|
|
||||||||
Gene Transcription1

*
Departments of Immunology and Medicine, and
Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki, Kanagawa, Japan
| Abstract |
|---|
|
|
|---|
gene
expression. In this study, we found that Txk bound to IFN-
promoter
region. Txk transfection increased transcriptional activity of IFN-
promoter plus luciferase constructs severalfold, including IFN-
promoter -538, -208, and -53. IFN-
promoter -39 was refractory
to the Txk transfection. The actual site to which Txk bound was the
element consisting of -53 and -39 bp from the transcription start
site of human IFN-
gene, a site distinct from several previously
characterized binding sites. We found that the entire -53/-39 region
was necessary for the binding to and function of Txk, because mutant
promoter oligoDNA that contained contiguous five base substitutions
dispersed throughout the -53/-39 inhibited the binding, and the
mutant promoters did not respond to the Txk transfection. Similar
sequences of this element are found within the 5' flanking regions of
several Th1 cell-associated protein genes. Thus, Txk is expressed on
Th1/Th0 cells with the IFN-
production and acts as a Th1
cell-specific transcription factor. | Introduction |
|---|
|
|
|---|
, and lymphotoxin and are
important for the cell-mediated response; Th2 cells produce IL-4, IL-5,
IL-10, and IL-13 and provide help for Ig production
(1, 2, 3, 4). Accumulating evidence suggests that distinct
signaling molecules and transcription factors mediate cytokine
expression pattern in Th1 and Th2 cells (5, 6, 7, 8, 9, 10, 11, 12, 13). However,
to date, precise mechanisms responsible for the differentiation and
development of polarized Th1 responses are not fully clarified in
humans. Especially, intracellular signaling pathway specific for Th1
cells remains elucidated.
The Tec family has emerged recently as a subfamily of nonreceptor
tyrosine kinases, consisting of Tec, Btk, Itk/Tsk/Emt, Bmx, and
Txk/Rlk, all of which are importantly involved in the lymphocyte
signaling pathways (14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24). Recently, Itk, the T
cell-associated Tec family kinase, has been suggested for the
involvement of Th2 cell development (5, 25). Txk/Rlk has
been shown to be involved in signaling pathways of lymphocyte
activation and is presumed to function in vivo as important signaling
mediators (26, 27, 28, 29, 30, 31). Schneider et al. (26)
suggested that TCR can utilize mouse Rlk (as well as ZAP-70) in the
phosphorylation of key sites in the adaptor protein, SLP-76, leading to
the up-regulation of Th1-preferred cytokine IL-2. Similarly, Rajagopal
et al. (27) identified the T cell-specific adaptor
protein, RIBP, which binds to mouse Rlk/Txk and modulates production of
IL-2 and IFN-
.
However, information concerning roles of Txk in human T lymphocyte
function is limited. We have recently reported that Txk expression is
restricted to Th1/Th0 cells with IFN-
-producing potential, and that
Txk transfection resulted in severalfold increase of IFN-
mRNA
expression and protein production by up-regulating IFN-
enhancer
activity specifically (32). This finding prompted us to
study a mechanism of Txk to provoke IFN-
production in humans.
| Materials and Methods |
|---|
|
|
|---|
Human Txk cDNA in
phage was provided by G. W. Litman
(University of South Florida, St. Petersburg, FL)
(16). Full-length Txk cDNA was ligated into a mammalian
expression vector, pME18S (SR-
promoter; provided by K. Maruyama,
Tokyo Medical and Dental University, Tokyo, Japan), as described
(32).
IFN-
promoter plus luciferase plasmids were kindly provided by
C. B. Wilson (University of Washington, Seattle, WA) and H.
A. Young (National Cancer Institute, Frederick, MD) (33, 34).
The IFN-
promoter mutant plus luciferase plasmids were created using
QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA.).
Briefly, pIFN-
promoter -208 plus luciferase was used as a
template. The primers containing the desired mutation were extended
during PCR cycling by PfuTurbo DNA polymerase (Stratagene). The
amplification cycle consisted of one cycle of denaturation (95°C) for
1 min, followed by 18 cycles of denaturation (95°C) for 30 s,
annealing for 1 min (55°C), and polymerization for 10 min (68°C).
After PCR cycling, the PCR product was treated with Dpn I that is
specific for methylated and hemimethylated DNA, and the synthesized
nonmethylated DNA containing the mutation was recovered. The resultant
mutant vector was used for transformation of Escherichia
coli, DH5
. Their sequences have been verified by DNA
sequencing. c-Jun expression vector has been reported previously
(35).
Transfection into Jurkat cells and luciferase assay
Purified plasmids were transfected into Jurkat cells by
electroporation, as described (30). In brief, 5 µg of
pIFN-
promoter plus luciferase, 5 µg of pRSV-chloramphenicol
acetyltransferase
(CAT),4 and 10 µg of
pME18S-Txk (Txk transfection) or pME18S (empty vector; mock
transfection) were cotransfected. Forty-eight hours after transfection,
the Jurkat cells were stimulated with 1 µg/ml PHA and cultured for
various periods. Thereafter, protein assay, luciferase assay, and
CAT-ELISA (Roche Diagnostics, Tokyo, Japan) of the cell lysates were
conducted (32). IL-2 promoter plus luciferase vector was
also included as a control promoter vector. In some experiments, c-Jun
expression vector was used to transfect Jurkat cells to obtain control
nuclear proteins (35).
Immunoblotting analysis
The cells were lysed with buffer containing 50 mM Tris, pH 8, 1% Nonidet P-40, 150 mM NaCl, and the protease inhibitors, as described (35). Equivalent amounts of proteins were resolved by SDS-PAGE. Proteins were transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA) and blocked with 3.5% BSA. Immunoblotting was performed using goat anti-Txk Ab (Santa Cruz Biotechnology, Santa Cruz, CA) and/or anti-Txk Ab developed by immunizing rabbits with whole Txk protein produced by bacterial cells. Blots were probed with appropriate biotin-conjugated secondary Ab, followed by streptavidin-alkaline phosphatase and detection by chemiluminescence.
Nuclear extracts
Nuclear extracts were prepared from T cells by a modification of the method of Dignam et al. (36). Briefly, cells were homogenized in two cell pellet volumes of 10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 0.5 mM DTT, 10% glycerol, and the protease inhibitors. The resultant nuclear pellet was homogenized in two cell pellet volumes of 20 mM HEPES, pH 7.9, 0.42 M KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 25% glycerol, and the protease inhibitors. After a 30-min incubation at 4°C, the samples were centrifuged for 20 min and the supernatants were dialyzed against buffer consisting of 20 mM HEPES, 20% glycerol, 0.2 mM EDTA, 0.5 mM PMSF, and 0.5 mM DTT. The protein concentration in the nuclear extracts was determined by Bio-Rad protein assay kit (Bio-Rad, Richmond, CA). In some experiments, human Th1 cell lines were established, as described previously (32), and nuclear proteins of the cells were recovered.
DNA-protein-binding assay
A gel shift assay was performed using digoxigenin gel shift kit
(Boehringer Mannheim Biochemica, Mannheim, Germany). In brief,
digoxigenin-labeled DNA fragments were incubated at room temperature
for 15 min with 510 µg of nuclear proteins. Protein-DNA complexes
were separated from free probe on a polyacrylamide gel. Thereafter, the
gels were electrically transferred to nylon membrane and detected by
chemiluminescence. We verified that a 20-fold excess of specific cold
oligonucleotide competed the binding of the protein to the
digoxigenin-labeled probe, whereas a similar excess from another site
would not compete (see Figs. 3
and 4
).
|
|
The probes were derived from sequences present in the IFN-
promoter region (33, 34), related promoter regions, and
irrelevant promoter regions. Actual DNA sequences synthesized were as
follows: IFN-
gene (designated as IFN -53/-39), -56 to
-36 region, ACGTAATCCTCAGGAGACTTC; IFN-
gene
(designated as IFN-irr), -160 to -140 region, AAACTCTAACTACAACACCCA;
CCR5 gene (designated as CCR5), -899 to -885
region, CACCAACCGCCAAGAGAGCTT; TNF-
gene (designated as
TNF-
), -457 to -437 region, TGGGCCACTGACTGATTTGTG;
IL-2 gene (designated as IL-2), -135 to -115 region,
AAAGAGTCATCAGAAGAGGAA.
| Results |
|---|
|
|
|---|
-producing potential, and that Txk itself
translocates into nuclei and enhances IFN-
gene transcription in T
cells. In this study, we have focused on whether Txk itself or a
protein complex including Txk acts as a Th1 cell-specific transcription
factor for IFN-
gene transcription.
It is important to clarify whether Txk protein directly binds to
IFN-
promoter/enhancer region to exert the positive effect for
IFN-
gene transcription. To this end, we labeled IFN-
promoter
-538 with biotin, which was recovered from pIFN-
promoter -538
plus luciferase vector. Biotin-labeled IFN-
promoter -538 was
reacted with nuclear proteins of Txk-transfected Jurkat cells
stimulated with PHA for 1 h. Thereafter, DNA-binding proteins were
recovered by streptavidin-Dynabeads (Dynal, Oslo, Norway) and
magnet, and analyzed by immunoblotting with anti-Txk Ab. We found
that Txk actually binds to IFN-
promoter -538 region (Fig. 1
).
|
gene transcription during Th1 cell activation
is mediated mainly by a region extending
538 bp upstream of the
transcription start site (33, 34), and this region
contains binding sites for several nuclear proteins (33, 34).
To identify to which element Txk binds for up-regulation of
IFN-
gene transcription, we tested a panel of constructs that
contain subfragments of the IFN-
gene linked to the
reporter gene luciferase in transient expression system (Fig. 2
). The pIFN-
promoter plus luciferase
vectors were transfected into the Jurkat cells. As a control, we used
IL-2 promoter plus luciferase vector. The transfected cells were then
treated with PHA for 8 h. pME18S-Txk or empty pME18S vector and
pRSV-CAT were cotransfected with the luciferase vector. Treatment of
the mock (empty pME18S)-transfected Jurkat cells with PHA increased
luciferase activity moderately (Fig. 2
). Txk-transfected Jurkat cells
induced severalfold more luciferase activity than the mock-transfected
Jurkat cells. Txk transfection had no detectable effect on the activity
of multimers of NF-
B, AP-1, CRE, and glucocorticoid response
element (data not shown). A construct containing the IFN-
promoter -53 had a reproducible increase in response to Txk
transfection with mitogenic activation. In contrast, a construct with
the IFN-
promoter -39 did not respond to Txk transfection
(Fig. 2
). Similarly, IL-2 promoter -568 plus luciferase did not
respond to Txk transfection, as has been shown previously
(32).
|
gene. Unstimulated Txk-transfected
(Fig. 3
Competition with a 10- and 20-fold molar excess of unlabeled
double-stranded IFN-
-53 to -39 oligoDNA specifically inhibited
the binding of the complex; competition with a 10- and 20-fold molar
excess of AP-3 binding site had no detectable effect (Fig. 3
C).
It is possible that the protein-DNA complex that appeared in
Txk-transfected Jurkat cells contained Txk protein itself. To prove the
possibility, we have performed the gel shift assay with anti-Txk Ab
to show the complex reacts with the Ab. We found that the complex was
depleted by the treatment of the complex with anti-Txk Ab (5
µg/reaction) but not anti-c-Fos Ab (Fig. 3
D). Thus, it
is evident that the DNA-protein complex contained Txk.
To more precisely define the recognition sequences of the complex, we
performed competition analysis with oligoDNA that contained contiguous
five base substitutions dispersed throughout the -53 to -39 region
(Fig. 4
, A and B).
The 20-bp oligoDNA containing -53 to -49 mutant (designated as 53 M),
-48 to -44 mutant (48 M), and -43 to -39 mutant (43 M) were
synthesized. Ten and 20 times excess of wild-type and the three mutant
oligoDNA efficiently inhibited formation of the labeled oligoDNA/Txk
complex. These results suggest that promoter region -53 to -39
is important for the Txk binding.
To confirm the above finding, we constructed mutant IFN-
promoter
plus luciferase constructs. We used pIFN-
promoter -208 as a
wild-type vector. We used site-directed mutagenesis to introduce the
mutations into the pIFN-
promoter plus luciferase construct, and
obtained -53 to -49 mutant, -48 to -44 mutant, and -43 to -39
mutant vectors. We found that the -53 to -49, -48 to -44, and -43
to -39 mutants did not respond to the Txk transfection (Fig. 4
C), suggesting that the entire sequence (-53 to -39) is
critical for the recognition and function of the Txk. Thus, the Txk
protein acts on the -53 to -39 region to up-regulate IFN-
gene
transcription.
To further characterize binding of Txk to IFN-
gene,
biotin-labeled double-stranded IFN-
-53 to -39 region was
synthesized. Nuclear proteins were prepared from c-Jun-transfected
Jurkat cells (35) and Txk-transfected Jurkat
cells. The nuclear proteins were incubated with the oligoDNA. The
binding proteins were recovered by streptavidin-Dynabeads and magnet,
and analyzed by immunoblotting with anti-Txk Ab. As shown in Fig. 3
E, c-Jun-transfected Jurkat cells contained undetectable
levels of Txk protein bound to the -53 to -39 region. In contrast,
Txk-transfected Jurkat cells contained full-length Txk (64 kDa). Thus,
the region -53 to -39 is specifically involved in the binding of
Txk.
Similar sequences to this DNA-binding motif were found within the 5'
flanking regions of IFN-
promoter of several mammals and several
human Th1 cell-associated protein genes, including CCR5 and
TNF-
(Fig. 5
). Thus, we
have conducted gel shift assays using the double-stranded oligoDNA
corresponding to several human Th1 cell-associated protein gene
promoters. As shown in Fig. 3
F, the same nuclear protein
included binding protein to the IFN-irr region -160 to -140,
but the DNA-protein complex did not contain Txk protein in the complex,
confirming the specificity of the Txk binding to the region -53 to
-39. Similarly, the same nuclear protein contained binding protein to
human IL-2 promoter region -135 to -115, but the binding complex did
not contain Txk. In contrast, the same nuclear protein bound to the
CCR5 and TNF-
promoters, and the complexes were disappeared by the
anti-Txk Ab, suggesting that Txk bound to the Th1 cell-associated
gene promoters.
|
| Discussion |
|---|
|
|
|---|
promoter -53/-39 region to exert a positive effect on IFN-
gene transcription. Similar sequences of this element are found within
the 5' flanking regions of several Th1 cell-associated protein genes,
and Txk also bound to the regions in the gel shift assay. Thus, it is
possible that Txk is expressed on Th1/Th0 cells with the IFN-
production and acts as a Th1 cell-specific transcription factor.
The importance of the proximal element (-71 to -43) for the IFN-
production has already been reported by C. B. Wilson et al.
(37); they suggested that activating transcription
factor-2 and c-Jun play an important role in the induction of
transcription by this proximal element. The Txk binding region we
identified (-53 to -39) partly overlaps with the proximal element
(-71 to -43), supporting their finding that the proximal region is
important for IFN-
gene transcription.
Recently, SLP-76 and RIBP were shown to be adaptor proteins of mouse
Rlk (26, 27). We found that the -53 to -39 binding
protein containing Txk did not contain activating transcription
factor-2 (70 kDa) and c-Jun (39 kDa) by the gel shift assay (data not
shown and Fig. 3
E). It thus is important to identify the
adaptor protein of human Txk.
In addition, they suggested that CpG dinucleotide in the proximal
element is selectively methylated in Th2 cells that do not express
IFN-
, and is demethylated in Th1 cells, and that methylation of this
region correlates strongly and inversely with the capacity of T cells
to express IFN-
(37, 38). These findings partly support
our present result that the region -53 to -39 is the Txk binding site
and is important for Th1 cell-specific IFN-
gene transcription.
Because Txk is a nonreceptor tyrosine kinase, it is important to
clarify whether phosphorylation of Txk is involved in the function of
Txk. With regard to the kinase activity of Txk, Chamorro et al.
(39) demonstrated that Rlk/Txk can be phosphorylated and
activated by Src kinases. They suggested that Rlk/Txk is phosphorylated
by Src family kinases in response to TCR engagement. We found that
phosphorylation of Txk is necessary to exert its positive effect on
IFN-
production.5
It has been shown that Rlk/Txk has two isoforms generated by
alternative translation start sites in mice (21). As shown
in Fig. 3
E, we have recovered the IFN-
promoter (region
-53/-39) binding protein and conducted immunoblotting analysis
employing anti-Txk Ab (this Ab was developed against whole Txk
protein). We found that the binding protein contained a longer type of
Txk preferentially. However, it is possible that small amount of a
shorter form of Txk is involved in the binding to IFN-
promoter.
Our study indicates that Txk can greatly increase IFN-
enhancer
activity as a Th1 cell-specific transcription factor. The region of the
IFN-
enhancer that responds to Txk is absolutely conserved between
the human and other mammalian IFN-
genes, and similar sequences are
present in the 5' flanking regions of several Th1 cell-associated
genes. This suggests an important function of this signal transduction
pathway and DNA-binding complex involving Txk for the Th1 cell
development.
| Footnotes |
|---|
2 Y.T. and H.N. contributed equally to this study. ![]()
3 Address correspondence and reprint requests to Dr. Noboru Suzuki, Departments of Immunology and Medicine, St. Marianna University School of Medicine, 2-16-1, Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-8511, Japan. E-mail address: n3suzuki{at}marianna-u.ac.jp ![]()
4 Abbreviation used in this paper: CAT, chloramphenicol acetyltransferase. ![]()
5 J.-I. Kashiwakura, N. Suzuki, M. Takeno, S. Itoh, T. Oku, T. Sakane, S. Nakajin, and S. Toyoshima. Evidence of autophosphorylation in Txk: Y91 is an autophosphorylation site. Submitted for publication. ![]()
Received for publication May 8, 2001. Accepted for publication December 21, 2001.
| References |
|---|
|
|
|---|
production in human T lymphocytes. J. Exp. Med. 190:1147.
promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.
promoter. J. Biol. Chem. 271:26783.
promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.
gene. J. Immunol. 153:3603.[Abstract]
This article has been cited by other articles:
![]() |
Y. Y. Wan and R. A. Flavell How Diverse--CD4 Effector T Cells and their Functions J Mol Cell Biol, May 28, 2009; (2009) mjp001v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sahu, A. M. Venegas, D. Jankovic, W. Mitzner, J. Gomez-Rodriguez, J. L. Cannons, C. Sommers, P. Love, A. Sher, P. L. Schwartzberg, et al. Selective Expression Rather than Specific Function of Txk and Itk Regulate Th1 and Th2 Responses J. Immunol., November 1, 2008; 181(9): 6125 - 6131. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Elo, H. Jarvenpaa, M. Oresic, R. Lahesmaa, and T. Aittokallio Systematic construction of gene coexpression networks with applications to human T helper cell differentiation process Bioinformatics, August 15, 2007; 23(16): 2096 - 2103. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Suzuki, K. Nara, and T. Suzuki Skewed Th1 Responses Caused by Excessive Expression of Txk, a Member of the Tec Family of Tyrosine Kinases, in Patients with Behcet's Disease. Clin. Med. Res., June 1, 2006; 4(2): 147 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Marshall, E. Olivas, S. Andreansky, N. L. La Gruta, G. A. Neale, A. Gutierrez, D. G. Wichlan, S. Wingo, C. Cheng, P. C. Doherty, et al. Effector CD8+ T cells recovered from an influenza pneumonia differentiate to a state of focused gene expression PNAS, April 26, 2005; 102(17): 6074 - 6079. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lu, P. Zagouras, J. E. Fischer, J. Lu, B. Li, and R. A. Flavell Kinetic analysis of genomewide gene expression reveals molecule circuitries that control T cell activation and Th1/2 differentiation PNAS, March 2, 2004; 101(9): 3023 - 3028. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-z. Zhang, M. Sinha, B. A. Luxon, and X.-j. Yu Survival Strategy of Obligately Intracellular Ehrlichia chaffeensis: Novel Modulation of Immune Response and Host Cell Cycles Infect. Immun., January 1, 2004; 72(1): 498 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, R. Lund, T. Aittokallio, M. Kosonen, O. Nevalainen, and R. Lahesmaa Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes J. Immunol., October 1, 2003; 171(7): 3627 - 3635. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Carinci, F. Francioso, A. Piattelli, C. Rubini, M. Fioroni, R. Evangelisti, D. Arcelli, L. Tosi, F. Pezzetti, P. Carinci, et al. Genetic Expression Profiling of Six Odontogenic Tumors Journal of Dental Research, July 1, 2003; 82(7): 551 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takesono, L. D. Finkelstein, and P. L. Schwartzberg Beyond calcium: new signaling pathways for Tec family kinases J. Cell Sci., January 8, 2002; 115(15): 3039 - 3048. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |