The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rodgers, W.
Right arrow Articles by Capra, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodgers, W.
Right arrow Articles by Capra, J. D.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2002, 168: 2348-2355.
Copyright © 2002 by The American Association of Immunologists

Transient Association of Ku with Nuclear Substrates Characterized Using Fluorescence Photobleaching1

William Rodgers, Stephen J. Jordan and J. Donald Capra2

Molecular Immunogenetics Program, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The autoantigen Ku, composed of subunits Ku70 and Ku86, is necessary for repair of DNA double-strand breaks by nonhomologous end joining. Similarly, Ku participates in repair of DNA double-strand breaks that occur during V(D)J recombination, and it is therefore required for the development of B and T lymphocytes. Although previous studies have identified the DNA-binding activities of Ku, little is known concerning its dynamics, such as the mobility of Ku in the nucleus and its rate of association with substrates. To address this question, fluorescence photobleaching experiments were performed using HeLa cells and B cells expressing a green fluorescent protein (GFP) fusion construct of either Ku70 or Ku86. The results show that Ku moves rapidly throughout the nucleus even following irradiation of the cells. However, the rate of diffusion of Ku was ~100-fold slower than that predicted from its size. Association of Ku-GFP with a filamentous nuclear structure was also evident, and nuclear extraction experiments suggest that this represents nuclear matrix. A central domain of Ku70 containing its DNA-binding and heterodimerization regions and its nuclear localization signal shows that this alone is sufficient for the observed mobility of Ku70-GFP and its association with nuclear matrix. These data suggest the mobility of Ku is characterized by a transient, high flux association with nuclear substrates that includes both DNA and the nuclear matrix and may represent a mechanism for repair of double-strand breaks using the nuclear matrix as a scaffold.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The V(D)J recombination reaction in B and T lymphocyte development occurs in two distinct phases (1). First, genomic DNA is cleaved at recombination signal sequences by the RAG1 and RAG2 enzymes. This is followed by repair of the ensuing DNA double-strand breaks (DSBs)3 by nonhomologous end joining (NHEJ). The protein complex DNA-PK, composed of Ku and a catalytic subunit (DNA-PKCS), initiates the NHEJ reaction. Ku binds to the free ends of the DSB, after which DNA-PKCS is recruited to the DNA-Ku complex (2, 3, 4). Assembly of DNA-PK at the DNA lesion leads to further recruitment of DNA repair enzymes, including the XRCC4/DNA ligase IV complex (5, 6). Similar to its role in V(D)J recombination, DNA-PK functions in NHEJ during repair of DNA lesions that form as a result of ionizing radiation and chemical agents.

Ku itself is a heterodimer composed of 70- and 83-kDa subunits, termed Ku70 and Ku86 (or Ku80), respectively (7). In vitro studies have shown that Ku binds to the free ends of DNA in a sequence- and structure-independent manner (8, 9, 10, 11). This presumably allows Ku to bind to DSBs to initiate DNA repair. The x-ray crystal structure of Ku shows that it binds to DNA through a channel that is formed by the Ku70-Ku86 heterodimer (12).

Genetic studies have provided important evidence that Ku is essential for NHEJ in the repair of DSBs. For example, cells deficient in either Ku70 or Ku86 are hypersensitive to ionizing radiation (13, 14). Other compelling evidence includes studies of T cell and B cell populations in Ku-deficient mice. For example, DSBs generated during V(D)J recombination are not efficiently repaired in mice that lack the expression of either Ku70 or Ku86 (15, 16, 17). Consequently, these animals exhibit a SCID phenotype. Similarly, Ig heavy chain class switch recombination, which also contains a DSB intermediate, is similarly inhibited in Ku70-deficient mice (18).

Despite the evidence that Ku functions in NHEJ during repair of DSBs, its properties in intact cells are unclear. For example, little is known concerning the dynamics of Ku in intact nuclei as defined by its mobility and the rate at which it associates with substrates. Interestingly, recent studies have provided specific examples of DNA- or RNA-binding proteins that exhibit rapid mobility within the nucleus (19, 20, 21, 22). In one case it was suggested from these results that some nuclear proteins undergo a transient, high flux association with their substrates (19). Whether these observations are applicable to Ku is unknown. Importantly, understanding the dynamics of Ku would provide important information regarding the kinetics of its association with DNA breaks and the repair reaction that follows.

To study the dynamics of Ku in cell nuclei, fluorescence photobleaching experiments were performed using cells expressing a green fluorescent protein (GFP) fusion construct of either Ku70 or Ku86. These results show Ku is highly mobile in cell nuclei, yet exhibits a diffusion coefficient that is significantly less than that predicted based from its size. The observed mobility of Ku includes its association with the nuclear matrix and DSBs generated by ionizing radiation. Together, these results show that Ku undergoes a transient, high flux association with its substrates. Furthermore, by coassociating with DSBs and the nuclear matrix, Ku could function to tether free ends of DNA to the nuclear matrix for repair of the DNA lesion.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Gene construction

Ku70- and Ku86-GFP constructs were generated using the GFP cloning and expression vector pWay20 (23). This vector contains a SmaI site immediately upstream of and in-frame with enhanced GFP (CLONTECH Laboratories, Palo Alto, CA) and a stop codon at the 3' end of enhanced GFP. The fusion genes were therefore constructed by subcloning blunt end PCR products into the SmaI site of pWay20. A CMV promoter drives the expression of the gene products.

Ku70 and Ku86 were amplified using the following oligonucleotides as primers for the PCR: Ku70, coding, AGAATGTCAGGGTGGGAGTC; Ku70, noncoding, GTTCTCGAGGTTGTTGTTGTTGTTGTCCTGGAAGTGCTTGG; Ku86, coding, AGAATGGTGCGGTCGGGGA; and Ku86, noncoding, GTTCTCGAGGTTGTTGTTGTTGTTTATCATGTCCAATAAATCGT. The underlined residues represent the start codon encoded in each coding primer. A second Ku70-GFP construct containing residues 255–550 was constructed using the following primers for amplification: coding, ACATCATCTAGAATGCTCAACAAAGATATAGTGAT; noncoding: TCTAGTGAATTCGTTGTTGTTGTTGTTCTTGGGCCTTTTGCTTCCAG. The underlined residues again indicate the start codon. The residues in bold indicate an XbaI and EcoRI site encoded in the coding and noncoding primers, respectively, for subcloning the PCR fragment upstream of GFP using a previously described vector (24). Each of the noncoding primers contains a polyglutamine insert between the C terminus of the Ku subunit and the N terminus of GFP. This was added to enhance folding of the separate protein domains. Glutamine was used for this purpose because it has the lowest propensity for forming secondary structures (25).

Cell culture and protein expression

HeLa and 293T cells were grown in DMEM supplemented with antibiotics and 10% FBS. Ramos, Daudi, Raji, and A20 cells were grown in RPMI 1640 supplemented with antibiotics and 10% FBS. All cells were maintained at 37°C in the presence of 5% CO2.

Before transfection, HeLa cells were seeded at 6.0 x 105 cells onto a coverslip in a 3.5-cm dish the day before the experiment. The cells were transfected using lipid carrier (Superfect; Qiagen, Valencia, CA) with 5 µg of plasmid DNA. In experiments using 293T cells, 10-cm plates were seeded with 7.5 x 106 cells 12 h before transfection. The cells were transfected using CaPO4 (Invitrogen, Carlsbad, CA) and 25 µg of plasmid DNA for each plate. All remaining cell lines were transfected by electroporation (Bio-Rad Gene Pulser II; Bio-Rad, Hercules, CA) using 107 cells, 25 µg of plasmid DNA, and settings of 330 V and 960 µF. In experiments including immunofluorescence staining, the samples were prepared as previously described (26).

Cell lysis, immunoprecipitation, and immunoblotting

All steps were performed at 4°C. Transfected 293T cells were washed twice with PBS and lysed using 750 µl of a 10 mM NaCl, 3 mM MgCl2, and 10 mM Tris (pH 7.4) buffer (RSB) containing 0.5% Triton X-100 (TX-100), 1.0 mM PMSF, and 100 kallikrein units of aprotinin. After 10 min in lysis buffer, the samples were centrifuged for 5 min at 4000 rpm using a desktop centrifuge (Brinkman, Westbury, NY). The pellet containing intact nuclei was suspended in 500 ml of 150 mM NaCl, 1 mM EDTA, 20 mM Tris (pH 8.0), 0.1% TX-100, 10% glycerol, 1.0 mM PMSF, and 100 kallikrein units of aprotinin, and the nuclei were lysed by sonication. The lysate was centrifuged, and the supernatant was removed and immunoprecipitated using an mAb specific for the Ku70/Ku86 heterodimer (Santa Cruz Biotechnology, Santa Cruz, CA). Pansorbin (Calbiochem, San Diego, CA) was used as a solid phase for the immunoprecipitations. The immunoprecipitates were washed twice with 10 mM Tris (pH 8.0), 150 mM NaCl, and 5 mM EDTA containing 0.10% TX-100, and eluted using SDS-PAGE sample buffer (27). The samples were separated by gel electrophoresis and detected by immunoblotting using a mAb to GFP (Covance Research Products, Richmond, CA) as the first step. A biotinylated horse Ab to mouse (Vector Laboratories, Burlingame, CA) and streptavidin-conjugated HRP (Vector Laboratories) were used as the second and third steps, respectively. The membranes were developed using ECL (Amersham Pharmacia Biotech, Piscataway, NJ).

Nuclear matrix preparation

Cell nuclei were prepared by lysing cells in RSB by Dounce homogenization (20–30 strokes). The lysate was sedimented and suspended in RSB containing 0.25 M sucrose and 1 mM PMSF. Nuclei were separated from cell debris by sedimenting through a 2 M sucrose layer (75,000 x g for 30 min). The resulting pellet was then suspended in RSB containing 0.25 M sucrose and 1 mM CaCl2 and digested with 25 µg of DNase I (Roche, Nutley, NJ) for 2 h at room temperature. Following DNase I treatment, the sample was extracted with high salt buffer by suspending in RSB containing 2 M NaCl and 10 mM EDTA and incubating at 0°C for 10 min. The sample was sedimented, washed with RSB containing 0.25 M sucrose, and then suspended in SDS-PAGE sample buffer. The samples were separated by SDS-PAGE and immunoblotted with the indicated Abs. Goat antiserum to Ku70, Ku86, and lamin B were purchased from Santa Cruz Biotechnology. mAb to phospho-RNA polymerase II (matrin 250) was purchased from Upstate Biotechnology (Lake Placid, NY). Biotinylated Ab to mouse or goat Ig was purchased from Vector Laboratories.

Fluorescence microscopy

Image acquisition. Images were collected using a Leica TCS laser scanning confocal microscope (William K. Warren Medical Research Institute, Oklahoma City, OK). GFP was excited at 488 nm, and Texas Red (TR) at 568 nm. Emission wavelengths between 530 and 560 nm were collected for GFP imaging, and emission wavelengths between 600 and 660 nm were collected for TR imaging. In double-labeling experiments, GFP and TR fluorescence were collected simultaneously in separate channels.

Fluorescence recovery after photobleaching (FRAP) measurements. Image analysis was performed using IP Lab Spectrum software (Scanalytics, Vienna, VA). Curve fitting for determining recovery values was performed using IGOR software (WaveMetrics, Palo Alto, CA). Protein mobility was measured as described previously (19). In brief, a region of the nucleus was photobleached using a brief (0.5 s) pulse of the 488-nm line of an argon laser at 100% power. Recovery of fluorescence within the bleached region was monitored by collecting a frame every 1.7 s. The amount of recovery at each time point was measured by determining the average fluorescence intensity in the bleached region. The recovery values were normalized using the equation: R = (AoIt)/(AtIo), where Ao is the total intensity of the nucleus in the prebleach image, At is the total intensity of the nucleus at time point t, Io is the average intensity of the bleached region in the prebleach image, and It is the average intensity of the bleached region at time point t. R therefore represents the ratio Ft:Fo corrected for the decay in the fluorescence signal due to collection of the images during the experiment (19), where Ft represents the average fluorescence intensity of the spot at each time t, and Fo is the average fluorescence intensity of this region in the prebleach image.

Fluorescence loss induced by photobleaching (FLIP) measurements. Intranuclear exchange of protein was measured by photobleaching a region of the nucleus with a 5-s pulse of laser (488-nm line of an argon laser at 100% power). Each pulse was followed by image acquisition. Photobleaching and image acquisition were repeated until the entire fluorescence signal was extinguished. The same region was photobleached in each pulse. The ratio of the average fluorescence intensity of the nucleus at each time point divided by its average intensity in the prebleach image was plotted vs time to represent the rate of decay of fluorescence signal during the FLIP experiment.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ku70- and Ku86-GFP molecules dimerize with endogenous protein

Ku is functional only as the Ku70/86 heterodimer (10). Consequently, for Ku70- and Ku86-GFP to be faithful reporters of Ku activity, each must dimerize with endogenous protein when separately expressed in transfected cells. To determine whether Ku70- and Ku86-GFP dimerize with endogenous protein, nuclei from cells transfected with either GFP construct were lysed and immunoprecipitated using a mAb that recognizes only the Ku70/Ku86 heterodimer. The immunoprecipitates were separated by SDS-PAGE, and Ku70- or Ku86-GFP was detected by immunoblotting with an Ab specific for GFP. Fig. 1GoA shows that both Ku70- and Ku86-GFP are immunoprecipitated in this manner, showing that Ku70- or Ku86-GFP associate with endogenous Ku.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. Measurement of association of Ku70- and Ku86-GFP with endogenous subunits of Ku heterodimer. A, Nuclei of 293 T cells expressing either Ku70- or Ku86-GFP were collected, lysed, and immunoprecipitated with an mAb that recognizes the Ku heterodimer. The immunoprecipitate was separated by 7.5% SDS-PAGE, and the GFP fusion proteins were detected by immunoblotting with Ab specific for GFP. The predicted sizes of Ku70- and Ku86-GFP are 102 and 112 kDa, respectively. Molecular weights (in thousands) are indicated on the left. Ig represents cross-reaction with the Ab used for the immunoprecipitation. B, Confocal images of HeLa cells expressing either Ku70-GFP (top) or Ku86-GFP. The samples were immunostained with an mAb that recognizes the Ku heterodimer and TR-conjugated secondary Ab ({alpha}Ku70/86-TR). Each set of panels shows the nuclei from two separate cells. White bar, 5 µm.

 
To compare the cellular localization of Ku70- and Ku86-GFP with that of Ku, HeLa cells expressing either Ku70-GFP (Fig. 1GoB, top) or Ku86-GFP (Fig. 1GoB, bottom) were fixed and immunostained with the heterodimer-specific Ab. The Ku70/86 complex was detected using a TR-conjugated secondary Ab specific for mouse Ig ({alpha}Ku70/86-TR). Fig. 1GoB shows that intranuclear localization of Ku70- and Ku86-GFP is identical to that of the Ku70/86 heterodimer. For example, the similarity of the distributions of the Ku-GFP molecules with that of the heterodimer is illustrated by the merge images where the overlap is indicated by yellow. Fig. 1Go shows that both Ku70- and Ku86-GFP efficiently associate with endogenous protein and are therefore faithful reporters of endogenous Ku.

Ku70- and Ku86-GFP are highly mobile in cell nuclei

To measure the mobility of Ku in cell nuclei, FRAP was measured in cells expressing either Ku70- or Ku86-GFP. Experiments measuring FRAP consist of first photobleaching a small region of the nucleus by a brief (0.5-s) laser pulse. Recovery of fluorescence by diffusion of protein into the bleached region is measured by acquiring images of the sample following the initial photobleaching.

Two separate photobleaching experiments that were performed using HeLa cells expressing Ku70-GFP are shown in Fig. 2GoA and in Supplements 1 and 2.4 In Fig. 2GoA, the green circle indicates the region that was photobleached in each experiment, and the images were acquired at the indicated times. In the top panel, the sample was untreated before photobleaching, and complete recovery of the fluorescence signal occurred by ~17 s. However, the sample in the bottom panel of Fig. 2GoA was fixed before the FRAP experiment. In this case, the bleached region remains void of fluorescence even after the recovery is complete in the untreated sample. This difference in mobility between the untreated and the fixed sample is also indicated by the recovery curves plotted in Fig. 2GoB. Furthermore, a region in the fixed sample the same size as that shown in Fig. 2GoA but outside of the bleach spot had a normalized fluorescence value close to 1.0 for all time points (data not shown). Thus, the lack of recovery in the fixed sample is not due to quenching of fluorescence by fixation. Experiments with cells expressing Ku86-GFP showed it has a mobility similar to that of Ku70-GFP (Supplement 3). These results therefore show Ku-GFP is mobile in cell nuclei and fixing the samples inhibits this mobility.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. FRAP measurements of HeLa cells expressing either Ku70- or Ku86-GFP. A, FRAP experiments with HeLa cells expressing Ku70-GFP. Only the nucleus of each cell is evident. The green circles indicate the regions that were photobleached. The cell in the bottom panel was fixed with 2% paraformaldehyde before the FRAP experiment. Frames were collected at the indicated times. B, A plot of the normalized fluorescence intensity values vs time of each FRAP experiment in A. The average fluorescence intensity within the photobleached region was measured in each frame and normalized using the equation. The lines represent the fitted curves of each experiment. The thick and thin lines represent the untreated and fixed samples, respectively. C, The time constants and recovered fractions measured in populations of HeLa cells expressing either Ku70- or Ku86-GFP. The histograms on the left represent data from cells expressing Ku70-GFP, and those on the right are from cells expressing Ku86-GFP.

 
To quantitate the mobility of Ku70-GFP and Ku86-GFP, the recoveries were fitted to the monoexponential function Ft/F0 = F{infty} + F1 x e(-t/{tau}), where F{infty} represents the fraction of recovery at infinite time and indicates the mobile fraction of the molecule in the bleached region or, inversely, its immobile fraction. {tau} is the time constant for recovery, and it is inversely proportional to the diffusion coefficient. Histograms of the time constants and percent recoveries measured in populations of HeLa cells expressing either Ku70- or Ku86-GFP are shown in Fig. 2GoC. Significantly, each histogram is unimodal in character, thus showing that all the cells in the samples exhibit a similar mobility.

The histograms in Fig. 2GoC correspond to an average time constant of ~6 s for both Ku70-GFP and Ku86-GFP (Table IGo). Furthermore, the diffusion coefficient (D) was calculated for each experiment using the change in the Gaussian profile of the bleach spot with time (28, 29). By this method, it was determined that the recoveries of Ku70-GFP and Ku86-GFP correspond to a diffusion coefficient of ~0.35 µm2s-1. This is similar to that measured for GFP fusion constructs of other proteins that function in the nucleus (19, 20, 21) and represents a diffusion coefficient nearly 200-fold less than that of GFP alone in the nucleus (30). This observed difference in the mobility of GFP and Ku-GFP cannot be accounted for by size alone (~200 kDa for the Ku-GFP heterodimer vs 27 kDa for GFP alone). For example, the ~8-fold difference in size between Ku-GFP and GFP corresponds to a 2-fold difference in molecular volume (assuming a spherical protein) (31). Thus, Ku70-GFP diffuses ~2 orders of magnitude slower than that predicted based on its volume relative to that of GFP alone. One mechanism for this slower than predicted mobility of Ku70- and Ku86-GFP is a transient association of Ku with other molecules in the nucleus.


View this table:
[in this window]
[in a new window]
 
Table I. Time constants and recovered fractions measured in populations of the indicated cell lines

 
To measure the effect of lowering the temperature of the sample on the mobility of Ku-GFP, FRAP experiments were performed at 10°C rather than 37°C. Both the rate and amount of recovery of Ku are similar at 10°C to that measured at 37°C (Table IGo), and this occurs despite temperature-dependent changes in the diffusion coefficient, viscosity, and perhaps composition of the nucleus. One possible explanation is that the difference in temperature is not great enough to affect these parameters. For example, the diffusion coefficient and viscosity of the sample depends upon the absolute temperature of the sample (31). The change from 37 to 10°C represents a 10% decrease in the absolute temperature, and this is less than the resolution of these measurements (SD = 2.7 s). Conversely, ATP-dependent mobility would probably be inhibited in this experiment. Thus, these data are consistent with the idea that the recoveries of Ku-GFP occur by diffusion rather than active transport within the nucleus.

In developing lymphocytes, Ku functions in repair of DSBs that occur as a consequence of V(D)J recombination (15, 18). To determine whether Ku exhibits a similar mobility in B cells as in HeLa cells, FRAP experiments were performed using Raji and A20 B cells expressing either Ku70- or Ku86-GFP. These results are summarized in Table IGo, and they show that both the time constant and the recovered fraction of Ku70- and Ku86-GFP in B cells are similar to those measured in HeLa cells. Thus, the mobility of Ku measured in HeLa cells is not restricted to this cell type, but also includes B cells.

Ku binds to the free ends of DNA (8, 9, 10), and genetic studies have shown that it is required for DSB repair following irradiation (13, 15, 32). To determine whether generation of DSBs affects the mobility of Ku proteins, FRAP experiments were performed using gamma-irradiated HeLa cells expressing Ku70-GFP. Table IIGo summarizes the results of these measurements and shows that there is no significant change in the rate or amount of recovery of Ku70-GFP at either 30 min or 6 h postirradiation compared with untreated cells (Table IGo). This result suggests that Ku does not form a complex with DSBs that results in changes in its mobility. However, another interpretation of these data is that DSB repair is complete by 30 min. For example, genetic studies have shown that some forms of NHEJ occur with a half-time of minutes, and that this is a DNA-PKCS-dependent pathway (33). To determine whether the failure to detect changes in the mobility of Ku following irradiation was due to rapid repair of DSBs, cells were pretreated with wortmannin before irradiation to inhibit DNA-PKCS-dependent DSB repair. The results of this experiment are also summarized in Table IIGo and show that the rate of recovery of the wortmannin plus irradiation sample is slightly slower than that of the sample treated with wortmannin alone. This difference may reflect a small increase in the lifetime of Ku70-GFP in complex with nuclear substrates such as DSBs. However, these results show that Ku is not sequestered by DSBs, since the amount of recovery is unchanged following irradiation. Thus, the fluorescence recoveries in the irradiated cells are consistent with our interpretation of the FRAP experiments in Fig. 2Go that Ku exhibits a transient association with its nuclear substrates. Such a transient association of nuclear proteins with their substrates has been reported for other molecules based on the results from FRAP experiments (19, 21).


View this table:
[in this window]
[in a new window]
 
Table II. Time constants and recovered fractions measured in populations of the indicated cell lines1

 
The entire nuclear pool of Ku is mobile

Both Ku70-GFP and Ku86-GFP exhibit ~95% recoveries in the FRAP experiments. This demonstrates that essentially the entire pool of either subunit within the bleached region is mobile. To determine whether the entire nuclear pool of Ku shares this characteristic, FLIP experiments were performed using HeLa cells expressing either Ku70-GFP or Ku86-GFP. In the FLIP experiments the sample is repeatedly photobleached with pulses of longer duration (5 s). Decay of total fluorescence signal is measured by acquiring an image of the sample between each photobleaching pulse (31). Thus, FLIP experiments measure the diffusion of fluorophore from all regions of the nucleus into the path of the laser beam.

An example of a FLIP experiment performed using HeLa cells expressing either Ku70-GFP or GFP alone is shown in Fig. 3GoA. In the case of the cell expressing Ku70-GFP, only the nucleus is evident. Both the nucleus and cytoplasm are labeled in the cell expressing GFP. In each experiment the region indicated by the green circle was bleached using laser pulses 5 s in duration. In the cell expressing GFP alone, fluorescence from the nucleus is quickly bleached. Bleaching of the remaining signal in the cell occurs as GFP diffuses into the nucleus from the cytoplasm. Similar to GFP, Ku70-GFP in the nucleus is also entirely photobleached, and this occurs in ~1 min. These results are also illustrated by the fluorescence decay curves in Fig. 3GoB. Importantly, in cases where a second cell expressing Ku70-GFP was adjacent to the cell that was photobleached, negligible photobleaching occurred in the adjacent cell (Supplement 4). Thus, the fluorescence decay is due specifically to photobleaching during the FLIP experiment. Efficient bleaching of the nuclear fluorescence also occurred in samples that were pretreated with wortmannin and irradiated before the FLIP experiment (Supplement 5). This result is consistent with FRAP measurements showing that Ku exhibits similar fluorescence recoveries in irradiated and untreated cells. Together the FLIP experiments show that the entire nuclear pool of Ku molecules is mobile, such that it is able to transverse the nucleus in ~1 min even in the presence of DSBs.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 3. FLIP experiments of cells expressing either Ku70-GFP or GFP alone. A, Two separate nuclei of cells expressing Ku70-GFP (top) or GFP (bottom) alone are shown. A FLIP experiment was performed by photobleaching the region indicated by the green circle for 5-s intervals. B, A plot of the decay of the fluorescence signal of each nucleus in A with time. Ku70-GFP is similar to GFP in that its signal is completely bleached during the experiment, thus demonstrating complete mobility within the time frame of the experiment. C, In an image collected after 10 s of photobleaching in each experiment in A Ku70-GFP appears localized with a filamentous structure within the nucleus (left), but GFP alone does not. The Ku70-GFP images are identical, except that the yellow lines were added to the image on the left to indicate the observed filaments.

 
Despite the similarity in the photobleaching of Ku70-GFP and GFP alone, each also displayed distinct properties during the course of the FLIP experiments. For example, Fig. 3GoB shows that Ku70-GFP fluorescence decayed at a slower rate than GFP alone. Furthermore, Fig. 3GoC shows higher magnification images of the cells in Fig. 3GoA, and Ku70-GFP is seen to associate with a filamentous structure within the nucleus. The yellow lines that are overlaid on the image on the left illustrate this. The filament-associated Ku is brighter than the adjacent regions within the nucleus. This suggests that Ku is transiently inhibited from diffusing into the bleach spot during the FLIP experiment due to association with the nuclear filaments. In contrast to the cell expressing Ku70-GFP, the entire nucleus of the cell expressing GFP is photobleached uniformly, and no filamentous network is apparent. These results show that association of Ku70-GFP with nuclear structures occurs in a specific manner.

Ku associates with nuclear matrix through the Ku70 subunit

The Ku-associated filaments evident in Fig. 3Go are also similar in appearance to nuclear matrix visible by immunostaining of DNase-treated nuclei (34). Furthermore, Ku70-GFP is present in the nuclear matrix fraction of transfected 293T cells (Fig. 4GoA), and endogenous Ku colocalizes with the matrix-associated protein matrin 250 (35) (Fig. 4GoB). Fig. 4GoC shows that endogenous Ku70 is present with the matrix marker lamin B (36) in the nuclear matrix fraction prepared from HeLa cells that had not been transfected. Interestingly, Ku86 is not present in the matrix fraction. Furthermore, Ku70, but not Ku86, is present in the nuclear matrix fraction of the B cell lines Raji, Daudi, and Ramos (Fig. 4GoD). These results suggest Ku associates with the nuclear matrix through the Ku70 subunit alone and that Ku86 is removed during preparation of the nuclear matrix fraction.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 4. Characterization of Ku in the nuclear matrix fraction. A, The nuclear matrix fraction of transfected 293T cells was prepared and separated by 7.5% SDS-PAGE. Ku70-GFP was detected by immunoblotting with Ab that recognizes GFP. B, HeLa cells were fixed and costained with an Ab that recognizes Ku and an Ab specific for matrin 250. Ku and matrin 250 were detected using fluorescein- and TR-conjugated secondary Abs, respectively. The arrowheads indicate filamentous regions that are coenriched with Ku and matrin 250. C and D, The nuclear matrix fraction was prepared using HeLa cells (C) and the indicated B cell lines (D). Each prepared nuclear matrix fraction was immunoblotted with Ab to Ku70 and Ku86. The fraction from HeLa cells was also immunoblotted with Ab to lamin B. An equivalent amount of material was loaded in each lane in C and D. D, WCL represents whole cell lysate prepared from Raji cells. Molecular weights (in thousands) are indicated on the left.

 
The central domain of Ku70 has properties similar to those of full-length Ku70

Ku70 contains a core region consisting of residues 255–450 that is sufficient for heterodimerization with Ku86, binding to DNA ends, and DSB repair (32). Furthermore, residues 535–550 contain the nuclear localization signal of Ku70 (37). To compare the properties of a central domain (CD) of Ku70 containing its core and nuclear localization signal with that of full-length protein, a GFP fusion gene was constructed encoding residues 255–550 of Ku70 (Ku70CD-GFP).

Fig. 5GoA shows three separate HeLa cells that are expressing Ku70CD-GFP, each of which demonstrates targeting of Ku70CD-GFP to the nucleus (white arrowheads). Interestingly, Fig. 5GoA also shows that Ku70CD-GFP is present in a membranous network within the cytoplasm. This is not found with either Ku70- or Ku86-GFP and may represent stable association of Ku70CD-GFP with a compartment within the cytoplasm. To measure the association of Ku70CD-GFP with endogenous Ku86, a nuclear lysate of transfected cells was immunoprecipitated with the dimer-specific Ab described for Fig. 1Go. Coimmunoprecipitation of Ku70CD-GFP with the Ku-specific Ab (Fig. 5GoB) shows that it associates with endogenous Ku86.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 5. Characterization of the central domain of Ku70. A, Confocal images of cells expressing Ku70CD-GFP. The arrowheads indicate the nucleus of each cell. White bar, 5 µm. B, Nuclei from 293T cells expressing Ku70CD-GFP were lysed and immunoprecipitated with dimer-specific Ab as described in Fig. 1Go. C, The nuclear matrix fraction of 293T cells expressing Ku70CD-GFP was prepared as described in Fig. 4Go. In both B and C, Ku70CD-GFP was detected in each experiment using GFP-specific Ab. The predicted size of Ku70CD-GFP is 61 kDa. Molecular weights (in thousands) are indicated on the left.

 
To compare the mobility of Ku70CD-GFP with that of full-length Ku70-GFP, FRAP measurements were preformed in parallel using HeLa cells expressing either Ku70CD-GFP or Ku70-GFP. An example of a FRAP experiment using a HeLa cell expressing Ku70CD-GFP is shown in Supplement 6. The average time constants measured for Ku70CD-GFP were 4.3 ± 2.2 (n = 11) and 5.2 ± 1.7 (n = 11) for the full-length protein. Similarly, the average fractional recovery of the samples was 0.95 ± 0.09 for CD and 0.93 ± 0.12 for full-length proteins. These results show Ku70CD-GFP and Ku70-GFP has a similar mobility within the nucleus despite the fact that Ku70CD-GFP is approximately half the size of the full-length protein.

To measure the association of Ku70CD-GFP with the nuclear matrix, the matrix fraction was prepared using transfected 293T cells. Fig. 5GoC shows that the matrix fraction contains core Ku70-GFP, as detected by immunoblotting with Ab specific for GFP. Thus, the matrix-targeting domain of Ku70 occurs within its central domain, and it is therefore proximal to the region in Ku that confers DSB repair activity.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report here experiments using GFP fusion constructs of Ku70 and Ku86 to measure the mobility of Ku in intact cell nuclei. Together, FRAP and FLIP experiments show that Ku moves rapidly throughout the nucleus, and the entire nuclear pool of Ku exhibits this mobility. However, quantitation of the recovery of Ku in FRAP experiments shows that it has approximately a 100-fold slower mobility than would be predicted based on its size alone. One explanation for the observed mobility of Ku is that it is reduced due to association of Ku with nuclear substrates. These results are therefore consistent with the idea that Ku undergoes a transient, high flux association with DNA and other nuclear structures as has been suggested for some nuclear proteins (19).

Previous studies have demonstrated that nuclear substrates for Ku include free ends of DNA (8, 9, 10) and telomeres (38, 39, 40, 41). Our results show the nuclear matrix represents another substrate for Ku binding. Fig. 6Go illustrates a model describing how association of Ku with the nuclear matrix may represent a functionally significant feature in its role in DSB repair. For example, Ku may serve to tether the free ends of the DSBs to the nuclear matrix so that the matrix can serve as a scaffold for further assembly of DNA repair machinery. Based on the mobility of Ku, the Ku-DSB-nuclear matrix complex must have a half-life of <10 s. However, if other DNA repair enzymes exhibit the same mobility as Ku, then a short-lived complex of enzymes and DNA may be sufficient for repair of the DSB. Evidence of a DNA-PK-dependent pathway for NHEJ that has a half-time of minutes is consistent with this idea (33). Alternatively, rapid replacement of Ku with additional Ku molecules may establish a steady-state assembly that has a lifetime considerably longer than that of the dwell time of individual Ku molecules.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 6. A model for DSB repair by simultaneous binding of Ku to the DSB and nuclear matrix. Ku coassociates with DSB and nuclear matrix, thereby allowing the matrix to serve as a scaffold for further assembly of DNA repair enzymes, including DNA-PKCS and the DNA ligase IV/XRCC4 complex. Association of Ku with DSB and nuclear matrix is transient (<20 s), but additional Ku molecules quickly replace it. Association of Ku with the nuclear matrix occurs through the Ku70 subunit alone.

 
One conclusion from the observation that Ku70, but not Ku86, is present in the matrix fraction is that only the Ku70 monomer associates with the nuclear matrix. However, a separate study has shown that equivalent amounts of Ku86 are immunoprecipitated with antiserum specific to either Ku70 or the Ku heterodimer, and dimerization is necessary for efficient nuclear translocation of each subunit (42). These results therefore indicate that nuclear Ku70 occurs as a heterodimer and that Ku associated with matrix does so as a heterodimer of Ku70 and Ku86. The suggestion that Ku86 is disassociated from Ku70 during preparation of the nuclear matrix is not surprising, since 0.3 M NaCl is sufficient to disassociate the Ku heterodimer in certain conditions (43).

A current model for DNA repair is that Ku initiates NHEJ by binding DSBs and recruiting additional DNA repair enzymes (7). The mobility exhibited by Ku in the nucleus indicates that it can move rapidly throughout the nucleus in search of DSBs. This contrasts with the model that Ku is sequestered at telomeres until the occurrence of DSBs, at which time it delocalizes from the telomeres to bind to the DNA lesions (44).

The rapid mobility exhibited by Ku and shared by other nuclear enzymes of diverse structure and function (19, 20, 21, 22) implies that this high mobility is a general feature of proteins that function in DNA or RNA synthesis and processing. This observation suggests that current opinion regarding the compartmentalization of the nucleus is oversimplified. For example, previous studies using immunofluorescence staining have shown that replication and transcription are associated with nuclear foci that appear in interphase nuclei (45, 46). This has led to the idea that proteins that function in these events are sequestered into stable, long-lived structures. However, based on the results from mobility studies, another interpretation is that the foci are composed of molecules that are rapidly exchanging with regions of the nucleus outside of the foci. Similar to this, nucleoli have been shown to be composed of molecules that are rapidly exchanging with the extranucleolar compartment (19, 21).

Some nuclear proteins do not share the rapid mobility of Ku. For example, the histone protein H2B shows little recovery even as late as 30 min postbleaching (19, 47, 48). Thus, while at least some proteins are freely diffusing within the nucleus and forming short-lived complexes, others are forming a stable scaffold with little or no flux from other regions of the nucleus. The nuclear matrix may represent a similar type of low exchange structure within the nucleus. In contrast, it has been argued that the nuclear matrix is merely an artifact arising from DNase treatment and salt extraction of nuclei (49). However, Fig. 3Go, showing association of Ku70-GFP with a filamentous network that also correlates with its occurrence in the matrix fraction, argues that the matrix fraction is, in fact, representative of a matrix structure in intact nuclei.

In summary, using fluorescence photobleaching to measure the mobility of Ku, it was determined that Ku rapidly diffuses throughout the nucleus. In addition to this mobility, Ku exhibits association with the nuclear matrix, and we postulate that this may represent a mechanism for tethering DSBs to the nuclear matrix for repair. Finally, the mobility exhibited by Ku and other nuclear proteins suggests that nuclear architecture can be defined as a structure composed of stable scaffolding molecules, among which enzymes that mediate DNA and RNA synthesis and processing rapidly diffuse and form transient interactions to complete their function.


    Acknowledgments
 
We thank B. Higgins and J. Zavzavadjian for their technical assistance, and Drs. K. Rodgers and C. Webb for the helpful discussions.


    Footnotes
 
1 This work was supported by a grant from the National Institutes of Health (AI 12127; to J.D.C.). Back

2 Address correspondence and reprint requests to Dr. J. Donald Capra, Molecular Immunogenetics Program, Oklahoma Medical Research Foundation, 825 NE 13th Street, MS 17, Oklahoma City, OK 73104. E-mail address: jdonald-capra{at}omrf.ouhsc.edu Back

3 Abbreviations used in this paper: DSB, double-strand break; CD, central domain; FLIP, fluorescence loss induced by photobleaching; FRAP, fluorescence recovery after photobleaching; GFP, green fluorescent protein; NHEJ, nonhomologous end joining; TR, Texas Red; TX-100, Triton X-100. Back

4 The on-line version of this article contains supplemental material. Back

Received for publication July 3, 2001.
    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fugmann, S. D., A. I. Lee, P. E. Shockett, I. J. Villey, D. G. Schatz. 2000. The RAG proteins and V(D)J recombination: complexes, ends, and transposition. Annu. Rev. Immunol. 18:495.[Medline]
  2. Dynan, W. S., S. Yoo. 1998. Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids. Nucleic Acids Res. 26:1551.[Abstract/Free Full Text]
  3. Dvir, A., S. R. Peterson, M. W. Knuth, H. Lu, W. S. Dynan. 1992. Ku autoantigen is the regulatory component of a template-associated protein kinase that phosphorylates RNA polymerase II. Proc. Natl. Acad. Sci. USA 89:11920.[Abstract/Free Full Text]
  4. Gottlieb, T. M., S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cell 72:131.[Medline]
  5. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388:492.[Medline]
  6. Ramsden, D. A., M. Gellert. 1998. Ku protein stimulates DNA end joining by mammalian DNA ligases: a direct role for Ku in repair of DNA double-strand breaks. EMBO J. 17:609.[Medline]
  7. Smith, G. C., S. P. Jackson. 1999. The DNA-dependent protein kinase. Genes Dev. 13:916.[Free Full Text]
  8. Mimori, T., J. A. Hardin. 1986. Mechanism of interaction between Ku protein and DNA. J. Biol. Chem. 261:10375.[Abstract/Free Full Text]
  9. Paillard, S., F. Strauss. 1991. Analysis of the mechanism of interaction of simian Ku protein with DNA. Nucleic Acids Res. 19:5619.[Abstract/Free Full Text]
  10. Ono, M., P. W. Tucker, J. D. Capra. 1994. Production and characterization of recombinant human Ku antigen. Nucleic Acids Res. 22:3918.[Abstract/Free Full Text]
  11. Ono, M., P. W. Tucker, J. D. Capra. 1996. Ku is a general inhibitor of DNA-protein complex formation and transcription. Mol. Immuno.l. 33:787.[Medline]
  12. Walker, J. R., R. A. Corpina, J. Goldberg. 2001. Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 412:607.[Medline]
  13. Gu, Y., S. Jin, Y. Gao, D. T. Weaver, F. W. Alt. 1997. Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination. Proc. Natl. Acad. Sci. USA 94:8076.[Abstract/Free Full Text]
  14. Tai, Y. T., G. Teoh, B. Lin, F. E. Davies, D. Chauhan, S. P. Treon, N. Raje, T. Hideshima, Y. Shima, K. Podar, K. C. Anderson. 2000. Ku86 variant expression and function in multiple myeloma cells is associated with increased sensitivity to DNA damage. J. Immunol. 165:6347.[Abstract/Free Full Text]
  15. Zhu, C., M. A. Bogue, D. S. Lim, P. Hasty, D. B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86:379.[Medline]
  16. Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, G. C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382:551.[Medline]
  17. Gu, Y., K. J. Seidl, G. A. Rathbun, C. Zhu, J. P. Manis, N. van der Stoep, L. Davidson, H. L. Cheng, J. M. Sekiguchi, K. Frank, et al 1997. Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity 7:653.[Medline]
  18. Manis, J. P., Y. Gu, R. Lansford, E. Sonoda, R. Ferrini, L. Davidson, K. Rajewsky, F. W. Alt. 1998. Ku70 is required for late B cell development and immunoglobulin heavy chain class switching. J. Exp. Med. 187:2081.[Abstract/Free Full Text]
  19. Phair, R. D., T. Misteli. 2000. High mobility of proteins in the mammalian cell nucleus. Nature 404:604.[Medline]
  20. McNally, J. G., W. G. Muller, D. Walker, R. Wolford, G. L. Hager. 2000. The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262.[Abstract/Free Full Text]
  21. Chen, D., C. Huang. 2001. Nucleolar components involved in ribosome biogenesis cycle between the nucleolus and nucleoplasm in interphase cells. J. Cell Biol. 153:169.[Abstract/Free Full Text]
  22. Boisvert, F. M., M. J. Kruhlak, A. K. Box, M. J. Hendzel, D. P. Bazett-Jones. 2001. The transcription coactivator cbp is a dynamic component of the promyelocytic leukemia nuclear body. J. Cell Biol. 152:1099.[Abstract/Free Full Text]
  23. Lo, W., W. Rodgers, T. Hughes. 1998. Making genes green: creating green fluorescent protein (GFP) fusions with blunt-end PCR products. BioTechniques 25:94.[Medline]
  24. Rodgers, W., J. Zavzavadjian. 2001. Glycolipid-enriched membrane domains are assembled into membrane patches by associating with the actin cytoskeleton. Exp. Cell Res. 267:173.[Medline]
  25. Jr Minor, D. L., P. S. Kim. 1994. Measurement of the {beta}-sheet-forming propensities of amino acids. Nature 367:660.[Medline]
  26. Haaf, T., E. Raderschall, G. Reddy, D. C. Ward, C. M. Radding, E. I. Golub. 1999. Sequestration of mammalian Rad51-recombination protein into micronuclei. J. Cell Biol. 144:11.[Abstract/Free Full Text]
  27. Laemmli, U. K.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680.[Medline]
  28. Yokoe, H., T. Meyer. 1996. Spatial dynamics of GFP-tagged proteins investigated by local fluorescence enhancement. Nat. Biotechnol. 14:1252.[Medline]
  29. Sowa, G., J. Liu, A. Papapetropoulos, M. Rex-Haffner, T. E. Hughes, W. C. Sessa. 1999. Trafficking of endothelial nitric-oxide synthase in living cells: quantitative evidence supporting the role of palmitoylation as a kinetic trapping mechanism limiting membrane diffusion. J. Biol. Chem. 274:22524.[Abstract/Free Full Text]
  30. Houtsmuller, A. B., S. Rademakers, A. L. Nigg, D. Hoogstraten, J. H. Hoeijmakers, W. Vermeulen. 1999. Action of DNA repair endonuclease ERCC1/XPF in living cells. Science 284:958.[Abstract/Free Full Text]
  31. Lippincott-Schwartz, J., E. Snapp, A. Kenworthy. 2001. Studying protein dynamics in living cells. Nat. Rev. Mol. Cell. Biol. 2:444.[Medline]
  32. Jin, S., D. T. Weaver. 1997. Double-strand break repair by Ku70 requires heterodimerization with Ku80 and DNA binding functions. EMBO J. 16:6874.[Medline]
  33. Wang, H., Z. C. Zeng, A. R. Perrault, X. Cheng, W. Qin, G. Iliakis. 2001. Genetic evidence for the involvement of DNA ligase IV in the DNA-PK-dependent pathway of non-homologous end joining in mammalian cells. Nucleic Acids Res. 29:1653.[Abstract/Free Full Text]
  34. Wei, X., S. Somanathan, J. Samarabandu, R. Berezney. 1999. Three-dimensional visualization of transcription sites and their association with splicing factor-rich nuclear speckles. J. Cell Biol. 146:543.[Abstract/Free Full Text]
  35. Mortillaro, M. J., B. J. Blencowe, X. Wei, H. Nakayasu, L. Du, S. L. Warren, P. A. Sharp, R. Berezney. 1996. A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix. Proc. Natl. Acad. Sci. USA 93:8253.[Abstract/Free Full Text]
  36. Luderus, M. E., A. de Graaf, E. Mattia, J. L. den Blaauwen, M. A. Grande, L. de Jong, R. van Driel. 1992. Binding of matrix attachment regions to lamin B1. Cell 70:949.[Medline]
  37. Koike, M., T. Ikuta, T. Miyasaka, T. Shiomi. 1999. The nuclear localization signal of the human Ku70 is a variant bipartite type recognized by the two components of nuclear pore-targeting complex. Exp. Cell Res. 250:401.[Medline]
  38. Hsu, H. L., D. Gilley, E. H. Blackburn, D. J. Chen. 1999. Ku is associated with the telomere in mammals. Proc. Natl. Acad. Sci. USA 96:12454.[Abstract/Free Full Text]
  39. Hsu, H. L., D. Gilley, S. A. Galande, M. P. Hande, B. Allen, S. H. Kim, G. C. Li, J. Campisi, T. Kohwi-Shigematsu, D. J. Chen. 2000. Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev. 14:2807.[Abstract/Free Full Text]
  40. Polotnianka, R. M., J. Li, A. J. Lustig. 1998. The yeast Ku heterodimer is essential for protection of the telomere against nucleolytic and recombinational activities. Curr. Biol. 8:831.[Medline]
  41. Porter, S. E., P. W. Greenwell, K. B. Ritchie, T. D. Petes. 1996. The DNA-binding protein Hdf1p (a putative Ku homologue) is required for maintaining normal telomere length in Saccharomyces cerevisiae. Nucleic Acids Res. 24:582.[Abstract/Free Full Text]
  42. Koike, M., T. Shiomi, A. Koike. 2001. Dimerization and nuclear localization of Ku proteins. J. Biol. Chem. 276:11167.[Abstract/Free Full Text]
  43. Wang, J., M. Satoh, A. Pierani, J. Schmitt, C. H. Chou, H. G. Stunnenberg, R. G. Roeder, W. H. Reeves. 1994. Assembly and DNA binding of recombinant Ku (p70/p80) autoantigen defined by a novel monoclonal antibody specific for p70/p80 heterodimers. J. Cell Sci. 107:3223.[Abstract]
  44. Haber, J. E.. 1999. Sir-Ku-itous routes to make ends meet. Cell 97:829.[Medline]
  45. Singer, R. H., M. R. Green. 1997. Compartmentalization of eukaryotic gene expression: causes and effects. Cell 91:291.[Medline]
  46. Strouboulis, J., A. P. Wolffe. 1996. Functional compartmentalization of the nucleus. J. Cell Sci. 109:1991.[Abstract]
  47. Misteli, T., A. Gunjan, R. Hock, M. Bustin, D. T. Brown. 2000. Dynamic binding of histone H1 to chromatin in living cells. Nature 408:877.[Medline]
  48. Lever, M. A., J. P. Th’ng, X. Sun, M. J. Hendzel. 2000. Rapid exchange of histone H1.1 on chromatin in living human cells. Nature 408:873.[Medline]
  49. Pederson, T.. 2000. Half a century of "the nuclear matrix.". Mol. Biol. Cell 11:799.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P.-O. Mari, B. I. Florea, S. P. Persengiev, N. S. Verkaik, H. T. Bruggenwirth, M. Modesti, G. Giglia-Mari, K. Bezstarosti, J. A. A. Demmers, T. M. Luider, et al.
Dynamic assembly of end-joining complexes requires interaction between Ku70/80 and XRCC4
PNAS, December 5, 2006; 103(49): 18597 - 18602.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
O. Mortusewicz, U. Rothbauer, M. C. Cardoso, and H. Leonhardt
Differential recruitment of DNA Ligase I and III to DNA repair sites
Nucleic Acids Res., July 19, 2006; 34(12): 3523 - 3532.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Drouet, C. Delteil, J. Lefrancois, P. Concannon, B. Salles, and P. Calsou
DNA-dependent Protein Kinase and XRCC4-DNA Ligase IV Mobilization in the Cell in Response to DNA Double Strand Breaks
J. Biol. Chem., February 25, 2005; 280(8): 7060 - 7069.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Byrum, S. Jordan, S. T. Safrany, and W. Rodgers
Visualization of inositol phosphate-dependent mobility of Ku: depletion of the DNA-PK cofactor InsP6 inhibits Ku mobility
Nucleic Acids Res., May 18, 2004; 32(9): 2776 - 2784.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Gordy, S. Mishra, and W. Rodgers
Visualization of Antigen Presentation by Actin-Mediated Targeting of Glycolipid-Enriched Membrane Domains to the Immune Synapse of B Cell APCs
J. Immunol., February 15, 2004; 172(4): 2030 - 2038.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rodgers, W.
Right arrow Articles by Capra, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodgers, W.
Right arrow Articles by Capra, J. D.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS