|
|
||||||||





*
Lautenberg Center for General and Tumor Immunology and
Sharet Institute of Oncology, Hadassah Medical School, Jerusalem, Israel;
Gastroenterology Division, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02115;
Department of Immunology, Weizmann Institute of Science, Rehovot, Israel; and
¶ Department of Internal Medicine, HaEmek Medical Center, Afula, Israel
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
There are also newly discovered NK-specific receptors, termed natural cytotoxicity receptors (NCRs) (10), which are directly involved in triggering NK cell cytotoxicity. The NCR group consists of several proteins, including NKp30 (11), NKp44 (12), NKp46 (13), NKp80 (14), and CD16 (15). The cellular lysis ligands for all the NCRs have yet to be identified. A viral ligand (hemagglutinin) was recently shown to interact with the NKp46 receptor, and this interaction resulted in the enhancement of lysis of certain virus-infected cells (16).
It has been previously reported that treatment of melanoma patients
with tumor-infiltrating lymphocytes resulted in the emergence of class
I MHC loss variants in 40% of melanoma patients (17).
This is due to down-regulation of
2-microglobulin expression in the tumor cells.
The same tumor lines were later shown to be sensitive to various
degrees for NK cell-mediated killing (18). In addition, it
was shown that one of these melanoma lines, 1106mel, was inefficiently
killed by many of the CD16-negative NK clones tested
(15).
CD66a is a transmembrane protein, a member of the carcinoembryonic Ags family. It contains two ITIM sequences located within its cytosolic tail and interacts in a homotypic/heterotypic manner with other known CD66 proteins, including CD66a, CD66c, and CD66e proteins (19, 20). It is expressed on a wide spectrum of cells, ranging from epithelial to hemopoietic origin (21). Importantly, among all CD66 proteins tested, the CD66a protein only is expressed on the surface of activated, CD16-negative NK cells (22). The effect of the CD66a interactions on the inhibition of human NK cell cytotoxicity was never investigated.
In this study we show that many of the CD16-negative NK clones inefficiently kill 1106mel cells because of the CD66a homotypic interactions. The inhibition of NK cell cytotoxicity by CD66a was dependent on the level of CD66a expression on both effector and target cells. 721.221 cells expressing CD66a protein were protected from lysis by CD66a-expressing NK and YTS cells. Redirected lysis experiments showed that the strength of the inhibition is dependent on the level of CD66a expression on NK cells. Importantly, a dramatic increase in CD66a expression was observed among NK cells isolated from melanoma patients. These findings demonstrate a novel class I MHC-independent inhibitory mechanism of human NK cell cytotoxicity and suggest that some melanoma tumors use this mechanism to avoid attack by NK cells.
| Materials and Methods |
|---|
|
|
|---|
The cell lines used in this work are the class I MHC-negative human cell line 721.221 (23), the YTS NK tumor line, and various MHC class I-negative and -positive human melanoma cell lines. NK cells were isolated from PBL using the human NK cell isolation kit and the autoMACS instrument (Miltenyi Biotec, Auburn, CA). For the enrichment of CD66a-positive NK cells, isolated NK cells were further purified by depletion of CD16-positive NK cells using anti-CD16 mAb 3G8 and the autoMACS instrument. NK cells were grown in culture as previously described (24). The production and specificity of anti-NKp44 and NKp46 sera were previously described (16). The mAbs used in this work were mAb W632, directed against class I MHC molecules, the mAb anti-CD66 a,b,c,e Kat4c (purchased from DAKO, Carpenteria, CA), anti-CD66a mAb 5F4 (25), and the rabbit polyclonal anti-CD66a,c,e Abs (purchased from DAKO). The anti-CD99 mAb 12E7, used as a control, was a gift from A. Bernard (Hopital de LArchet, Nice, France). The anti-CD56 mAb (BD PharMingen, San Diego, CA) was also used as control.
Cytotoxicity assay and Ig fusion proteins
The cytotoxic activity of YTS and NK cells against the various targets was assayed in 5-h 35S release assays as described previously (24). In experiments in which mAb were included, the final mAb concentration was 10 µg/ml, or 40 µl/ml in cases where rabbit polyclonal Abs were used. Redirected lysis experiments were performed as previously described (11). The production of CD99-Ig, CD16-Ig, NKp30-Ig, NKp44-Ig, and NKp46-Ig fusion proteins by COS-7 cells and purification on a protein G column were previously described (15, 16, 26)
Quadruple staining
For quadruple staining, the following fluorochrome-conjugated mAbs were used: FITC-conjugated anti-CD66 Kat4c mAb (DAKO), PE-conjugated anti-CD56 mAb (BD PharMingen), and CyChrome-conjugated anti-CD3 (BD PharMingen). As the fourth color, biotinylated anti-CD16 mAb (Serotec, Oxford, U.K.) was used, followed by streptavidin-Cy5 (Jackson ImmunoResearch Laboratories, West Grove, PA) as a second reagent. To block nonspecific binding, cells were first incubated for 1 h on ice with 25% human serum and then incubated with the various Abs.
Generation of YTS and 721.221 cells expressing CD66a
The primers used for the amplification of CD66a cDNA needed for the transfection of 721.221 cells were as follows: 5' primer, CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including the HindIII restriction site), and 3' primer, GGAATTCCTTACTGCTTTTTTACTTCTGAATA (including the EcoRI restriction site). cDNA was cloned into the pCDNA3 vector (Invitrogen, San Diego, CA) and transfected into 721.221 cells as previously described (24). For transfection into YTS cells, CD66a cDNA was amplified by PCR using the 5' primer GGAATTCCGCCGCCACCATGGGGCACCTCTCAGCC (including the EcoRI restriction site) and the 3' primer GCGTCGACTTACTGCTTTTTTACTTCTGAATA (including the SalI restriction site). For amplification of the CD66aTrunc cDNA, the same 5' primer was used, with the 3' primer GCGTCGACATCTTGTTAGGTGGGTCATT. Amplified fragments were cloned into the pBABE retroviral vector and transfected into YTS cells as previously described (26).
| Results |
|---|
|
|
|---|
The roles of NKp30, NKp44, NKp46, and CD16 receptors in NK
recognition of various melanoma cells deficient in class I MHC
expression (except from LB33melA1, used as a control) were studied by
production of fusion proteins in which the extracellular domains of
NKp30 NKp44, NKp46, and CD16 were fused to the Fc portion of Ig. cDNA
encoding the extracellular domains of CD99 fused to the human IgG1 DNA
was used as a control. The Ig fusion proteins were incubated with the
various melanoma cells and analyzed for binding by indirect
immunostaining as previously described (15). In general,
the highest staining of the melanoma cells was observed with the
NKp30-Ig and NKp44-Ig fusion proteins (Table I
). Little staining of all Ig fusion
proteins was observed with LB33melA1 cells, a cell line that is hardly
killed by NK cells (data not shown). All other cell lines that can be
killed by NK cells were stained to various degrees with the Ig fusion
proteins (Table I
).
|
We therefore tested whether the expression of CD66a molecule can be
detected on the surface of various melanoma cell lines and NK cells.
Remarkably, all seven class I MHC-negative melanoma cell lines tested
expressed the CD66a protein at moderate or high levels (Table II
). No expression of MHC class I protein
(detected with the W632 mAb) was observed among these cell lines,
except from the LB33melB1 cell line that expresses the HLA-A24 protein
only (27). In contrast, 40% of the class I MHC-positive
melanoma lines tested showed little or no staining for the CD66a
protein (Table II
).
|
It was previously reported that the CD66a isoform is expressed on
CD16-negative NK cells (22). We next tested whether
1106mel cells would be protected from lysis by CD16-negative NK cells
expressing the CD66a protein. For the generation of CD16-negative NK
cells expressing CD66a, NK cells were first isolated from PBL of
various healthy donors and then depleted from CD16-positive NK cells by
using the anti-CD16 mAb 3G8 (as described in Materials and
Methods). Of 63 CD16-negative clones tested, 28 (45%) expressed
the CD66a protein (data not shown). In rare cases (2%) CD66a
expression could be detected on the surface of CD16-positive NK clones
(see Fig. 5
). The percentage of CD16-negative, CD66a-positive NK cells
can vary among different donors after activation. Various NK clones
were then tested in killing assays against 1106mel cells. Efficient
killing of 1106mel cells was observed with
CD16+CD66a- NK clones
(Fig. 1
, A and B).
The addition of anti-CD66 polyclonal Abs or the control 12E7 mAb
(incubated with either effector or target cells) had little
or noeffect (Fig. 1
, A and B). Similar results
were obtained when
CD16-CD66a- NK
clones were used (see Fig. 5
). In agreement with our previous
observations (15), little killing of 1106mel cells was
observed when CD16-CD66a+
NK cells (for example, clone 163) were used (Fig. 1
, C and
D), whereas effective killing (32.4%; data not shown) of
the CD66-deficient NK-sensitive 721.221 cell line was observed. The low
rate of 1106mel killing observed was the result of the inhibition
mediated by the CD66a homotypic interactions, as lysis of 1106mel cells
was restored when either the effector or the target cells were
incubated with anti-CD66a polyclonal Abs (Fig. 1
, C and
D). The anti-CD66 polyclonal Abs specifically stained
all cells that were positive for CD66a expression (NK clones,
melanomas, and various transfectants) and did not stain cells that were
negative for CD66a expression (for example, CD66a-negative NK clones;
data not shown). The controls, 12E7 mAb or polyclonal Abs from rabbit
immunized with purified ubiquitin, had little or no effect (Fig. 1
and
data not shown). Similar results were obtained when
CD16+CD66a+ NK clones were
used (see Fig. 5
). Reversal of the CD66a-mediated inhibition was also
observed even when the LB33melB1 cell line was used as a target. This
cell line expressed the lowest levels of CD66a proteins among all seven
class I-negative melanoma cells tested (Table II
and data not shown).
No inhibition of lysis by CD66a-positive NK cells was observed when
these clones were incubated with the 1259mel melanoma line, a cell line
that is efficiently killed by CD16-negative NK cells (Fig. 1
E). The reason why 1259mel cells are so sensitive to NK
killing is not yet understood. It is especially surprising because the
expression levels of the lysis ligands for CD16, NKp30, NKp44, and
NKp46, detected by the Ig fusion proteins were similar to those of
1106mel cells. One possible explanation is that other lysis ligands for
other lysis receptors (yet to be identified) exist on the surface of
1259mel cells, and the combined effect of all lysis receptors overcomes
the CD66a-mediated inhibition. In conclusion, the results presented
above demonstrate a novel class I-independent inhibitory mechanism of
human NK cell cytotoxicity.
|
|
To directly test the role of the CD66a protein in inhibition of NK
cell cytotoxicity, 721.221 target cells and YTS effector cells (both
deficient for CD66a expression; Fig. 2
)
were transfected with the CD66a cDNA. Several clones of 721.221 cells
expressing various levels of CD66a protein (.221/CD66a) were obtained.
Two representative clones, expressing either low
(.221/CD66alow) or high
(.221/CD66ahigh) levels, are shown in Fig. 2
. YTS
cells expressing either CD66a (YTS/CD66a) or CD66a in which the
cytoplasmic tail of the molecule was truncated not to include the ITIMs
(YTS/CD66aTrunc) were also generated (Fig. 2
). Importantly, the
expression level of the CD66a protein on YTS cells was similar to the
physiological level of expression on an average primary NK clone
(median fluorescence intensity (MFI) was >2-fold over the
background; a representative clone is shown in Fig. 2
). YTS
transfectants expressing higher levels of CD66a protein could not be
obtained. Transfectants were next tested in cytotoxicity assays.
Moderate, but significant, inhibition of YTS/CD66a killing was observed
when cells were incubated with .221/CD66ahigh in
all E:T cell ratios tested (Fig. 3
). The
percentages of killing of other targets, including the parental 721.221
or the .221/CD66alow were similar. Similar
results were obtained with other YTS and 721.221 cells expressing
similar levels of CD66a (data not shown).
|
|
|
Levels of CD66a expression on both effector and target cells are important for effective inhibition
One likely explanation for the moderate inhibition observed when
.221/CD66ahigh cells were incubated either with
YTS/CD66a or with CD66a+ NK cells is the level of
CD66a expression on both target and effector cells. Indeed, no
inhibition of lysis was observed when
.221/CD66alow cells were used (Fig. 3
), moderate
inhibition was observed when .221/CD66ahigh cells
were used (Fig. 3
), and strong inhibition of lysis was observed when
1106mel cells were used (Fig. 1
, C and D). The
1106mel cell line expresses the CD66a protein at a level 10-fold higher
than that of the .221/CD66ahigh transfectants
(Table II
and Fig. 2
). 721.221 cells expressing the CD66a protein at a
higher level than the transfectant presented in Fig. 2
could not be
obtained (data not shown). Thus, the level of CD66a expression on
target cells is important for effective inhibition of both YTS and NK
cells.
To correlate the level of expression of CD66a on NK cells and the
strength of inhibition, various NK clones (positive or negative for
CD16) expressing different levels of CD66a were used. The redirected
lysis of P815 cells was induced with either anti-CD16 mAb or
anti-NKp44 and -NKp46 sera depending whether the NK clone tested
expressed the CD16 protein. A direct correlation was observed between
the level of CD66 expression on the surface of the NK clones and the
percentage of inhibition of redirected lysis (Fig. 5
). The level of CD66a expression had to
be at least 2-fold above the background staining for efficient
inhibition to occur (Fig. 5
).
Elevation of CD66a expression on NK cells derived from melanoma patients
The in vivo significance of the CD66a interactions was studied by
the staining of NK cells derived from either metastasized lymph nodes
or peripheral blood. The lymph node of patient M-169 was infiltrated
with melanoma cells, highly positive for the CD66a expression (MFI,
247; data not shown). The lymph node was surgically removed, and
lymphocytes in direct contact with the tumor cells were obtained after
digestion and density gradient separation. Quadruple staining of the
lymphocytes was performed for the expression of the CD16, CD3, CD56,
and CD66 receptors. Remarkably, 12.85% of the NK cells
(CD56+CD3-) obtained from
M-169 lymph node expressed the CD66a protein (Fig. 6
A). A total of 10.5% of the
NK cells obtained were
CD16-CD66+, and 2.35%
were CD16+CD66+ (data not
shown). Importantly, the MFI of the CD66a-positive NK population was
8-fold above background, which is sufficient for effective inhibition
(an MFI >2-fold above background is needed; see Fig. 5
). Similar
results were obtained when peripheral blood NK cells derived from
patient 3 were analyzed with the same quadruple staining; 14.8% of the
NK cells were CD66a positive, and the MFI of this NK population was
7.5-fold above background (Fig. 6
B).
|
PBL from eight healthy donors were also obtained, and the expression of
CD66a on NK cells was analyzed using the same quadruple staining as
that described above. Very little or no CD66a staining was observed
among all NK cells tested (a representative healthy donor OM is shown
in Fig. 6
D). This is in agreement with a previous
observation (22) demonstrating the expression of the CD66a
molecule on activated NK clones only.
In conclusion, the results presented in this study suggest that the CD66a interactions are used by some melanoma cells as a mechanism of defense to avoid attack by CD66a-positive NK cells.
| Discussion |
|---|
|
|
|---|
The melanoma cell line 1106mel is shown to express high levels of the
CD66a protein (Table II
), and the lysis of this cell line is inhibited
by the CD66a protein present mainly on the surface of CD16-negative NK
cells (Fig. 1
, C and D). A direct interaction
between the CD66a proteins expressed on both target and effector cells,
leading to inhibition of NK cell cytotoxicity, was demonstrated by
lysis and blocking experiments, in which NK and target tumor cell lines
transfected with the CD66a cDNA were used (Figs. 3
and 4
A).
The strength of the inhibitory effect of the CD66a protein on NK
cytotoxicity was shown to correlate with the level of CD66a expression
on both target and effector cells.
To our knowledge there are only two other receptors, Irp60 (28) and p75/AIRM-1 (29), that are expressed on the surface of NK cells and can inhibit cytotoxicity via a class I-independent mechanism. However, the ligands that are recognized by these receptors are currently unknown (28, 29). The findings presented in this work together with the recent discovery of NCRs (11, 12, 13, 14, 15) and the identification of viral hemagglutinin as a ligand for the NKp46 receptor (16) suggest a certain degree of specificity for the killing by NK cells. Furthermore, they demonstrate that class I MHC proteins are not the only molecules that are able to confer inhibition of NK cell cytotoxicity, thus extending the boundaries of the missing self hypothesis.
The second issue arising from this study is the finding that some of
the melanoma cell lines use CD66a interactions to avoid attack by
CD66a-positive NK cells. All class I MHC-deficient melanoma cell lines
(a total of seven) express CD66a in moderate to high levels (Table II
),
but, in contrast, 40% of the class I MHC-positive melanomas do not
express the CD66a protein. A partial or complete loss of class I MHC
molecules was observed in 16 and 58% of primary and metastatic
melanoma lesions, respectively (30, 31).
The reason why the class I MHC-negative melanoma lines express high
levels of CD66a protein is currently unknown. In this regard it is
striking to learn that most class I-negative melanoma cell lines tested
here were obtained from patients treated with tumor-infiltrating
lymphocytes injection combined with IL-2 (1106mel, 1074mel, and
1259mel) (17) or with IFN-
and IL-2 treatment combined
with autologous melanoma vaccination of LB33melA1 (LB33melB1)
(27). In contrast, all class I-positive melanoma cell
lines were obtained from untreated patients.
Importantly, we demonstrate that in vivo in some melanoma patients a
dramatic increase in CD66a expression can be observed on the surface of
NK cells derived from lymph node or peripheral blood (Fig. 6
). The
up-regulation of CD66a expression was observed on the surface of
1314% of the NK cells tested. Other inhibitory mechanisms might
therefore account for the protection of MHC class I-negative melanoma
cells from lysis by the
86% of NK cells that are CD66a negative.
Strikingly, no CD66a expression was observed among NK cells isolated
either from lymph node infiltrated with melanoma cells that are
negative for CD66a expression or from the PBL of melanoma patients with
no detectable disease or from healthy donors (Fig. 6
). The increase in
CD66a expression correlates with the poor prognosis of the melanoma
patients.
The reason why CD66a expression is up-regulated on the surface of NK cells isolated from these patients is not completely understood. One possible explanation is that the NK cells obtained from these patients were activated. Indeed, it has been reported that the fraction of CD16-negative NK cells in the periphery (the same population that expresses the CD66a protein) is increased after prolonged treatment with continuous low dose rIL-2 (32).
In view of these results it is possible that in some cases of malignant melanoma the CD66a interactions are used by the tumors as a mechanism of defense to avoid attacks by CD66a-positive NK cells. Understanding the precise mechanism leading to the emergence of CD66a protein on the surface of both melanoma and NK cells might eventually lead to a better treatment for melanoma patients.
The expression of CD66a protein on NK cells must have different physiological roles other than inhibition of NK cytotoxicity by tumors. Indeed, CD66a protein was reported to be involved in the adhesive interactions of neutrophils with other cells (33) as well in signal transduction (34, 35). Furthermore, the CD66a protein was also reported to be involved in prostatic and colonic carcinoma growth inhibition (36, 37, 38).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ofer Mandelboim, Lautenberg Center for General and Tumor Immunology, Hadassah Medical School, 91120 Jerusalem, Israel. E-mail address: oferman{at}md2.huji.ac.il ![]()
3 Abbreviations used in this paper: ITIM, immunoreceptor tyrosine-based inhibitory motif; MFI, median fluorescence intensity; NCR, natural cytotoxicity receptor. ![]()
Received for publication November 26, 2001. Accepted for publication January 18, 2002.
| References |
|---|
|
|
|---|
2-microglobulin in metastatic melanomas from five patients receiving immunotherapy. J. Natl. Cancer Inst. 88:100.
2-microglobulin-deficient melanoma cells: implications for cancer immunotherapy. Proc. Natl. Acad. Sci. USA 94:13140.This article has been cited by other articles:
![]() |
N. Stanietsky, H. Simic, J. Arapovic, A. Toporik, O. Levy, A. Novik, Z. Levine, M. Beiman, L. Dassa, H. Achdout, et al. The interaction of TIGIT with PVR and PVRL2 inhibits human NK cell cytotoxicity PNAS, October 20, 2009; 106(42): 17858 - 17863. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O. Lobo, Z. Zhang, and J. E. Shively Pivotal Advance: CEACAM1 is a negative coreceptor for the B cell receptor and promotes CD19-mediated adhesion of B cells in a PI3K-dependent manner J. Leukoc. Biol., August 1, 2009; 86(2): 205 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Horst, T. Bickert, N. Brewig, P. Ludewig, N. van Rooijen, U. Schumacher, N. Beauchemin, W. D. Ito, B. Fleischer, C. Wagener, et al. CEACAM1+ myeloid cells control angiogenesis in inflammation Blood, June 25, 2009; 113(26): 6726 - 6736. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gambichler, S. Grothe, S. Rotterdam, P. Altmeyer, and A. Kreuter Protein Expression of Carcinoembryonic Antigen Cell Adhesion Molecules in Benign and Malignant Melanocytic Skin Lesions Am J Clin Pathol, June 1, 2009; 131(6): 782 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Halfteck, M. Elboim, C. Gur, H. Achdout, H. Ghadially, and O. Mandelboim Enhanced In Vivo Growth of Lymphoma Tumors in the Absence of the NK-Activating Receptor NKp46/NCR1 J. Immunol., February 15, 2009; 182(4): 2221 - 2230. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. MARKEL, T. COHEN-SINAI, M. J. BESSER, K. OVED, O. ITZHAKI, R. SEIDMAN, A. J. TREVES, E. FRIDMAN, Y. KEISARI, Z. DOTAN, et al. Preclinical Evaluation of Adoptive Cell Therapy for Patients with Metastatic Renal Cell Carcinoma Anticancer Res, January 1, 2009; 29(1): 145 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Achdout, I. Manaster, and O. Mandelboim Influenza Virus Infection Augments NK Cell Inhibition through Reorganization of Major Histocompatibility Complex Class I Proteins J. Virol., August 15, 2008; 82(16): 8030 - 8037. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. W. Lee, M. A. Ostrowski, and S. D. Gray-Owen CEACAM1 Dynamics during Neisseria gonorrhoeae Suppression of CD4+ T Lymphocyte Activation J. Immunol., May 15, 2008; 180(10): 6827 - 6835. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mizrahi, E. Yefenof, M. Gross, P. Attal, A. Ben Yaakov, D. Goldman-Wohl, B. Maly, N. Stern, G. Katz, R. Gazit, et al. A phenotypic and functional characterization of NK cells in adenoids J. Leukoc. Biol., November 1, 2007; 82(5): 1095 - 1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stern-Ginossar, S. Nedvetzki, G. Markel, R. Gazit, G. Betser-Cohen, H. Achdout, M. Aker, R. S. Blumberg, D. M. Davis, B. Appelmelk, et al. Intercellular Transfer of Carcinoembryonic Antigen from Tumor Cells to NK Cells J. Immunol., October 1, 2007; 179(7): 4424 - 4434. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Schmitter, S. Pils, V. Sakk, R. Frank, K.-D. Fischer, and C. R. Hauck The Granulocyte Receptor Carcinoembryonic Antigen-Related Cell Adhesion Molecule 3 (CEACAM3) Directly Associates with Vav to Promote Phagocytosis of Human Pathogens J. Immunol., March 15, 2007; 178(6): 3797 - 3805. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yu, E. M. C. Chow, H. Wong, J. Gu, O. Mandelboim, S. D. Gray-Owen, and M. A. Ostrowski CEACAM1 (CD66a) Promotes Human Monocyte Survival via a Phosphatidylinositol 3-Kinase- and AKT-dependent Pathway J. Biol. Chem., December 22, 2006; 281(51): 39179 - 39193. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Albarran-Somoza, R. Franco-Topete, V. Delgado-Rizo, F. Cerda-Camacho, L. Acosta-Jimenez, M. Lopez-Botet, and A. Daneri-Navarro CEACAM1 in Cervical Cancer and Precursor Lesions: Association With Human Papillomavirus Infection J. Histochem. Cytochem., December 1, 2006; 54(12): 1393 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, R. Seidman, N. Stern, T. Cohen-Sinai, O. Izhaki, G. Katz, M. Besser, A. J. Treves, R. S. Blumberg, R. Loewenthal, et al. Inhibition of Human Tumor-Infiltrating Lymphocyte Effector Functions by the Homophilic Carcinoembryonic Cell Adhesion Molecule 1 Interactions J. Immunol., November 1, 2006; 177(9): 6062 - 6071. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iizuka, T. Kaifu, A. Nakamura, M. Obinata, and T. Takai Establishment and Functional Characterization of Novel Natural Killer Cell Lines Derived from a Temperature-Sensitive SV40 Large T Antigen Transgenic Mouse J. Biochem., August 1, 2006; 140(2): 255 - 265. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Betser-Cohen, G. Katz, T. Gonen-Gross, N. Stern, T. I. Arnon, H. Achdout, R. Gazit, and O. Mandelboim Reduced KIR2DL1 Recognition of MHC Class I Molecules Presenting Phosphorylated Peptides. J. Immunol., June 1, 2006; 176(11): 6762 - 6769. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Colonna Cytolytic responses: cadherins put out the fire J. Exp. Med., February 20, 2006; 203(2): 261 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Azuz-Lieberman, G. Markel, S. Mizrahi, R. Gazit, J. Hanna, H. Achdout, R. Gruda, G. Katz, T. I. Arnon, S. Battat, et al. The involvement of NK cells in ankylosing spondylitis Int. Immunol., July 1, 2005; 17(7): 837 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Puxeddu, J A Knauf, M A Sartor, N Mitsutake, E P Smith, M Medvedovic, C R Tomlinson, S Moretti, and J A Fagin RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response Endocr. Relat. Cancer, June 1, 2005; 12(2): 319 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stern, G. Markel, T. I. Arnon, R. Gruda, H. Wong, S. D. Gray-Owen, and O. Mandelboim Carcinoembryonic Antigen (CEA) Inhibits NK Killing via Interaction with CEA-Related Cell Adhesion Molecule 1 J. Immunol., June 1, 2005; 174(11): 6692 - 6701. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, R. Gruda, H. Achdout, G. Katz, M. Nechama, R. S. Blumberg, R. Kammerer, W. Zimmermann, and O. Mandelboim The Critical Role of Residues 43R and 44Q of Carcinoembryonic Antigen Cell Adhesion Molecules-1 in the Protection from Killing by Human NK Cells J. Immunol., September 15, 2004; 173(6): 3732 - 3739. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Katz, R. Gazit, T. I. Arnon, T. Gonen-Gross, G. Tarcic, G. Markel, R. Gruda, H. Achdout, O. Drize, S. Merims, et al. MHC Class I-Independent Recognition of NK-Activating Receptor KIR2DS4 J. Immunol., August 1, 2004; 173(3): 1819 - 1825. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Chen and J. E. Shively The Cell-Cell Adhesion Molecule Carcinoembryonic Antigen-Related Cellular Adhesion Molecule 1 Inhibits IL-2 Production and Proliferation in Human T Cells by Association with Src Homology Protein-1 and Down-Regulates IL-2 Receptor J. Immunol., March 15, 2004; 172(6): 3544 - 3552. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Sundberg, N. Beauchemin, and B. Obrink The cytoplasmic domain of CEACAM1-L controls its lateral localization and the organization of desmosomes in polarized epithelial cells J. Cell Sci., March 1, 2004; 117(7): 1091 - 1104. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, H. Mussaffi, K.-L. Ling, M. Salio, S. Gadola, G. Steuer, H. Blau, H. Achdout, M. de Miguel, T. Gonen-Gross, et al. The mechanisms controlling NK cell autoreactivity in TAP2-deficient patients Blood, March 1, 2004; 103(5): 1770 - 1778. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. I. Arnon, H. Achdout, N. Lieberman, R. Gazit, T. Gonen-Gross, G. Katz, A. Bar-Ilan, N. Bloushtain, M. Lev, A. Joseph, et al. The mechanisms controlling the recognition of tumor- and virus-infected cells by NKp46 Blood, January 15, 2004; 103(2): 664 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Achdout, T. I. Arnon, G. Markel, T. Gonen-Gross, G. Katz, N. Lieberman, R. Gazit, A. Joseph, E. Kedar, and O. Mandelboim Enhanced Recognition of Human NK Receptors After Influenza Virus Infection J. Immunol., July 15, 2003; 171(2): 915 - 923. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Greicius, E. Severinson, N. Beauchemin, B. Obrink, and B. B. Singer CEACAM1 is a potent regulator of B cell receptor complex-induced activation J. Leukoc. Biol., July 1, 2003; 74(1): 126 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Finkenzeller, B. Fischer, S. Lutz, H. Schrewe, T. Shimizu, and W. Zimmermann Carcinoembryonic Antigen-Related Cell Adhesion Molecule 10 Expressed Specifically Early in Pregnancy in the Decidua Is Dispensable for Normal Murine Development Mol. Cell. Biol., January 1, 2003; 23(1): 272 - 279. [Abstract] [Full Text] |
||||
![]() |
T. A. Plunkett and P. A. Ellis CEACAM1: A Marker With a Difference or More of the Same? J. Clin. Oncol., November 1, 2002; 20(21): 4273 - 4275. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |