The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bertocci, B.
Right arrow Articles by Reynaud, C.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bertocci, B.
Right arrow Articles by Reynaud, C.-A.
The Journal of Immunology, 2002, 168: 3702-3706.
Copyright © 2002 by The American Association of Immunologists

Cutting Edge

Cutting Edge: DNA Polymerases µ and {lambda} Are Dispensable for Ig Gene Hypermutation1

Barbara Bertocci*, Annie De Smet*, Eric Flatter*, Auriel Dahan*, Jean-Christophe Bories{dagger}, Catherine Landreau{ddagger}, Jean-Claude Weill2,* and Claude-Agnès Reynaud2,3,*

* Institut National de la Santé et de la Recherche Médicale, Unité 373, Faculté de Médecine Necker-Enfants Malades, and {dagger} Institut National de la Santé et de la Recherche Médicale, Unité 462, Hôpital Saint-Louis, Center Hayem, Paris, France; and {ddagger} Service d’Expérimentation Animale et de Transgénèse du Centre National de la Recherche Scientifique, Villejuif, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Mutations arising in Ig V genes during an immune response are most likely introduced by one or several error-prone DNA polymerases. Many of the recently described nonreplicative DNA polymerases have an intrinsic fidelity compatible with such an activity, the strongest candidates being polymerase (pol) {eta}, pol {iota}, pol {zeta}, and pol µ. We report in this work that mice inactivated for either of the two polymerases related to pol {beta} (i.e., pol µ and pol {lambda}) are viable and fertile and display a normal hypermutation pattern.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Thirty-five years after the initial proposition of Brenner and Milstein (1), it is now generally considered that somatic mutations introduced in Ig genes involve the participation of an error-prone DNA polymerase (reviewed in Ref. 2). The specific characteristics of these mutations appear indeed poorly compatible with other types of DNA-modifying activities, as, for example, chemical alterations or base modifications. Among these characteristics are a bias for transitions, a low frequency of deletions and duplications (but no insertions), and the occurrence of slippage events at short repeated sequences (3).

Polymerase (pol)4 {beta} has long been the only known nonreplicative DNA polymerase whose intrinsic fidelity, in the 10-3 range, would be compatible with the estimated mutation rate of Ig genes (4). However, inactivation of this enzyme by gene targeting has excluded its participation in the mutation process (5). Over the past 4 years, nine additional DNA polymerases (if one includes Rev1, a deoxycytidyl transferase) have been identified (reviewed in Ref. 2). Although many of these enzymes have bacterial or yeast homologs with known repair function, their precise role in mammalian cells remains hypothetical for most of them (3, 6).

Among the candidates for hypermutation is a group of DNA polymerases described collectively as lesion bypass enzymes. The participation of several of them has been proposed in hypermutation (7, 8, 9, 10), but no direct evidence points so far to the implication of a unique enzyme in this process.

We reported previously that the mutation pattern of microsatellite sequences embedded in the Ig locus share striking similarities with the synthesis errors generated in vitro by pol {beta} (11). Therefore, we have searched for new DNA polymerases related to this enzyme, which, together with Tdt, belongs to the polX family. We have discovered two such enzymes, pol {lambda} and pol µ (12), which have been independently identified by other groups (13, 14, 15). Pol {lambda} has 54% homology with pol {beta}, while pol µ is closer to Tdt, an enzyme whose only function is to contribute to the T and B cell repertoire by diversification of V(D)J junctions during rearrangement of TCR and Ig genes. Its homology with a lymphoid-specific enzyme and its higher expression in lymphoid tissues have made pol µ a strong candidate for the Ig mutase (12, 13). For pol {lambda}, its low ubiquitous expression and its lack of proofreading activity (12) make it a possible candidate as well. We report in this work the generation of gene-targeted mice for these two enzymes and the lack of incidence of their inactivation on the Ig gene mutation process.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Construction of targeting vectors

{lambda} phages spanning 20 kb of both {lambda} and µ genes were isolated from a mouse 129/SvJ genomic library ({lambda}FixII; Stratagene, La Jolla, CA). One phage for each gene was selected, and 5' and 3' fragments flanking the region to be deleted were amplified. For pol µ, a 3.9-kb 5' fragment was amplified using primers in exons 3 and 6, respectively; a 3.5-kb 3' fragment spanned from exon 10 up to the end of the phage insert. For pol {lambda}, a large part of the genomic sequence was available (AC003694): a 5-kb 5' fragment was amplified with primers located, respectively, 1.8 kb upstream from the ATG codon and at the end of the intron between exons 4 and 5; a 3.8-kb 3' fragment spanned from the 5' border of the intron between exons 7 and 8 up to the end of the phage insert, ~3 kb downstream from the stop codon. Fragments were inserted either blunt or using restriction sites added in the primers in the XhoI and SalI cloning sites flanking the neomycin resistance gene of the pLNTK vector (a gift from F. W. Alt, Harvard Medical School, Boston, MA) (16). Additional NotI and SfiI sites have been introduced in this vector to be used for linearization.

Generation of gene-targeted mice

E14.1 embyronic stem (ES) cells (a gift from K. Rajewsky, Institute for Genetics, Cologne, Germany) were transfected as described (17). G418- and ganciclovir-resistant clones were screened individually by PCR (30 cycles with the Long Expand PCR system according to the conditions of the supplier; Boehringer Mannheim, Mannheim, Germany), using the following gene-specific primers, amplifying both the endogenous genes and the construct if properly targeted (see location in Figs. 1Go and 2Go): pol µ 5' primer, GGGCAGAGTACATGCCAGTG, and 3' primer, GCTGAACCGCCGTAGCTCCC; and pol {lambda} 5' primer, GCTCCATATGGTTGCTGGGC, and 3' primer, CAGAGCTGAGGAGGAAGGATG. One positive clone among 363 was obtained for pol µ, and two among 370 were obtained for pol {lambda}. Homologous recombination was confirmed by Southern blot analysis of DNA from ES clones and from spleen of gene-targeted mice (see Figs. 1GoB and 2B). Injection of ES cells into C57BL/6 blastocysts was performed as described (17), and chimeric mice were bred into the C57BL/6 background. Genotyping of mice was performed by PCR, with simultaneous amplification of the wild-type allele (250 bp) and the gene-targeted allele (500 bp) for both pol µ and pol {lambda}. Primers were as follows: pol µ 5' primer, GGGTTGGGGTGAAGACTGC, 3' wild-type-specific primer, CTCATGGCCAACCCTGGGTC, and 3' neomycin resistance gene (neoR) primer, CATAGCGTTGGCTACCCGTG; pol {lambda} 5' primer, GCTCCATATGGTTGCTGGGC, 3' wild-type-specific primer, CAGCTCCCCAGATGTTGGAG, and 3'-neoR primer as above.



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 1. Targeted disruption of the mouse pol {lambda} gene. A, Schematic representation of the targeted pol {lambda} locus. Filled boxes represent coding exons. Primers used for the screening of targeted ES cells are represented by horizontal arrows below the targeted allele. Positions of XmnI (X) sites and of the probe used for Southern blot analysis are indicated. TK, Herpes simplex thymidine kinase gene. B, Southern blot analysis of XmnI-digested spleen DNA from wild-type, heterozygous, and homozygous pol {lambda}-deficient mice. Migration positions of the 13.5-kb wild-type allele and of the 6.5-kb targeted allele are indicated. C, Analysis of pol {lambda} RNA expression in spleen PNAhigh B cells from wild-type and pol {lambda}-deficient mice. RT-PCR amplification of the complete pol {lambda} coding sequence (1.7 kb) was performed. D, Representation of the protein domains deleted from the pol {lambda} by gene targeting. The position of the breast cancer-associated protein 1 C terminus, HhH, and polX domains relative to the pol {lambda} exons is schematized, with their replacement by the neoR.

 


View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 2. Targeted disruption of the mouse pol µ gene. A, Schematic representation of the targeted pol µ locus. Positions of the HindIII (H) sites are indicated. B, Southern blot analysis of HindIII-digested spleen DNA from wild-type, heterozygous, and homozygous pol µ-deficient mice. Migration position of the 14-kb wild-type allele and of the 7-kb targeted allele is indicated. C, Analysis of pol µ RNA expression in spleen PNAhigh B cells from wild-type and pol µ-deficient mice. RT-PCR amplification of the complete pol µ coding sequence (1.5 kb) was performed. D, Representation of the protein domains deleted from the pol µ polymerase by gene targeting. Other details are as described in Fig. 1Go

 
Analysis of pol µ and pol {lambda} expression

Spleen peanut agglutinin (PNA)high B cells from 2-mo-old animals were isolated as described previously (18). RNA was extracted from 105 cells using the RNeasy mini kit (Qiagen, Hilden, Germany) and cDNA was synthesized using the ProSTAR First-Strand RT-PCR kit (Stratagene). Primers amplifying the complete coding sequence of pol µ and pol {lambda} were used. PCR products were analyzed after gel transfer by hybridization with a full-length µ or {lambda} cDNA probe.

Analysis of V gene mutations

Peyer’s patch PNAhigh B cells were isolated as described previously (18). Mutations were analyzed in a 260-bp segment downstream from rearranged JH4 sequences as described (18). Pol µ-/- mice were selected between 3 and 5 mo of age, and pol {lambda}-/- mice were selected at 4 mo. Wild-type littermates were taken as controls.

Flow cytometric analysis

Splenic cell suspensions from 4-wk-old mice were stained with FITC-conjugated goat anti-mouse-IgM and PE-conjugated rat anti-mouse-IgD Abs (Southern Biotechnology Associates, Birmingham, AL) and analyzed with a FACStar apparatus (BD Biosciences, Mountain View, CA).


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
DNA polymerases µ and {lambda} share a similar organization comprising a DNA polymerase domain, two HhH (helix-hairpin-helix) domains, and, unlike pol {beta}, an N-terminal breast cancer-associated protein 1 C terminus domain that could mediate protein-protein interactions (named after the prototypal C-terminal domain of the breast cancer protein 1) (19). Because multiple splicing variants have been described for both polymerases (12), we chose not to delete their first exon, but rather their catalytic domain. Exons 5–7 were deleted in the pol {lambda}-targeted allele, thus removing not only the DNA polymerase catalytic site but also the first HhH domain corresponding to the 5'-deoxyribose phosphate lyase activity (20) (Fig. 1Go). For pol µ, exons 7–9 were deleted and exons 6 and 10 were truncated, resulting in the deletion of most of the polX domain (Fig. 2Go). The residues characterized in pol {beta} and pol {lambda} as critical for the 5'-deoxyribose phosphate lyase activity are conserved in the first HhH domain of neither pol µ nor Tdt, making it unlikely that these enzymes possess an enzymatic activity other than their nucleotidyl transferase function (20, 21). Homologous recombination was confirmed by Southern blot on both the ES clones chosen for injection and spleen DNA from the resulting heterozygous and homozygous mice (Figs. 1GoB and 2B). No expression was detected in either case upon amplification of the complete coding sequence (Figs. 1GoC and 2C).

Homozygous knockout (k.o.) mice were viable and were obtained in both cases with normal mendelian segregation. Despite the strong expression seen in testis for pol {lambda}, the male k.o. mice were fertile, and homozygous breeding has been performed up to the third generation without noticeable problem. Pol µ-deficient mice were also bred as homozygous mutants.

To assess the possible contribution of these polymerases to the Ig gene hypermutation process, Ig gene mutations from chronically stimulated B cells were analyzed. PNAhigh B cells were sorted from Peyer’s patches of 3- to 5-mo-old animals, and mutations occurring within 260 bp flanking rearranged JH4 segments, i.e., within nonselected sequences, were studied.

