|
|
||||||||
Cutting Edge |
Are Dispensable for Ig Gene Hypermutation1


* Institut National de la Santé et de la Recherche Médicale, Unité 373, Faculté de Médecine Necker-Enfants Malades, and
Institut National de la Santé et de la Recherche Médicale, Unité 462, Hôpital Saint-Louis, Center Hayem, Paris, France; and
Service dExpérimentation Animale et de Transgénèse du Centre National de la Recherche Scientifique, Villejuif, France
| Abstract |
|---|
|
|
|---|
, pol
, pol
, and pol µ.
We report in this work that mice inactivated for either of the two
polymerases related to pol
(i.e., pol µ and pol
) are viable
and fertile and display a normal hypermutation
pattern. | Introduction |
|---|
|
|
|---|
Polymerase (pol)4
has long been the only known nonreplicative DNA polymerase whose
intrinsic fidelity, in the 10-3 range, would be
compatible with the estimated mutation rate of Ig genes
(4). However, inactivation of this enzyme by gene
targeting has excluded its participation in the mutation process
(5). Over the past 4 years, nine additional DNA
polymerases (if one includes Rev1, a deoxycytidyl transferase) have
been identified (reviewed in Ref. 2). Although many of
these enzymes have bacterial or yeast homologs with known repair
function, their precise role in mammalian cells remains hypothetical
for most of them (3, 6).
Among the candidates for hypermutation is a group of DNA polymerases described collectively as lesion bypass enzymes. The participation of several of them has been proposed in hypermutation (7, 8, 9, 10), but no direct evidence points so far to the implication of a unique enzyme in this process.
We reported previously that the mutation pattern of microsatellite
sequences embedded in the Ig locus share striking similarities with the
synthesis errors generated in vitro by pol
(11).
Therefore, we have searched for new DNA polymerases related to this
enzyme, which, together with Tdt, belongs to the polX family. We have
discovered two such enzymes, pol
and pol µ (12),
which have been independently identified by other groups
(13, 14, 15). Pol
has 54% homology with pol
, while
pol µ is closer to Tdt, an enzyme whose only function is to
contribute to the T and B cell repertoire by diversification of V(D)J
junctions during rearrangement of TCR and Ig genes. Its homology with a
lymphoid-specific enzyme and its higher expression in lymphoid tissues
have made pol µ a strong candidate for the Ig mutase (12, 13). For pol
, its low ubiquitous expression and its lack of
proofreading activity (12) make it a possible candidate as
well. We report in this work the generation of gene-targeted mice for
these two enzymes and the lack of incidence of their inactivation on
the Ig gene mutation process.
| Materials and Methods |
|---|
|
|
|---|
phages spanning 20 kb of both
and µ genes were
isolated from a mouse 129/SvJ genomic library (
FixII;
Stratagene, La Jolla, CA). One phage for each gene was selected,
and 5' and 3' fragments flanking the region to be deleted were
amplified. For pol µ, a 3.9-kb 5' fragment was amplified using
primers in exons 3 and 6, respectively; a 3.5-kb 3' fragment spanned
from exon 10 up to the end of the phage insert. For pol
, a large
part of the genomic sequence was available (AC003694): a 5-kb 5'
fragment was amplified with primers located, respectively, 1.8 kb
upstream from the ATG codon and at the end of the intron between exons
4 and 5; a 3.8-kb 3' fragment spanned from the 5' border of the intron
between exons 7 and 8 up to the end of the phage insert,
3 kb
downstream from the stop codon. Fragments were inserted either blunt or
using restriction sites added in the primers in the XhoI and
SalI cloning sites flanking the neomycin resistance gene of
the pLNTK vector (a gift from F. W. Alt, Harvard Medical
School, Boston, MA) (16). Additional NotI and
SfiI sites have been introduced in this vector to be used
for linearization.
Generation of gene-targeted mice
E14.1 embyronic stem (ES) cells (a gift from K. Rajewsky,
Institute for Genetics, Cologne, Germany) were transfected as described
(17). G418- and ganciclovir-resistant clones were screened
individually by PCR (30 cycles with the Long Expand PCR system
according to the conditions of the supplier; Boehringer Mannheim,
Mannheim, Germany), using the following gene-specific primers,
amplifying both the endogenous genes and the construct if properly
targeted (see location in Figs. 1
and 2
): pol µ 5' primer,
GGGCAGAGTACATGCCAGTG, and 3' primer, GCTGAACCGCCGTAGCTCCC; and pol
5' primer, GCTCCATATGGTTGCTGGGC, and 3' primer,
CAGAGCTGAGGAGGAAGGATG. One positive clone among 363 was obtained
for pol µ, and two among 370 were obtained for pol
. Homologous
recombination was confirmed by Southern blot analysis of DNA from ES
clones and from spleen of gene-targeted mice (see Figs. 1
B
and 2B). Injection of ES cells into C57BL/6 blastocysts was
performed as described (17), and chimeric mice were bred
into the C57BL/6 background. Genotyping of mice was performed by PCR,
with simultaneous amplification of the wild-type allele (250 bp) and
the gene-targeted allele (500 bp) for both pol µ and pol
. Primers
were as follows: pol µ 5' primer, GGGTTGGGGTGAAGACTGC, 3'
wild-type-specific primer, CTCATGGCCAACCCTGGGTC, and 3' neomycin
resistance gene (neoR) primer,
CATAGCGTTGGCTACCCGTG; pol
5' primer, GCTCCATATGGTTGCTGGGC, 3'
wild-type-specific primer, CAGCTCCCCAGATGTTGGAG, and
3'-neoR primer as above.
|
|
expression
Spleen peanut agglutinin (PNA)high
B cells from 2-mo-old animals were isolated as described previously
(18). RNA was extracted from 105
cells using the RNeasy mini kit (Qiagen, Hilden, Germany) and cDNA was
synthesized using the ProSTAR First-Strand RT-PCR kit (Stratagene).
Primers amplifying the complete coding sequence of pol µ and pol
were used. PCR products were analyzed after gel transfer by
hybridization with a full-length µ or
cDNA probe.
Analysis of V gene mutations
Peyers patch PNAhigh B cells were
isolated as described previously (18). Mutations were
analyzed in a 260-bp segment downstream from rearranged
JH4 sequences as described (18). Pol
µ-/- mice were selected between 3 and 5 mo of
age, and pol
-/- mice were selected at 4 mo.
Wild-type littermates were taken as controls.
Flow cytometric analysis
Splenic cell suspensions from 4-wk-old mice were stained with FITC-conjugated goat anti-mouse-IgM and PE-conjugated rat anti-mouse-IgD Abs (Southern Biotechnology Associates, Birmingham, AL) and analyzed with a FACStar apparatus (BD Biosciences, Mountain View, CA).
| Results and Discussion |
|---|
|
|
|---|
share a similar organization
comprising a DNA polymerase domain, two HhH (helix-hairpin-helix)
domains, and, unlike pol
, an N-terminal breast cancer-associated
protein 1 C terminus domain that could mediate protein-protein
interactions (named after the prototypal C-terminal domain of the
breast cancer protein 1) (19). Because multiple splicing
variants have been described for both polymerases (12), we
chose not to delete their first exon, but rather their catalytic
domain. Exons 57 were deleted in the pol
-targeted allele, thus
removing not only the DNA polymerase catalytic site but also the first
HhH domain corresponding to the 5'-deoxyribose phosphate lyase activity
(20) (Fig. 1
and pol
as critical for the 5'-deoxyribose phosphate lyase activity
are conserved in the first HhH domain of neither pol µ nor Tdt,
making it unlikely that these enzymes possess an enzymatic activity
other than their nucleotidyl transferase function (20, 21). Homologous recombination was confirmed by Southern
blot on both the ES clones chosen for injection and spleen DNA from the
resulting heterozygous and homozygous mice (Figs. 1
Homozygous knockout (k.o.) mice were viable and were obtained in both
cases with normal mendelian segregation. Despite the strong expression
seen in testis for pol
, the male k.o. mice were fertile, and
homozygous breeding has been performed up to the third generation
without noticeable problem. Pol µ-deficient mice were also bred as
homozygous mutants.
To assess the possible contribution of these polymerases to the Ig gene hypermutation process, Ig gene mutations from chronically stimulated B cells were analyzed. PNAhigh B cells were sorted from Peyers patches of 3- to 5-mo-old animals, and mutations occurring within 260 bp flanking rearranged JH4 segments, i.e., within nonselected sequences, were studied.
Mutations obtained from both types of k.o. mice appear normal in every
aspect, compared with littermate control animals. They are
quantitatively similar, expressed either as average mutation frequency,
the differences observed being within the range of the normal
individual variations (Table I
), or as
distribution of mutations per sequence (Fig. 3
). Qualitatively, the relative mutation
frequency of the four nucleotides, as well as the
transition:transversion ratio, is comparable (Table II
). Distribution of mutations along the
JH4 intronic sequence is also similar between
controls and k.o. mice, with a similar targeting of hot spot
positions (Fig. 4
).
|
|
|
|
in meiosis and in base excision repair has been
proposed (14, 20). An overall histological examination of
various tissues from pol
-deficient mice has been performed without
revealing any defect (data not shown). Nevertheless, apoptosis
within specific tissues, in particular during embryonic development,
remains to be assessed. The perfect viability and fertility of pol
-deficient mice over several generations argues that this
enzyme is dispensable for mouse development. Most repair polymerases
are highly expressed in testis, as, for example,
,
,
, or
;
therefore, there might be some redundancy between them, at least over
the time scale of a few generations. Moreover, whatever its
contribution to base excision repair might be, pol
is unable to
substitute for the repair function of pol
during early mouse
development, the inactivation of the latter being lethal at birth due
to massive embryonic neuronal apoptosis (22).
However, the lack of phenotype of pol
deficiency is quite
unexpected, considering the strong interspecies conservation of this
enzyme, which has a putative ortholog in plants (14).
Pol µ has been considered a good candidate for the elusive Ig gene
mutase according to several criteria (12, 13): 1) its very
strong homology with Tdt, a strictly lymphoid-specific enzyme whose
contribution is crucial to diversify the third
complementarity-determining region of Ig and TCR genes during
V(D)J rearrangement; 2) despite a ubiquitous expression, a higher level
of transcription in lymphoid tissues, in particular B cells from
tonsils, but also, and obviously not in favor of an Ig mutase, in
thymus; 3) its rather high level of infidelity during DNA synthesis,
which classified it as one of the most error-prone polymerases
described so far (13). However, the last point was
challenged recently, this enzyme being more prone to generate
frameshifts based on misalignments of primer template in vitro than to
perform strict base misincorporations (23). No specific
defect was detected by histology in nonlymphoid tissues of pol
µ-deficient mice (data not shown). In contrast, about half of the
mice have a marked depletion of B cells in peripheral lymphoid organs.
Indeed, flow cytometric analysis of splenic lymphoid cells showed that,
among 20 mice between 4 and 16 wk of age, 10 have a splenic B:T cell
ratio between 18 and 28%, while the others have values between 33 and
59%, i.e., within the normal variation range. Nevertheless, the B cell
maturation monitored by the progressive diminution in surface IgM with
concomitant increase in IgD appears unaffected. Representative cases
are shown in Fig. 5
. We are currently
investigating what type of lymphoid-specific DNA transaction involving
pol µ could generate such a B cell deficit, with these rather
surprising individual variations.
|
| Acknowledgments |
|---|
-deficient mice. | Footnotes |
|---|
2 J.-C.W. and C.-A.R. share equal senior authorship. ![]()
3 Address correspondence and reprint requests to Dr. Claude-Agnès Reynaud, Institut National de la Santé et de la Recherche Médicale, Unité 373, Faculté de Médecine Necker-Enfants Malades, 156 rue de Vaugirard, 75730 Paris Cedex 15, France. E-mail address: reynaud{at}necker.fr ![]()
4 Abbreviations used in this paper: pol, polymerase; ES, embyronic stem; neoR, neomycin resistance gene; k.o., knockout; HhH, helix-hairpin-helix; PNA, peanut agglutinin. ![]()
Received for publication January 11, 2002. Accepted for publication February 21, 2002.
| References |
|---|
|
|
|---|
-deficient fetal liver cells are able to mount a T cell-dependent immune response and mutate their Ig genes normally. Proc. Natl. Acad. Sci. USA 97:1166.
is an A-T mutator in somatic hypermutation of immunoglobulin variable genes. Nat. Immunol. 2:537.[Medline]
plays a major role in Ig and bcl-6 somatic hypermutation. Immunity 14:643.[Medline]
. J. Immunol. 167:327.
), a novel eukaryotic DNA polymerase with a potential role in meiosis. J. Mol. Biol. 301:851.[Medline]
2, a DNA polymerase
-related enzyme. J. Biol. Chem. 275:31233.
3' enhancer influences the ratio of Ig
versus Ig
B lymphocytes. Immunity 5:241.[Medline]
: a possible role in base excision repair. J. Biol. Chem. 276:34659.
as revealed by site-directed mutagenesis: DNA binding and 5'-deoxyribose phosphate lyase activities. J. Biol. Chem. 273:11121.
. EMBO J. 19:1397.[Medline]
This article has been cited by other articles:
![]() |
K. Takakusagi, Y. Takakusagi, K. Ohta, S. Aoki, F. Sugawara, and K. Sakaguchi A sulfoglycolipid beta-sulfoquinovosyldiacylglycerol ({beta}SQDG) binds to Met1-Arg95 region of murine DNA polymerase lambda (Mmpol {lambda}) and inhibits its nuclear transit Protein Eng. Des. Sel., November 20, 2009; (2009) gzp064v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Saribasak, D. Rajagopal, R. W Maul, and P. J Gearhart Hijacked DNA repair proteins and unchained DNA polymerases Phil Trans R Soc B, March 12, 2009; 364(1517): 605 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Schenten, S. Kracker, G. Esposito, S. Franco, U. Klein, M. Murphy, F. W. Alt, and K. Rajewsky Pol{zeta} ablation in B cells impairs the germinal center reaction, class switch recombination, DNA break repair, and genome stability J. Exp. Med., February 16, 2009; 206(2): 477 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Livraghi and S. H. Randell Cystic Fibrosis and Other Respiratory Diseases of Impaired Mucus Clearance Toxicol Pathol, January 1, 2007; 35(1): 116 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Juarez, J. F. Ruiz, S. A. N. McElhinny, D. Ramsden, and L. Blanco A specific loop in human DNA polymerase mu allows switching between creative and DNA-instructed synthesis Nucleic Acids Res., September 11, 2006; 34(16): 4572 - 4582. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Fiala, W. W. Duym, J. Zhang, and Z. Suo Up-regulation of the Fidelity of Human DNA Polymerase {lambda} by Its Non-enzymatic Proline-rich Domain J. Biol. Chem., July 14, 2006; 281(28): 19038 - 19044. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Escalier Knockout mouse models of sperm flagellum anomalies Hum. Reprod. Update, July 1, 2006; 12(4): 449 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Braithwaite, P. S. Kedar, L. Lan, Y. Y. Polosina, K. Asagoshi, V. P. Poltoratsky, J. K. Horton, H. Miller, G. W. Teebor, A. Yasui, et al. DNA Polymerase {lambda} Protects Mouse Fibroblasts against Oxidative DNA Damage and Is Recruited to Sites of DNA Damage/Repair J. Biol. Chem., September 9, 2005; 280(36): 31641 - 31647. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. I. Mayorov, I. B. Rogozin, L. R. Adkison, and P. J. Gearhart DNA Polymerase {eta} Contributes to Strand Bias of Mutations of A versus T in Immunoglobulin Genes J. Immunol., June 15, 2005; 174(12): 7781 - 7786. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Martomo, W. W. Yang, R. P. Wersto, T. Ohkumo, Y. Kondo, M. Yokoi, C. Masutani, F. Hanaoka, and P. J. Gearhart Different mutation signatures in DNA polymerase {eta}- and MSH6-deficient mice suggest separate roles in antibody diversification PNAS, June 14, 2005; 102(24): 8656 - 8661. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Braithwaite, R. Prasad, D. D. Shock, E. W. Hou, W. A. Beard, and S. H. Wilson DNA Polymerase {lambda} Mediates a Back-up Base Excision Repair Activity in Extracts of Mouse Embryonic Fibroblasts J. Biol. Chem., May 6, 2005; 280(18): 18469 - 18475. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Delbos, A. De Smet, A. Faili, S. Aoufouchi, J.-C. Weill, and C.-A. Reynaud Contribution of DNA polymerase {eta} to immunoglobulin gene hypermutation in the mouse J. Exp. Med., April 18, 2005; 201(8): 1191 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Wilson, A. Vaisman, S. A. Martomo, P. Sullivan, L. Lan, F. Hanaoka, A. Yasui, R. Woodgate, and P. J. Gearhart MSH2-MSH6 stimulates DNA polymerase {eta}, suggesting a role for A:T mutations in antibody genes J. Exp. Med., February 22, 2005; 201(4): 637 - 645. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Storck, F. Delbos, N. Stadler, C. Thirion-Delalande, F. Bernex, C. Verthuy, P. Ferrier, J.-C. Weill, and C.-A. Reynaud Normal Immune System Development in Mice Lacking the Deltex-1 RING Finger Domain Mol. Cell. Biol., February 15, 2005; 25(4): 1437 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Ruiz, D. Lucas, E. Garcia-Palomero, A. I. Saez, M. A. Gonzalez, M. A. Piris, A. Bernad, and L. Blanco Overexpression of human DNA polymerase {micro} (Pol {micro}) in a Burkitt's lymphoma cell line affects the somatic hypermutation rate Nucleic Acids Res., November 1, 2004; 32(19): 5861 - 5873. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tippin, S. Kobayashi, J. G. Bertram, and M. F. Goodman To Slip or Skip, Visualizing Frameshift Mutation Dynamics for Error-prone DNA Polymerases J. Biol. Chem., October 29, 2004; 279(44): 45360 - 45368. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zariwala, W. K. O'Neal, P. G. Noone, M. W. Leigh, M. R. Knowles, and L. E. Ostrowski Investigation of the Possible Role of a Novel Gene, DPCD, in Primary Ciliary Dyskinesia Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 428 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Covo, L. Blanco, and Z. Livneh Lesion Bypass by Human DNA Polymerase {micro} Reveals a Template-dependent, Sequence-independent Nucleotidyl Transferase Activity J. Biol. Chem., January 9, 2004; 279(2): 859 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Lee, L. Blanco, T. Zhou, M. Garcia-Diaz, K. Bebenek, T. A. Kunkel, Z. Wang, and L. F. Povirk Implication of DNA Polymerase {lambda} in Alignment-based Gap Filling for Nonhomologous DNA End Joining in Human Nuclear Extracts J. Biol. Chem., January 2, 2004; 279(1): 805 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bebenek, M. Garcia-Diaz, L. Blanco, and T. A. Kunkel The Frameshift Infidelity of Human DNA Polymerase {lambda}: IMPLICATIONS FOR FUNCTION J. Biol. Chem., September 5, 2003; 278(36): 34685 - 34690. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Winter, Q. H. Phung, X. Zeng, E. Seeberg, D. E. Barnes, T. Lindahl, and P. J. Gearhart Normal Somatic Hypermutation of Ig Genes in the Absence of 8-Hydroxyguanine-DNA Glycosylase J. Immunol., June 1, 2003; 170(11): 5558 - 5562. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Longacre, T. Sun, R. E. Goldsby, B. D. Preston, and U. Storb Ig gene somatic hypermutation in mice defective for DNA polymerase {delta} proofreading Int. Immunol., April 1, 2003; 15(4): 477 - 481. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Maga, G. Villani, K. Ramadan, I. Shevelev, N. T. Le Gac, L. Blanco, G. Blanca, S. Spadari, and U. Hubscher Human DNA Polymerase lambda Functionally and Physically Interacts with Proliferating Cell Nuclear Antigen in Normal and Translesion DNA Synthesis J. Biol. Chem., December 6, 2002; 277(50): 48434 - 48440. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yavuz, A. S. Yavuz, K. H. Kraemer, and P. E. Lipsky The Role of Polymerase {eta} in Somatic Hypermutation Determined by Analysis of Mutations in a Patient with Xeroderma Pigmentosum Variant J. Immunol., October 1, 2002; 169(7): 3825 - 3830. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. I. Pavlov, I. B. Rogozin, A. P. Galkin, A. Y. Aksenova, F. Hanaoka, C. Rada, and T. A. Kunkel Correlation of somatic hypermutation specificity and A-T base pair substitution errors by DNA polymerase eta during copying of a mouse immunoglobulin kappa light chain transgene PNAS, July 23, 2002; 99(15): 9954 - 9959. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |