|
|
||||||||




* Department of Laboratory Medicine and
Department of Genetics and Section of Immunobiology, Yale University, New Haven, CT 06520;
Department of Medicine, Division of Hematology, Albert Einstein College of Medicine, Bronx, NY 10461; and
Lawrence Berkeley Laboratory, University of California, Berkeley, CA 94720
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
have shown that the entire respective
lineage does not develop (1, 2), making it likely that
factors that regulate CD4 and CD8 expression also regulate the
functional commitment of the cell. Therefore investigating the
mechanisms controlling CD4 and CD8 expression should increase our
understanding of thymocyte development.
CD8 can be expressed in mice and humans as an 
homodimer or an

heterodimer. Human CD8
can also be expressed as a 
homodimer in transfected COS cells and transgenic mice
(3). The CD8A and B genes, closely
linked at a distance of
36 kb in mice and 56 kb in humans (see Fig. 1
), are coexpressed on most CD8+ T cells. The
close linkage and coexpression of the CD8 genes suggest
coordinate regulation. However, regulation is not always coordinated,
particularly in cells which seem to be extrathymically derived, as
subsets of human NK cells (4) and gut intraepithethelial
lymphocytes (IELs)3
(5, 6) express only the CD8
homodimer.
|
25
kb upstream of the CD8B gene and containing the entire
CD8B gene afforded developmentally correct expression on
thymus-derived T cells in transgenic mice, indicating that CD8
lineage-specific regulatory sequences must be located within that
fragment (7). Likewise, an 80-kb murine genomic fragment
from 2 kb upstream of the CD8B gene to 25 kb downstream of
the CD8A gene allowed appropriate expression in transgenic
mice (8). The 80-kb murine genomic fragment contained four
clusters of DNase hypersensitive (HS) sites (9) which were
analyzed for enhancer activity in transgenic mice. One cluster at the
3' end of the CD8B gene and two in the intergenic region had
enhancer activity. The results indicate that there are separate
elements for CD8 expression in the thymus vs the periphery, and
possibly also for CD8
vs CD8
(9, 10, 11, 12, 13). To locate regulatory regions within the human CD8 gene complex, we mapped the DNase HS sites which often colocalize with cis-acting transcriptional regulators. In addition, since many lymphoid gene enhancers are closely linked to matrix association regions (MARs) (14), we also undertook the mapping of MARs in the human CD8A and B loci. MARs, interspersed in genomes on the average of 50100 kb, have been identified as specialized genomic sequences that tightly associate with the nuclear matrix, a RNA and protein containing fraction that remains after high salt extraction and DNase I treatment. MARs serve to anchor chromatin loops to the nuclear matrix and have been shown to facilitate long-range chromatin remodeling and accessibility (15, 16). We identified several MARs spanning the human CD8 loci. Interestingly, three strong MARs are closely linked to DNase HS clusters III and IV, located at the 3' end of the CD8B gene, making this region a prime candidate for an element regulating CD8 gene expression.
To further establish the significance of this region, we analyzed the candidate regulatory region for binding of SATB1, a tissue-specific MAR-binding protein (17). Studies of SATB1 knockout animals showed that SATB1, expressed primarily in thymocytes, regulates temporal and spatial expression of multiple genes during T cell development, and is required for maturation of CD4+ and CD8+ T cells (18). Within the MARs associated with the human CD8 DNase HS clusters III and IV, we found two fragments that bound SATB1 with high affinity in an EMSA.
Further analysis of the sequence in the region of HS clusters III and IV revealed several potential binding sites for GATA-3, a transcription factor widely expressed in embryonic tissues, but whose expression is mainly limited in adult animals to T cells and NK cells (19, 20, 21). Targeted deletion of GATA-3 was embryonically lethal (22), but using Rag complementation, it was determined that GATA-3 is required for development of the earliest T cell progenitors (23). GATA-3 binding sites have been reported in several T cell-specific genes (24, 25, 26, 27, 28, 29, 30, 31), including the murine CD8 promoter/enhancer (32). In the present study, EMSA analysis revealed that an oligonucleotide with a double GATA-3 binding site, corresponding to the cluster IV HS site located in a strong MAR, binds GATA-3 strongly, while others in the HS cluster III and IV region also bind. Colocalization of GATA-3 binding sites, SATB1 binding sites, MARs, and DNase HS clusters suggests this region is a candidate regulator of human CD8 expression.
| Materials and Methods |
|---|
|
|
|---|
All cell lines were grown in RPMI 1640 medium supplemented with
2 mM L-glutamine, 100 U of penicillin/ml, 100 µg of
streptomycin/ml, and 10% FCS. Cell lines used included the
EBV-transformed B cell line UC and the human T cell lines HPB.ALL
(CD4+CD8
+
+),
JM (CD4+CD8
-
-), and
Jurkat (CD4+CD8-). Cells
were cultured at 37°C in a water-saturated atmosphere of 5%
CO2.
DNase I hypersensitivity mapping
DNase I hypersensitivity mapping was performed as described
previously (7). Briefly, DNA purified from DNase-treated
nuclei was restriction digested and used to prepare Southern blots
which were probed with the following fragments (see Fig. 1
): 1, 0.9-kb
NotI-EcoRI fragment from the 3' end of clone 647;
2, 0.5-kb NcoI-BamHI fragment from the 3' end of
clone 646; 3, a 0.8-kb BamHI-KpnI fragment from
the 5' end of clone 1229; 4, 0.9-kb KpnI-Stu
fragment from 1229; 5, 1-kb EcoRV-BamHI fragment
from the 3' end of clone 1231; 6, 0.6-kb
Xho-BamHI fragment from the 3' end of 1230; and
7, 0.6-kb BssHII fragment including CD8
exon II.
Fragments 1, 2, 3, 5, and 6 were used to probe DNA restriction digested
with BamHI, fragment 4 with Kpn-digested DNA, and
fragment 7 with BglII-digested DNA. Fragment 6 was also used
to probe DNA double digested with Xho and
SphI.
MAR assays
Nuclei from the human T cell line JM
(CD4+CD8
+
-)
were obtained by hypotonic lysis and purified by centrifugation through
a cushion of 2 M sucrose. Nuclear matrices were isolated in the
continuous presence of 250 µM PMSF and 10 µg/ml leupeptin, as
described previously (33, 34). Briefly, isolated nuclei
were digested with 100 µg/ml DNase I in 10 mM NaCl, 3 mM
MgCl2, 10 mM Tris (pH 7.4), 0.25 mM sucrose, and
1 mM CaCl2 for 1 h at room temperature, and
nonmatrix proteins were extracted with 2 M NaCl. Nuclear matrix binding
was determined in an in vitro DNA-binding assay (34).
Briefly, plasmids were restriction digested and the fragments were
end-labeled with [
-32P]ATP. After
preincubation of nuclear matrices at room temperature with 100 or 200
µg of unlabeled Escherichia coli DNA as a nonspecific
competitor, labeled plasmid fragments were added and the incubation was
continued for 2 h. Insoluble matrix proteins were pelleted and
washed to remove unbound DNA, treated with proteinase K, and the
remaining DNA was electrophoresed on agarose gels. Gels were dried on
Whatman 3 MM paper (Whatman, Clifton, NJ) and exposed to X-OMAT AR
film. A 6-kb HindIII fragment from the p34 region upstream
of ZNF 127, which contains strong MARs on 2.7- and 3.3-kb fragments
generated by BamHI digestion (35, 36), was used
as a positive control in these assays. The vector DNA from which the
test fragments were excised served as an internal negative control. To
show the relative intensities and sizes of the input radiolabeled probe
fragments, 5% of the total radioactivity added to each MAR-binding
assay (the probe) was electrophoresed beside 50% of the bound
fragments. The intensities of the insert (Ii) and plasmid bands (Ip)
within each assay were quantified by densitometry using the NIH Image
program (rsb.info.nih.gov/nih-image). Adjusted relative binding ratios
were calculated according to the following equation (37):
(Iibound/Ipbound) x
(Ipprobe/Iiprobe).
Sequence analysis
Base composition (Percent A + T) plots were produced using the
MacVector software program (Accelrys, Princeton, NJ) with a
window size of 50 nt. Maps of MAR-binding motifs were created by
entering the specific motifs (38) into an enzyme
filter in the MapDraw program (version 4.0) of Lasergene software
(DNAstar, Madison, WI). Repetitive content in each sequence was
identified using the RepeatMasker database
(http://ftp.genome.washington.edu/cgi-bin/RepeatMasker/). Free
energy values were calculated with the nearest-neighbor algorithm
program Web-Thermodyn
(http://wings.buffalo.edu/gsa/dna/dk/WEBTHERMODYN/index.html) using
the programs default values. We have previously found that the
presence of free energy values of <90 in four or more successive
windows was a specific indicator of in vitro MARs at the
and
globin and imprinted loci (J. M. Greally, unpublished data). The
several sequences fitting this criterion are indicated as low free
energy (LFE) regions in Fig. 4
.
|
The SATB1 gel shift assay was performed as described previously (39), using recombinant SATB1, a GST fusion protein consisting of aa 346763 of human SATB1 (GST-SATB1). This protein contains both the MAR-binding domain and homeodomain. To estimate the Kd values for SATB1-binding sites, gel shift assays were run using 0.5 ng of DNA probe and increasing concentrations of SATB1. The dried gels were exposed to a phosphor imager screen, and the amounts of remaining free probe in each lane were quantitated. The Kd values were determined by calculating the concentration of SATB1 required to shift 50% of the probe DNA.
The GATA-3 gel shift assays were performed essentially as described
previously (27). The binding reactions contained 10 mM
HEPES (pH 7.9), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 1 mM
MgCl2, 10% glycerol, 50 µg/ml
poly(dI)-poly(dC), 200 µg/ml BSA, 1x protease inhibitor mixture
(catalogue no. 1836170; Roche, Mannheim, Germany), and nuclear
extract prepared from Jurkat cells stimulated for 8 h with 1 mM
Bt2 cAMP and 25 ng/ml PMA. Abs used for the supershifts were
anti-GATA-3 (Santa Cruz Biotechnology, Santa Cruz, CA) and an
isotype control, anti-human CD8
(Immunotech, Westbrook, ME). The
top strand sequences of the oligonucleotides used in the GATA-3 EMSAs
are shown below. The number in parentheses indicates the location in
plasmid 1231 for oligonucleotides 13 and in plasmid 1230 for
oligonucleotides 47. Bold sequences highlight the putative GATA-3
motif, and underlined sequences indicate that the motif is on the
complimentary strand: 1, atctccatcagatctcttgggtg (3858); 2a,
ctctctccatatcagcaataag (541); 2b,
tcgttttcttatcattcatgtg (4569); 3,
tgcataccctatcttgaaatttgtgggt(5844); 4,
ttgaaaagagatctaaaattga (2909;, 5,
caaaaattagatcaagtagataaaattta (5013); 6,
aaaatttgttatcaccttttaa (5262); and
7,tattatgcagatatcagataagattcatgaag
(5400) contains three GATA-3 motifs. The sequence of the IL-5 promoter
GATA-3-positive control oligonucleotide is
cctctatctgattgttagca
(27).
The GenBank accession number for the 19-kb nucleotide sequence from the 3' end of the human CD8B gene is AY032722.
| Results |
|---|
|
|
|---|
We had previously identified a tissue-specific DNase HS cluster
upstream of the human CD8B gene (HS I) (7) and
another in the last intron of the CD8A gene (HS VI)
(40). The entire human CD8 gene complex was
subcloned to facilitate a comprehensive mapping of DNase HS sites (Fig. 1
). We determined that these clones
contain the whole CD8 gene complex, except for a small
region between clones 1231 and 1230 containing CD8
exon IX, which we
obtained by PCR. Cell lines used in this work were HPB.ALL, which are a
CD4+CD8
+CD8
+
thymoma cell line, and UC cells, a B cell line, as a control for tissue
specificity. In the present work, we identified four additional DNase
HS clusters in the human CD8 loci, making a total of six HS
clusters (Fig. 1
).
The data for DNase HS cluster III, located between CD8
exons VIII
and IX, are shown in Fig. 2
A.
Of the seven bands marked, those at 3.7 and 3.4 kb appeared to be
specific for HPB.ALL cells. The 5.6- and 4.5-kb bands can be seen in
the UC cells in Fig. 2
A, and bands appearing to correspond
to the 3-, 2.4-, and 1.3-kb bands were seen in other blots made from UC
cells treated with 25 U/ml DNase (data not shown).
|
There are several DNase HS sites within cluster II (Fig. 1
and data not
shown). Sites which map to 1.5, 1.1, and 1.0 kb from the 3' end of
clone 646 appear to be tissue specific, in that they were not seen in
UC cells, whereas sites at 3.2 and 3.5 kb from the 3' end of 646 were
also seen in UC cells. Cluster II contains additional sites, which map
to 3.5, 3.0, 1.7, 1.6, 1.3, and 1.1 kb from the 5' end of 1229. Of
these, only the 3.5-kb band appeared to be specific for HPB.ALL
cells.
In summary, we identified four new DNase HS clusters in the human
CD8 gene complex. These are DNase HS cluster II (HS II),
located just downstream of CD8
exon VII, HS III, between CD8
exons VIII and IX, and HS IV and V, in the intergenic region, 35 and
811 kb downstream of CD8
exon IX, respectively. We also observed
four weak but tissue-specific DNase HS sites 00.8 kb upstream of the
first exons of both CD8A and CD8B, in the promoter regions (Fig. 1
and
data not shown).
MAR assays
An in vitro MAR-binding assay was used to map the MARs in the
CD8 loci. Over the whole region, there were four strong MARs
and several weaker MARs. In plasmid 1235-4, located 1317 kb
upstream of the CD8B gene, there is a strong MAR in the 5'
2-kb fragment and, in addition, at least one weaker MAR (Fig. 3
A). Since the 0.9- and 1.6-kb
fragments are juxtaposed, it is possible that there is only one MAR
split between them. Another strong MAR, located between CD8B exons VIII
and IX in fragment 1231, is shown in Fig. 3
B. This strong
MAR is closely linked to the tissue-specific DNase HS sites in cluster
III (Fig. 4
A). There is also a
weaker MAR at the 5' end of clone 1231. The data for clone 1230, shown
in Fig. 3
C, indicate a cluster of MARs in the center of
plasmid 1230, with two strong MARs flanking a weaker one. Two of the
three tissue-specific DNase HS sites of cluster IV are located within
the weak MAR and the third is within the strong MAR on the 3' end of
1230 (Fig. 4
B). We found six additional weaker MARs in the
CD8 complex (data not shown). Thus, distributed over the CD8
gene complex were 4 strong MARs and 10 weaker MARs, as indicated in
Fig. 1
.
|
Given that MARs are generally AT-rich sequences, we considered whether this frequency of MARs could be attributed to the human CD8 genes possibly being located in an AT-rich isochore, as was the case for the 15q11-13 imprinting center (35). We determined the isochore type to which the CD8 genes belonged by manually scanning the third base of each codon in the coding regions for guanine cytosine (GC) content (percent GC3). CD8A and B genes were grouped into their corresponding isochores based on the following criteria: L1 + L2, GC poor (GC3 < 57%), H1 + H2, GC high (57% < GC3 < 75%), and H3, GC rich (GC3 > 75%) (41, 42). The GC3 content of the CD8A and B genes were 71 and 84%, placing them well into the GC high and GC-rich isochores, respectively (data not shown). This indicates that the frequency of MARs we observe is not simply due to location of the CD8 genes in an AT-rich isochore.
Since clones 1231 and 1230 contain strong MARs closely linked to
tissue-specific DNase HS sites, we considered them likely candidates
for containing regulatory elements. Therefore, we sequenced the 19 kb
spanned by the plasmid 1231, plasmid 1230, the PCR product between 1231
and 1230, and 4 kb from the 5' end of 1264. We located the CD8
exons
VIII and IX within this region as shown in Fig. 1
.
The sequence of a typical MAR is
65% AT rich (43) and
contains a region of 150200 bp that has a high potential for base
unpairing (44, 45, 46). A Thermodyn analysis of the 19-kb
sequence predicted seven potential LFE regions (Fig. 4
). Only one of
the seven LFE regions did not localize to the biochemically
determined MARs.
A mapping of repetitive elements in clones 1231 and 1230 is shown in
Fig. 4
. There were eight whole or partial Alu elements. Interestingly,
five of the six long interspersed nuclear elements were within
fragments that bound to the nuclear matrix. The strong MAR in 1231
overlapped on its 5' end with a Tigger 1 element, an interspersed
repeat that resembles DNA transposons, which move by excision and
reintegration into the genome without a RNA intermediate.
Several sequence motifs have been associated with MARs (17, 37, 44, 47, 48, 49). We mapped ATATTT and vertebrate topoisomerase sites
and found that there was some clustering in the biochemically defined
MARs, but this clustering was not absolute, particularly for the
topoisomerase (Fig. 4
, A and B). In addition, we
analyzed the sequence for potential SATB1-binding sequences. SATB1 is
an interesting MAR-binding protein in that it does not recognize a DNA
sequence but rather it is believed to recognize ATC sequences
indirectly by the altered sugar-phosphate backbone determined by the
ATC sequence context (50). The ATC sequence defined by one
strand consists of exclusively As, Ts and Cs, excluding Gs, and at
least 65% AT content. When the ATC stretches are clustered, it
potentially confers high base unpairing propensity (44).
With only one exception, the long ATC sequence stretches within our
19-kb sequence were confined to regions containing MARs (Fig. 4
).
SATB1 binding
To test for SATB1 binding to the potential ATC sequence stretches,
we performed EMSAs using recombinant GST-SATB1. Ten fragments, ranging
in size from 190 to 580 bp, and a control fragment were tested. Two
fragments from the regions with strong matrix binding activity were
found to bind purified SATB1. One fragment, from plasmid 1231, showed
very strong binding (Fig. 5
B)
with a Kd of 0.040.15 nM. A fragment
from plasmid 1230, bound SATB1 more weakly with a
Kd of 1.62 nM (data not shown).
Locations of these SATB1 binding sites are mapped in Fig. 4
. For
comparison, the Kd values were 0.31
nM for in vitro SATB1 binding to six other MAR probes, including
fragments from the IgH and
globin MARs, (51) and
ranged from 1 to 29 nM for 16 SATB1-binding sequences identified using
chromatin immunoprecipitation studies with anti-SATB1 Ab and T cell
nuclear extracts (39).
|
GATA-3 binding
Another transcription factor that is potentially important for
CD8A gene expression is GATA-3. We therefore analyzed the
19-kb region for putative GATA-3 sites using either the motif GATA or
GATC with appropriate 5' and 3' bases according to Ko and Engel
(53). We tested eight oligonucleotides for GATA-3 binding
by EMSA analysis. We focused on oligonucleotide 5 with two tandem
GATA-3 binding sites separated by 3 bases, that was located at a
tissue-specific HS site. This oligonucleotide gave a band that was
shifted with an anti-GATA-3 Ab. A mutated oligonucleotide with the
AGATCA site mutation, M1, was able to compete fairly well
as compared with the wild-type oligonucleotide (Fig. 6
A), indicating that the M1
site was not as critical for GATA-3 binding as the AGATAA
site which when mutated (M2 mutant) could not compete. To test the
other oligonucleotides, we performed cold competition studies (Fig. 6
B). Oligonucleotide 7, with three potential GATA-3 sites,
competed strongly and the others to a lesser extent. The IL-5 promoter
oligonucleotide, which contains a known double binding site for GATA-3,
competed for binding less well than did oligonucleotide 5. This may
have to do with the arrangement of the two GATA-3 sites in both
oligonucleotides. In contrast to the tandem GATA-3 sites in
oligonucleotide 5, the two GATA-3 sites in the IL-5 oligonucleotide
overlap and are on opposite strands. Interestingly, oligonucleotide 7
is located 400 kb 3' of oligonucleotide 5 within the same MAR. This
oligonucleotide, as well as oligonucleotides 2a, 2b, and 3 showed
supershifts with the anti-GATA-3 Ab (data not shown).
|
| Discussion |
|---|
|
|
|---|
enhancer (54). Also, MARs flank both the IgH
(55) and the TCR
(56) enhancers.
Therefore, identifying regions of the human CD8 loci that
contain HS sites near MARs seemed a logical approach to more rapidly
identify strong candidates for regulatory elements.
By mapping DNase I HS sites and MARs in the human CD8 gene
complex, we found two regions at the 3' end of the CD8B gene
in which both HS sites and strong MARs were colocalized. The
tissue-specific DNase I HS cluster III, located between the last two
CD8
exons, was adjacent to a strong MAR. Another tissue-specific HS
cluster, IV, located 3' of the last exon, was flanked by strong MARs.
Further support for the potential importance of these regions in
CD8 gene expression is the presence of a very strong SATB1
binding site in the MAR linked to HS cluster III and another site in
the 5' MAR linked to HS cluster IV. Although we have discussed these
regions separately, they encompass an 11-kb region that may actually
function as a locus control region-like regulatory unit.
Positive functional effects by MARs on enhancer activity have been
observed (56, 57, 58, 59, 60). Studies have shown that MARs are
required for demethylation of the Ig
locus (61, 62) and
generation of long-range accessibility of chromatin in the Igµ locus
(15, 63). An elegant study by Forrester et al.
(16) demonstrated that MARs could facilitate long-range
chromatin remodeling. They studied the Igµ enhancer, which is flanked
by MARs, for its ability to activate the VH
promoter over a distance of 150 bp or 1.2 kb upstream of a methylated
or demethylated gene in stable transfectants of B cell lines. They
found that the enhancer alone induced local chromatin remodeling,
giving rise to a DNase I HS site and local demethylation, which was
sufficient to activate transcription when theenhancer was 150 bp
from the promoter. However, for enhancer-mediated promoter activation
over a distance, both MARs were required for methylated µ gene
expression. The MARs in combination with the µ enhancer could induce
acetylation of histones at a distal position. This may explain why the
µ MARs were found to predominantly function in germline transmission
but not in transient transfection assays where chromatin remodeling
does not need to occur (60). Because the
HS sites linked to the strong MARs that we have identified are located
at least 20 kb from either CD8 promoter, it is possible that the MARs
associated with these putative enhancers could promote a similar
long-range interaction.
The higher order chromatin structure that may be required for tissue-specific expression of the CD8 genes may in part be regulated by the presence of SATB1. SATB1-binding sequences isolated from a T cell line were localized to the nuclear matrix at the base of chromatin loops in vivo (39). However, in a breast cancer cell line, in which SATB1 is absent, this was not the case for at least one of these SATB1-binding sequences, indicating that in vivo, anchoring of certain MARs onto the nuclear matrix is cell type specific. The hypothesis was put forth that SATB1 binding to the base of chromatin loops in vivo would create a specific chromatin loop domain structure that was involved in T cell-specific gene regulation. The SATB1-binding MARs in the CD8 region may likewise form a chromatin loop structure that is tissue specific. The very high-affinity SATB1 binding site in the strong MAR located in the last intron of the CD8B gene and the other site in the strong MAR located 4.5 kb downstream could lead to the formation of a loop domain that might facilitate CD8 gene expression, possibly through long-range histone acetylation of the CD8 gene. Because of the differences in affinity for SATB1 between the two sites, the formation of specific loop structures may vary depending on the concentration of SATB1.
The other protein that we found to bind to the candidate regulatory region, GATA-3, is also likely to affect CD8A gene expression. In the mouse a region in the murine HS cluster II located 45 kb upstream of the CD8A gene (32) contains two GATA-3 binding sites which function in in vitro assays. These GATA-3 binding sites are within the murine CD8 gene thymocyte-specific enhancer which also contains a SATB1-binding MAR (64). Interestingly, GATA-3 levels are high in CD4/CD8 thymocytes and then decline as they mature (65). Therefore, GATA-3 may be most important for CD8 expression in the double-positive T cell stage and would bind to the thymocyte-specific enhancer. The strong GATA-3 binding site that we found in the human CD8 tissue-specific HS cluster IV is potentially a functional site in that it has two GATA motifs 3 bp apart; double GATA motifs are often found in functional GATA sites.
Although it would be very informative to be able to compare the
location of HS sites between the two species, exact comparisons are not
possible because the human gene complex has
20 kb more DNA in the
intergenic region (56 kb) compared with the murine region (36 kb), and
the murine CD8B gene lacks exons VIII and IX. Despite this
caveat, some sites may be comparable (Fig. 7
). For instance, the murine HS cluster
IV at the end of the murine CD8B gene corresponds to our
cluster II. In transgenic animal studies, this region contained
regulatory element(s) which directed expression to double-positive
thymocytes and mature CD8+ T cells, but not to
CD8
IEL (9, 12, 13).
|
16 kb upstream of the murine
CD8A gene, contained an enhancer that was specific for
mature CD8+ T cells and CD8
IEL (10, 11). A fragment from murine DNase HS cluster II, just upstream
of the murine CD8A gene, when analyzed alone did not display
enhancer activity, but did direct expression to double-positive
thymocytes when combined with cluster III (9). The
location of human DNase HS clusters III, IV, and V in the intergenic
region may be similar to these murine HS clusters in the intergenic
region (8). The finding that one of the murine clusters
did not function unless linked to another cluster indicates that a
large regulatory unit composed of multiple HS clusters is likely to be
regulating murine CD8A gene expression. To address the functional significance of potential regulatory elements in the human CD8 gene complex, we have continued to test in transgenic animals portions from the 95-kb genomic CD8 fragment that gave tissue-specific expression in transgenic animals. Focusing on the region described in this article, we have linked cluster III plus MAR or clusters IV and V plus MARs to a genomic human CD8A gene marker gene and analyzed for expression in transgenic animals. High level expression in a small percentage of the murine CD8 T cells was noted with both constructs in all transgenic lines (two to five lines per transgene, our unpublished data). However, our failure to obtain expression in most of the murine CD8 T cells may be related to the fact that both regions together may be required for large numbers of cells expressing the transgene. Such studies are currently in progress.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Paula B. Kavathas, 333 Cedar Street, P.O. Box 208035, New Haven, CT 06520-8035. E-mail address: paula.kavathas{at}yale.edu ![]()
3 Abbreviations used in this paper: IEL, intraepithelial lymphocyte; MAR, matrix attachment region; HS, hypersensitive; LFE, low energy free; GC, guanine cytosine. ![]()
Received for publication December 10, 2001. Accepted for publication February 20, 2002.
| References |
|---|
|
|
|---|
, but not mouse CD8
, can be expressed in the absence of CD8
as a 
homodimer. J. Immunol. 164:833.
or 
) and CD3- lymphocytes isolated from normal human gut epithelium display phenotypical features different from their counterparts in peripheral blood. Eur. J. Immunol. 20:1097.[Medline]
in transgenic mice. J. Immunol. 159:4907.[Abstract]
gene expression in subsets of thymocytes and peripheral T cells. Immunity 9:497.[Medline]
at double- and single-positive stages of thymic development. J. Immunol. 161:2254.
promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.
upstream regulatory sequences. J. Exp. Med. 178:941.
immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites. Cell 44:273.[Medline]
gene. Mol. Cell. Biol. 13:7056.
gene enhancer binds Cux/CDP and SATB1 and modulates enhancer-dependent reporter gene expression but not endogenous gene expression. J. Biol. Chem. 273:29838.
enhancer to promote V(D)J recombination. Proc. Natl. Acad. Sci. USA 96:11970.
gene expression after stable integration. I. Role of the intronic MAR and enhancer in plasmacytoma cells. J. Biol. Chem. 264:21183.
transgenes show clonal recruitment of hypermutation: a role for both MAR and the enhancers. EMBO J. 16:3987.[Medline]
gene expression after stable integration. II. Role of the intronic MAR and enhancer in transgenic mice. J. Biol. Chem. 264:21190.
B in B-cell-specific demethylation of the Ig
locus. Nat. Genet. 13:435.[Medline]
chain enhancer sequence. Cell 76:913.[Medline]
gene. J. Biol. Chem. 272:18440.This article has been cited by other articles:
![]() |
H. Nie, S. D. Maika, P. W. Tucker, and P. D. Gottlieb A Role for SATB1, a Nuclear Matrix Association Region-Binding Protein, in the Development of CD8SP Thymocytes and Peripheral T Lymphocytes J. Immunol., April 15, 2005; 174(8): 4745 - 4752. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Roh, S. Cuddapah, and K. Zhao Active chromatin domains are defined by acetylation islands revealed by genome-wide mapping Genes & Dev., March 1, 2005; 19(5): 542 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Martins, G. C. Ostermeier, and S. A. Krawetz Nuclear Matrix Interactions at the Human Protamine Domain: A WORKING MODEL OF POTENTIATION J. Biol. Chem., December 10, 2004; 279(50): 51862 - 51868. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang and D. Kowalski WEB-THERMODYN: sequence analysis software for profiling DNA helical stability Nucleic Acids Res., July 1, 2003; 31(13): 3819 - 3821. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Goebel, A. Montalbano, N. Ayers, E. Kompfner, L. Dickinson, C. F. Webb, and A. J. Feeney High Frequency of Matrix Attachment Regions and Cut-Like Protein x/CCAAT-Displacement Protein and B Cell Regulator of IgH Transcription Binding Sites Flanking Ig V Region Genes J. Immunol., September 1, 2002; 169(5): 2477 - 2487. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||