Mutations obtained from both types of k.o. mice appear normal in every aspect, compared with littermate control animals. They are quantitatively similar, expressed either as average mutation frequency, the differences observed being within the range of the normal individual variations (Table IGo), or as distribution of mutations per sequence (Fig. 3Go). Qualitatively, the relative mutation frequency of the four nucleotides, as well as the transition:transversion ratio, is comparable (Table IIGo). Distribution of mutations along the JH4 intronic sequence is also similar between controls and k.o. mice, with a similar targeting of hot spot positions (Fig. 4Go).


View this table:
[in this window]
[in a new window]
  		Table I. Mutations in JH4 flanking sequences from PNAhigh Peyer’s patch B cells of DNA pol µ- and {lambda}-deficient mice

 


View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 3. Accumulation of mutations among JH4 flanking sequences of Peyer’s patch PNAhigh B cells from pol µ- and pol {lambda}-deficient mice. Sequences reported in Table IGo were analyzed according to the relative distribution of sequences harboring a given number of mutations. Littermate controls of both k.o. mice were pooled.

 

View this table:
[in this window]
[in a new window]
  		Table II. Percentage of nucleotide substitution in JH4 flanking sequences from PNAhigh Peyer’s patch B cells of DNA pol {lambda}- and µ-deficient mice1

 


View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 4. Distribution of mutations along JH4 flanking sequences of Peyer’s patch PNAhigh B cells from pol µ- and pol {lambda}-deficient mice. Mutations listed in Table IGo were analyzed for their distribution along JH4 flanking sequences. Hot spot positions are marked for control mice, with the targeted nucleotide underlined in a 4-base context.

 
A role of pol {lambda} in meiosis and in base excision repair has been proposed (14, 20). An overall histological examination of various tissues from pol {lambda}-deficient mice has been performed without revealing any defect (data not shown). Nevertheless, apoptosis within specific tissues, in particular during embryonic development, remains to be assessed. The perfect viability and fertility of pol {lambda}-deficient mice over several generations argues that this enzyme is dispensable for mouse development. Most repair polymerases are highly expressed in testis, as, for example, {beta}, {zeta}, {kappa}, or {iota}; therefore, there might be some redundancy between them, at least over the time scale of a few generations. Moreover, whatever its contribution to base excision repair might be, pol {lambda} is unable to substitute for the repair function of pol {beta} during early mouse development, the inactivation of the latter being lethal at birth due to massive embryonic neuronal apoptosis (22). However, the lack of phenotype of pol {lambda} deficiency is quite unexpected, considering the strong interspecies conservation of this enzyme, which has a putative ortholog in plants (14).

Pol µ has been considered a good candidate for the elusive Ig gene mutase according to several criteria (12, 13): 1) its very strong homology with Tdt, a strictly lymphoid-specific enzyme whose contribution is crucial to diversify the third complementarity-determining region of Ig and TCR genes during V(D)J rearrangement; 2) despite a ubiquitous expression, a higher level of transcription in lymphoid tissues, in particular B cells from tonsils, but also, and obviously not in favor of an Ig mutase, in thymus; 3) its rather high level of infidelity during DNA synthesis, which classified it as one of the most error-prone polymerases described so far (13). However, the last point was challenged recently, this enzyme being more prone to generate frameshifts based on misalignments of primer template in vitro than to perform strict base misincorporations (23). No specific defect was detected by histology in nonlymphoid tissues of pol µ-deficient mice (data not shown). In contrast, about half of the mice have a marked depletion of B cells in peripheral lymphoid organs. Indeed, flow cytometric analysis of splenic lymphoid cells showed that, among 20 mice between 4 and 16 wk of age, 10 have a splenic B:T cell ratio between 18 and 28%, while the others have values between 33 and 59%, i.e., within the normal variation range. Nevertheless, the B cell maturation monitored by the progressive diminution in surface IgM with concomitant increase in IgD appears unaffected. Representative cases are shown in Fig. 5Go. We are currently investigating what type of lymphoid-specific DNA transaction involving pol µ could generate such a B cell deficit, with these rather surprising individual variations.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5. Flow cytometric analysis of the splenic B cell compartment of pol µ- and pol {lambda}-deficient mice. Spleen cells from pol µ- and pol {lambda}-deficient mice, gated on lymphoid cells, were stained with anti-IgM and anti-IgD Abs, and the fraction of IgD+IgM+ cells is indicated. Pol µ-/- (2) mouse has a marked B cell deficit, whereas the value for pol µ-/- (1) still matches the lower edge of control values.

 
It has been suggested that several of the translesional DNA polymerases may cooperate in the hypermutation process, and, more precisely, that G/C and A/T targeted mutations could be generated by two different steps and/or enzymes (Ref. 24 ; discussed in Ref. 3). In any event, considering the complete neutral effect of pol µ deletion on the mutation profile of Ig genes, it appears unlikely that this enzyme is involved at any step of the process.


   Acknowledgments
 
We thank C. Garcia and F. Delbos for performing cell sorting and Ana Cumano for help with the analysis of lymphoid development of pol µ- and pol {lambda}-deficient mice.


   Footnotes
 
1 This work has been supported by the APEX program of Institut National de la Santé et de la Recherche Médicale, the Association pour la Recherche contre le Cancer, and the Fondation Princesse Grace de Monaco. Back

2 J.-C.W. and C.-A.R. share equal senior authorship. Back

3 Address correspondence and reprint requests to Dr. Claude-Agnès Reynaud, Institut National de la Santé et de la Recherche Médicale, Unité 373, Faculté de Médecine Necker-Enfants Malades, 156 rue de Vaugirard, 75730 Paris Cedex 15, France. E-mail address: reynaud{at}necker.fr Back

4 Abbreviations used in this paper: pol, polymerase; ES, embyronic stem; neoR, neomycin resistance gene; k.o., knockout; HhH, helix-hairpin-helix; PNA, peanut agglutinin. Back

Received for publication January 11, 2002. Accepted for publication February 21, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Brenner, S., C. Milstein. 1966. Origin of antibody variation. Nature 211:242.[Medline]
  2. Gearhart, P. J., R. D. Wood. 2001. Emerging links between hypermutation of Ab genes and DNA polymerases. Nat. Rev. Immunol. 1:187.[Medline]
  3. Weill, J.-C., B. Bertocci, A. Faili, S. Aoufouchi, S. Frey, A. de Smet, S. Storck, A. Dahan, F. Delbos, S. Weller, et al 2002. Ig gene hypermutation: a mechanism is due. Adv. Immunol. 80:183.[Medline]
  4. Kunkel, T.. 1992. DNA replication fidelity. J. Biol. Chem. 260:5787.[Abstract/Free Full Text]
  5. Esposito, G., G. Texido, U. A. Betz, H. Gu, W. Müller, U. Klein, K. Rajewsky. 2000. Mice reconstituted with DNA polymerase {beta}-deficient fetal liver cells are able to mount a T cell-dependent immune response and mutate their Ig genes normally. Proc. Natl. Acad. Sci. USA 97:1166.[Abstract/Free Full Text]
  6. Goodman, M. F., B. Tippin. 2000. The expanding polymerase universe. Nat. Rev. Mol. Cell Biol. 1:101.[Medline]
  7. Zeng, X., D. B. Winter, C. Kasmer, K. H. Kraemer, A. R. Lehmann, P. J. Gearhart. 2001. DNA polymerase {eta} is an A-T mutator in somatic hypermutation of immunoglobulin variable genes. Nat. Immunol. 2:537.[Medline]
  8. Zan, H., A. Komori, Z. Li, A. Cerutti, A. Schaffer, M. F. Flajnik, M. Diaz, P. Casali. 2001. The translesion DNA polymerase {zeta} plays a major role in Ig and bcl-6 somatic hypermutation. Immunity 14:643.[Medline]
  9. Diaz, M., L. K. Verkoczy, M. Flajnik, N. R. Klinman. 2001. Decreased frequency of somatic hypermutation and impaired affinity maturation but intact germinal center formation in mice expressing antisense RNA to DNA polymerase {zeta}. J. Immunol. 167:327.[Abstract/Free Full Text]
  10. Poltoratsky, V., C. J. Woo, B. Tippin, A. Martin, M. F. Goodman, M. D. Scharff. 2001. Expression of error-prone polymerases in BL2 cells activated for Ig somatic hypermutation. Proc. Natl. Acad. Sci. USA 98:7976.[Abstract/Free Full Text]
  11. Bertocci, B., L. Quint, F. Delbos, C. Garcia, C.-A. Reynaud, J.-C. Weill. 1998. Probing immunoglobulin gene hypermutation with microsatellites suggests a non-replicative short patch DNA synthesis process. Immunity 9:257.[Medline]
  12. Aoufouchi, S., E. Flatter, A. Dahan, A. Faili, B. Bertocci, S. Storck, F. Delbos, L. Cocea, N. Gupta, J.-C. Weill, C.-A. Reynaud. 2000. Two novel human and mouse DNA polymerases of the polX family. Nucleic Acids Res. 28:3684.[Abstract/Free Full Text]
  13. Dominguez, O., J. F. Ruiz, T. Lain de Lera, M. Garcia-Diaz, M. A. Gonzalez, T. Kirchhoff, C. Martinez-A, A. Bernad, L. Blanco. 2000. DNA polymerase µ (Pol µ), homologous to TdT, could act as a DNA mutator in eukaryotic cells. EMBO J. 19:1731.[Medline]
  14. Garcia-Diaz, M., O. Dominguez, L. A. Lopez-Fernandez, L. T. de Lera, M. L. Saniger, J. F. Ruiz, M. Parraga, M. J. Garcia-Ortiz, T. Kirchhoff, J. del Mazo, et al 2000. DNA polymerase lambda (Pol {lambda}), a novel eukaryotic DNA polymerase with a potential role in meiosis. J. Mol. Biol. 301:851.[Medline]
  15. Nagasawa, K., K. Kitamura, A. Yasui, Y. Nimura, K. Ikeda, M. Hirai, A. Matsukage, M. Nakanishi. 2000. Identification and characterization of human DNA polymerase {beta}2, a DNA polymerase {beta}-related enzyme. J. Biol. Chem. 275:31233.[Abstract/Free Full Text]
  16. Gorman, J. R., N. van der Stoep, R. Monroe, M. Cogné, L. Davidson, F. W. Alt. 1996. The Ig{kappa} 3' enhancer influences the ratio of Ig{kappa} versus Ig{lambda} B lymphocytes. Immunity 5:241.[Medline]
  17. Torres, R., R. Kühn. 1997. Laboratory Protocols for Conditional Gene Targeting Oxford Univ. Press., Oxford.
  18. Frey, S., B. Bertocci, F. Delbos, L. Quint, J.-C. Weill, C.-A. Reynaud. 1998. Mismatch repair deficiency interferes with the accumulation of mutations in chronically stimulated B cells and not with the hypermutation process. Immunity 9:127.[Medline]
  19. Bork, P., K. Hofmann, P. Bucher, A. F. Neuwald, S. F. Altschul, E. V. Koonin. 1997. A superfamily of conserved domains in DNA damage-responsive cell cycle checkpoint proteins. FASEB J. 11:68.[Abstract]
  20. Garcia-Diaz, M., K. Bebenek, T. A. Kunkel, L. Blanco. 2001. Identification of an intrinsic 5'-deoxyribose-5-phosphate lyase activity in human DNA polymerase {lambda}: a possible role in base excision repair. J. Biol. Chem. 276:34659.[Abstract/Free Full Text]
  21. Prased, R., W. A. Beard, J. Y. Chyan, M. M. Maciejewski, G. P. Mullen, S. H. Wilson. 1998. Functional analysis of the amino-terminal 8-kDa domain of DNA polymerase {beta} as revealed by site-directed mutagenesis: DNA binding and 5'-deoxyribose phosphate lyase activities. J. Biol. Chem. 273:11121.[Abstract/Free Full Text]
  22. Sugo, N., Y. Aratani, Y. Nagashima, Y. Kubota, H. Koyama. 2000. Neonatal lethality with abnormal neurogenesis in mice deficient in DNA polymerase {beta}. EMBO J. 19:1397.[Medline]
  23. Zhang, Y., X. Wu, F. Yuan, Z. Xie, Z. Wang. 2001. Highly frequent frameshift DNA synthesis by human DNA polymerase µ. Mol. Cell. Biol. 21:7995.[Abstract/Free Full Text]
  24. Rada, C., M. R. Ehrenstein, M. S. Neuberger, C. Milstein. 1998. Hot spot focusing of somatic hypermutation in MSH2-deficient mice suggests two stages of mutational targeting. Immunity 9:135.[Medline]



This article has been cited by other articles:


Home page
 Toxicol PatholHome page
A. Livraghi and S. H. Randell
Cystic Fibrosis and Other Respiratory Diseases of Impaired Mucus Clearance
Toxicol Pathol, January 1, 2007; 35(1): 116 - 129.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
R. Juarez, J. F. Ruiz, S. A. N. McElhinny, D. Ramsden, and L. Blanco
A specific loop in human DNA polymerase mu allows switching between creative and DNA-instructed synthesis
Nucleic Acids Res., September 11, 2006; 34(16): 4572 - 4582.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. A. Fiala, W. W. Duym, J. Zhang, and Z. Suo
Up-regulation of the Fidelity of Human DNA Polymerase {lambda} by Its Non-enzymatic Proline-rich Domain
J. Biol. Chem., July 14, 2006; 281(28): 19038 - 19044.
[Abstract] [Full Text] [PDF]

Home page
 Hum Reprod UpdateHome page
D. Escalier
Knockout mouse models of sperm flagellum anomalies
Hum. Reprod. Update, July 1, 2006; 12(4): 449 - 461.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. K. Braithwaite, P. S. Kedar, L. Lan, Y. Y. Polosina, K. Asagoshi, V. P. Poltoratsky, J. K. Horton, H. Miller, G. W. Teebor, A. Yasui, et al.
DNA Polymerase {lambda} Protects Mouse Fibroblasts against Oxidative DNA Damage and Is Recruited to Sites of DNA Damage/Repair
J. Biol. Chem., September 9, 2005; 280(36): 31641 - 31647.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
V. I. Mayorov, I. B. Rogozin, L. R. Adkison, and P. J. Gearhart
DNA Polymerase {eta} Contributes to Strand Bias of Mutations of A versus T in Immunoglobulin Genes
J. Immunol., June 15, 2005; 174(12): 7781 - 7786.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. A. Martomo, W. W. Yang, R. P. Wersto, T. Ohkumo, Y. Kondo, M. Yokoi, C. Masutani, F. Hanaoka, and P. J. Gearhart
Different mutation signatures in DNA polymerase {eta}- and MSH6-deficient mice suggest separate roles in antibody diversification
PNAS, June 14, 2005; 102(24): 8656 - 8661.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. K. Braithwaite, R. Prasad, D. D. Shock, E. W. Hou, W. A. Beard, and S. H. Wilson
DNA Polymerase {lambda} Mediates a Back-up Base Excision Repair Activity in Extracts of Mouse Embryonic Fibroblasts
J. Biol. Chem., May 6, 2005; 280(18): 18469 - 18475.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
F. Delbos, A. De Smet, A. Faili, S. Aoufouchi, J.-C. Weill, and C.-A. Reynaud
Contribution of DNA polymerase {eta} to immunoglobulin gene hypermutation in the mouse
J. Exp. Med., April 18, 2005; 201(8): 1191 - 1196.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
T. M. Wilson, A. Vaisman, S. A. Martomo, P. Sullivan, L. Lan, F. Hanaoka, A. Yasui, R. Woodgate, and P. J. Gearhart
MSH2-MSH6 stimulates DNA polymerase {eta}, suggesting a role for A:T mutations in antibody genes
J. Exp. Med., February 22, 2005; 201(4): 637 - 645.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Storck, F. Delbos, N. Stadler, C. Thirion-Delalande, F. Bernex, C. Verthuy, P. Ferrier, J.-C. Weill, and C.-A. Reynaud
Normal Immune System Development in Mice Lacking the Deltex-1 RING Finger Domain
Mol. Cell. Biol., February 15, 2005; 25(4): 1437 - 1445.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
J. F. Ruiz, D. Lucas, E. Garcia-Palomero, A. I. Saez, M. A. Gonzalez, M. A. Piris, A. Bernad, and L. Blanco
Overexpression of human DNA polymerase {micro} (Pol {micro}) in a Burkitt's lymphoma cell line affects the somatic hypermutation rate
Nucleic Acids Res., November 1, 2004; 32(19): 5861 - 5873.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Tippin, S. Kobayashi, J. G. Bertram, and M. F. Goodman
To Slip or Skip, Visualizing Frameshift Mutation Dynamics for Error-prone DNA Polymerases
J. Biol. Chem., October 29, 2004; 279(44): 45360 - 45368.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
M. Zariwala, W. K. O'Neal, P. G. Noone, M. W. Leigh, M. R. Knowles, and L. E. Ostrowski
Investigation of the Possible Role of a Novel Gene, DPCD, in Primary Ciliary Dyskinesia
Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 428 - 434.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Covo, L. Blanco, and Z. Livneh
Lesion Bypass by Human DNA Polymerase {micro} Reveals a Template-dependent, Sequence-independent Nucleotidyl Transferase Activity
J. Biol. Chem., January 9, 2004; 279(2): 859 - 865.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. W. Lee, L. Blanco, T. Zhou, M. Garcia-Diaz, K. Bebenek, T. A. Kunkel, Z. Wang, and L. F. Povirk
Implication of DNA Polymerase {lambda} in Alignment-based Gap Filling for Nonhomologous DNA End Joining in Human Nuclear Extracts
J. Biol. Chem., January 2, 2004; 279(1): 805 - 811.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Bebenek, M. Garcia-Diaz, L. Blanco, and T. A. Kunkel
The Frameshift Infidelity of Human DNA Polymerase {lambda}: IMPLICATIONS FOR FUNCTION
J. Biol. Chem., September 5, 2003; 278(36): 34685 - 34690.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. B. Winter, Q. H. Phung, X. Zeng, E. Seeberg, D. E. Barnes, T. Lindahl, and P. J. Gearhart
Normal Somatic Hypermutation of Ig Genes in the Absence of 8-Hydroxyguanine-DNA Glycosylase
J. Immunol., June 1, 2003; 170(11): 5558 - 5562.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
A. Longacre, T. Sun, R. E. Goldsby, B. D. Preston, and U. Storb
Ig gene somatic hypermutation in mice defective for DNA polymerase {delta} proofreading
Int. Immunol., April 1, 2003; 15(4): 477 - 481.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Maga, G. Villani, K. Ramadan, I. Shevelev, N. T. Le Gac, L. Blanco, G. Blanca, S. Spadari, and U. Hubscher
Human DNA Polymerase lambda Functionally and Physically Interacts with Proliferating Cell Nuclear Antigen in Normal and Translesion DNA Synthesis
J. Biol. Chem., December 6, 2002; 277(50): 48434 - 48440.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Yavuz, A. S. Yavuz, K. H. Kraemer, and P. E. Lipsky
The Role of Polymerase {eta} in Somatic Hypermutation Determined by Analysis of Mutations in a Patient with Xeroderma Pigmentosum Variant
J. Immunol., October 1, 2002; 169(7): 3825 - 3830.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. I. Pavlov, I. B. Rogozin, A. P. Galkin, A. Y. Aksenova, F. Hanaoka, C. Rada, and T. A. Kunkel
Correlation of somatic hypermutation specificity and A-T base pair substitution errors by DNA polymerase eta during copying of a mouse immunoglobulin kappa light chain transgene
PNAS, July 23, 2002; 99(15): 9954 - 9959.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bertocci, B.
Right arrow Articles by Reynaud, C.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bertocci, B.
Right arrow Articles by Reynaud, C.-A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS