| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Max Delbrück Center for Molecular Medicine, Cellular Neuroscience, Berlin, Germany;
University of Groningen, Medical Physiology, Groningen, The Netherlands;
Max Delbrück Center for Molecular Medicine, Molecular Tumorgenetics and Immunogenetics, Berlin, Germany; and
Ina Sue Perlmutter Laboratory, Children’s Hospital, Harvard Medical School, Boston, MA 02115
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chemokine ligand (CCL21)3; damaged
neurons in vitro and in vivo rapidly induce CCL21 expression
(6). Because CCL21 induces intracellular calcium signals
and chemotaxis of cultured microglia, a potential role of CCL21 in
neuron-microglia communication has been proposed (6).
Electrophysiological responses are the most rapid form of cellular
communication, and we have therefore used the patch-clamp technique to
record changes in membrane currents of microglia in response to CCL21.
The membrane channel pattern of microglial cells is unique for CNS
cells and furthermore different with respect to non-CNS macrophages.
Therefore, this physiological fingerprint is used to identify
microglial cells in culture and brain slices (7).
CCL21 (formerly known as secondary lymphoid organ chemokine, TCA4,
6Ckine or exodus-2) is a lymphoid chemokine and is
constitutively expressed in secondary lymphoid organs. It controls the
homing of naive T cells and mature dendritic cells, all of which
express the corresponding receptor CCR7 (8, 9). Other
chemokines are inflammatory like CXCL10 (formerly known as
IFN-
-inducible protein 10), which is induced under inflammatory
conditions and controls the infiltration of the inflamed tissue by
CXCR3-expressing lymphocytes (10). Chemokines mediate
their biological activities through G-protein-coupled cell surface
receptors of the seven-transmembrane domain, rhodopsin-type superfamily
(11, 12). As in the periphery, chemokines are also highly
expressed in CNS inflammation (13). According to their
function in the peripheral immune system, CNS chemokines have been
suggest to orchestrate the infiltration of the CNS by blood leukocytes
(14, 15), given that it is well known that all intrinsic
brain cells (neurons and glial cells) express chemokine receptors
(14). Therefore, several authors (13, 16, 17)
have suggested a possible role for chemokines in intercellular
signalling in CNS.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Microglial cells were prepared and purified from primary cultures of newborn NMRI mouse brains essentially as described previously (18, 19). In brief, brains were removed under sterile conditions from the skull and meninges, and blood vessels were carefully removed. The total brain was trypsinized for 5 min. After centrifugation, the pellet was resuspended in FCS-containing DMEM and washed twice. Finally, the cell suspension was plated in poly-L-lysine-coated tissue culture flasks (cells from two brains per flask). Thereafter, the medium was changed after 24 h and then every third day.
After 7–10 days in culture, microglia were detached from the astrocytic monolayer by manually shaking the cultures for 2–3 min. For patch-clamp experiments, isolated microglia were seeded on glass coverslips at a nonconfluent density of 3 x 104/cm2. Electrophysiological recordings were performed 1–5 days after the isolation procedure. For chemotaxis assays, detached microglial cells were washed once and directly used. Cell media and supplements were purchased from Seromed/Biochrom (Berlin, Germany).
CCR7 and CXCR3 knockout (-/-) mice
Homozygotes of the CCR7 and CXCR3 knockout line were used. Microglial cultures were prepared from CCR7 and CXCR3 knockout mice as described above. Generation of the knockout lines have been described previously (20, 21).
Drugs and solutions
HEPES-buffered salt solution contained 150 mM NaCl, 5.4 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 5 mM HEPES, and 10 mM glucose, adjusted to pH 7.4 with NaOH. The bicarbonate-buffered salt solution contained 134 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 1.3 mM MgCl2, 1.25 mM K2HPO4, 26 mM NaHCO3, and 10 mM glucose. The recombinant CCL21 and CXCL10 from PeproTech EC (London, U.K.) and CCL19 from R&D (London, U.K.) were prepared as 10 µM stock solutions in PBS. The human recombinant C5a was purchased from Sigma (Deisenhofen, Germany) and prepared as a 2 x 10-4 M stock solution in PBS and 0.1% BSA. For the chloride substitution experiments, NaCl was replaced by equimolar amounts of 500 µM sodium gluconate and 1 mM 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS) and 4-acetamido-4'-isothiocynatostilbene-2,2'-disulfonic acid (SITS) were dissolved in the HEPES bath solution. The pipette solution contained 130 mM KCl, 0.5 mM CaCl2, 3 mM MgCl2, 10 mM HEPES, and 5 mM EGTA, adjusted to pH 7.3 with KOH.
Microchemotaxis assay
Cell migration assays in response to CCL21 were performed in a 48-well microchemotaxis chamber (Neuroprobe, Bethesda, MD) as previously described (22). Briefly, lower wells were loaded with chemokines diluted in serum-free DMEM. DMEM was used as a negative control, and 100 nM C5a was used as a positive control. Upper and lower wells were separated by a polycarbonate filter (8-µm pore size; Poretics, Livermore, CA). Microglial cells (2–3 x 104) in 50 µl serum-free DMEM medium were added to the upper wells, and the chamber was incubated at 37°C and 5% CO2 for 120 min. Experiments were performed in triplicates. Rate of microglial migration was calculated by counting cells in four random fields of each well using a x40 bright field objective. The chemokine-induced migration was normalized for migration of the unstimulated control groups and presented as percent of controls ± SEM. Significance levels were calculated using a one-way analysis of variance (t test). A value of p < 0.01 was considered significant.
Electrophysiology
Glass coverslips with adherent microglial cells were placed in a
recording chamber on a microscope equipped with phase-contrast optics
(Axiovert FS; Zeiss, Oberkochen, Germany). The chamber was permanently
perfused with bath solution, and all patch-clamp recordings were made
at room temperature. Voltage-clamp experiments were conducted using the
whole-cell variant of the patch-clamp technique (23).
Microelectrodes with 5–10 M
resistance were fabricated from
thin-walled borosilicate capillaries with filament. Uncompensated
whole-cell currents were recorded with an EPC-9 patch-clamp amplifier
(HEKA Electronics, Lambrecht/Pfalz, Germany) at a sampling rate of 3
kHz. Signals were filtered at 2.9 kHz. Voltage-clamp protocol, data
acquisition, storage, and analysis were controlled by software (Wintida
4.02; HEKA). Low Cl-, SITS, and DIDS were applied by
changing the bath solution. For Cl- current recordings,
the bath electrode was separated with an agar bridge of 1% agar from
the bath solution. To stimulate microglial cells with CCL21 during
patch-clamp recordings, we used a second application pipette, which was
filled with 10 µM CCL21 and placed close to the cell.
CCL21-containing solution was ejected by applying pressure to the rear
of the pipette. As a control for the application system, PBS was
ejected from a similar type of micropipette; only in 1 of 18 cells was
a change in membrane conductance observed.
The preparation of acute brain slices of 6-wk-old mice was as described previously (24). Briefly, 130-µm-thick slices were cut with a vibratome (Vibracut; FTB Feinwerktechnik, Bensheim, Germany) in ice-cold bicarbonate-buffered salt solution gassed with carbogen (5% CO2 and 95% O2). For identification of microglial cells, slices were stained for 45 min at 37°C with 100 µg/ml Texas Red-coupled tomato lectin (Sigma).
RT-PCR
Cells and brain material were lysed in guanidinium isothiocyanate-mercaptoethanol buffer, and total RNA was extracted with slight modifications according to the method of Chomczynski and Sacchi (25).
Reverse transcription. One microgram of total RNA was transcribed into cDNA as described (26). Potential contaminations by genomic DNA were checked by running the reactions without reverse transcriptase and using GAPDH primers (housekeeping gene) in subsequent PCR amplifications. Only RNA samples that showed no bands (no contamination) were used for further investigation.
PCR. Two microliters of the RT reaction were used in subsequent PCR amplification as described (26). Cloning into pCRII (Invitrogen, San Diego, CA), and subsequent sequencing verified the identity of the PCR products.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To test for the presence of functional CCL21 receptors on cultured
microglial cells, we used the patch-clamp technique to analyze
conductance changes after applying the ligand CCL21. To obtain
CCL21-induced current changes, we repetitively clamped the membrane at
a holding potential of -20 mV for a series of voltage steps ranging
from -120 to +60 mV (100 ms/step, 100-ms interval, 20-mV increment,
150-Hz sampling frequency, every 5 s). CCL21 was applied by pressure
ejection from a micropipette, which was placed close to the cell (30-s
application, 10 µM). In 12 of 21 cells, CCL21 activated a long
lasting membrane conductance (Fig 1A
).
This current activated slowly and continued to increase after CCL21 had
already been washed out. The CCL21-induced membrane conductance
(average, 5.2 ns) reached its peak after 
5 min, and returned to its
resting level 10 min after the application of CCL21. To isolate the
CCL21-induced current at high time resolution (3-kHz sampling
frequency), we repetitively clamped the membrane for 50 ms at a holding
potential of -20 mV for a series of nine depolarizing and
hyperpolarizing voltage steps with an increment of 10 mV. The
current-voltage curve of the CCL21-induced current (Fig. 1A)
showed an outward rectification and a reversal potential close to 0 mV.
The current did not inactivate. This suggests the involvement of either
a nonselective cation conductance or a chloride conductance. In only 4
of 12 cells, could a second CCL21 response be elicited; furthermore,
the conductance increase induced by the second application was smaller
than that of the first (data not shown).
|
B). This increase in membrane conductance was, however, not
reversible within the recording time of about 1.5 h. CCL21 triggers a long lasting Cl- conductance
To test for the ionic specificity of the CCL21-induced current,
the Cl- gradient across the membrane was altered by
decreasing extracellular Cl- concentration
([Cl-]) from 161.4 to 6 mM by equimolar substitution of
Cl- with gluconate. CCL21 was first applied and washed
out; subsequently the Cl- gradient was changed for 2 min
while the membrane conductance slowly increased (Fig. 2A). In low Cl-,
the membrane conductance decreased, mainly affecting the outward
conductance. Concomitantly, the reversal potential shifted to a more
positive value, namely to +40 mV on average (Fig. 2B). Thus,
the reversal shifts toward the new, theoretical Cl-
equilibrium potential (+80 mV), yet it is still more negative. This
discrepancy can be explained due to either decreased intracellular
Cl- activity or a significant permeability to gluconate as
described by Xu et al. (27).
|
, n = 8) and by 79 ± 4.67% for 1 mM
DIDS (not shown, n = 5). The blockade was more
pronounced with positive membrane potentials. SITS or DIDS (500 µM)
also reduced the CCL21-induced current, but slightly less effectively. CCL21 and CXCL10 act via CXCR3 receptors
CCL21 commonly acts via CCR7 receptors (28, 29, 30). We
therefore used another CCR7 ligand and studied the effect of CCL21 on
membrane currents in microglial cells derived from mice in which the
CCR7 locus has been disrupted by gene targeting. Stimulation of
microglia with CCL19 did not induce any change in membrane conductance
(n = 27, data not shown). Moreover, in microglial cells
derived from CCR7 knockout animals, CCL21 triggered an increase in
conductance similar to that in control cells. These results indicate
that CCR7 is not the receptor for CCL21 in microglia (Fig. 3A; n = 17).
|
A; n =
21).
To further confirm the expression of CXCR3 in microglia, we tested
microglial responses to CXCL10 (formerly known as IFN--inducible
proteins 10), one of the high affinity ligands for the CXCR3. CXCL10
was applied in paradigm comparable with that of CCL21 and triggered a
similar long lasting membrane conductance increase similar to CCL21
(Fig. 3B; n = 11). The CXCL10-induced
current shared all the features with the CCL21 induced current: 1) it
reversed close to 0 mV in normal bathing solution; 2) lowering of the
extracellular Cl- concentration shifted the reversal
potential of this current to more positive potentials, and led to a
reduction in the current amplitude; 3) the chloride channel blockers
DIDS and SITS reversibly reduced the CXCL10-induced current; 4) a
CXCL10-induced current was observed in microglial cells from CCR7
knockout (n = 9), but 5) not in those from CXCR3
knockout animals (n = 17).
Chemotaxis is controlled by CXCR3 receptors and impaired by Cl- channel blockers
To test for the involvement of CXCR3 receptors in microglial
chemotaxis, both the effects of CCL21 and CXCL10 in an in vitro
chemotaxis assay were investigated. Under control conditions microglial
cells showed considerable random migration. Both chemokines (Fig. 4) induced a significant increase in
chemotaxis of cultured microglia compared with unstimulated control
cells at a concentration range of 0.1 nM–1 µM
(p < 0.01). CCL21 (100 nM) and CXCL10 (100 nM)
led to an increase in infiltrating cells by 175 ± 2.10% (four
independent experiments) and 157 ± 9.33% (n =
5), respectively, as compared with controls. The chemotactic migration
of cultured microglial cells from CCR7 knockout animals in response to
100 nM CCL21 and 100 nM CXCL10 was comparable with that of wild-type
animals, namely 165 ± 9.96% for CCL21 (n = 7)
and 163 ± 11.65% for CXCL10 (n = 6). In
contrast, in microglial cells cultured from CXCR3 knockout animals,
both chemokines did not significantly increase the number of cells that
migrated into the filter, indicating that these chemokines did not
stimulate chemotactic migration (Fig. 4, n = 5).
However, the chemotactic behavior in general was not impaired in these
knockout mice, because microglial migration in response to C5a was
found (data not shown). Taken together, the results indicate that
activation of CXCR3 by CCL21 or CXCL10 stimulate the chemotactic
behavior of microglial cells.
|
B,
n = 3). The basic migratory activity of microglia, however,
was only slightly influenced by DIDS treatment; moreover, DIDS
treatment did not influence the viability of microglial cells
determined by trypan blue staining (data not shown, n =
3). The serine variant of CCL21 is the situ ligand in the brain
Two different CCL21 forms have been described recently (31). Both genes differ only in one amino acid at position 65 but are expressed in different tissues. The serine form is present in lymphoid organs in contrast to the leucine form of this chemokine (31). To investigate which form is induced in mouse brain upon ischemic brain damage, the full-length sequence of the CCL21 gene was determined by RT-PCR using the following primers: forward, #63, CAGCTCTGGTCTCATCCTCA; backward, #556, TGAACCACCCAGCTTGAAGT. Primers were designed according to the published sequence of CCL21 (AC: AF006637). PCR amplification using cDNA derived from either lymph nodes or ischemic brain gave rise to 493-bp product. Cloning and subsequent sequencing of the PCR product revealed no difference between the CCL21 expressed in lymph nodes and in ischemic mouse brain. In both cases, the serine form of CCL21 was found.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
There are two different genes for CCL21 (31). Cloning studies indicated that the CCL21 gene inducibly expressed by neurons is the same as that in lymph nodes where it is constitutively expressed (31, 34). This indicates that the chemokine CCL21 which has been described this far as a constitutive chemokine in the periphery (35) is an inducible chemokine in the CNS. Taken together, these results indicate that the CNS is an organ where CCL21 chemokine signaling is different from that of the peripheral immune system.
The induction of inflammatory chemokines such as monocyte
chemoattractant protein 1, macrophage-inflammatory proteins 1 and
1
, CXCL10, and monokine induced by IFN- in the CNS has been
described in a variety of different brain diseases
(36, 37, 38, 39, 40, 41). Microglial cells respond to any type of CNS
injury; therefore, chemokines are good candidates for signaling neural
injury to microglia. Because it has been found that neurons express
high levels of fractalkine and the corresponding receptor (CX3CR1) is
expressed in microglia, a functional role of chemokines in the
signaling from neurons to microglia has been suggested
(42). Although microglial activation was unchanged in
CX3CR1 knockout mice, other neuronal chemokines might contribute to the
signaling (43). We have recently shown that damaged
neurons in vivo and in vitro rapidly induce the expression of CCL21,
and we therefore suggest that CCL21 signals neuronal damage to
microglial cells (6). CCL21 has been demonstrated to
induce Ca2+ signals and chemotaxis in cultured microglial
cells (6). These cultured cells, however, are not a good
model for resting, ramified microglial cells in brain tissue, which are
the unactivated recipients receiving signals from injured neurons; the
culture conditions transform microglial into activated (ameboid)
phenotype. We provide first evidence that ramified microglial cells
from acutely isolated brain tissue, which display a down-regulated
immunophenotype, respond to CCL21 by the activation of a long lasting
conductance increase. Thus, neuronal CCL21 via microglial CXCR3 may
provide resting microglial cells with information on neuronal damage in
their vicinity.
Because CCL21 triggered a conductance increase in both microglial
cells in the slice and in culture, we used the cultured microglial
cells as a model to study CCL21 signaling. Brief application (30 s) of
CCL21 triggered a long lasting increase in a Cl-
conductance, which strongly changed the physiological properties of the
cell for many minutes. We also provide first evidence that the activity
of Cl- channels and the chemotactic activity are linked;
the Cl- channel blocker DIDS impaired the CCL21-induced
chemotaxis. Thus, the CCL21-induced Cl- conductance could
be an initial switch to alter microglial behavior after neuronal
injury. There is more evidence that Cl- channels influence
cellular behavior, even in microglia. A long lasting
Cl--current can be evoked by membrane stretch and is
thought to be required for the induction of ramification but not
for maintaining the ramified shape of cultured microglial cells
(44). Alternatively, Cl- channels
appear to be necessary for CSF-1-stimulated proliferation of rat
microglia (45), given that Cl- channels play
a similar role in lymphocyte proliferation and control the activation
of these cells (46). We could not yet find an effect of
CCL21 on typical parameters of microglial activation, namely basal or
LPS-induced synthesis of inflammatory cytokines (TNF-, IL-6, IL-12),
chemokines (macrophage-inflammatory protein 1, monocyte
chemoattractant protein 1) or nitric oxide (data not shown). Thus,
the CCL21/CXCR3 signaling system is rather an indicator of neuronal
damage to microglia than an induction system for microglial activation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Helmut Kettenmann, Department of Cellular Neuroscience, Max Delbrück Center for Molecular Medicine, Robert Rössle Strasse 10, 13092 Berlin, Germany. E-mail address: hketten{at}mdc-berlin.de
3 Abbreviations used in this paper: CCL, CC chemokine ligand; CXCL, CXC chemokine ligand; DIDS, 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; SITS, 4-acetamido-4'-isothiocynatostilbene-2,2'-disulfonic acid; [Cl-], chloride concentration.
Received for publication August 29, 2001. Accepted for publication January 9, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-treated microglial cells. Eur. J. Immunol. 17:1271.[Medline]
receptor CCR7. J. Cell Biol. 141:1053. in the pathogenesis of HIV associated central nervous system disorders. J. Neurovirol. 5:685.[Medline]
-inducible chemokines IP-10 and Mig and their receptor, CXCR3, in multiple sclerosis lesions. Neuropathol. Appl. Neurobiol. 26:133.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Ifuku, K. Farber, Y. Okuno, Y. Yamakawa, T. Miyamoto, C. Nolte, V. F. Merrino, S. Kita, T. Iwamoto, I. Komuro, et al. Bradykinin-Induced Microglial Migration Mediated by B1-Bradykinin Receptors Depends on Ca2+ Influx via Reverse-Mode Activity of the Na+/Ca2+ Exchanger J. Neurosci., November 28, 2007; 27(48): 13065 - 13073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Muller, S. L. Carter, M. J. Hofer, P. Manders, D. R. Getts, M. T. Getts, A. Dreykluft, B. Lu, C. Gerard, N. J. C. King, et al. CXCR3 Signaling Reduces the Severity of Experimental Autoimmune Encephalomyelitis by Controlling the Parenchymal Distribution of Effector and Regulatory T Cells in the Central Nervous System J. Immunol., September 1, 2007; 179(5): 2774 - 2786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Zhao, S. G. Waxman, and B. C. Hains Modulation of Thalamic Nociceptive Processing after Spinal Cord Injury through Remote Activation of Thalamic Microglia by Cysteine Cysteine Chemokine Ligand 21 J. Neurosci., August 15, 2007; 27(33): 8893 - 8902. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Levavasseur, P. Metharom, G. Dorban, H. Nakano, T. Kakiuchi, C. Carnaud, P. Sarradin, and P. Aucouturier Experimental scrapie in 'plt' mice: an assessment of the role of dendritic-cell migration in the pathogenesis of prion diseases J. Gen. Virol., August 1, 2007; 88(8): 2353 - 2360. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Sun, B. Yang, D. F. Donnelly, C. Ma, and R. H. LaMotte MCP-1 Enhances Excitability of Nociceptive Neurons in Chronically Compressed Dorsal Root Ganglia J Neurophysiol, November 1, 2006; 96(5): 2189 - 2199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, D. Huang, M. Matsui, T. T. He, T. Hu, J. DeMartino, B. Lu, C. Gerard, and R. M. Ransohoff Severe Disease, Unaltered Leukocyte Migration, and Reduced IFN-{gamma} Production in CXCR3-/- Mice with Experimental Autoimmune Encephalomyelitis J. Immunol., April 1, 2006; 176(7): 4399 - 4409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wang, R. Han, I. Lee, A. S. Hancock, G. Xiong, M. D. Gunn, and W. W. Hancock Permanent Survival of Fully MHC-Mismatched Islet Allografts by Targeting a Single Chemokine Receptor Pathway J. Immunol., November 15, 2005; 175(10): 6311 - 6318. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kouroumalis, R. J. Nibbs, H. Aptel, K. L. Wright, G. Kolios, and S. G. Ward The Chemokines CXCL9, CXCL10, and CXCL11 Differentially Stimulate G{alpha}i-Independent Signaling and Actin Responses in Human Intestinal Myofibroblasts J. Immunol., October 15, 2005; 175(8): 5403 - 5411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rappert, I. Bechmann, T. Pivneva, J. Mahlo, K. Biber, C. Nolte, A. D. Kovac, C. Gerard, H. W. G. M. Boddeke, R. Nitsch, et al. CXCR3-Dependent Microglial Recruitment Is Essential for Dendrite Loss after Brain Lesion J. Neurosci., September 29, 2004; 24(39): 8500 - 8509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Schultz, A. Schwarz, S. Neidhold, M. Burwinkel, C. Riemer, D. Simon, M. Kopf, M. Otto, and M. Baier Role of Interleukin-1 in Prion Disease-Associated Astrocyte Activation Am. J. Pathol., August 1, 2004; 165(2): 671 - 678. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. M. Dijkstra, S. Hulshof, P. van der Valk, H. W. G. M. Boddeke, and K. Biber Cutting Edge: Activity of Human Adult Microglia in Response to CC Chemokine Ligand 21 J. Immunol., March 1, 2004; 172(5): 2744 - 2747. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Lasagni, M. Francalanci, F. Annunziato, E. Lazzeri, S. Giannini, L. Cosmi, C. Sagrinati, B. Mazzinghi, C. Orlando, E. Maggi, et al. An Alternatively Spliced Variant of CXCR3 Mediates the Inhibition of Endothelial Cell Growth Induced by IP-10, Mig, and I-TAC, and Acts as Functional Receptor for Platelet Factor 4 J. Exp. Med., June 2, 2003; 197(11): 1537 - 1549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Blackwell and A. M. Krieg CpG-A-Induced Monocyte IFN-{gamma}-Inducible Protein-10 Production Is Regulated by Plasmacytoid Dendritic Cell-Derived IFN-{alpha} J. Immunol., April 15, 2003; 170(8): 4061 - 4068. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), after the onset of the
conductance increase (middle, •), and the CCL21-induced
current (bottom, •–
–
–
