The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.
The Journal of Immunology, 2002, 168: 2803-2810.
Copyright © 2002 by The American Association of Immunologists

CD66a Interactions Between Human Melanoma and NK Cells: A Novel Class I MHC-Independent Inhibitory Mechanism of Cytotoxicity1

Gal Markel*, Niva Lieberman*, Gil Katz*, Tal I. Arnon*, Michal Lotem{dagger}, Olga Drize{dagger}, Richard S. Blumberg{ddagger}, Erez Bar-Haim§, Reuven Mader, Lea Eisenbach§ and Ofer Mandelboim2,*

* Lautenberg Center for General and Tumor Immunology and {dagger} Sharet Institute of Oncology, Hadassah Medical School, Jerusalem, Israel; {ddagger} Gastroenterology Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; § Department of Immunology, Weizmann Institute of Science, Rehovot, Israel; and Department of Internal Medicine, HaEmek Medical Center, Afula, Israel


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NK cells are able to kill virus-infected and tumor cells via a panel of lysis receptors. Cells expressing class I MHC proteins are protected from lysis primarily due to the interactions of several families of NK receptors with both classical and nonclassical class I MHC proteins. In this study we show that a class I MHC-deficient melanoma cell line (1106mel) is stained with several Ig-fused lysis receptors, suggesting the expression of the appropriate lysis ligands. Surprisingly, however, this melanoma line was not killed by CD16-negative NK clones. The lack of killing is shown to be the result of homotypic CD66a interactions between the melanoma line and the NK cells. Furthermore, 721.221 cells expressing the CD66a protein were protected from lysis by YTS cells and by NK cells expressing the CD66a protein. Redirected lysis experiments demonstrated that the strength of the inhibitory effect is correlated with the levels of CD66a expression. Finally, the expression of CD66a protein was observed on NK cells derived from patients with malignant melanoma. These findings suggest the existence of a novel class I MHC-independent inhibitory mechanism of human NK cell cytotoxicity. This may be a mechanism that is used by some of the class I MHC-negative melanoma cells to evade attack by CD66a-positive NK cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Natural killer cells belong to the innate immune system and efficiently kill virus-infected and tumor cells. NK killing is restricted mainly to cells that have lost class I MHC expression, a phenomenon known as the missing self (1). In normal conditions, NK cell cytotoxicity is tightly regulated by various inhibitory, class I MHC-recognizing receptors. The inhibitory signal is delivered via the immunoreceptor tyrosine-based inhibitory motif (ITIM)3 sequences found within the cytosolic tail of these receptors. Three known families of class I MHC binding inhibitory receptors are known to date (2). These include members of the Ig superfamily, namely killer Ig-related two-domain long-tail (p58) and three-domain long-tail (p70) receptors (3, 4, 5), the C-type lectin complex CD94/NKG2A (6, 7), and the leukocyte Ig-like receptor (Ig-like transcript) family (8, 9).

There are also newly discovered NK-specific receptors, termed natural cytotoxicity receptors (NCRs) (10), which are directly involved in triggering NK cell cytotoxicity. The NCR group consists of several proteins, including NKp30 (11), NKp44 (12), NKp46 (13), NKp80 (14), and CD16 (15). The cellular lysis ligands for all the NCRs have yet to be identified. A viral ligand (hemagglutinin) was recently shown to interact with the NKp46 receptor, and this interaction resulted in the enhancement of lysis of certain virus-infected cells (16).

It has been previously reported that treatment of melanoma patients with tumor-infiltrating lymphocytes resulted in the emergence of class I MHC loss variants in 40% of melanoma patients (17). This is due to down-regulation of {beta}2-microglobulin expression in the tumor cells. The same tumor lines were later shown to be sensitive to various degrees for NK cell-mediated killing (18). In addition, it was shown that one of these melanoma lines, 1106mel, was inefficiently killed by many of the CD16-negative NK clones tested (15).

CD66a is a transmembrane protein, a member of the carcinoembryonic Ags family. It contains two ITIM sequences located within its cytosolic tail and interacts in a homotypic/heterotypic manner with other known CD66 proteins, including CD66a, CD66c, and CD66e proteins (19, 20). It is expressed on a wide spectrum of cells, ranging from epithelial to hemopoietic origin (21). Importantly, among all CD66 proteins tested, the CD66a protein only is expressed on the surface of activated, CD16-negative NK cells (22). The effect of the CD66a interactions on the inhibition of human NK cell cytotoxicity was never investigated.

In this study we show that many of the CD16-negative NK clones inefficiently kill 1106mel cells because of the CD66a homotypic interactions. The inhibition of NK cell cytotoxicity by CD66a was dependent on the level of CD66a expression on both effector and target cells. 721.221 cells expressing CD66a protein were protected from lysis by CD66a-expressing NK and YTS cells. Redirected lysis experiments showed that the strength of the inhibition is dependent on the level of CD66a expression on NK cells. Importantly, a dramatic increase in CD66a expression was observed among NK cells isolated from melanoma patients. These findings demonstrate a novel class I MHC-independent inhibitory mechanism of human NK cell cytotoxicity and suggest that some melanoma tumors use this mechanism to avoid attack by NK cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and mAb

The cell lines used in this work are the class I MHC-negative human cell line 721.221 (23), the YTS NK tumor line, and various MHC class I-negative and -positive human melanoma cell lines. NK cells were isolated from PBL using the human NK cell isolation kit and the autoMACS instrument (Miltenyi Biotec, Auburn, CA). For the enrichment of CD66a-positive NK cells, isolated NK cells were further purified by depletion of CD16-positive NK cells using anti-CD16 mAb 3G8 and the autoMACS instrument. NK cells were grown in culture as previously described (24). The production and specificity of anti-NKp44 and NKp46 sera were previously described (16). The mAbs used in this work were mAb W632, directed against class I MHC molecules, the mAb anti-CD66 a,b,c,e Kat4c (purchased from DAKO, Carpenteria, CA), anti-CD66a mAb 5F4 (25), and the rabbit polyclonal anti-CD66a,c,e Abs (purchased from DAKO). The anti-CD99 mAb 12E7, used as a control, was a gift from A. Bernard (Hopital de L’Archet, Nice, France). The anti-CD56 mAb (BD PharMingen, San Diego, CA) was also used as control.

Cytotoxicity assay and Ig fusion proteins

The cytotoxic activity of YTS and NK cells against the various targets was assayed in 5-h 35S release assays as described previously (24). In experiments in which mAb were included, the final mAb concentration was 10 µg/ml, or 40 µl/ml in cases where rabbit polyclonal Abs were used. Redirected lysis experiments were performed as previously described (11). The production of CD99-Ig, CD16-Ig, NKp30-Ig, NKp44-Ig, and NKp46-Ig fusion proteins by COS-7 cells and purification on a protein G column were previously described (15, 16, 26)

Quadruple staining

For quadruple staining, the following fluorochrome-conjugated mAbs were used: FITC-conjugated anti-CD66 Kat4c mAb (DAKO), PE-conjugated anti-CD56 mAb (BD PharMingen), and CyChrome-conjugated anti-CD3 (BD PharMingen). As the fourth color, biotinylated anti-CD16 mAb (Serotec, Oxford, U.K.) was used, followed by streptavidin-Cy5 (Jackson ImmunoResearch Laboratories, West Grove, PA) as a second reagent. To block nonspecific binding, cells were first incubated for 1 h on ice with 25% human serum and then incubated with the various Abs.

Generation of YTS and 721.221 cells expressing CD66a

The primers used for the amplification of CD66a cDNA needed for the transfection of 721.221 cells were as follows: 5' primer, CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including the HindIII restriction site), and 3' primer, GGAATTCCTTACTGCTTTTTTACTTCTGAATA (including the EcoRI restriction site). cDNA was cloned into the pCDNA3 vector (Invitrogen, San Diego, CA) and transfected into 721.221 cells as previously described (24). For transfection into YTS cells, CD66a cDNA was amplified by PCR using the 5' primer GGAATTCCGCCGCCACCATGGGGCACCTCTCAGCC (including the EcoRI restriction site) and the 3' primer GCGTCGACTTACTGCTTTTTTACTTCTGAATA (including the SalI restriction site). For amplification of the CD66aTrunc cDNA, the same 5' primer was used, with the 3' primer GCGTCGACATCTTGTTAGGTGGGTCATT. Amplified fragments were cloned into the pBABE retroviral vector and transfected into YTS cells as previously described (26).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of various lysis ligands, CD66a, and class I MHC proteins on human melanoma cells

The roles of NKp30, NKp44, NKp46, and CD16 receptors in NK recognition of various melanoma cells deficient in class I MHC expression (except from LB33melA1, used as a control) were studied by production of fusion proteins in which the extracellular domains of NKp30 NKp44, NKp46, and CD16 were fused to the Fc portion of Ig. cDNA encoding the extracellular domains of CD99 fused to the human IgG1 DNA was used as a control. The Ig fusion proteins were incubated with the various melanoma cells and analyzed for binding by indirect immunostaining as previously described (15). In general, the highest staining of the melanoma cells was observed with the NKp30-Ig and NKp44-Ig fusion proteins (Table IGo). Little staining of all Ig fusion proteins was observed with LB33melA1 cells, a cell line that is hardly killed by NK cells (data not shown). All other cell lines that can be killed by NK cells were stained to various degrees with the Ig fusion proteins (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Expression of various putative lysis ligands on human melanoma cell lines1

 
We have previously reported that IL-2-activated CD16-negative NK cells inefficiently kill 1106mel cells (15). Surprisingly, 1106mel cells probably express the ligands for all the NK lysis receptors tested, including CD16, NKp30, NKp44, and NKp46 (Table IGo). Thus, killing of 1106mel cells was expected to occur even when CD16-negative NK cells, which express the NKp44 and NKp46 receptors (data not shown), were used. We therefore hypothesized the existence of a class I-independent mechanism of inhibition of NK cell cytotoxicity that controls the lysis of 1106mel cells. This inhibitory mechanism should include a protein that is expressed mainly on the surface of IL-2-activated CD16-negative NK cell and is expected to deliver an inhibitory signal via the ITIM. The CD66a (carcinoembryonic Ag CAM1) protein was reported to follow the above criteria. It is expressed primarily on CD16-negative NK cells (22), it contains ITIM sequences, and it can bind in a homotypic/heterotypic manner to various CD66 proteins (19, 20). The inhibitory effect of the CD66a protein on human NK cell cytotoxicity was never investigated.

We therefore tested whether the expression of CD66a molecule can be detected on the surface of various melanoma cell lines and NK cells. Remarkably, all seven class I MHC-negative melanoma cell lines tested expressed the CD66a protein at moderate or high levels (Table IIGo). No expression of MHC class I protein (detected with the W632 mAb) was observed among these cell lines, except from the LB33melB1 cell line that expresses the HLA-A24 protein only (27). In contrast, 40% of the class I MHC-positive melanoma lines tested showed little or no staining for the CD66a protein (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. Expression of class I MHC and CD66a proteins on human melanoma cell lines1

 
Recognition of CD66a expressed on 1106mel by CD66a on CD16-negative NK cells leads to inhibition of lysis

It was previously reported that the CD66a isoform is expressed on CD16-negative NK cells (22). We next tested whether 1106mel cells would be protected from lysis by CD16-negative NK cells expressing the CD66a protein. For the generation of CD16-negative NK cells expressing CD66a, NK cells were first isolated from PBL of various healthy donors and then depleted from CD16-positive NK cells by using the anti-CD16 mAb 3G8 (as described in Materials and Methods). Of 63 CD16-negative clones tested, 28 (45%) expressed the CD66a protein (data not shown). In rare cases (2%) CD66a expression could be detected on the surface of CD16-positive NK clones (see Fig. 5Go). The percentage of CD16-negative, CD66a-positive NK cells can vary among different donors after activation. Various NK clones were then tested in killing assays against 1106mel cells. Efficient killing of 1106mel cells was observed with CD16+CD66a- NK clones (Fig. 1Go, A and B). The addition of anti-CD66 polyclonal Abs or the control 12E7 mAb (incubated with either effector or target cells) had little or noeffect (Fig. 1Go, A and B). Similar results were obtained when CD16-CD66a- NK clones were used (see Fig. 5Go). In agreement with our previous observations (15), little killing of 1106mel cells was observed when CD16-CD66a+ NK cells (for example, clone 163) were used (Fig. 1Go, C and D), whereas effective killing (32.4%; data not shown) of the CD66-deficient NK-sensitive 721.221 cell line was observed. The low rate of 1106mel killing observed was the result of the inhibition mediated by the CD66a homotypic interactions, as lysis of 1106mel cells was restored when either the effector or the target cells were incubated with anti-CD66a polyclonal Abs (Fig. 1Go, C and D). The anti-CD66 polyclonal Abs specifically stained all cells that were positive for CD66a expression (NK clones, melanomas, and various transfectants) and did not stain cells that were negative for CD66a expression (for example, CD66a-negative NK clones; data not shown). The controls, 12E7 mAb or polyclonal Abs from rabbit immunized with purified ubiquitin, had little or no effect (Fig. 1Go and data not shown). Similar results were obtained when CD16+CD66a+ NK clones were used (see Fig. 5Go). Reversal of the CD66a-mediated inhibition was also observed even when the LB33melB1 cell line was used as a target. This cell line expressed the lowest levels of CD66a proteins among all seven class I-negative melanoma cells tested (Table IIGo and data not shown). No inhibition of lysis by CD66a-positive NK cells was observed when these clones were incubated with the 1259mel melanoma line, a cell line that is efficiently killed by CD16-negative NK cells (Fig. 1GoE). The reason why 1259mel cells are so sensitive to NK killing is not yet understood. It is especially surprising because the expression levels of the lysis ligands for CD16, NKp30, NKp44, and NKp46, detected by the Ig fusion proteins were similar to those of 1106mel cells. One possible explanation is that other lysis ligands for other lysis receptors (yet to be identified) exist on the surface of 1259mel cells, and the combined effect of all lysis receptors overcomes the CD66a-mediated inhibition. In conclusion, the results presented above demonstrate a novel class I-independent inhibitory mechanism of human NK cell cytotoxicity.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. The high level of CD66a expression on NK clones correlates with efficient inhibition of redirected lysis of P815 cells. The CD66a expression on NK clones was monitored by FACS. To correctly compare the level of CD66a expression among different NK clones, and because the background staining F(ab)'2 of FITC-conjugated goat anti-mouse IgG Abs of each NK clone might be different, the level of CD66a expression in each clone was determined by dividing the MFI of the CD66a staining on a given clone with the MFI of the background staining of the same clone. The fold increase in CD66a staining above the background of each clone is indicated in brackets. The percent inhibition of each clone was calculated by dividing the percentage of specific lysis of the NK clone incubated with anti-CD66 mAb by that of the clone incubated with no mAb. Similar results were obtained when the specific lysis of each NK clone incubated with anti-CD66 mAb was divided by the percent specific lysis of the same NK clone incubated with control mAb. The NK clones are presented in the figure in the order of the fold increase in CD66a above background. The figure shows CD16-CD66- clones (24, 89, and 98), CD16-CD66+ clones (21, 79, 84, and 100), CD16+CD66- clones (25, 47, 48, 63, and 64), and CD16+CD66+ clones (1, 2, 3, 9, 10, 13, 17, 30, 32, 34, 43, 44, 49, 58, 61, 65, 69, 70, 71, 73, 75, and 96). When CD16- NK clones were used, anti-NKp44 and NKp46 sera were included to stimulate the redirected lysis experiments. When CD16+ NK clones were used, anti-CD16 mAb was included in the redirected lysis experiments. The figure shows NK clones generated from one healthy donor YF that contains an unusually high number of CD16+CD66+ NK clones.

 


View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 1. Killing of melanoma lines by NK clones. Lysis of 1106mel cells (A–D) and 1259mel cells (E) by CD16+CD66a- NK clone (A and B) or CD16-CD66a+ NK clone (C–E) was performed as described in Materials and Methods. The anti-CD99 mAb (12E7) and anti-CD66a polyclonal Abs were incubated with the target cells (A and C) or with the effector cells (B, D, and E). The E:T cell ratio was 3:1.

 
721.221 cells expressing the CD66a protein are protected from lysis by CD66a-positive NK and YTS cells

To directly test the role of the CD66a protein in inhibition of NK cell cytotoxicity, 721.221 target cells and YTS effector cells (both deficient for CD66a expression; Fig. 2Go) were transfected with the CD66a cDNA. Several clones of 721.221 cells expressing various levels of CD66a protein (.221/CD66a) were obtained. Two representative clones, expressing either low (.221/CD66alow) or high (.221/CD66ahigh) levels, are shown in Fig. 2Go. YTS cells expressing either CD66a (YTS/CD66a) or CD66a in which the cytoplasmic tail of the molecule was truncated not to include the ITIMs (YTS/CD66aTrunc) were also generated (Fig. 2Go). Importantly, the expression level of the CD66a protein on YTS cells was similar to the physiological level of expression on an average primary NK clone (median fluorescence intensity (MFI) was >2-fold over the background; a representative clone is shown in Fig. 2Go). YTS transfectants expressing higher levels of CD66a protein could not be obtained. Transfectants were next tested in cytotoxicity assays. Moderate, but significant, inhibition of YTS/CD66a killing was observed when cells were incubated with .221/CD66ahigh in all E:T cell ratios tested (Fig. 3Go). The percentages of killing of other targets, including the parental 721.221 or the .221/CD66alow were similar. Similar results were obtained with other YTS and 721.221 cells expressing similar levels of CD66a (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of CD66a on various cell types. Transfectants were generated as described in Materials and Methods. Shown is CD66a staining of transfected .221 and YTS cells with the anti-CD66a mAb Kat4c (dark line) overlaid on the staining of the parental cells (.221 and YTS) with the same mAb (light line). Staining of a representative NK clone by Kat4c (dark line) overlaid on the staining of the same NK clones with the control FITC-conjugated goat anti-mouse Abs (light line) is also shown. The figure shows one representative experiment of three performed.

 


View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 3. Killing of various 721.221 transfectants by various YTS transfectants. Killing assays were performed as described above. The various YTS transfectants are indicated in each histogram. The figure shows one representative experiment of six performed.

 
Lysis of all target cells tested against YTS cells transfected with the pBABE vector alone (YTS/MOCK) was similar. The CD66a inhibitory signal is probably transduced via the ITIM sequences, as no inhibition of lysis by YTS/CD66aTrunc was observed, even when these cells were incubated with 721.221/CD66ahigh cells (Fig. 3Go). The low level of CD66a expression on target cells (.221/CD66alow) did not confer protection (Fig. 3Go). The inhibition of lysis of .221/CD66ahigh cells by YTS/CD66a was the result of the CD66a interactions, as lysis was restored when anti-CD66 Abs were included in the assays (incubated either with the effector cells (Fig. 4GoA) or with the target cells (data not shown)). The controls, 12E7 mAb or rabbit polyclonal Abs directed against ubiquitin, had no effect (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 4. Killing of .221/CD66ahigh cells by NK clones. Killing of target cells by YTS/CD66a (A), CD66-positive NK clone (B), and CD66-negative NK clone (C) incubated with or without anti-CD66a polyclonal Abs. The figure shows one representative experiment of five performed.

 
Lysis experiments were also performed with NK clones positive or negative for the expression of CD66a. NK clones were prepared as described above and tested against .221/CD66ahigh cells. CD66a-dependent inhibition of lysis of .221/CD66ahigh cells was observed when CD66a-positive NK cells were used (a representative clone is shown in Fig. 4GoB). In contrast, no inhibition of lysis of .221/CD66ahigh cells was observed when CD66a-negative NK clones were used (representative clone is shown in Fig. 4GoC).

Levels of CD66a expression on both effector and target cells are important for effective inhibition

One likely explanation for the moderate inhibition observed when .221/CD66ahigh cells were incubated either with YTS/CD66a or with CD66a+ NK cells is the level of CD66a expression on both target and effector cells. Indeed, no inhibition of lysis was observed when .221/CD66alow cells were used (Fig. 3Go), moderate inhibition was observed when .221/CD66ahigh cells were used (Fig. 3Go), and strong inhibition of lysis was observed when 1106mel cells were used (Fig. 1Go, C and D). The 1106mel cell line expresses the CD66a protein at a level 10-fold higher than that of the .221/CD66ahigh transfectants (Table IIGo and Fig. 2Go). 721.221 cells expressing the CD66a protein at a higher level than the transfectant presented in Fig. 2Go could not be obtained (data not shown). Thus, the level of CD66a expression on target cells is important for effective inhibition of both YTS and NK cells.

To correlate the level of expression of CD66a on NK cells and the strength of inhibition, various NK clones (positive or negative for CD16) expressing different levels of CD66a were used. The redirected lysis of P815 cells was induced with either anti-CD16 mAb or anti-NKp44 and -NKp46 sera depending whether the NK clone tested expressed the CD16 protein. A direct correlation was observed between the level of CD66 expression on the surface of the NK clones and the percentage of inhibition of redirected lysis (Fig. 5Go). The level of CD66a expression had to be at least 2-fold above the background staining for efficient inhibition to occur (Fig. 5Go).

Elevation of CD66a expression on NK cells derived from melanoma patients

The in vivo significance of the CD66a interactions was studied by the staining of NK cells derived from either metastasized lymph nodes or peripheral blood. The lymph node of patient M-169 was infiltrated with melanoma cells, highly positive for the CD66a expression (MFI, 247; data not shown). The lymph node was surgically removed, and lymphocytes in direct contact with the tumor cells were obtained after digestion and density gradient separation. Quadruple staining of the lymphocytes was performed for the expression of the CD16, CD3, CD56, and CD66 receptors. Remarkably, 12.85% of the NK cells (CD56+CD3-) obtained from M-169 lymph node expressed the CD66a protein (Fig. 6GoA). A total of 10.5% of the NK cells obtained were CD16-CD66+, and 2.35% were CD16+CD66+ (data not shown). Importantly, the MFI of the CD66a-positive NK population was 8-fold above background, which is sufficient for effective inhibition (an MFI >2-fold above background is needed; see Fig. 5Go). Similar results were obtained when peripheral blood NK cells derived from patient 3 were analyzed with the same quadruple staining; 14.8% of the NK cells were CD66a positive, and the MFI of this NK population was 7.5-fold above background (Fig. 6GoB).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 6. CD66a expression on NK cells derived from healthy donors and melanoma patients. Lymphocytes were obtained from surgically removed lymph nodes derived from two different melanoma patients, infiltrated with melanoma metastases positive (A) or negative (C) for CD66a expression. Lymphocytes were also obtained from peripheral blood of another melanoma patient (B) or from peripheral blood of representative healthy donor (D). Lymphocytes were stained for expression of CD3, CD16, CD56, and CD66 as described in Materials and Methods. The figure shows CD66a expression on NK cells.

 
In contrast, little or no CD66a expression was observed among NK cells derived from the metastasized lymph node of patient M-172 (Fig. 6GoC). Strikingly, the infiltrating M-172 melanoma cells did not express the CD66a protein (data not shown). Furthermore, no CD66a expression was observed among NK cells derived from the peripheral blood of 10 other melanoma patients with no clinical evidence of active disease (data not shown).

PBL from eight healthy donors were also obtained, and the expression of CD66a on NK cells was analyzed using the same quadruple staining as that described above. Very little or no CD66a staining was observed among all NK cells tested (a representative healthy donor OM is shown in Fig. 6GoD). This is in agreement with a previous observation (22) demonstrating the expression of the CD66a molecule on activated NK clones only.

In conclusion, the results presented in this study suggest that the CD66a interactions are used by some melanoma cells as a mechanism of defense to avoid attack by CD66a-positive NK cells.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several important and novel conclusions arise from the findings of this study. The first is the identification of a novel class I MHC-independent inhibitory mechanism of human NK cell cytotoxicity, which is mediated by the CD66a molecules.

The melanoma cell line 1106mel is shown to express high levels of the CD66a protein (Table IIGo), and the lysis of this cell line is inhibited by the CD66a protein present mainly on the surface of CD16-negative NK cells (Fig. 1Go, C and D). A direct interaction between the CD66a proteins expressed on both target and effector cells, leading to inhibition of NK cell cytotoxicity, was demonstrated by lysis and blocking experiments, in which NK and target tumor cell lines transfected with the CD66a cDNA were used (Figs. 3Go and 4GoA). The strength of the inhibitory effect of the CD66a protein on NK cytotoxicity was shown to correlate with the level of CD66a expression on both target and effector cells.

To our knowledge there are only two other receptors, Irp60 (28) and p75/AIRM-1 (29), that are expressed on the surface of NK cells and can inhibit cytotoxicity via a class I-independent mechanism. However, the ligands that are recognized by these receptors are currently unknown (28, 29). The findings presented in this work together with the recent discovery of NCRs (11, 12, 13, 14, 15) and the identification of viral hemagglutinin as a ligand for the NKp46 receptor (16) suggest a certain degree of specificity for the killing by NK cells. Furthermore, they demonstrate that class I MHC proteins are not the only molecules that are able to confer inhibition of NK cell cytotoxicity, thus extending the boundaries of the missing self hypothesis.

The second issue arising from this study is the finding that some of the melanoma cell lines use CD66a interactions to avoid attack by CD66a-positive NK cells. All class I MHC-deficient melanoma cell lines (a total of seven) express CD66a in moderate to high levels (Table IIGo), but, in contrast, 40% of the class I MHC-positive melanomas do not express the CD66a protein. A partial or complete loss of class I MHC molecules was observed in 16 and 58% of primary and metastatic melanoma lesions, respectively (30, 31).

The reason why the class I MHC-negative melanoma lines express high levels of CD66a protein is currently unknown. In this regard it is striking to learn that most class I-negative melanoma cell lines tested here were obtained from patients treated with tumor-infiltrating lymphocytes injection combined with IL-2 (1106mel, 1074mel, and 1259mel) (17) or with IFN-{gamma} and IL-2 treatment combined with autologous melanoma vaccination of LB33melA1 (LB33melB1) (27). In contrast, all class I-positive melanoma cell lines were obtained from untreated patients.

Importantly, we demonstrate that in vivo in some melanoma patients a dramatic increase in CD66a expression can be observed on the surface of NK cells derived from lymph node or peripheral blood (Fig. 6Go). The up-regulation of CD66a expression was observed on the surface of ~13–14% of the NK cells tested. Other inhibitory mechanisms might therefore account for the protection of MHC class I-negative melanoma cells from lysis by the ~86% of NK cells that are CD66a negative. Strikingly, no CD66a expression was observed among NK cells isolated either from lymph node infiltrated with melanoma cells that are negative for CD66a expression or from the PBL of melanoma patients with no detectable disease or from healthy donors (Fig. 6Go). The increase in CD66a expression correlates with the poor prognosis of the melanoma patients.

The reason why CD66a expression is up-regulated on the surface of NK cells isolated from these patients is not completely understood. One possible explanation is that the NK cells obtained from these patients were activated. Indeed, it has been reported that the fraction of CD16-negative NK cells in the periphery (the same population that expresses the CD66a protein) is increased after prolonged treatment with continuous low dose rIL-2 (32).

In view of these results it is possible that in some cases of malignant melanoma the CD66a interactions are used by the tumors as a mechanism of defense to avoid attacks by CD66a-positive NK cells. Understanding the precise mechanism leading to the emergence of CD66a protein on the surface of both melanoma and NK cells might eventually lead to a better treatment for melanoma patients.

The expression of CD66a protein on NK cells must have different physiological roles other than inhibition of NK cytotoxicity by tumors. Indeed, CD66a protein was reported to be involved in the adhesive interactions of neutrophils with other cells (33) as well in signal transduction (34, 35). Furthermore, the CD66a protein was also reported to be involved in prostatic and colonic carcinoma growth inhibition (36, 37, 38).


    Acknowledgments
 
We thank the volunteers who donated their blood, Dr. C. Stanners for providing the CD66a cDNA and for critically reading the manuscript, and Dr. D. M. Davis for helpful suggestions.


    Footnotes
 
1 This work was supported by research grants from the Israel Science Foundation, the Charles H. Revson Foundation (no. 153/00), the Israel Cancer Research Fund, the Cancer Research Institute, and the Joint German-Israeli Research Program (all to O.M.). Back

2 Address correspondence and reprint requests to Dr. Ofer Mandelboim, Lautenberg Center for General and Tumor Immunology, Hadassah Medical School, 91120 Jerusalem, Israel. E-mail address: oferman{at}md2.huji.ac.il Back

3 Abbreviations used in this paper: ITIM, immunoreceptor tyrosine-based inhibitory motif; MFI, median fluorescence intensity; NCR, natural cytotoxicity receptor. Back

Received for publication November 26, 2001. Accepted for publication January 18, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ljunggren, H. G., K. Karre. 1990. In search of the "missing self": MHC molecules and NK recognition. Immunol. Today 11:237.[Medline]
  2. Long, E. O.. 1999. Regulation of immune responses through inhibitory receptors. Annu. Rev. Immunol. 17:875.[Medline]
  3. Colonna, M., J. Samaridis. 1995. Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells. Science 268:405.[Abstract/Free Full Text]
  4. Moretta, A., M. Vitale, C. Bottino, A. M. Orengo, L. Morelli, R. Augugliaro, M. Barbaresi, E. Ciccone, L. Moretta. 1993. P58 molecules as putative receptors for major histocompatibility complex (MHC) class I molecules in human natural killer (NK) cells: anti-p58 antibodies reconstitute lysis of MHC class I-protected cells in NK clones displaying different specificities. J. Exp. Med. 178:597.[Abstract/Free Full Text]
  5. Moretta, A., C. Bottino, M. Vitale, D. Pende, R. Biassoni, M. C. Mingari, L. Moretta. 1996. Receptors for HLA class-I molecules in human natural killer cells. Annu. Rev. Immunol. 14:619.[Medline]
  6. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea, G. S. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795.[Medline]
  7. Braud, V. M., A. J. McMichael. 1999. Regulation of NK cell functions through interaction of the CD94/NKG2 receptors with the nonclassical class I molecule HLA-E. Curr. Top. Microbiol. Immunol. 244:85.[Medline]
  8. Colonna, M., H. Nakajima, F. Navarro, M. Lopez-Botet. 1999. A novel family of Ig-like receptors for HLA class I molecules that modulate function of lymphoid and myeloid cells. J. Leukocyte Biol. 66:375.[Abstract]
  9. Colonna, M., F. Navarro, T. Bellon, M. Llano, P. Garcia, J. Samaridis, L. Angman, M. Cella, M. Lopez-Botet. 1997. A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809.[Abstract/Free Full Text]
  10. Moretta, A., C. Bottino, M. Vitale, D. Pende, C. Cantoni, M. C. Mingari, R. Biassoni, L. Moretta. 2001. Activating receptors and coreceptors involved in human natural killer cell-mediated cytolysis. Annu. Rev. Immunol. 19:197.[Medline]
  11. Pende, D., S. Parolini, A. Pessino, S. Sivori, R. Augugliaro, L. Morelli, E. Marcenaro, L. Accame, A. Malaspina, R. Biassoni, et al 1999. Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells. J. Exp. Med. 190:1505.[Abstract/Free Full Text]
  12. Cantoni, C., C. Bottino, M. Vitale, A. Pessino, R. Augugliaro, A. Malaspina, S. Parolini, L. Moretta, A. Moretta, R. Biassoni. 1999. NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J. Exp. Med. 189:787.[Abstract/Free Full Text]
  13. Pessino, A., S. Sivori, C. Bottino, A. Malaspina, L. Morelli, A. Moretta, R. Biassoni, L. Moretta. 1998. Molecular cloning of NKp46: novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity. J. Exp. Med. 188:953.[Abstract/Free Full Text]
  14. Vitale, M., M. Falco, R. Castriconi, S. Parolini, R. Zambello, G. Semenzato, R. Biassoni, C. Bottino, L. Moretta, A. Moretta. 2001. Identification of NKp80, a novel triggering molecule expressed by human NK cells. Eur. J. Immunol. 31:233.[Medline]
  15. Mandelboim, O., P. Malik, D. M. Davis, H. J. Chang, J. E. Boyson, J. L. Strominger. 1999. Human CD16 as a lysis receptor mediating direct natural killer (NK) cell cytotoxicity. Proc. Natl. Acad. Sci. USA 96:5640.[Abstract/Free Full Text]
  16. Mandelboim, O., N. Lieberman, M. Lev, L. Paul, T. I. Arnon, Y. Bushkin, D. M. Davis, J. L. Strominger, J. W. Yewdell, A. Porgador. 2001. Recognition of haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK cells. Nature 409:1055.[Medline]
  17. Restifo, N. P., F. M. Marincola, Y. Kawakami, J. Taubenbenger, J. R. Yannelli, S. A. Rosengerg. 1996. Loss of functional {beta}2-microglobulin in metastatic melanomas from five patients receiving immunotherapy. J. Natl. Cancer Inst. 88:100.[Abstract/Free Full Text]
  18. Porgador, A., O. Mandelboim, N. P. Restifo, J. L. Strominger. 1997. Natural killer cell lines kill autologous {beta}2-microglobulin-deficient melanoma cells: implications for cancer immunotherapy. Proc. Natl. Acad. Sci. USA 94:13140.[Abstract/Free Full Text]
  19. Teixeira, A. M., J. Fawcett, D. L. Simmons, S. M. Watt. 1994. The N-domain of the biliary glycoprotein (BGP) adhesion molecule mediates homotypic binding: domain interactions and epitope analysis of BGPc. Blood 84:211.[Abstract/Free Full Text]
  20. Watt, S. M., J. Fawcett, S. J. Murdoch, A. M. Teixeira, S. E. Gschmeissner, N. M. Hajibagheri, D. L. Simmons. 1994. CD66 identifies the biliary glycoprotein (BGP) adhesion molecule: cloning, expression, and adhesion functions of the BGPc splice variant. Blood 84:200.[Abstract/Free Full Text]
  21. Hammarstrom, S.. 1999. The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues. Semin. Cancer Biol. 9:67.[Medline]
  22. Moller, M. J., R. Kammerer, F. Grunert, S. von Kleist. 1996. Biliary glycoprotein (BGP) expression on T cells and on a natural-killer-cell sub-population. Int. J. Cancer 65:740.[Medline]
  23. Shimizu, Y., R. DeMars. 1989. Production of human cells expressing individual transferred HLA-A, -B, -C genes using an HLA-A, -B, -C null human cell line. J. Immunol. 142:3320.[Abstract]
  24. Mandelboim, O., H. T. Reyburn, M. Vales-Gomez, L. Pazmany, M. Colonna, G. Borsellino, J. L. Strominger. 1996. Protection from lysis by natural killer cells of group 1 and 2 specificity is mediated by residue 80 in human histocompatibility leukocyte antigen C alleles and also occurs with empty major histocompatibility complex molecules. J. Exp. Med. 184:913.[Abstract/Free Full Text]
  25. Morales, V. M., A. Christ, S. M. Watt, H. S. Kim, K. W. Johnson, N. Utku, A. M. Texieira, A. Mizoguchi, E. Mizoguchi, G. J. Russell, et al 1999. Regulation of human intestinal intraepithelial lymphocyte cytolytic function by biliary glycoprotein (CD66a). J. Immunol. 163:1363.[Abstract/Free Full Text]
  26. Katz, G., G. Markel, S. Mizrahi, T. I. Arnon, O. Mandelboim. 2001. Recognition of HLA-Cw4 but not HLA-Cw6 by the NK cell receptor killer cell Ig-like receptor two-domain short tail number 4. J. Immunol. 166:7260.[Abstract/Free Full Text]
  27. Lehmann, F., M. Marchand, P. Hainaut, P. Pouillart, X. Sastre, H. Ikeda, T. Boon, P. G. Coulie. 1995. Differences in the antigens recognized by cytotoxic T cells on two successive metastases of a melanoma patient are consistent with immune selection. Eur. J. Immunol. 25:340.[Medline]
  28. Cantoni, C., C. Bottino, R. Augugliaro, L. Morelli, E. Marcenaro, R. Castriconi, M. Vitale, D. Pende, S. Sivori, R. Millo, et al 1999. Molecular and functional characterization of Irp60, a member of the immunoglobulin superfamily that functions as an inhibitory receptor in human NK cells. Eur. J. Immunol. 29:3148.[Medline]
  29. Falco, M., R. Biassoni, C. Bottino, M. Vitale, S. Sivori, R. Augugliaro, L. Moretta, A. Morreta. 1999. Identification and molecular cloning of p75/AIRM1, a novel member of the sialoadhesin family that functions as an inhibitory receptor in human natural killer cells. J. Exp. Med. 190:793.[Abstract/Free Full Text]
  30. Ferrone, S., F. M. Marincola. 1995. Loss of HLA class I antigens by melanoma cells: molecular mechanisms, functional significance and clinical relevance. Immunol. Today 16:487.[Medline]
  31. Maio, M., G. Parmiani. 1996. Melanoma immunotherapy: new dreams or solid hopes?. Immunol. Today 17:405.[Medline]
  32. Vlasveld, L. T., A. Hekman, F. A. Vyth-Dreese, E. M. Rankin, J. G. Scharenberg, A. C. Voordouw, J. J. Sein, T. A. Dellemijn, S. Rodenhuis, C. J. Melief. 1993. A phase I study of prolonged continuous infusion of low dose recombinant interleukin-2 in melanoma and renal cell cancer. II. Immunological aspects. Br. J. Cancer 68:559.[Medline]
  33. Barclay, A. N., M. H. Brown, S. K. A. Law, A. J. McKnight, M. G. Tomlinson, P. A. van der Merwe. 1997. The Leucocyte Antigen FactsBook 2nd Ed.310. Academic, San Diego.
  34. Kammerer, R., S. Hahn, B. B. Singer, J. S. Lou, S. von Kleist. 1998. Biliary glycoprotein (CD66a), a cell adhesion molecule of the immunoglobulin superfamily, on human lymphocytes: structure, expression and involvement in T cell activation. Eur. J. Immunol. 28:3664.[Medline]
  35. Skubitz, K. M., K. D. Campbell, A. P. Skubitz. 2000. Synthetic peptides of CD66a stimulate neutrophil adhesion to endothelial cells. J. Immunol. 164:4257.[Abstract/Free Full Text]
  36. Luo, W., M. Tapolsky, K. Earley, C. G. Wood, D. R. Wilson, C. J. Logothetis, S. H. Lin. 1999. Tumor-suppressive activity of CD66a in prostate cancer. Cancer Gene Ther. 6:313.[Medline]
  37. Izzi, L., C. Turbide, C. Houde, T. Kunath, N. Beauchemin. 1999. cis-determinants in the cytoplasmic domain of CEACAM1 responsible for its tumor inhibitory function. Oncogene 18:5563.[Medline]
  38. Turbide, C., T. Kunath, E. Daniels, N. Beauchemin. 1997. Optimal ratios of biliary glycoprotein isoforms required for inhibition of colonic tumor growth. Cancer Res. 57:2781.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
A. K. Horst, T. Bickert, N. Brewig, P. Ludewig, N. van Rooijen, U. Schumacher, N. Beauchemin, W. D. Ito, B. Fleischer, C. Wagener, et al.
CEACAM1+ myeloid cells control angiogenesis in inflammation
Blood, June 25, 2009; 113(26): 6726 - 6736.
[Abstract] [Full Text] [PDF]


Home page
Am J Clin PatholHome page
T. Gambichler, S. Grothe, S. Rotterdam, P. Altmeyer, and A. Kreuter
Protein Expression of Carcinoembryonic Antigen Cell Adhesion Molecules in Benign and Malignant Melanocytic Skin Lesions
Am J Clin Pathol, June 1, 2009; 131(6): 782 - 787.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. G. Halfteck, M. Elboim, C. Gur, H. Achdout, H. Ghadially, and O. Mandelboim
Enhanced In Vivo Growth of Lymphoma Tumors in the Absence of the NK-Activating Receptor NKp46/NCR1
J. Immunol., February 15, 2009; 182(4): 2221 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
G. MARKEL, T. COHEN-SINAI, M. J. BESSER, K. OVED, O. ITZHAKI, R. SEIDMAN, A. J. TREVES, E. FRIDMAN, Y. KEISARI, Z. DOTAN, et al.
Preclinical Evaluation of Adoptive Cell Therapy for Patients with Metastatic Renal Cell Carcinoma
Anticancer Res, January 1, 2009; 29(1): 145 - 154.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Achdout, I. Manaster, and O. Mandelboim
Influenza Virus Infection Augments NK Cell Inhibition through Reorganization of Major Histocompatibility Complex Class I Proteins
J. Virol., August 15, 2008; 82(16): 8030 - 8037.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. S. W. Lee, M. A. Ostrowski, and S. D. Gray-Owen
CEACAM1 Dynamics during Neisseria gonorrhoeae Suppression of CD4+ T Lymphocyte Activation
J. Immunol., May 15, 2008; 180(10): 6827 - 6835.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Mizrahi, E. Yefenof, M. Gross, P. Attal, A. Ben Yaakov, D. Goldman-Wohl, B. Maly, N. Stern, G. Katz, R. Gazit, et al.
A phenotypic and functional characterization of NK cells in adenoids
J. Leukoc. Biol., November 1, 2007; 82(5): 1095 - 1105.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Stern-Ginossar, S. Nedvetzki, G. Markel, R. Gazit, G. Betser-Cohen, H. Achdout, M. Aker, R. S. Blumberg, D. M. Davis, B. Appelmelk, et al.
Intercellular Transfer of Carcinoembryonic Antigen from Tumor Cells to NK Cells
J. Immunol., October 1, 2007; 179(7): 4424 - 4434.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Schmitter, S. Pils, V. Sakk, R. Frank, K.-D. Fischer, and C. R. Hauck
The Granulocyte Receptor Carcinoembryonic Antigen-Related Cell Adhesion Molecule 3 (CEACAM3) Directly Associates with Vav to Promote Phagocytosis of Human Pathogens
J. Immunol., March 15, 2007; 178(6): 3797 - 3805.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Yu, E. M. C. Chow, H. Wong, J. Gu, O. Mandelboim, S. D. Gray-Owen, and M. A. Ostrowski
CEACAM1 (CD66a) Promotes Human Monocyte Survival via a Phosphatidylinositol 3-Kinase- and AKT-dependent Pathway
J. Biol. Chem., December 22, 2006; 281(51): 39179 - 39193.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
B. Albarran-Somoza, R. Franco-Topete, V. Delgado-Rizo, F. Cerda-Camacho, L. Acosta-Jimenez, M. Lopez-Botet, and A. Daneri-Navarro
CEACAM1 in Cervical Cancer and Precursor Lesions: Association With Human Papillomavirus Infection
J. Histochem. Cytochem., December 1, 2006; 54(12): 1393 - 1399.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Markel, R. Seidman, N. Stern, T. Cohen-Sinai, O. Izhaki, G. Katz, M. Besser, A. J. Treves, R. S. Blumberg, R. Loewenthal, et al.
Inhibition of Human Tumor-Infiltrating Lymphocyte Effector Functions by the Homophilic Carcinoembryonic Cell Adhesion Molecule 1 Interactions
J. Immunol., November 1, 2006; 177(9): 6062 - 6071.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
S. Iizuka, T. Kaifu, A. Nakamura, M. Obinata, and T. Takai
Establishment and Functional Characterization of Novel Natural Killer Cell Lines Derived from a Temperature-Sensitive SV40 Large T Antigen Transgenic Mouse
J. Biochem., August 1, 2006; 140(2): 255 - 265.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Betser-Cohen, G. Katz, T. Gonen-Gross, N. Stern, T. I. Arnon, H. Achdout, R. Gazit, and O. Mandelboim
Reduced KIR2DL1 Recognition of MHC Class I Molecules Presenting Phosphorylated Peptides.
J. Immunol., June 1, 2006; 176(11): 6762 - 6769.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Colonna
Cytolytic responses: cadherins put out the fire
J. Exp. Med., February 20, 2006; 203(2): 261 - 264.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Azuz-Lieberman, G. Markel, S. Mizrahi, R. Gazit, J. Hanna, H. Achdout, R. Gruda, G. Katz, T. I. Arnon, S. Battat, et al.
The involvement of NK cells in ankylosing spondylitis
Int. Immunol., July 1, 2005; 17(7): 837 - 845.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E Puxeddu, J A Knauf, M A Sartor, N Mitsutake, E P Smith, M Medvedovic, C R Tomlinson, S Moretti, and J A Fagin
RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response
Endocr. Relat. Cancer, June 1, 2005; 12(2): 319 - 334.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Stern, G. Markel, T. I. Arnon, R. Gruda, H. Wong, S. D. Gray-Owen, and O. Mandelboim
Carcinoembryonic Antigen (CEA) Inhibits NK Killing via Interaction with CEA-Related Cell Adhesion Molecule 1
J. Immunol., June 1, 2005; 174(11): 6692 - 6701.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Markel, R. Gruda, H. Achdout, G. Katz, M. Nechama, R. S. Blumberg, R. Kammerer, W. Zimmermann, and O. Mandelboim
The Critical Role of Residues 43R and 44Q of Carcinoembryonic Antigen Cell Adhesion Molecules-1 in the Protection from Killing by Human NK Cells
J. Immunol., September 15, 2004; 173(6): 3732 - 3739.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Katz, R. Gazit, T. I. Arnon, T. Gonen-Gross, G. Tarcic, G. Markel, R. Gruda, H. Achdout, O. Drize, S. Merims, et al.
MHC Class I-Independent Recognition of NK-Activating Receptor KIR2DS4
J. Immunol., August 1, 2004; 173(3): 1819 - 1825.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-J. Chen and J. E. Shively
The Cell-Cell Adhesion Molecule Carcinoembryonic Antigen-Related Cellular Adhesion Molecule 1 Inhibits IL-2 Production and Proliferation in Human T Cells by Association with Src Homology Protein-1 and Down-Regulates IL-2 Receptor
J. Immunol., March 15, 2004; 172(6): 3544 - 3552.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
U. Sundberg, N. Beauchemin, and B. Obrink
The cytoplasmic domain of CEACAM1-L controls its lateral localization and the organization of desmosomes in polarized epithelial cells
J. Cell Sci., March 1, 2004; 117(7): 1091 - 1104.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Markel, H. Mussaffi, K.-L. Ling, M. Salio, S. Gadola, G. Steuer, H. Blau, H. Achdout, M. de Miguel, T. Gonen-Gross, et al.
The mechanisms controlling NK cell autoreactivity in TAP2-deficient patients
Blood, March 1, 2004; 103(5): 1770 - 1778.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. I. Arnon, H. Achdout, N. Lieberman, R. Gazit, T. Gonen-Gross, G. Katz, A. Bar-Ilan, N. Bloushtain, M. Lev, A. Joseph, et al.
The mechanisms controlling the recognition of tumor- and virus-infected cells by NKp46
Blood, January 15, 2004; 103(2): 664 - 672.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Achdout, T. I. Arnon, G. Markel, T. Gonen-Gross, G. Katz, N. Lieberman, R. Gazit, A. Joseph, E. Kedar, and O. Mandelboim
Enhanced Recognition of Human NK Receptors After Influenza Virus Infection
J. Immunol., July 15, 2003; 171(2): 915 - 923.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Greicius, E. Severinson, N. Beauchemin, B. Obrink, and B. B. Singer
CEACAM1 is a potent regulator of B cell receptor complex-induced activation
J. Leukoc. Biol., July 1, 2003; 74(1): 126 - 134.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Finkenzeller, B. Fischer, S. Lutz, H. Schrewe, T. Shimizu, and W. Zimmermann
Carcinoembryonic Antigen-Related Cell Adhesion Molecule 10 Expressed Specifically Early in Pregnancy in the Decidua Is Dispensable for Normal Murine Development
Mol. Cell. Biol., January 1, 2003; 23(1): 272 - 279.
[Abstract] [Full Text]


Home page
JCOHome page
T. A. Plunkett and P. A. Ellis
CEACAM1: A Marker With a Difference or More of the Same?
J. Clin. Oncol., November 1, 2002; 20(21): 4273 - 4275.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS