HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takeba, Y. Articles by Suzuki, N. Search for Related Content PubMed PubMed Citation Articles by Takeba, Y. Articles by Suzuki, N.

Txk, a Member of Nonreceptor Tyrosine Kinase of Tec Family, Acts as a Th1 Cell-Specific Transcription Factor and Regulates IFN- Gene Transcription¹

Yuko Takeba^2,*, Hiroko Nagafuchi^2,, Mitsuhiro Takeno^*, Jun-ichi Kashiwakura^* and Noboru Suzuki^3,*

^* Departments of Immunology and Medicine, and Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki, Kanagawa, Japan

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Precise mechanisms responsible for Th1 cell activation and differentiation are not fully elucidated. We have recently reported that Txk, a member of Tec family nonreceptor tyrosine kinase, is expressed on Th1/Th0 cells, and Txk regulates specifically IFN- gene expression. In this study, we found that Txk bound to IFN- promoter region. Txk transfection increased transcriptional activity of IFN- promoter plus luciferase constructs severalfold, including IFN- promoter -538, -208, and -53. IFN- promoter -39 was refractory to the Txk transfection. The actual site to which Txk bound was the element consisting of -53 and -39 bp from the transcription start site of human IFN- gene, a site distinct from several previously characterized binding sites. We found that the entire -53/-39 region was necessary for the binding to and function of Txk, because mutant promoter oligoDNA that contained contiguous five base substitutions dispersed throughout the -53/-39 inhibited the binding, and the mutant promoters did not respond to the Txk transfection. Similar sequences of this element are found within the 5' flanking regions of several Th1 cell-associated protein genes. Thus, Txk is expressed on Th1/Th0 cells with the IFN- production and acts as a Th1 cell-specific transcription factor.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Much interest has focused on Th1 and Th2 subsets that have been characterized on the basis of the discrete cytokine production profiles; Th1 cells secrete IL-2, IFN-, and lymphotoxin and are important for the cell-mediated response; Th2 cells produce IL-4, IL-5, IL-10, and IL-13 and provide help for Ig production (1, 2, 3, 4). Accumulating evidence suggests that distinct signaling molecules and transcription factors mediate cytokine expression pattern in Th1 and Th2 cells (5, 6, 7, 8, 9, 10, 11, 12, 13). However, to date, precise mechanisms responsible for the differentiation and development of polarized Th1 responses are not fully clarified in humans. Especially, intracellular signaling pathway specific for Th1 cells remains elucidated.

The Tec family has emerged recently as a subfamily of nonreceptor tyrosine kinases, consisting of Tec, Btk, Itk/Tsk/Emt, Bmx, and Txk/Rlk, all of which are importantly involved in the lymphocyte signaling pathways (14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24). Recently, Itk, the T cell-associated Tec family kinase, has been suggested for the involvement of Th2 cell development (5, 25). Txk/Rlk has been shown to be involved in signaling pathways of lymphocyte activation and is presumed to function in vivo as important signaling mediators (26, 27, 28, 29, 30, 31). Schneider et al. (26) suggested that TCR can utilize mouse Rlk (as well as ZAP-70) in the phosphorylation of key sites in the adaptor protein, SLP-76, leading to the up-regulation of Th1-preferred cytokine IL-2. Similarly, Rajagopal et al. (27) identified the T cell-specific adaptor protein, RIBP, which binds to mouse Rlk/Txk and modulates production of IL-2 and IFN-.

However, information concerning roles of Txk in human T lymphocyte function is limited. We have recently reported that Txk expression is restricted to Th1/Th0 cells with IFN--producing potential, and that Txk transfection resulted in severalfold increase of IFN- mRNA expression and protein production by up-regulating IFN- enhancer activity specifically (32). This finding prompted us to study a mechanism of Txk to provoke IFN- production in humans.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Plasmid vectors

Human Txk cDNA in phage was provided by G. W. Litman (University of South Florida, St. Petersburg, FL) (16). Full-length Txk cDNA was ligated into a mammalian expression vector, pME18S (SR- promoter; provided by K. Maruyama, Tokyo Medical and Dental University, Tokyo, Japan), as described (32).

IFN- promoter plus luciferase plasmids were kindly provided by C. B. Wilson (University of Washington, Seattle, WA) and H. A. Young (National Cancer Institute, Frederick, MD) (33, 34).

The IFN- promoter mutant plus luciferase plasmids were created using QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA.). Briefly, pIFN- promoter -208 plus luciferase was used as a template. The primers containing the desired mutation were extended during PCR cycling by PfuTurbo DNA polymerase (Stratagene). The amplification cycle consisted of one cycle of denaturation (95°C) for 1 min, followed by 18 cycles of denaturation (95°C) for 30 s, annealing for 1 min (55°C), and polymerization for 10 min (68°C). After PCR cycling, the PCR product was treated with Dpn I that is specific for methylated and hemimethylated DNA, and the synthesized nonmethylated DNA containing the mutation was recovered. The resultant mutant vector was used for transformation of Escherichia coli, DH5. Their sequences have been verified by DNA sequencing. c-Jun expression vector has been reported previously (35).

Transfection into Jurkat cells and luciferase assay

Purified plasmids were transfected into Jurkat cells by electroporation, as described (30). In brief, 5 µg of pIFN- promoter plus luciferase, 5 µg of pRSV-chloramphenicol acetyltransferase (CAT),⁴ and 10 µg of pME18S-Txk (Txk transfection) or pME18S (empty vector; mock transfection) were cotransfected. Forty-eight hours after transfection, the Jurkat cells were stimulated with 1 µg/ml PHA and cultured for various periods. Thereafter, protein assay, luciferase assay, and CAT-ELISA (Roche Diagnostics, Tokyo, Japan) of the cell lysates were conducted (32). IL-2 promoter plus luciferase vector was also included as a control promoter vector. In some experiments, c-Jun expression vector was used to transfect Jurkat cells to obtain control nuclear proteins (35).

Immunoblotting analysis

The cells were lysed with buffer containing 50 mM Tris, pH 8, 1% Nonidet P-40, 150 mM NaCl, and the protease inhibitors, as described (35). Equivalent amounts of proteins were resolved by SDS-PAGE. Proteins were transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA) and blocked with 3.5% BSA. Immunoblotting was performed using goat anti-Txk Ab (Santa Cruz Biotechnology, Santa Cruz, CA) and/or anti-Txk Ab developed by immunizing rabbits with whole Txk protein produced by bacterial cells. Blots were probed with appropriate biotin-conjugated secondary Ab, followed by streptavidin-alkaline phosphatase and detection by chemiluminescence.

Nuclear extracts

Nuclear extracts were prepared from T cells by a modification of the method of Dignam et al. (36). Briefly, cells were homogenized in two cell pellet volumes of 10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl₂, 1 mM EDTA, 0.5 mM DTT, 10% glycerol, and the protease inhibitors. The resultant nuclear pellet was homogenized in two cell pellet volumes of 20 mM HEPES, pH 7.9, 0.42 M KCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM DTT, 25% glycerol, and the protease inhibitors. After a 30-min incubation at 4°C, the samples were centrifuged for 20 min and the supernatants were dialyzed against buffer consisting of 20 mM HEPES, 20% glycerol, 0.2 mM EDTA, 0.5 mM PMSF, and 0.5 mM DTT. The protein concentration in the nuclear extracts was determined by Bio-Rad protein assay kit (Bio-Rad, Richmond, CA). In some experiments, human Th1 cell lines were established, as described previously (32), and nuclear proteins of the cells were recovered.

DNA-protein-binding assay

A gel shift assay was performed using digoxigenin gel shift kit (Boehringer Mannheim Biochemica, Mannheim, Germany). In brief, digoxigenin-labeled DNA fragments were incubated at room temperature for 15 min with 5–10 µg of nuclear proteins. Protein-DNA complexes were separated from free probe on a polyacrylamide gel. Thereafter, the gels were electrically transferred to nylon membrane and detected by chemiluminescence. We verified that a 20-fold excess of specific cold oligonucleotide competed the binding of the protein to the digoxigenin-labeled probe, whereas a similar excess from another site would not compete (see Figs. 3 and 4).

View larger version (45K): [in this window] [in a new window]   FIGURE 3. Gel shift assays of the Txk protein. A and B, Jurkat T cells were transfected with Txk expression vector (A), and a Th1 cell line was established from normal PBLs (B). The cells were recovered and were stimulated with PHA for the periods indicated. IFN- promoter region (core region, -53 to -39; actual synthetic oligoDNA, -56 to -36) was labeled with digoxigenin. Nuclear extracts were incubated with the digoxigenin-labeled probe and analyzed. C, Nuclear extracts from the Txk-transfected Jurkat cells stimulated with PHA for 1 h were incubated with the digoxigenin-labeled probe in the presence of a 10- or 20-fold molar excess of unlabeled (-56 to -36) oligoDNA or unlabeled AP-3 competitor oligoDNA (40 ). The DNA-protein complex was disappeared specifically by the introduction of the relevant oligoDNA, indicating the specificity of the binding. D, Txk-transfected Jurkat cells were kept unstimulated or stimulated with PHA for 1 h. The nuclear proteins were incubated with the -56 to -36 oligoDNA in the presence of control (anti-c-Fos) Ab and anti-Txk Ab, and analyzed similarly. Anti-Txk Ab, but not anti-c-Fos Ab, specifically depleted the binding, indicating that the DNA-protein complex includes Txk protein. E, Nuclear proteins were prepared from c-Jun-transfected Jurkat cells (35 ) and Txk-transfected Jurkat cells. The cells were kept unstimulated or stimulated with PHA for 1 h. The nuclear proteins were incubated with the biotin-labeled double-stranded IFN- -56 to -36. The binding proteins were recovered by streptavidin-Dynabeads and magnet, and analyzed by immunoblotting with anti-Txk Ab. c-Jun-transfected Jurkat cells contained undetectable levels of Txk protein bound to the -53 to -39 region. In contrast, Txk-transfected Jurkat cells contained full-length Txk (64 kDa). F, Double-stranded oligoDNA were synthesized according to the sequences of Th1-associated gene promoters, irrelevant sequences of the IFN- -160 to -140 and IL-2 -135 to -115 promoters. The oligoDNA were similarly tested for the binding. When we used IFN-irr and IL-2 promoter oligoDNA, there have been several DNA-protein complexes that appeared by the Txk-overexpressing Jurkat cells. However, none of the complexes has been disappeared by the introduction of the anti-Txk Ab, suggesting Txk did not bind to the irrelevant IFN- and IL-2 promoter regions. The protein-DNA complexes have been formed when we used CCR5 and TNF- promoter oligoDNA. The complexes have been specifically disappeared by the anti-Txk Ab, suggesting that Txk binds to CCR5 and TNF- promoter regions. All the complexes were specific to the relevant oligoDNA, because 20 times excess of unlabeled oligoDNA abolished the binding (data not shown).

View larger version (24K): [in this window] [in a new window]   FIGURE 4. Mutations of the Txk binding site of the IFN- promoter/enhancer region render the promoter/enhancer unresponsive to Txk transfection. A, Sequences and position of the mutant IFN- promoters used in this study. Three 20-bp mutant oligoDNA (-56 to -36) that were used in the gel shift assay and the mutant promoter plasmids were shown. B, Mutational analysis of the Txk binding site. Nuclear extract from the Txk-transfected T cells stimulated with PHA for 1 h was incubated with the digoxigenin-labeled wild-type (-56 to -36) probe in the presence of 10- or 20-fold molar excess of the indicated unlabeled oligoDNA. The binding was completely abolished by the three mutant oligoDNA, indicating that -53 to -49, -48 to -44, and -43 to -39 are necessary for Txk to bind the region. C, Luciferase assay of the mutant IFN- promoters. Site-directed mutagenesis was used to introduce exactly the same mutations (53 M, 48 M, and 43 M) into the pIFN- promoter -208 plus luciferase plasmid. The resulting constructs were transfected separately into the Jurkat cells, which were cotransfected with pRSV-CAT and Txk expression vector (pME-18S-Txk), or empty vector (pME-18S). After 40 h, the cells were treated with PHA or kept unstimulated. After 8-h stimulation, the cells were harvested, and the luciferase activity and CAT activities were measured. The results shown are representative of five independent experiments with similar results.

The probes were derived from sequences present in the IFN- promoter region (33, 34), related promoter regions, and irrelevant promoter regions. Actual DNA sequences synthesized were as follows: IFN- gene (designated as IFN -53/-39), -56 to -36 region, ACGTAATCCTCAGGAGACTTC; IFN- gene (designated as IFN-irr), -160 to -140 region, AAACTCTAACTACAACACCCA; CCR5 gene (designated as CCR5), -899 to -885 region, CACCAACCGCCAAGAGAGCTT; TNF- gene (designated as TNF-), -457 to -437 region, TGGGCCACTGACTGATTTGTG; IL-2 gene (designated as IL-2), -135 to -115 region, AAAGAGTCATCAGAAGAGGAA.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
We recently found that Txk expression is restricted to Th1/Th0 cells with IFN--producing potential, and that Txk itself translocates into nuclei and enhances IFN- gene transcription in T cells. In this study, we have focused on whether Txk itself or a protein complex including Txk acts as a Th1 cell-specific transcription factor for IFN- gene transcription.

It is important to clarify whether Txk protein directly binds to IFN- promoter/enhancer region to exert the positive effect for IFN- gene transcription. To this end, we labeled IFN- promoter -538 with biotin, which was recovered from pIFN- promoter -538 plus luciferase vector. Biotin-labeled IFN- promoter -538 was reacted with nuclear proteins of Txk-transfected Jurkat cells stimulated with PHA for 1 h. Thereafter, DNA-binding proteins were recovered by streptavidin-Dynabeads (Dynal, Oslo, Norway) and magnet, and analyzed by immunoblotting with anti-Txk Ab. We found that Txk actually binds to IFN- promoter -538 region (Fig. 1).

View larger version (33K): [in this window] [in a new window]   FIGURE 1. IFN- promoter-binding activity of Txk protein in Jurkat T cells. Jurkat cells were transfected with pME18S-Txk (wild-type Txk) expression vector and cultured for 48 h. Thereafter, the cells were activated with PHA for 1 h or kept unstimulated. IFN- promoter region -538 was biotin labeled and incubated with nuclear proteins of the Txk-transfected Jurkat cells in the presence of 5 µg/reaction poly(dI-dC). The DNA-binding nuclear proteins were recovered by streptavidin-Dynabeads and magnet. Thereafter, the proteins were analyzed by immunoblotting with anti-Txk Ab. As control DNA, calf thymus DNA was sonicated; 550-bp DNA fragment was recovered by glass beads and similarly treated. Txk protein (64 kDa; arrow) binds to the IFN- promoter region -538. The results shown are representative of three independent experiments with essentially the same result.

To identify to which element Txk binds for up-regulation of IFN- gene transcription, we tested a panel of constructs that contain subfragments of the IFN- gene linked to the reporter gene luciferase in transient expression system (Fig. 2). The pIFN- promoter plus luciferase vectors were transfected into the Jurkat cells. As a control, we used IL-2 promoter plus luciferase vector. The transfected cells were then treated with PHA for 8 h. pME18S-Txk or empty pME18S vector and pRSV-CAT were cotransfected with the luciferase vector. Treatment of the mock (empty pME18S)-transfected Jurkat cells with PHA increased luciferase activity moderately (Fig. 2). Txk-transfected Jurkat cells induced severalfold more luciferase activity than the mock-transfected Jurkat cells. Txk transfection had no detectable effect on the activity of multimers of NF-B, AP-1, CRE, and glucocorticoid response element (data not shown). A construct containing the IFN- promoter -53 had a reproducible increase in response to Txk transfection with mitogenic activation. In contrast, a construct with the IFN- promoter -39 did not respond to Txk transfection (Fig. 2). Similarly, IL-2 promoter -568 plus luciferase did not respond to Txk transfection, as has been shown previously (32).

View larger version (29K): [in this window] [in a new window]   FIGURE 2. Effects of Txk transfection on transcriptional activity of Jurkat cells transfected with a panel of IFN- promoter plus luciferase plasmids. Jurkat cells were cotransfected with the pIFN- promoter plus luciferase, pRSV-CAT, and pME18S-Txk. As a control vector, empty pME18S was used. Forty hours after transfection, one-half of the cells was stimulated with PHA for 8 h, and the remaining was kept unstimulated. pRSV-CAT was used to compare the transfection efficiency, and accordingly the luciferase activity of the promoter assays was corrected. We found that pIFN- promoter -53 reproducibly responded to the Txk transfection, whereas pIFN- promoter -39 did not. As a control promoter vector, pIL-2 promoter -568 plus luciferase vector was used. The results shown are representative of five independent experiments with essentially the same result.

Competition with a 10- and 20-fold molar excess of unlabeled double-stranded IFN- -53 to -39 oligoDNA specifically inhibited the binding of the complex; competition with a 10- and 20-fold molar excess of AP-3 binding site had no detectable effect (Fig. 3C).

It is possible that the protein-DNA complex that appeared in Txk-transfected Jurkat cells contained Txk protein itself. To prove the possibility, we have performed the gel shift assay with anti-Txk Ab to show the complex reacts with the Ab. We found that the complex was depleted by the treatment of the complex with anti-Txk Ab (5 µg/reaction) but not anti-c-Fos Ab (Fig. 3D). Thus, it is evident that the DNA-protein complex contained Txk.

To more precisely define the recognition sequences of the complex, we performed competition analysis with oligoDNA that contained contiguous five base substitutions dispersed throughout the -53 to -39 region (Fig. 4, A and B). The 20-bp oligoDNA containing -53 to -49 mutant (designated as 53 M), -48 to -44 mutant (48 M), and -43 to -39 mutant (43 M) were synthesized. Ten and 20 times excess of wild-type and the three mutant oligoDNA efficiently inhibited formation of the labeled oligoDNA/Txk complex. These results suggest that promoter region -53 to -39 is important for the Txk binding.

To confirm the above finding, we constructed mutant IFN- promoter plus luciferase constructs. We used pIFN- promoter -208 as a wild-type vector. We used site-directed mutagenesis to introduce the mutations into the pIFN- promoter plus luciferase construct, and obtained -53 to -49 mutant, -48 to -44 mutant, and -43 to -39 mutant vectors. We found that the -53 to -49, -48 to -44, and -43 to -39 mutants did not respond to the Txk transfection (Fig. 4C), suggesting that the entire sequence (-53 to -39) is critical for the recognition and function of the Txk. Thus, the Txk protein acts on the -53 to -39 region to up-regulate IFN- gene transcription.

To further characterize binding of Txk to IFN- gene, biotin-labeled double-stranded IFN- -53 to -39 region was synthesized. Nuclear proteins were prepared from c-Jun-transfected Jurkat cells (35) and Txk-transfected Jurkat cells. The nuclear proteins were incubated with the oligoDNA. The binding proteins were recovered by streptavidin-Dynabeads and magnet, and analyzed by immunoblotting with anti-Txk Ab. As shown in Fig. 3E, c-Jun-transfected Jurkat cells contained undetectable levels of Txk protein bound to the -53 to -39 region. In contrast, Txk-transfected Jurkat cells contained full-length Txk (64 kDa). Thus, the region -53 to -39 is specifically involved in the binding of Txk.

Similar sequences to this DNA-binding motif were found within the 5' flanking regions of IFN- promoter of several mammals and several human Th1 cell-associated protein genes, including CCR5 and TNF- (Fig. 5). Thus, we have conducted gel shift assays using the double-stranded oligoDNA corresponding to several human Th1 cell-associated protein gene promoters. As shown in Fig. 3F, the same nuclear protein included binding protein to the IFN-irr region -160 to -140, but the DNA-protein complex did not contain Txk protein in the complex, confirming the specificity of the Txk binding to the region -53 to -39. Similarly, the same nuclear protein contained binding protein to human IL-2 promoter region -135 to -115, but the binding complex did not contain Txk. In contrast, the same nuclear protein bound to the CCR5 and TNF- promoters, and the complexes were disappeared by the anti-Txk Ab, suggesting that Txk bound to the Th1 cell-associated gene promoters.

View larger version (37K): [in this window] [in a new window]   FIGURE 5. Conserved sequences in the 5' flanking region of Th1-associated protein genes. The sequences have been compared with the human IFN- sequence. The different nucleotide was underlined.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The importance of the proximal element (-71 to -43) for the IFN- production has already been reported by C. B. Wilson et al. (37); they suggested that activating transcription factor-2 and c-Jun play an important role in the induction of transcription by this proximal element. The Txk binding region we identified (-53 to -39) partly overlaps with the proximal element (-71 to -43), supporting their finding that the proximal region is important for IFN- gene transcription.

Recently, SLP-76 and RIBP were shown to be adaptor proteins of mouse Rlk (26, 27). We found that the -53 to -39 binding protein containing Txk did not contain activating transcription factor-2 (70 kDa) and c-Jun (39 kDa) by the gel shift assay (data not shown and Fig. 3E). It thus is important to identify the adaptor protein of human Txk.

In addition, they suggested that CpG dinucleotide in the proximal element is selectively methylated in Th2 cells that do not express IFN-, and is demethylated in Th1 cells, and that methylation of this region correlates strongly and inversely with the capacity of T cells to express IFN- (37, 38). These findings partly support our present result that the region -53 to -39 is the Txk binding site and is important for Th1 cell-specific IFN- gene transcription.

Because Txk is a nonreceptor tyrosine kinase, it is important to clarify whether phosphorylation of Txk is involved in the function of Txk. With regard to the kinase activity of Txk, Chamorro et al. (39) demonstrated that Rlk/Txk can be phosphorylated and activated by Src kinases. They suggested that Rlk/Txk is phosphorylated by Src family kinases in response to TCR engagement. We found that phosphorylation of Txk is necessary to exert its positive effect on IFN- production.⁵

It has been shown that Rlk/Txk has two isoforms generated by alternative translation start sites in mice (21). As shown in Fig. 3E, we have recovered the IFN- promoter (region -53/-39) binding protein and conducted immunoblotting analysis employing anti-Txk Ab (this Ab was developed against whole Txk protein). We found that the binding protein contained a longer type of Txk preferentially. However, it is possible that small amount of a shorter form of Txk is involved in the binding to IFN- promoter.

Our study indicates that Txk can greatly increase IFN- enhancer activity as a Th1 cell-specific transcription factor. The region of the IFN- enhancer that responds to Txk is absolutely conserved between the human and other mammalian IFN- genes, and similar sequences are present in the 5' flanking regions of several Th1 cell-associated genes. This suggests an important function of this signal transduction pathway and DNA-binding complex involving Txk for the Th1 cell development.

	Footnotes

 
¹ This work was supported, in part, by a grant for the Promotion of the Advancement of Education and Research in Graduate Schools from the Promotion and Mutual Aid Corporation for Private Schools of Japan; a grant-in-aid for Scientific Research Project 13037033 and special coordination funds from the Ministry of Education, Culture, Sports and Technology of Japan; Comprehensive Research on Aging and Health research grants from the Ministry of Health, Labor and Welfare of Japan; and a grant from the SRF Foundation.

² Y.T. and H.N. contributed equally to this study.

³ Address correspondence and reprint requests to Dr. Noboru Suzuki, Departments of Immunology and Medicine, St. Marianna University School of Medicine, 2-16-1, Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-8511, Japan. E-mail address: n3suzuki{at}marianna-u.ac.jp

⁴ Abbreviation used in this paper: CAT, chloramphenicol acetyltransferase.

⁵ J.-I. Kashiwakura, N. Suzuki, M. Takeno, S. Itoh, T. Oku, T. Sakane, S. Nakajin, and S. Toyoshima. Evidence of autophosphorylation in Txk: Y91 is an autophosphorylation site. Submitted for publication.

Received for publication May 8, 2001. Accepted for publication December 21, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Mosmann, T. R., R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.[Medline]
2. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4⁺ T cells. Annu. Rev. Immunol. 12:635.[Medline]
3. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler, D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses. Annu. Rev. Immunol. 16:495.[Medline]
4. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
5. Fowell, D. J., K. Shinkai, X. C. Liao, A. M. Beebe, R. L. Coffman, D. R. Littman, R. M. Locksley. 1999. Impaired NFATc translocation and failure of Th2 development in Itk-deficient CD4⁺ T cells. Immunity 11:399.[Medline]
6. Yang, D. D., D. Conze, A. J. Whitmarsh, T. Barrett, R. J. Davis, M. Rincon, R. A. Flavell. 1998. Differentiation of CD4⁺ T cells to Th1 cells requires MAP kinase JNK2. Immunity 9:575.[Medline]
7. Ouyang, W., M. Lohning, Z. Gao, M. Assenmacher, S. Ranganath, A. Radbruch, K. M. Murphy. 2000. Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity 12:27.[Medline]
8. Kiani, A., J. P. Viola, A. H. Lichtman, A. Rao. 1997. Down-regulation of IL-4 gene transcription and control of Th2 cell differentiation by a mechanism involving NFAT1. Immunity 7:849.[Medline]
9. Ranger, A. M., M. Oukka, J. Rengarajan, L. H. Glimcher. 1998. Inhibitory function of two NFAT family members in lymphoid homeostasis and Th2 development. Immunity 9:627.[Medline]
10. Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengere, A. C. Wakeham, D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, et al 1998. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production. Immunity 8:115.[Medline]
11. Li-Weber, M., P. Salgame, C. Hu, I. V. Davydov, O. Laur, S. Klevenz, P. H. Krammer. 1998. Th2-specific protein/DNA interactions at the proximal nuclear factor-AT site contribute to the functional activity of the human IL-4 promoter. J. Immunol. 161:1380.[Abstract/Free Full Text]
12. Moriggl, R., C. Kristofic, B. Kinzel, S. Volarevic, B. Groner, V. Brinkmann. 1998. Activation of STAT proteins and cytokine genes in human Th1 and Th2 cells generated in the absence of IL-12 and IL-4. J. Immunol. 160:3385.[Abstract/Free Full Text]
13. Gollob, J. A., E. A. Murphy, S. Mahajan, C. P. Schnipper, J. Ritz, D. A. Frank. 1998. Altered interleukin-12 responsiveness in Th1 and Th2 cells is associated with the differential activation of STAT5 and STAT1. Blood 91:1341.[Abstract/Free Full Text]
14. Mano, H.. 1999. Tec family of protein-tyrosine kinases: an overview of their structure and function. Cytokine Growth Factor Rev. 10:267.[Medline]
15. Hu, Q., D. Davidson, P. L. Schwartzberg, F. Macchiarini, M. J. Lenardo, J. A. Bluestone, L. A. Matis. 1995. Identification of Rlk, a novel protein tyrosine kinase with predominant expression in the T cell lineage. J. Biol. Chem. 270:1928.[Abstract/Free Full Text]
16. Haire, R. N., Y. Ohta, J. E. Lewis, S. M. Fu, P. Kroisel, G. W. Litman. 1994. TXK, a novel human tyrosine kinase expressed in T cells shares sequence identity with Tec family kinases and maps to 4p12. Hum. Mol. Genet. 3:897.[Abstract/Free Full Text]
17. Sommers, C. L., K. Huang, E. W. Shores, A. Grinberg, D. A. Charlick, C. A. Kozak, P. E. Love. 1995. Murine txk: a protein tyrosine kinase gene regulated by T cell activation. Oncogene 11:245.[Medline]
18. Ohta, Y., R. N. Haire, C. T. Amemiya, R. T. Litman, T. Trager, O. Riess, G. W. Litman. 1996. Human Txk: genomic organization, structure and contiguous physical linkage with the Tec gene. Oncogene 12:937.[Medline]
19. Ellis, J. H., R. P. Sutmuller, M. J. Sims, S. Cooksley. 1998. Functional analysis of the T-cell-restricted protein tyrosine kinase Txk. Biochem. J. 335:277.
20. Schneider, H., P. L. Schwartzberg, C. E. Rudd. 1998. Resting lymphocyte kinase (Rlk/Txk) phosphorylates the YVKM motif and regulates PI 3-kinase binding to T-cell antigen CTLA-4. Biochem. Biophys. Res. Commun. 252:14.[Medline]
21. Debnath, J., M. Chamorro, M. J. Czar, E. M. Schaeffer, M. J. Lenardo, H. E. Varmus, P. L. Schwartzberg. 1999. rlk/TXK encodes two forms of a novel cysteine string tyrosine kinase activated by src family kinases. Mol. Cell. Biol. 19:1498.[Abstract/Free Full Text]
22. Siliciano, J. D., T. A. Morrow, S. V. Desiderio. 1992. itk, a T-cell-specific tyrosine kinase gene inducible by interleukin 2. Proc. Natl. Acad. Sci. USA 89:11194.[Abstract/Free Full Text]
23. August, A., A. Sadra, B. Dupont, H. Hanafusa. 1997. Src-induced activation of inducible T cell kinase (ITK) requires phosphatidylinositol 3-kinase activity and the Pleckstrin homology domain of inducible T cell kinase. Proc. Natl. Acad. Sci. USA 94:11227.[Abstract/Free Full Text]
24. Andreotti, A. H., S. C. Bunnell, S. Feng, L. J. Berg, S. L. Schreiber. 1997. Regulatory intramolecular association in a tyrosine kinase of the Tec family. Nature 385:93.[Medline]
25. Liu, K. Q., S. C. Bunnell, C. B. Gurniak, L. J. Berg. 1998. T cell receptor-initiated calcium release is uncoupled from capacitative calcium entry in Itk-deficient T cells. J. Exp. Med. 187:1721.[Abstract/Free Full Text]
26. Schneider, H., B. Guerette, C. Guntermann, C. E. Rudd. 2000. Resting lymphocyte kinase (Rlk/Txk) targets lymphoid adaptor SLP-76 in the cooperative activation of interleukin-2 transcription in T-cells. J. Biol. Chem. 275:3835.[Abstract/Free Full Text]
27. Rajagopal, K., C. L. Sommers, D. C. Decker, E. O. Mitchell, U. Korthauer, A. I. Sperling, C. A. Kozak, P. E. Love, J. A. Bluestone. 1999. RIBP, a novel Rlk/Txk- and itk-binding adaptor protein that regulates T cell activation. J. Exp. Med. 190:1657.[Abstract/Free Full Text]
28. Sommers, C. L., R. L. Rabin, A. Grinberg, H. C. Tsay, J. Farber, P. E. Love. 1999. A role for the Tec family tyrosine kinase Txk in T cell activation and thymocyte selection. J. Exp. Med. 190:1427.[Abstract/Free Full Text]
29. Schaeffer, E. M., J. Debnath, G. Yap, D. McVicar, X. C. Liao, D. R. Littman, A. Sher, H. E. Varmus, M. J. Lenardo, P. L. Schwartzberg. 1999. Requirement for Tec kinases Rlk and Itk in T cell receptor signaling and immunity. Science 284:638.[Abstract/Free Full Text]
30. Hu, Q., D. Davidson, P. L. Schwartzberg, F. Macchiarin, M. J. Lenardo, J. A. Bluestone, L. A. Matis. 1995. Identification of Rlk, a novel protein tyrosine kinase with predominant expression in the T cell lineage. J. Biol. Chem. 270:1928.
31. Debnath, J., M. Chamorro, M. J. Czar, E. M. Schaeffer, M. J. Lenardo, H. E. Varmus, P. L. Schwartzberg. 1999. rlk/TXK encodes two forms of a novel cysteine string tyrosine kinase activated by Src family kinases. Mol. Cell. Biol. 19:1498.
32. Kashiwakura, J., N. Suzuki, H. Nagafuchi, M. Takeno, Y. Takeba, Y. Shimoyama, T. Sakane. 1999. Txk, a nonreceptor tyrosine kinase of the Tec family, is expressed in T helper type 1 cells and regulates interferon production in human T lymphocytes. J. Exp. Med. 190:1147.[Abstract/Free Full Text]
33. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, C. B. Wilson. 1993. Two essential regulatory elements in the human interferon promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
34. Cippitelli, M., J. Ye, V. Viggiano, A. Sica, P. Ghosh, A. Gulino, A. Santoni, H. A. Young. 1996. Retinoic acid-induced transcriptional modulation of the human interferon- promoter. J. Biol. Chem. 271:26783.[Abstract/Free Full Text]
35. Wakisaka, S., N. Suzuki, N. Saito, T. Ochi, T. Sakane. 1998. Possible correction of abnormal rheumatoid arthritis synovial cell function by jun D transfection in vitro. Arthritis Rheum. 41:470.[Medline]
36. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
37. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, C. B. Wilson. 1996. The proximal regulatory element of the interferon- promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.[Abstract/Free Full Text]
38. Young, H. A., P. Ghosh, J. Ye, J. Lederer, A. Lichtman, J. R. Gerard, L. Penix, C. B. Wilson, A. J. Melvin, M. E. McGurn, et al 1994. Differentiation of the T helper phenotypes by analysis of the methylation state of the IFN- gene. J. Immunol. 153:3603.[Abstract]
39. Chamorro, M., M. J. Czar, J. Debnath, G. Cheng, M. J. Lenardo, H. E. Varmus, P. L. Schwartzberg. 2001. Requirements for activation and RAFT localization of the T-lymphocyte kinase Rlk/Txk. BMC Immunol. 2:3.[Medline]
40. Wood, I. C., A. Roopra, C. Harrington, N. J. Buckley. 1995. Structure of the m4 cholinergic muscarinic receptor gene and its promoter. J. Biol. Chem. 270:30933.[Abstract/Free Full Text]

This article has been cited by other articles:

				L. L. Elo, H. Jarvenpaa, M. Oresic, R. Lahesmaa, and T. Aittokallio Systematic construction of gene coexpression networks with applications to human T helper cell differentiation process Bioinformatics, August 15, 2007; 23(16): 2096 - 2103. [Abstract] [Full Text] [PDF]

				N. Suzuki, K. Nara, and T. Suzuki Skewed Th1 Responses Caused by Excessive Expression of Txk, a Member of the Tec Family of Tyrosine Kinases, in Patients with Behcet's Disease. Clin. Med. Res., June 1, 2006; 4(2): 147 - 151. [Abstract] [Full Text] [PDF]

				D. R. Marshall, E. Olivas, S. Andreansky, N. L. La Gruta, G. A. Neale, A. Gutierrez, D. G. Wichlan, S. Wingo, C. Cheng, P. C. Doherty, et al. Effector CD8+ T cells recovered from an influenza pneumonia differentiate to a state of focused gene expression PNAS, April 26, 2005; 102(17): 6074 - 6079. [Abstract] [Full Text] [PDF]

				B. Lu, P. Zagouras, J. E. Fischer, J. Lu, B. Li, and R. A. Flavell Kinetic analysis of genomewide gene expression reveals molecule circuitries that control T cell activation and Th1/2 differentiation PNAS, March 2, 2004; 101(9): 3023 - 3028. [Abstract] [Full Text] [PDF]

				J.-z. Zhang, M. Sinha, B. A. Luxon, and X.-j. Yu Survival Strategy of Obligately Intracellular Ehrlichia chaffeensis: Novel Modulation of Immune Response and Host Cell Cycles Infect. Immun., January 1, 2004; 72(1): 498 - 507. [Abstract] [Full Text] [PDF]

				Z. Chen, R. Lund, T. Aittokallio, M. Kosonen, O. Nevalainen, and R. Lahesmaa Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes J. Immunol., October 1, 2003; 171(7): 3627 - 3635. [Abstract] [Full Text] [PDF]

				F. Carinci, F. Francioso, A. Piattelli, C. Rubini, M. Fioroni, R. Evangelisti, D. Arcelli, L. Tosi, F. Pezzetti, P. Carinci, et al. Genetic Expression Profiling of Six Odontogenic Tumors J. Dent. Res., July 1, 2003; 82(7): 551 - 557. [Abstract] [Full Text] [PDF]

				A. Takesono, L. D. Finkelstein, and P. L. Schwartzberg Beyond calcium: new signaling pathways for Tec family kinases J. Cell Sci., January 8, 2002; 115(15): 3039 - 3048. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takeba, Y. Articles by Suzuki, N. Search for Related Content PubMed PubMed Citation Articles by Takeba, Y. Articles by Suzuki, N.