C. G.A. McGregor
Pulmonary arterial reactivity during induced infection of single lung allografts
Eur. J. Cardiothorac. Surg., March 1, 2007; 31(3): 475 - 481.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. Jayachandran, G. J. Brunn, K. Karnicki, R. S. Miller, W. G. Owen, and V. M. Miller
In vivo effects of lipopolysaccharide and TLR4 on platelet production and activity: implications for thrombotic risk
J Appl Physiol, January 1, 2007; 102(1): 429 - 433.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Hashimoto, K. Tawaratsumida, H. Kariya, A. Kiyohara, Y. Suda, F. Krikae, T. Kirikae, and F. Gotz
Not Lipoteichoic Acid but Lipoproteins Appear to Be the Dominant Immunobiologically Active Compounds in Staphylococcus aureus.
J. Immunol., September 1, 2006; 177(5): 3162 - 3169.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Gao, Y. Wang, and M.-F. Tsan
The heat sensitivity of cytokine-inducing effect of lipopolysaccharide
J. Leukoc. Biol., August 1, 2006; 80(2): 359 - 366.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. D. Pecora, A. J. Gehring, D. H. Canaday, W. H. Boom, and C. V. Harding
Mycobacterium tuberculosis LprA Is a Lipoprotein Agonist of TLR2 That Regulates Innate Immunity and APC Function
J. Immunol., July 1, 2006; 177(1): 422 - 429.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Zacharowski, P. A. Zacharowski, A. Koch, A. Baban, N. Tran, R. Berkels, C. Papewalis, K. Schulze-Osthoff, P. Knuefermann, U. Zahringer, et al.
Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome
PNAS, April 18, 2006; 103(16): 6392 - 6397.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
J. S. Yang, H. J. Kim, Y. H. Ryu, C.-H. Yun, D. K. Chung, and S. H. Han
Endotoxin contamination in commercially available pokeweed mitogen contributes to the activation of murine macrophages and human dendritic cell maturation.
Clin. Vaccine Immunol., March 1, 2006; 13(3): 309 - 313.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. M. Berguer, J. Mundinano, I. Piazzon, and F. A. Goldbaum
A Polymeric Bacterial Protein Activates Dendritic Cells via TLR4
J. Immunol., February 15, 2006; 176(4): 2366 - 2372.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Hashimoto, K. Tawaratsumida, H. Kariya, K. Aoyama, T. Tamura, and Y. Suda
Lipoprotein is a predominant Toll-like receptor 2 ligand in Staphylococcus aureus cell wall components
Int. Immunol., February 1, 2006; 18(2): 355 - 362.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Meyer, E. van Liempt, A. Imberty, Y. van Kooyk, H. Geyer, R. Geyer, and I. van Die
DC-SIGN Mediates Binding of Dendritic Cells to Authentic Pseudo-LewisY Glycolipids of Schistosoma mansoni Cercariae, the First Parasite-specific Ligand of DC-SIGN
J. Biol. Chem., November 11, 2005; 280(45): 37349 - 37359.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M.-A. Nahori, E. Fournie-Amazouz, N. S. Que-Gewirth, V. Balloy, M. Chignard, C. R. H. Raetz, I. Saint Girons, and C. Werts
Differential TLR Recognition of Leptospiral Lipid A and Lipopolysaccharide in Murine and Human Cells
J. Immunol., November 1, 2005; 175(9): 6022 - 6031.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Cohen-Sfady, G. Nussbaum, M. Pevsner-Fischer, F. Mor, P. Carmi, A. Zanin-Zhorov, O. Lider, and I. R. Cohen
Heat Shock Protein 60 Activates B Cells via the TLR4-MyD88 Pathway
J. Immunol., September 15, 2005; 175(6): 3594 - 3602.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
G. Mancuso, A. Midiri, C. Biondo, C. Beninati, M. Gambuzza, D. Macri, A. Bellantoni, A. Weintraub, T. Espevik, and G. Teti
Bacteroides fragilis-Derived Lipopolysaccharide Produces Cell Activation and Lethal Toxicity via Toll-Like Receptor 4
Infect. Immun., September 1, 2005; 73(9): 5620 - 5627.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Sen, A. Q. Khan, Q. Chen, and C. M. Snapper
In Vivo Humoral Immune Responses to Isolated Pneumococcal Polysaccharides Are Dependent on the Presence of Associated TLR Ligands
J. Immunol., September 1, 2005; 175(5): 3084 - 3091.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. A. Steiner, S. Chakravarty, J. R. Robbins, A. S. Dragic, J. Pan, M. Herkenham, and A. A. Romanovsky
Thermoregulatory responses of rats to conventional preparations of lipopolysaccharide are caused by lipopolysaccharide per se-- not by lipoprotein contaminants
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R348 - R352.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
B. Fournier and D. J. Philpott
Recognition of Staphylococcus aureus by the Innate Immune System
Clin. Microbiol. Rev., July 1, 2005; 18(3): 521 - 540.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Zanin-Zhorov, G. Tal, S. Shivtiel, M. Cohen, T. Lapidot, G. Nussbaum, R. Margalit, I. R. Cohen, and O. Lider
Heat Shock Protein 60 Activates Cytokine-Associated Negative Regulator Suppressor of Cytokine Signaling 3 in T Cells: Effects on Signaling, Chemotaxis, and Inflammation
J. Immunol., July 1, 2005; 175(1): 276 - 285.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
T. H. Elsasser, J. W. Blum, and S. Kahl
Characterization of calves exhibiting a novel inheritable TNF-{alpha} hyperresponsiveness to endotoxin: associations with increased pathophysiological complications
J Appl Physiol, June 1, 2005; 98(6): 2045 - 2055.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Rounioja, J. Rasanen, M. Ojaniemi, V. Glumoff, H. Autio-Harmainen, and M. Hallman
Mechanism of Acute Fetal Cardiovascular Depression after Maternal Inflammatory Challenge in Mouse
Am. J. Pathol., June 1, 2005; 166(6): 1585 - 1592.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Asai, M. Hashimoto, H. M. Fletcher, K. Miyake, S. Akira, and T. Ogawa
Lipopolysaccharide Preparation Extracted from Porphyromonas gingivalis Lipoprotein-Deficient Mutant Shows a Marked Decrease in Toll-Like Receptor 2-Mediated Signaling
Infect. Immun., April 1, 2005; 73(4): 2157 - 2163.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Zanin-Zhorov, R. Bruck, G. Tal, S. Oren, H. Aeed, R. Hershkoviz, I. R. Cohen, and O. Lider
Heat Shock Protein 60 Inhibits Th1-Mediated Hepatitis Model via Innate Regulation of Th1/Th2 Transcription Factors and Cytokines
J. Immunol., March 15, 2005; 174(6): 3227 - 3236.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Zamboni, M. A. Campos, A. C. T. Torrecilhas, K. Kiss, J. E. Samuel, D. T. Golenbock, F. N. Lauw, C. R. Roy, I. C. Almeida, and R. T. Gazzinelli
Stimulation of Toll-like Receptor 2 by Coxiella burnetii Is Required for Macrophage Production of Pro-inflammatory Cytokines and Resistance to Infection
J. Biol. Chem., December 24, 2004; 279(52): 54405 - 54415.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Osterloh, F. Meier-Stiegen, A. Veit, B. Fleischer, A. von Bonin, and M. Breloer
Lipopolysaccharide-free Heat Shock Protein 60 Activates T Cells
J. Biol. Chem., November 12, 2004; 279(46): 47906 - 47911.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Hashimoto, Y. Asai, and T. Ogawa
Separation and structural analysis of lipoprotein in a lipopolysaccharide preparation from Porphyromonas gingivalis
Int. Immunol., October 1, 2004; 16(10): 1431 - 1437.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Dunzendorfer, H.-K. Lee, and P. S. Tobias
Flow-Dependent Regulation of Endothelial Toll-Like Receptor 2 Expression Through Inhibition of SP1 Activity
Circ. Res., October 1, 2004; 95(7): 684 - 691.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. P. Darveau, T.-T. T. Pham, K. Lemley, R. A. Reife, B. W. Bainbridge, S. R. Coats, W. N. Howald, S. S. Way, and A. M. Hajjar
Porphyromonas gingivalis Lipopolysaccharide Contains Multiple Lipid A Species That Functionally Interact with Both Toll-Like Receptors 2 and 4
Infect. Immun., September 1, 2004; 72(9): 5041 - 5051.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M.-F. Tsan and B. Gao
Endogenous ligands of Toll-like receptors
J. Leukoc. Biol., September 1, 2004; 76(3): 514 - 519.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock
Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1
J. Immunol., August 15, 2004; 173(4): 2736 - 2745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M.-F. Tsan and B. Gao
Cytokine function of heat shock proteins
Am J Physiol Cell Physiol, April 1, 2004; 286(4): C739 - C744.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-K. Lee, S. Dunzendorfer, and P. S. Tobias
Cytoplasmic Domain-mediated Dimerizations of Toll-like Receptor 4 Observed by {beta}-Lactamase Enzyme Fragment Complementation
J. Biol. Chem., March 12, 2004; 279(11): 10564 - 10574.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. F. Alcorn and J. R. Wright
Surfactant protein A inhibits alveolar macrophage cytokine production by CD14-independent pathway
Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L129 - L136.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. R. Coats, R. A. Reife, B. W. Bainbridge, T.-T. T. Pham, and R. P. Darveau
Porphyromonas gingivalis Lipopolysaccharide Antagonizes Escherichia coli Lipopolysaccharide at Toll-Like Receptor 4 in Human Endothelial Cells
Infect. Immun., December 1, 2003; 71(12): 6799 - 6807.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Fujita, T. Into, M. Yasuda, T. Okusawa, S. Hamahira, Y. Kuroki, A. Eto, T. Nisizawa, M. Morita, and K.-i. Shibata
Involvement of Leucine Residues at Positions 107, 112, and 115 in a Leucine-Rich Repeat Motif of Human Toll-Like Receptor 2 in the Recognition of Diacylated Lipoproteins and Lipopeptides and Staphylococcus aureus Peptidoglycans
J. Immunol., October 1, 2003; 171(7): 3675 - 3683.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
E. S. Van Amersfoort, T. J. C. Van Berkel, and J. Kuiper
Receptors, Mediators, and Mechanisms Involved in Bacterial Sepsis and Septic Shock
Clin. Microbiol. Rev., July 1, 2003; 16(3): 379 - 414.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Gao and M.-F. Tsan
Recombinant Human Heat Shock Protein 60 Does Not Induce the Release of Tumor Necrosis Factor {alpha} from Murine Macrophages
J. Biol. Chem., June 13, 2003; 278(25): 22523 - 22529.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. E. Girardin, I. G. Boneca, L. A. M. Carneiro, A. Antignac, M. Jehanno, J. Viala, K. Tedin, M.-K. Taha, A. Labigne, U. Zathringer, et al.
Nod1 Detects a Unique Muropeptide from Gram-Negative Bacterial Peptidoglycan
Science, June 6, 2003; 300(5625): 1584 - 1587.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Muroi, T. Ohnishi, S. Azumi-Mayuzumi, and K.-i. Tanamoto
Lipopolysaccharide-Mimetic Activities of a Toll-Like Receptor 2-Stimulatory Substance(s) in Enterobacterial Lipopolysaccharide Preparations
Infect. Immun., June 1, 2003; 71(6): 3221 - 3226.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Inohara, Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K. Fukase, S. Inamura, S. Kusumoto, M. Hashimoto, et al.
Host Recognition of Bacterial Muramyl Dipeptide Mediated through NOD2. IMPLICATIONS FOR CROHN'S DISEASE
J. Biol. Chem., February 14, 2003; 278(8): 5509 - 5512.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Andonegui, S. M. Goyert, and P. Kubes
Lipopolysaccharide-Induced Leukocyte-Endothelial Cell Interactions: A Role for CD14 Versus Toll-Like Receptor 4 Within Microvessels
J. Immunol., August 15, 2002; 169(4): 2111 - 2119.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, H.-K.
Right arrow Articles by Tobias, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, H.-K.
Right arrow Articles by Tobias, P. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS