The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kieffer, L. J.
Right arrow Articles by Kavathas, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kieffer, L. J.
Right arrow Articles by Kavathas, P. B.
The Journal of Immunology, 2002, 168: 3915-3922.
Copyright © 2002 by The American Association of Immunologists

Identification of a Candidate Regulatory Region in the Human CD8 Gene Complex by Colocalization of DNase I Hypersensitive Sites and Matrix Attachment Regions Which Bind SATB1 and GATA-31

Lynda J. Kieffer*, John M. Greally{ddagger}, Inna Landres*, Shanta Nag*, Yuko Nakajima§, Terumi Kohwi-Shigematsu§ and Paula B. Kavathas2,*,{dagger}

* Department of Laboratory Medicine and {dagger} Department of Genetics and Section of Immunobiology, Yale University, New Haven, CT 06520; {ddagger} Department of Medicine, Division of Hematology, Albert Einstein College of Medicine, Bronx, NY 10461; and § Lawrence Berkeley Laboratory, University of California, Berkeley, CA 94720


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To locate elements regulating the human CD8 gene complex, we mapped nuclear matrix attachment regions (MARs) and DNase I hypersensitive (HS) sites over a 100-kb region that included the CD8B gene, the intergenic region, and the CD8A gene. MARs facilitate long-range chromatin remodeling required for enhancer activity and have been found closely linked to several lymphoid enhancers. Within the human CD8 gene complex, we identified six DNase HS clusters, four strong MARs, and several weaker MARs. Three of the strong MARs were closely linked to two tissue-specific DNase HS clusters (III and IV) at the 3' end of the CD8B gene. To further establish the importance of this region, we obtained 19 kb of sequence and screened for potential binding sites for the MAR-binding protein, SATB1, and for GATA-3, both of which are critical for T cell development. By gel shift analysis we identified two strong SATB1 binding sites, located 4.5 kb apart, in strong MARs. We also detected strong GATA-3 binding to an oligonucleotide containing two GATA-3 motifs located at an HS site in cluster IV. This clustering of DNase HS sites and MARs capable of binding SATB1 and GATA-3 at the 3' end of the CD8B gene suggests that this region is an epigenetic regulator of CD8 expression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
As thymocytes progress through development, they undergo induction and repression of a number of cell surface molecules. Changes in the expression of the CD4 and CD8 T cell surface glycoproteins best characterize the stages of ontogeny and ultimately define the two major lineages of mature T cells (CD4+CD8- or CD4-CD8+). Gene knockout studies with CD4 and CD8{alpha} have shown that the entire respective lineage does not develop (1, 2), making it likely that factors that regulate CD4 and CD8 expression also regulate the functional commitment of the cell. Therefore investigating the mechanisms controlling CD4 and CD8 expression should increase our understanding of thymocyte development.

CD8 can be expressed in mice and humans as an {alpha}{alpha} homodimer or an {alpha}{beta} heterodimer. Human CD8{beta} can also be expressed as a {beta}{beta} homodimer in transfected COS cells and transgenic mice (3). The CD8A and B genes, closely linked at a distance of ~36 kb in mice and 56 kb in humans (see Fig. 1Go), are coexpressed on most CD8+ T cells. The close linkage and coexpression of the CD8 genes suggest coordinate regulation. However, regulation is not always coordinated, particularly in cells which seem to be extrathymically derived, as subsets of human NK cells (4) and gut intraepithethelial lymphocytes (IELs)3 (5, 6) express only the CD8{alpha}{alpha} homodimer.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 1. Map of the human CD8A and CD8B gene complex (bottom) with a partial restriction map of the enzymes used to map DNase HS sites (B, BamHI; K, Kpn; X, Xho; Bg, BglII; S, Sph). Subclones used in this work are shown. DNase HS mapping was performed on the 95-kb region flanked by and included within clones 647 and 732. The only regions not covered in this DNase I hypersensitivity mapping survey are the 355-bp PCR product generated from the region between clones 1231 and 1230 and a 2-kb fragment on the 3' end of plasmid 647. Locations of the DNase HS sites are shown, the tissue-specific sites with an arrow. Probes used to identify HS sites are indicated. MAR mapping was performed on the 102-kb region flanked by and included within clones 1235-4 and 732 with the exception of the 355-bp PCR product, which was not AT rich. The locations of the MARs are identified, with strong MARs shown as {blacksquare}, weak MARs with .

 
Toward identifying cis-acting transcriptional regulatory elements in the CD8 loci, large fragments of genomic DNA have been used to make transgenic mice. A 95-kb human genomic fragment beginning ~25 kb upstream of the CD8B gene and containing the entire CD8B gene afforded developmentally correct expression on thymus-derived T cells in transgenic mice, indicating that CD8 lineage-specific regulatory sequences must be located within that fragment (7). Likewise, an 80-kb murine genomic fragment from 2 kb upstream of the CD8B gene to 25 kb downstream of the CD8A gene allowed appropriate expression in transgenic mice (8). The 80-kb murine genomic fragment contained four clusters of DNase hypersensitive (HS) sites (9) which were analyzed for enhancer activity in transgenic mice. One cluster at the 3' end of the CD8B gene and two in the intergenic region had enhancer activity. The results indicate that there are separate elements for CD8 expression in the thymus vs the periphery, and possibly also for CD8{alpha} vs CD8{beta} (9, 10, 11, 12, 13).

To locate regulatory regions within the human CD8 gene complex, we mapped the DNase HS sites which often colocalize with cis-acting transcriptional regulators. In addition, since many lymphoid gene enhancers are closely linked to matrix association regions (MARs) (14), we also undertook the mapping of MARs in the human CD8A and B loci. MARs, interspersed in genomes on the average of 50–100 kb, have been identified as specialized genomic sequences that tightly associate with the nuclear matrix, a RNA and protein containing fraction that remains after high salt extraction and DNase I treatment. MARs serve to anchor chromatin loops to the nuclear matrix and have been shown to facilitate long-range chromatin remodeling and accessibility (15, 16). We identified several MARs spanning the human CD8 loci. Interestingly, three strong MARs are closely linked to DNase HS clusters III and IV, located at the 3' end of the CD8B gene, making this region a prime candidate for an element regulating CD8 gene expression.

To further establish the significance of this region, we analyzed the candidate regulatory region for binding of SATB1, a tissue-specific MAR-binding protein (17). Studies of SATB1 knockout animals showed that SATB1, expressed primarily in thymocytes, regulates temporal and spatial expression of multiple genes during T cell development, and is required for maturation of CD4+ and CD8+ T cells (18). Within the MARs associated with the human CD8 DNase HS clusters III and IV, we found two fragments that bound SATB1 with high affinity in an EMSA.

Further analysis of the sequence in the region of HS clusters III and IV revealed several potential binding sites for GATA-3, a transcription factor widely expressed in embryonic tissues, but whose expression is mainly limited in adult animals to T cells and NK cells (19, 20, 21). Targeted deletion of GATA-3 was embryonically lethal (22), but using Rag complementation, it was determined that GATA-3 is required for development of the earliest T cell progenitors (23). GATA-3 binding sites have been reported in several T cell-specific genes (24, 25, 26, 27, 28, 29, 30, 31), including the murine CD8 promoter/enhancer (32). In the present study, EMSA analysis revealed that an oligonucleotide with a double GATA-3 binding site, corresponding to the cluster IV HS site located in a strong MAR, binds GATA-3 strongly, while others in the HS cluster III and IV region also bind. Colocalization of GATA-3 binding sites, SATB1 binding sites, MARs, and DNase HS clusters suggests this region is a candidate regulator of human CD8 expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell lines

All cell lines were grown in RPMI 1640 medium supplemented with 2 mM L-glutamine, 100 U of penicillin/ml, 100 µg of streptomycin/ml, and 10% FCS. Cell lines used included the EBV-transformed B cell line UC and the human T cell lines HPB.ALL (CD4+CD8{alpha}+{beta}+), JM (CD4+CD8{alpha}-{beta}-), and Jurkat (CD4+CD8-). Cells were cultured at 37°C in a water-saturated atmosphere of 5% CO2.

DNase I hypersensitivity mapping

DNase I hypersensitivity mapping was performed as described previously (7). Briefly, DNA purified from DNase-treated nuclei was restriction digested and used to prepare Southern blots which were probed with the following fragments (see Fig. 1Go): 1, 0.9-kb NotI-EcoRI fragment from the 3' end of clone 647; 2, 0.5-kb NcoI-BamHI fragment from the 3' end of clone 646; 3, a 0.8-kb BamHI-KpnI fragment from the 5' end of clone 1229; 4, 0.9-kb KpnI-Stu fragment from 1229; 5, 1-kb EcoRV-BamHI fragment from the 3' end of clone 1231; 6, 0.6-kb Xho-BamHI fragment from the 3' end of 1230; and 7, 0.6-kb BssHII fragment including CD8{alpha} exon II. Fragments 1, 2, 3, 5, and 6 were used to probe DNA restriction digested with BamHI, fragment 4 with Kpn-digested DNA, and fragment 7 with BglII-digested DNA. Fragment 6 was also used to probe DNA double digested with Xho and SphI.

MAR assays

Nuclei from the human T cell line JM (CD4+CD8{alpha}+{beta}-) were obtained by hypotonic lysis and purified by centrifugation through a cushion of 2 M sucrose. Nuclear matrices were isolated in the continuous presence of 250 µM PMSF and 10 µg/ml leupeptin, as described previously (33, 34). Briefly, isolated nuclei were digested with 100 µg/ml DNase I in 10 mM NaCl, 3 mM MgCl2, 10 mM Tris (pH 7.4), 0.25 mM sucrose, and 1 mM CaCl2 for 1 h at room temperature, and nonmatrix proteins were extracted with 2 M NaCl. Nuclear matrix binding was determined in an in vitro DNA-binding assay (34). Briefly, plasmids were restriction digested and the fragments were end-labeled with [{gamma}-32P]ATP. After preincubation of nuclear matrices at room temperature with 100 or 200 µg of unlabeled Escherichia coli DNA as a nonspecific competitor, labeled plasmid fragments were added and the incubation was continued for 2 h. Insoluble matrix proteins were pelleted and washed to remove unbound DNA, treated with proteinase K, and the remaining DNA was electrophoresed on agarose gels. Gels were dried on Whatman 3 MM paper (Whatman, Clifton, NJ) and exposed to X-OMAT AR film. A 6-kb HindIII fragment from the p34 region upstream of ZNF 127, which contains strong MARs on 2.7- and 3.3-kb fragments generated by BamHI digestion (35, 36), was used as a positive control in these assays. The vector DNA from which the test fragments were excised served as an internal negative control. To show the relative intensities and sizes of the input radiolabeled probe fragments, 5% of the total radioactivity added to each MAR-binding assay (the probe) was electrophoresed beside 50% of the bound fragments. The intensities of the insert (Ii) and plasmid bands (Ip) within each assay were quantified by densitometry using the NIH Image program (rsb.info.nih.gov/nih-image). Adjusted relative binding ratios were calculated according to the following equation (37): (Iibound/Ipbound) x (Ipprobe/Iiprobe).

Sequence analysis

Base composition (Percent A + T) plots were produced using the MacVector software program (Accelrys, Princeton, NJ) with a window size of 50 nt. Maps of MAR-binding motifs were created by entering the specific motifs (38) into an enzyme filter in the MapDraw program (version 4.0) of Lasergene software (DNAstar, Madison, WI). Repetitive content in each sequence was identified using the RepeatMasker database (http://ftp.genome.washington.edu/cgi-bin/RepeatMasker/). Free energy values were calculated with the nearest-neighbor algorithm program Web-Thermodyn (http://wings.buffalo.edu/gsa/dna/dk/WEBTHERMODYN/index.html) using the program’s default values. We have previously found that the presence of free energy values of <90 in four or more successive windows was a specific indicator of in vitro MARs at the {alpha} and {beta} globin and imprinted loci (J. M. Greally, unpublished data). The several sequences fitting this criterion are indicated as low free energy (LFE) regions in Fig. 4Go.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 4. Sequence analysis of clones 1231 (A) and 1230 (B). The top of this figure shows the locations of the MARs as determined in Fig. 3Go. Dark and light shading indicate strong and weaker MARs, respectively. Locations of DNase HS sites, as determined in Fig. 2Go, are shown. Sites indicated with arrows are tissue specific. Those without arrows are not tissue specific. The (A + T) content is indicated and the locations of consensus MAR motifs are shown below. Sequences tested for SATB1 binding met the following criteria: a stretch of A/T/C30 or greater, well mixed, with AT content at least 65%, and second stretch of A/T/C20 or greater, with the two stretches not >35 bp apart. In addition, several longer single stretches of at least A/T/C35 were also tested since these may contain a weak binding site. Also shown are possible base unpairing regions, with predicted LFE, as determined by Thermodyn analysis (see Materials and Methods). This is followed by specific repetitive elements. B, The interruption of a line element with a very GC-rich insertion is shown with a vertical black oval.

 
EMSAs

The SATB1 gel shift assay was performed as described previously (39), using recombinant SATB1, a GST fusion protein consisting of aa 346–763 of human SATB1 (GST-SATB1). This protein contains both the MAR-binding domain and homeodomain. To estimate the Kd values for SATB1-binding sites, gel shift assays were run using 0.5 ng of DNA probe and increasing concentrations of SATB1. The dried gels were exposed to a phosphor imager screen, and the amounts of remaining free probe in each lane were quantitated. The Kd values were determined by calculating the concentration of SATB1 required to shift 50% of the probe DNA.

The GATA-3 gel shift assays were performed essentially as described previously (27). The binding reactions contained 10 mM HEPES (pH 7.9), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 1 mM MgCl2, 10% glycerol, 50 µg/ml poly(dI)-poly(dC), 200 µg/ml BSA, 1x protease inhibitor mixture (catalogue no. 1836170; Roche, Mannheim, Germany), and nuclear extract prepared from Jurkat cells stimulated for 8 h with 1 mM Bt2 cAMP and 25 ng/ml PMA. Abs used for the supershifts were anti-GATA-3 (Santa Cruz Biotechnology, Santa Cruz, CA) and an isotype control, anti-human CD8{beta} (Immunotech, Westbrook, ME). The top strand sequences of the oligonucleotides used in the GATA-3 EMSAs are shown below. The number in parentheses indicates the location in plasmid 1231 for oligonucleotides 1–3 and in plasmid 1230 for oligonucleotides 4–7. Bold sequences highlight the putative GATA-3 motif, and underlined sequences indicate that the motif is on the complimentary strand: 1, atctccatcagatctcttgggtg (3858); 2a, ctctctccatatcagcaataag (541); 2b, tcgttttcttatcattcatgtg (4569); 3, tgcataccctatcttgaaatttgtgggt(5844); 4, ttgaaaagagatctaaaattga (2909;, 5, caaaaattagatcaagtagataaaattta (5013); 6, aaaatttgttatcaccttttaa (5262); and 7,tattatgcagatatcagataagattcatgaag (5400) contains three GATA-3 motifs. The sequence of the IL-5 promoter GATA-3-positive control oligonucleotide is cctctatctgattgttagca (27).

The GenBank accession number for the 19-kb nucleotide sequence from the 3' end of the human CD8B gene is AY032722.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
DNase hypersensitivity mapping

We had previously identified a tissue-specific DNase HS cluster upstream of the human CD8B gene (HS I) (7) and another in the last intron of the CD8A gene (HS VI) (40). The entire human CD8 gene complex was subcloned to facilitate a comprehensive mapping of DNase HS sites (Fig. 1Go). We determined that these clones contain the whole CD8 gene complex, except for a small region between clones 1231 and 1230 containing CD8{beta} exon IX, which we obtained by PCR. Cell lines used in this work were HPB.ALL, which are a CD4+CD8{alpha}+CD8{beta}+ thymoma cell line, and UC cells, a B cell line, as a control for tissue specificity. In the present work, we identified four additional DNase HS clusters in the human CD8 loci, making a total of six HS clusters (Fig. 1Go).

The data for DNase HS cluster III, located between CD8{beta} exons VIII and IX, are shown in Fig. 2GoA. Of the seven bands marked, those at 3.7 and 3.4 kb appeared to be specific for HPB.ALL cells. The 5.6- and 4.5-kb bands can be seen in the UC cells in Fig. 2GoA, and bands appearing to correspond to the 3-, 2.4-, and 1.3-kb bands were seen in other blots made from UC cells treated with 25 U/ml DNase (data not shown).



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 2. DNase I hypersensitivity mapping of the region contained in clone 1231 (A) and clone 1230 (B). Nuclei from the human cell lines HPB.All or UC were either untreated or treated with increasing concentrations of DNase I before isolation of genomic DNA. DNase concentrations in units per milliliter are indicated at the top of each lane. The isolated DNA was cut with the restriction endonuclease BamHI and Southern blot analysis performed using a 32P-labeled probe isolated from the 3' end of clone 1231 (A) or 1230 (B) (see Fig. 1Go). The locations of the HS sites are indicated to the right of each gel, and represent distance in kilobases from the probe. Bands marked with arrows are those which appear to be tissue specific.

 
The data for DNase HS cluster IV and part of cluster V are shown in Fig. 2GoB. Of the bands seen, those at 4.7, 3.8, and 2.9 kb appeared to be specific for HPB.ALL cells, since those at 0.7, 0.5, and 0.4 were also seen in UC cells. These latter three small bands at the 3' end of 1230 have been placed in cluster V in Fig. 1Go because they are closer to the other sites in cluster V than they are to the three tissue-specific DNase HS sites in cluster IV. There are several more weak DNase HS sites within cluster V, seen at 1.3, 1.0, 0.8, 0.5, 0.3, 0.25, and 0.1 kb from the 5' end of 1264 (data not shown). These bands, although weak, appear to be tissue specific.

There are several DNase HS sites within cluster II (Fig. 1Go and data not shown). Sites which map to 1.5, 1.1, and 1.0 kb from the 3' end of clone 646 appear to be tissue specific, in that they were not seen in UC cells, whereas sites at 3.2 and 3.5 kb from the 3' end of 646 were also seen in UC cells. Cluster II contains additional sites, which map to 3.5, 3.0, 1.7, 1.6, 1.3, and 1.1 kb from the 5' end of 1229. Of these, only the 3.5-kb band appeared to be specific for HPB.ALL cells.

In summary, we identified four new DNase HS clusters in the human CD8 gene complex. These are DNase HS cluster II (HS II), located just downstream of CD8{beta} exon VII, HS III, between CD8{beta} exons VIII and IX, and HS IV and V, in the intergenic region, 3–5 and 8–11 kb downstream of CD8{beta} exon IX, respectively. We also observed four weak but tissue-specific DNase HS sites 0–0.8 kb upstream of the first exons of both CD8A and CD8B, in the promoter regions (Fig. 1Go and data not shown).

MAR assays

An in vitro MAR-binding assay was used to map the MARs in the CD8 loci. Over the whole region, there were four strong MARs and several weaker MARs. In plasmid 1235-4, located 13–17 kb upstream of the CD8B gene, there is a strong MAR in the 5' 2-kb fragment and, in addition, at least one weaker MAR (Fig. 3GoA). Since the 0.9- and 1.6-kb fragments are juxtaposed, it is possible that there is only one MAR split between them. Another strong MAR, located between CD8B exons VIII and IX in fragment 1231, is shown in Fig. 3GoB. This strong MAR is closely linked to the tissue-specific DNase HS sites in cluster III (Fig. 4GoA). There is also a weaker MAR at the 5' end of clone 1231. The data for clone 1230, shown in Fig. 3GoC, indicate a cluster of MARs in the center of plasmid 1230, with two strong MARs flanking a weaker one. Two of the three tissue-specific DNase HS sites of cluster IV are located within the weak MAR and the third is within the strong MAR on the 3' end of 1230 (Fig. 4GoB). We found six additional weaker MARs in the CD8 complex (data not shown). Thus, distributed over the CD8 gene complex were 4 strong MARs and 10 weaker MARs, as indicated in Fig. 1Go.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 3. Nuclear matrix binding assays (MAR assays) using as probes restriction-digested plasmids 1235-4 (A), 1231 and 1313 (B), and 1230 and 508 (C). Locations of these plasmids within the CD8 complex are shown in Fig. 1Go. The three lanes in each assay represent, from left to right, unbound end-labeled probe, and the fraction that bound to the probe in the presence of 100 or 200 µg/ml competitor E. coli DNA. Band sizes are indicated to the right of each gel. P, plasmid band. Below the gels are restriction maps showing the fragments, generated by each set of restriction enzymes, that were tested for MAR activity. The relative binding ratios (RBR) of the fragments within each assay are indicated beneath the restriction maps. Quantitation of some bands was not possible if they were not well resolved from other bands on the gel. Strong and weaker MARs are indicated in these maps by dark and light shading, respectively. B and C, A compilation of the locations of the MARs is shown at the bottom. C, An additional analysis using BamHI/BglI-digested plasmid 1230 as probe is not shown.

 
Sequence analysis

Given that MARs are generally AT-rich sequences, we considered whether this frequency of MARs could be attributed to the human CD8 genes possibly being located in an AT-rich isochore, as was the case for the 15q11-13 imprinting center (35). We determined the isochore type to which the CD8 genes belonged by manually scanning the third base of each codon in the coding regions for guanine cytosine (GC) content (percent GC3). CD8A and B genes were grouped into their corresponding isochores based on the following criteria: L1 + L2, GC poor (GC3 < 57%), H1 + H2, GC high (57% < GC3 < 75%), and H3, GC rich (GC3 > 75%) (41, 42). The GC3 content of the CD8A and B genes were 71 and 84%, placing them well into the GC high and GC-rich isochores, respectively (data not shown). This indicates that the frequency of MARs we observe is not simply due to location of the CD8 genes in an AT-rich isochore.

Since clones 1231 and 1230 contain strong MARs closely linked to tissue-specific DNase HS sites, we considered them likely candidates for containing regulatory elements. Therefore, we sequenced the 19 kb spanned by the plasmid 1231, plasmid 1230, the PCR product between 1231 and 1230, and 4 kb from the 5' end of 1264. We located the CD8{beta} exons VIII and IX within this region as shown in Fig. 1Go.

The sequence of a typical MAR is ~65% AT rich (43) and contains a region of 150–200 bp that has a high potential for base unpairing (44, 45, 46). A Thermodyn analysis of the 19-kb sequence predicted seven potential LFE regions (Fig. 4Go). Only one of the seven LFE regions did not localize to the biochemically determined MARs.

A mapping of repetitive elements in clones 1231 and 1230 is shown in Fig. 4Go. There were eight whole or partial Alu elements. Interestingly, five of the six long interspersed nuclear elements were within fragments that bound to the nuclear matrix. The strong MAR in 1231 overlapped on its 5' end with a Tigger 1 element, an interspersed repeat that resembles DNA transposons, which move by excision and reintegration into the genome without a RNA intermediate.

Several sequence motifs have been associated with MARs (17, 37, 44, 47, 48, 49). We mapped ATATTT and vertebrate topoisomerase sites and found that there was some clustering in the biochemically defined MARs, but this clustering was not absolute, particularly for the topoisomerase (Fig. 4Go, A and B). In addition, we analyzed the sequence for potential SATB1-binding sequences. SATB1 is an interesting MAR-binding protein in that it does not recognize a DNA sequence but rather it is believed to recognize ATC sequences indirectly by the altered sugar-phosphate backbone determined by the ATC sequence context (50). The ATC sequence defined by one strand consists of exclusively As, Ts and Cs, excluding Gs, and at least 65% AT content. When the ATC stretches are clustered, it potentially confers high base unpairing propensity (44). With only one exception, the long ATC sequence stretches within our 19-kb sequence were confined to regions containing MARs (Fig. 4Go).

SATB1 binding

To test for SATB1 binding to the potential ATC sequence stretches, we performed EMSAs using recombinant GST-SATB1. Ten fragments, ranging in size from 190 to 580 bp, and a control fragment were tested. Two fragments from the regions with strong matrix binding activity were found to bind purified SATB1. One fragment, from plasmid 1231, showed very strong binding (Fig. 5GoB) with a Kd of 0.04–0.15 nM. A fragment from plasmid 1230, bound SATB1 more weakly with a Kd of 1.6–2 nM (data not shown). Locations of these SATB1 binding sites are mapped in Fig. 4Go. For comparison, the Kd values were 0.3–1 nM for in vitro SATB1 binding to six other MAR probes, including fragments from the IgH and {beta} globin MARs, (51) and ranged from 1 to 29 nM for 16 SATB1-binding sequences identified using chromatin immunoprecipitation studies with anti-SATB1 Ab and T cell nuclear extracts (39).



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 5. SATB1 selectively binds with high affinity to a fragment of the strong MAR of clone 1231. Gel mobility shift assays were performed with GST-SATB1 protein and, as a negative control, a 190-bp BsaI-BsrGI fragment (A) or a contiguous 300-bp BsrGI-EcoRV fragment (B), both from clone 1231. DNA-binding activity was visualized after electrophoresis through a 6% acrylamide gel followed by autoradiography. Lanes 1–5 contain 0, 1.2, 0.3, 0.15, and 0.04 nM GST-SATB1 protein. The ATC sequence context from the 1231 MAR fragment which bound SATB1 is shown in C, with the potential SATB1 binding sites, stretches of As, Ts, and Cs, in bold and underlined. The ATC sequence context of the fragment from the strong MAR of 1230 which bound SATB1 is shown in D (see text).

 
Both SATB1 binding sites are in Thermodyn predicted LFE regions, which is consistent with previous findings that SATB1 binds to DNA regions with a high propensity to base unpair (52). In the very high-affinity binding fragment from 1231, there are 3 stretches of ATCs of 28, 31, and 27 bases, separated by 8 and 18 bases, respectively (Fig. 5GoC). Our other SATB1-binding site had two stretches of ATCs of 37 and 33 bases, separated by 33 bp (Fig. 5GoD). The presence of multiple potential SATB1 sites separated by 25 bp or less has been noted in other fragments that bound SATB1 (39).

GATA-3 binding

Another transcription factor that is potentially important for CD8A gene expression is GATA-3. We therefore analyzed the 19-kb region for putative GATA-3 sites using either the motif GATA or GATC with appropriate 5' and 3' bases according to Ko and Engel (53). We tested eight oligonucleotides for GATA-3 binding by EMSA analysis. We focused on oligonucleotide 5 with two tandem GATA-3 binding sites separated by 3 bases, that was located at a tissue-specific HS site. This oligonucleotide gave a band that was shifted with an anti-GATA-3 Ab. A mutated oligonucleotide with the AGATCA site mutation, M1, was able to compete fairly well as compared with the wild-type oligonucleotide (Fig. 6GoA), indicating that the M1 site was not as critical for GATA-3 binding as the AGATAA site which when mutated (M2 mutant) could not compete. To test the other oligonucleotides, we performed cold competition studies (Fig. 6GoB). Oligonucleotide 7, with three potential GATA-3 sites, competed strongly and the others to a lesser extent. The IL-5 promoter oligonucleotide, which contains a known double binding site for GATA-3, competed for binding less well than did oligonucleotide 5. This may have to do with the arrangement of the two GATA-3 sites in both oligonucleotides. In contrast to the tandem GATA-3 sites in oligonucleotide 5, the two GATA-3 sites in the IL-5 oligonucleotide overlap and are on opposite strands. Interestingly, oligonucleotide 7 is located 400 kb 3' of oligonucleotide 5 within the same MAR. This oligonucleotide, as well as oligonucleotides 2a, 2b, and 3 showed supershifts with the anti-GATA-3 Ab (data not shown).



View larger version (63K):
[in this window]
[in a new window]
  		FIGURE 6. GATA-3 binding to fragments from clones 1231 and 1230. Gel mobility shift assays were performed as described in Materials and Methods with nuclear extracts from stimulated Jurkat cells (a CD4+ human T cell line). A, Lane 1, Binding of GATA-3 to oligonucleotide 5 from plasmid 1230 containing two GATA-3 binding sites. The band representing GATA-3 binding is identified with an arrow. Lanes 2 and 3, A supershift with the anti-GATA-3 Ab but not with an isotype control Ab. Competition was performed with self-oligonucleotide, M1 (mutated first site), M2 (mutated second site), M3 (mutated both sites), or an oligonucleotide from the IL-5 promoter containing a GATA-3 binding site (27 ). The oligonucleotide 5 sequence, with specific mutations indicated in lower case lettering, is CAAAAATTActTCAAGTActTAAAATTTA (GATA-3 motifs bolded (B) Competition of labeled oligonucleotide 5 with other oligonucleotides (see Materials and Methods for sequences) containing putative GATA-3 motifs from the candidate regulatory region.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Gene transcription is dictated by regulatory elements to which transcription factors bind and by appropriate chromatin modification (epigenetic regulation). Because chromatin remodeling appears to be a critical component of gene transcription, DNase I HS sites, indicators of relatively open chromatin, are often used as signposts for regulatory elements. However, not all HS sites contain regulatory elements. Another indicator is colocalization of matrix attachment regions with HS sites. For example, there is a single MAR adjacent to both the Ig L chain enhancer, (33) and the TCR{beta} enhancer (54). Also, MARs flank both the IgH (55) and the TCR{delta} (56) enhancers. Therefore, identifying regions of the human CD8 loci that contain HS sites near MARs seemed a logical approach to more rapidly identify strong candidates for regulatory elements.

By mapping DNase I HS sites and MARs in the human CD8 gene complex, we found two regions at the 3' end of the CD8B gene in which both HS sites and strong MARs were colocalized. The tissue-specific DNase I HS cluster III, located between the last two CD8{beta} exons, was adjacent to a strong MAR. Another tissue-specific HS cluster, IV, located 3' of the last exon, was flanked by strong MARs. Further support for the potential importance of these regions in CD8 gene expression is the presence of a very strong SATB1 binding site in the MAR linked to HS cluster III and another site in the 5' MAR linked to HS cluster IV. Although we have discussed these regions separately, they encompass an 11-kb region that may actually function as a locus control region-like regulatory unit.

Positive functional effects by MARs on enhancer activity have been observed (56, 57, 58, 59, 60). Studies have shown that MARs are required for demethylation of the Ig{kappa} locus (61, 62) and generation of long-range accessibility of chromatin in the Igµ locus (15, 63). An elegant study by Forrester et al. (16) demonstrated that MARs could facilitate long-range chromatin remodeling. They studied the Igµ enhancer, which is flanked by MARs, for its ability to activate the VH promoter over a distance of 150 bp or 1.2 kb upstream of a methylated or demethylated gene in stable transfectants of B cell lines. They found that the enhancer alone induced local chromatin remodeling, giving rise to a DNase I HS site and local demethylation, which was sufficient to activate transcription when theenhancer was 150 bp from the promoter. However, for enhancer-mediated promoter activation over a distance, both MARs were required for methylated µ gene expression. The MARs in combination with the µ enhancer could induce acetylation of histones at a distal position. This may explain why the µ MARs were found to predominantly function in germline transmission but not in transient transfection assays where chromatin remodeling does not need to occur (60). Because the HS sites linked to the strong MARs that we have identified are located at least 20 kb from either CD8 promoter, it is possible that the MARs associated with these putative enhancers could promote a similar long-range interaction.

The higher order chromatin structure that may be required for tissue-specific expression of the CD8 genes may in part be regulated by the presence of SATB1. SATB1-binding sequences isolated from a T cell line were localized to the nuclear matrix at the base of chromatin loops in vivo (39). However, in a breast cancer cell line, in which SATB1 is absent, this was not the case for at least one of these SATB1-binding sequences, indicating that in vivo, anchoring of certain MARs onto the nuclear matrix is cell type specific. The hypothesis was put forth that SATB1 binding to the base of chromatin loops in vivo would create a specific chromatin loop domain structure that was involved in T cell-specific gene regulation. The SATB1-binding MARs in the CD8 region may likewise form a chromatin loop structure that is tissue specific. The very high-affinity SATB1 binding site in the strong MAR located in the last intron of the CD8B gene and the other site in the strong MAR located 4.5 kb downstream could lead to the formation of a loop domain that might facilitate CD8 gene expression, possibly through long-range histone acetylation of the CD8 gene. Because of the differences in affinity for SATB1 between the two sites, the formation of specific loop structures may vary depending on the concentration of SATB1.

The other protein that we found to bind to the candidate regulatory region, GATA-3, is also likely to affect CD8A gene expression. In the mouse a region in the murine HS cluster II located 4–5 kb upstream of the CD8A gene (32) contains two GATA-3 binding sites which function in in vitro assays. These GATA-3 binding sites are within the murine CD8 gene thymocyte-specific enhancer which also contains a SATB1-binding MAR (64). Interestingly, GATA-3 levels are high in CD4/CD8 thymocytes and then decline as they mature (65). Therefore, GATA-3 may be most important for CD8 expression in the double-positive T cell stage and would bind to the thymocyte-specific enhancer. The strong GATA-3 binding site that we found in the human CD8 tissue-specific HS cluster IV is potentially a functional site in that it has two GATA motifs 3 bp apart; double GATA motifs are often found in functional GATA sites.

Although it would be very informative to be able to compare the location of HS sites between the two species, exact comparisons are not possible because the human gene complex has ~20 kb more DNA in the intergenic region (56 kb) compared with the murine region (36 kb), and the murine CD8B gene lacks exons VIII and IX. Despite this caveat, some sites may be comparable (Fig. 7Go). For instance, the murine HS cluster IV at the end of the murine CD8B gene corresponds to our cluster II. In transgenic animal studies, this region contained regulatory element(s) which directed expression to double-positive thymocytes and mature CD8+ T cells, but not to CD8{alpha}{alpha} IEL (9, 12, 13).



View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 7. Comparison of DNase I HS sites in the human and mouse CD8 gene complexes. They were aligned using the end of the murine CD8B gene with the homologous human CD8B exon VII.

 
Another murine regulatory region, associated with DNase HS cluster III, located in the intergenic region ~16 kb upstream of the murine CD8A gene, contained an enhancer that was specific for mature CD8+ T cells and CD8{alpha}{alpha} IEL (10, 11). A fragment from murine DNase HS cluster II, just upstream of the murine CD8A gene, when analyzed alone did not display enhancer activity, but did direct expression to double-positive thymocytes when combined with cluster III (9). The location of human DNase HS clusters III, IV, and V in the intergenic region may be similar to these murine HS clusters in the intergenic region (8). The finding that one of the murine clusters did not function unless linked to another cluster indicates that a large regulatory unit composed of multiple HS clusters is likely to be regulating murine CD8A gene expression.

To address the functional significance of potential regulatory elements in the human CD8 gene complex, we have continued to test in transgenic animals portions from the 95-kb genomic CD8 fragment that gave tissue-specific expression in transgenic animals. Focusing on the region described in this article, we have linked cluster III plus MAR or clusters IV and V plus MARs to a genomic human CD8A gene marker gene and analyzed for expression in transgenic animals. High level expression in a small percentage of the murine CD8 T cells was noted with both constructs in all transgenic lines (two to five lines per transgene, our unpublished data). However, our failure to obtain expression in most of the murine CD8 T cells may be related to the fact that both regions together may be required for large numbers of cells expressing the transgene. Such studies are currently in progress.


   Acknowledgments
 
We thank Dr. Carol Webb for the MAR assay protocol. We are very grateful to Dr. Anuradha Ray for the GATA-3 EMSA protocol, nuclear extracts, and helpful discussions. We also thank Lei Yan and Sarah Cho for technical assistance and Roberta O’Brien for secretarial assistance.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant CA48115 (to P.B.K.), National Research Service Award 5 F32 AI09700 (to L.J.K.), National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Diseases Grants DK02467 and DK45676 (to J.M.G.), and National Institutes of Health Grant R01 CA39681 (to T.K.-S.). Back

2 Address correspondence and reprint requests to Dr. Paula B. Kavathas, 333 Cedar Street, P.O. Box 208035, New Haven, CT 06520-8035. E-mail address: paula.kavathas{at}yale.edu Back

3 Abbreviations used in this paper: IEL, intraepithelial lymphocyte; MAR, matrix attachment region; HS, hypersensitive; LFE, low energy free; GC, guanine cytosine. Back

Received for publication December 10, 2001. Accepted for publication February 20, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fung-Leung, W., M. W. Schilham, A. Rahemtulla, T. M. Kundig, M. Vollenweider, J. Potter, W. van Ewijk, T. W. Mak. 1991. CD8 is needed for development of cytotoxic T cells but not helper T cells. Cell 65:443.[Medline]
  2. Rahemtulla, A., W. P. Fung-Leung, M. W. Schilham, T. M. Kundig, S. R. Sambhara, A. Narendran, A. Arabian, A. Wakeham, C. J. Paige, R. M. Zinkernagel, et al 1991. Normal development and function of CD8+ cells but markedly decreased helper cell activity in mice lacking CD4. Nature 353:180.[Medline]
  3. Devine, L., L. J. Kieffer, V. Aitken, P. B. Kavathas. 2000. Human CD8{beta}, but not mouse CD8{beta}, can be expressed in the absence of CD8{alpha} as a {beta}{beta} homodimer. J. Immunol. 164:833.[Abstract/Free Full Text]
  4. Kober, G., A. L. Griscelli, T. Hercend, S. C. Meuer. 1991. Expression of different CD8 isoforms on distinct human lymphocyte subpopulations. Eur. J. Immunol. 21:1793.[Medline]
  5. Jarry, A., N. Cerf-Bensussan, N. Brouse, F. Selz, D. Guy-Grand. 1990. Subsets of CD3+ (T cell receptor {alpha}{beta} or {gamma}{delta}) and CD3- lymphocytes isolated from normal human gut epithelium display phenotypical features different from their counterparts in peripheral blood. Eur. J. Immunol. 20:1097.[Medline]
  6. Lefrancois, L.. 1991. Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J. Immunol. 146:1746.
  7. Kieffer, L. J., L. Yan, J. H. Hanke, P. B. Kavathas. 1997. Appropriate developmental expression of human CD8{beta} in transgenic mice. J. Immunol. 159:4907.[Abstract]
  8. Hostert, A., M. Tolaini, R. Festenstein, L. McNeill, B. Malissen, O. Williams, R. Zamoyska, D. Kioussis. 1997. A CD8 genomic fragment that directs subset-specific expression of CD8 in transgenic mice. J. Immunol. 158:4270.[Abstract]
  9. Hostert, A., A. Garefalaki, G. Mavria, M. Tolaini, K. Roderick, T. Norton, P. J. Mee, V. L. Tybulewicz, M. Coles, D. Kioussis. 1998. Hierarchical interactions of control elements determine CD8{alpha} gene expression in subsets of thymocytes and peripheral T cells. Immunity 9:497.[Medline]
  10. Ellmeier, W., M. J. Sunshine, K. Losos, F. Hatam, D. R. Littman. 1997. An enhancer that directs lineage-specific expression of CD8 in positively selected thymocytes and mature T cells. Immunity 7:537.[Medline]
  11. Hostert, A., M. Tolaini, K. Roderick, N. Harker, T. Norton, D. Kioussis. 1997. A region in the CD8 gene locus that directs expression to the mature CD8 T cell subset in transgenic mice. Immunity 7:525.[Medline]
  12. Ellmeier, W., M. J. Sunshine, K. Losos, D. R. Littman. 1998. Multiple developmental stage-specific enhancers regulate CD8 expression in developing thymocytes and in thymus-independent T cells. Immunity 9:485.[Medline]
  13. Zhang, X., R. Seong, R. Piracha, M. Larijani, M. Heeney, J. R. Parnes, J. W. Chamberlain. 1998. Distinct stage-specific cis-active transcriptional mechanisms control expression of T cell coreceptor CD8{alpha} at double- and single-positive stages of thymic development. J. Immunol. 161:2254.[Abstract/Free Full Text]
  14. Scheuermann, R. H., W. T. Garrard. 1999. MARs of the antigen receptor and C0-receptor genes. Crit. Rev. Eukaryotic Gene Expression 9:295.[Medline]
  15. Fernandez, L. A., M. Winkler, R. Grosschedl. 2001. Matrix attachment region-dependent function of the immunoglobulin µ enhancer involves histone acetylation at a distance without changes in enhancer occupancy. Mol. Cell. Biol. 21:196.[Abstract/Free Full Text]
  16. Forrester, W. C., L. A. Fernandez, R. Grosschedl. 1999. Nuclear matrix attachment regions antagonize methylation-dependent repression of long-range enhancer-promoter interactions. Genes Dev. 13:3003.[Abstract/Free Full Text]
  17. Dickinson, L. A., T. Joh, Y. Kohwi, T. Kohwi-Shigematsu. 1992. A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70:631.[Medline]
  18. Alvarez, J. D., D. H. Yasui, H. Niida, T. Joh, D. Y. Loh, T. Kohwi-Shigematsu. 2000. The MAR-binding protein SATB1 orchestrates temporal and spatial expression of multiple genes during T-cell development. Genes Dev. 14:521.[Abstract/Free Full Text]
  19. George, K. M., M. W. Leonard, M. E. Roth, K. H. Lieuw, D. Kioussis, F. Grosveld, J. D. Engel. 1994. Embryonic expression and cloning of the murine GATA-3 gene. Development 120:2673.[Abstract/Free Full Text]
  20. Hattori, N., H. Kawamoto, S. Fujimoto, K. Kuno, Y. Katsura. 1996. Involvement of transcription factors TCF-1 and GATA-3 in the initiation of the earliest step of T cell development in the thymus. J. Exp. Med. 184:1137.[Abstract/Free Full Text]
  21. Oosterwegel, M., J. Timmerman, J. Leiden, H. Clevers. 1992. Expression of GATA-3 during lymphocyte differentiation and mouse embryogenesis. Dev. Immunol. 3:1.[Medline]
  22. Pandolfi, P. P., M. E. Roth, A. Karis, M. W. Leonard, E. Dzierzak, F. G. Grosveld, J. D. Engel, M. H. Lindenbaum. 1995. Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat. Genet. 11:40.[Medline]
  23. Ting, C. N., M. C. Olson, K. P. Barton, J. M. Leiden. 1996. Transcription factor GATA-3 is required for development of the T-cell lineage. Nature 384:474.[Medline]
  24. Lee, H. J., A. O’Garra, K. Arai, N. Arai. 1998. Characterization of cis-regulatory elements and nuclear factors conferring Th2-specific expression of the IL-5 gene: a role for a GATA-binding protein. J. Immunol. 160:2343.[Abstract/Free Full Text]
  25. Leiden, J. M.. 1993. Transcriptional regulation of T cell receptor genes. Annu. Rev. Immunol. 11:539.[Medline]
  26. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, C. B. Wilson. 1993. Two essential regulatory elements in the human interferon {gamma} promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
  27. Siegel, M. D., D.-H. Zhang, P. Ray, A. Ray. 1995. Activation of the interleukin-5 promoter by cAMP in murine EL-4 cells requires the GATA-3 and CLEO elements. J. Biol. Chem. 270:24548.[Abstract/Free Full Text]
  28. Wurster, A. L., G. Siu, J. M. Leiden, S. M. Hedrick. 1994. Elf-1 binds to a critical element in a second CD4 enhancer. Mol. Cell. Biol. 14:6452.[Abstract/Free Full Text]
  29. Yamagata, T., K. Mitani, H. Ueno, Y. Kanda, Y. Yazaki, H. Hirai. 1997. Triple synergism of human T-lymphotropic virus type 1-encoded tax, GATA- binding protein, and AP-1 is required for constitutive expression of the interleukin-5 gene in adult T-cell leukemia cells. Mol. Cell. Biol. 17:4272.[Abstract]
  30. Yamagata, T., J. Nishida, R. Sakai, T. Tanaka, H. Honda, N. Hirano, H. Mano, Y. Yazaki, H. Hirai. 1995. Of the GATA-binding proteins, only GATA-4 selectively regulates the human interleukin-5 gene promoter in interleukin-5-producing cells which express multiple GATA-binding proteins. Mol. Cell. Biol. 15:3830.[Abstract]
  31. Zhang, D. H., L. Yang, A. Ray. 1998. Differential responsiveness of the IL-5 and IL-4 genes to transcription factor GATA-3. J. Immunol. 161:3817.[Abstract/Free Full Text]
  32. Landry, D. B., J. D. Engel, R. Sen. 1993. Functional GATA-3 binding sites within murine CD8 {alpha} upstream regulatory sequences. J. Exp. Med. 178:941.[Abstract/Free Full Text]
  33. Cockerill, P. N., W. T. Garrard. 1986. Chromosomal loop anchorage of the {kappa} immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites. Cell 44:273.[Medline]
  34. Webb, C. F., C. Das, K. L. Eneff, P. W. Tucker. 1991. Identification of a matrix-associated region 5' of an immunoglobulin heavy chain variable region gene. Mol. Cell. Biol. 11:5206.[Abstract/Free Full Text]
  35. Greally, J. M., T. A. Gray, J. M. Gabriel, L. Song, S. Zemel, R. D. Nicholls. 1999. Conserved characteristics of heterochromatin-forming DNA at the 15q11–q13 imprinting center. Proc. Natl. Acad. Sci. USA 96:14430.[Abstract/Free Full Text]
  36. Jong, M. T., T. A. Gray, Y. Ji, C. C. Glenn, S. Saitoh, D. J. Driscoll, R. D. Nicholls. 1999. A novel imprinted gene, encoding a RING zinc-finger protein, and overlapping antisense transcript in the Prader-Willi syndrome critical region. Hum. Mol. Genet. 8:783.[Abstract/Free Full Text]
  37. Greally, J. M., M. E. Guinness, J. McGrath, S. Zemel. 1997. Matrix-attachment regions in the mouse chromosome 7F imprinted domain. Mamm. Genome 8:805.[Medline]
  38. Kramer, J. A., G. B. Singh, S. A. Krawetz. 1996. Computer-assisted search for sites of nuclear matrix attachment. [Published erratum appears in 1996 Genomics 35:273.]. Genomics 32:305.
  39. de Belle, I., S. Cai, T. Kohwi-Shigematsu. 1998. The genomic sequences bound to special AT-rich sequence-binding protein 1 (SATB1) in vivo in Jurkat T cells are tightly associated with the nuclear matrix at the bases of the chromatin loops. J. Cell Biol. 141:335.[Abstract/Free Full Text]
  40. Hambor, J. E., J. Mennone, M. E. Coon, J. H. Hanke, P. Kavathas. 1993. Identification and characterization of an Alu-containing, T cell-specific enhancer located in the last intron of the human CD8{alpha} gene. Mol. Cell. Biol. 13:7056.[Abstract/Free Full Text]
  41. Duret, L., D. Mouchiroud, C. Gautier. 1995. Statistical analysis of vertebrate sequences reveals that long genes are scarce in GC-rich isochores. J. Mol. Evol. 40:308.[Medline]
  42. McVean, G. T., L. D. Hurst, T. Moore. 1996. Genomic evolution in mice and men: imprinted genes have little intronic content. BioEssays 18:773.[Medline]
  43. Bode, J., M. Stengert-Iber, V. Kay, T. Schlake, A. Dietz-Pfeilstetter. 1996. Scaffold/matrix-attached regions: topological switches with multiple regulatory functions. Crit. Rev. Eukaryotic Gene Expression 6:115.[Medline]
  44. Bode, J., Y. Kohwi, L. Dickinson, T. Joh, D. Klehr, C. Mielke, T. Kohwi-Shigematsu. 1992. Biological significance of unwinding capability of nuclear matrix-associating DNAs. Science 255:195.[Abstract/Free Full Text]
  45. Kohwi-Shigematsu, T., Y. Kohwi. 1990. Torsional stress stabilizes extended base unpairing in suppressor sites flanking immunoglobulin heavy chain enhancer. Biochemistry 29:9551.[Medline]
  46. Benham, C., T. Kohwi-Shigematsu, J. Bode. 1997. Stress-induced duplex DNA destabilization in scaffold/matrix attachment regions. J. Mol. Biol. 274:181.[Medline]
  47. Boulikas, T.. 1993. Nature of DNA sequences at the attachment regions of genes to the nuclear matrix. J. Cell. Biochem. 52:14.[Medline]
  48. Boulikas, T.. 1995. Chromatin domains and prediction of MAR sequences. Int. Rev. Cytol. 162A:279.
  49. Gasser, S. M., B. B. Amati, M. E. Cardenas, J. F. Hofmann. 1989. Studies on scaffold attachment sites and their relation to genome function. Int. Rev. Cytol. 119:57.[Medline]
  50. Nakagomi, K., Y. Kohwi, L. A. Dickinson, T. Kohwi-Shigematsu. 1994. A novel DNA-binding motif in the nuclear matrix attachment DNA-binding protein SATB1. Mol. Cell. Biol. 14:1852.[Abstract/Free Full Text]
  51. Dickinson, L. A., T. Kohwi-Shigematsu. 1995. Nucleolin is a matrix attachment region DNA-binding protein that specifically recognizes a region with high base-unpairing potential. Mol. Cell. Biol. 15:456.[Abstract]
  52. Dickinson, L. A., C. D. Dickinson, T. Kohwi-Shigematsu. 1997. An atypical homeodomain in SATB1 promotes specific recognition of the key structural element in a matrix attachment region. J. Biol. Chem. 272:11463.[Abstract/Free Full Text]
  53. Ko, L. J., J. D. Engel. 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13:4011.[Abstract/Free Full Text]
  54. Chattopadhyay, S., C. E. Whitehurst, J. Chen. 1998. A nuclear matrix attachment region upstream of the T cell receptor {beta} gene enhancer binds Cux/CDP and SATB1 and modulates enhancer-dependent reporter gene expression but not endogenous gene expression. J. Biol. Chem. 273:29838.[Abstract/Free Full Text]
  55. Cockerill, P. N., M. H. Yuen, W. T. Garrard. 1987. The enhancer of the immunoglobulin heavy chain locus is flanked by presumptive chromosomal loop anchorage elements. J. Biol. Chem. 262:5394.[Abstract/Free Full Text]
  56. Zhong, X. P., J. Carabana, M. S. Krangel. 1999. Flanking nuclear matrix attachment regions synergize with the T cell receptor {delta} enhancer to promote V(D)J recombination. Proc. Natl. Acad. Sci. USA 96:11970.[Abstract/Free Full Text]
  57. Blasquez, V. C., M. Xu, S. C. Moses, W. T. Garrard. 1989. Immunoglobulin {kappa} gene expression after stable integration. I. Role of the intronic MAR and enhancer in plasmacytoma cells. J. Biol. Chem. 264:21183.[Abstract/Free Full Text]
  58. Goyenechea, B., N. Klix, J. Yelamos, G. T. Williams, A. Riddell, M. S. Neuberger, C. Milstein. 1997. Cells strongly expressing Ig{kappa} transgenes show clonal recruitment of hypermutation: a role for both MAR and the enhancers. EMBO J. 16:3987.[Medline]
  59. Xu, M., R. E. Hammer, V. C. Blasquez, S. L. Jones, W. T. Garrard. 1989. Immunoglobulin {kappa} gene expression after stable integration. II. Role of the intronic MAR and enhancer in transgenic mice. J. Biol. Chem. 264:21190.[Abstract/Free Full Text]
  60. Forrester, W. C., C. van Genderen, T. Jenuwein, R. Grosschedl. 1994. Dependence of enhancer-mediated transcription of the immunoglobulin µ gene on nuclear matrix attachment regions. Science 265:1221.[Abstract/Free Full Text]
  61. Kirillov, A., B. Kistler, R. Mostoslavsky, H. Cedar, T. Wirth, Y. Bergman. 1996. A role for nuclear NF-{kappa}B in B-cell-specific demethylation of the Ig{kappa} locus. Nat. Genet. 13:435.[Medline]
  62. Lichtenstein, M., G. Keini, H. Cedar, Y. Bergman. 1994. B cell-specific demethylation: a novel role for the intronic {kappa} chain enhancer sequence. Cell 76:913.[Medline]
  63. Jenuwein, T., W. C. Forrester, L. A. Fernandez-Herrero, G. Laible, M. Dull, R. Grosschedl. 1997. Extension of chromatin accessibility by nuclear matrix attachment regions. Nature 385:269.[Medline]
  64. Banan, M., I. C. Rojas, W.-H. Lee, H. L. King, J. V. Harriss, R. Kobayashi, C. F. Webb, P. D. Gottlieb. 1997. Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8{alpha} gene. J. Biol. Chem. 272:18440.[Abstract/Free Full Text]
  65. Nawijn, M. C., R. Ferreira, G. M. Dingjan, O. Kahre, D. Drabek, A. Karis, F. Grosveld, R. W. Hendriks. 2001. Enforced expression of GATA-3 during T cell development inhibits maturation of CD8 single-positive cells and induces thymic lymphoma in transgenic mice. J. Immunol. 167:715.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
S. H. Apte, A. Baz, P. Groves, A. Kelso, and N. Kienzle
Interferon-{gamma} and interleukin-4 reciprocally regulate CD8 expression in CD8+ T cells
PNAS, November 11, 2008; 105(45): 17475 - 17480.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Nie, S. D. Maika, P. W. Tucker, and P. D. Gottlieb
A Role for SATB1, a Nuclear Matrix Association Region-Binding Protein, in the Development of CD8SP Thymocytes and Peripheral T Lymphocytes
J. Immunol., April 15, 2005; 174(8): 4745 - 4752.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
T.-Y. Roh, S. Cuddapah, and K. Zhao
Active chromatin domains are defined by acetylation islands revealed by genome-wide mapping
Genes & Dev., March 1, 2005; 19(5): 542 - 552.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. P. Martins, G. C. Ostermeier, and S. A. Krawetz
Nuclear Matrix Interactions at the Human Protamine Domain: A WORKING MODEL OF POTENTIATION
J. Biol. Chem., December 10, 2004; 279(50): 51862 - 51868.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
Y. Huang and D. Kowalski
WEB-THERMODYN: sequence analysis software for profiling DNA helical stability
Nucleic Acids Res., July 1, 2003; 31(13): 3819 - 3821.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. Goebel, A. Montalbano, N. Ayers, E. Kompfner, L. Dickinson, C. F. Webb, and A. J. Feeney
High Frequency of Matrix Attachment Regions and Cut-Like Protein x/CCAAT-Displacement Protein and B Cell Regulator of IgH Transcription Binding Sites Flanking Ig V Region Genes
J. Immunol., September 1, 2002; 169(5): 2477 - 2487.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kieffer, L. J.
Right arrow Articles by Kavathas, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kieffer, L. J.
Right arrow Articles by Kavathas, P. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS