|
|
||||||||
Molecular Immunogenetics Program, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104
| Abstract |
|---|
|
|
|---|
100-fold slower than that
predicted from its size. Association of Ku-GFP with a filamentous
nuclear structure was also evident, and nuclear extraction experiments
suggest that this represents nuclear matrix. A central domain of Ku70
containing its DNA-binding and heterodimerization regions and its
nuclear localization signal shows that this alone is sufficient for the
observed mobility of Ku70-GFP and its association with nuclear matrix.
These data suggest the mobility of Ku is characterized by a transient,
high flux association with nuclear substrates that includes both DNA
and the nuclear matrix and may represent a mechanism for repair of
double-strand breaks using the nuclear matrix as a
scaffold. | Introduction |
|---|
|
|
|---|
Ku itself is a heterodimer composed of 70- and 83-kDa subunits, termed Ku70 and Ku86 (or Ku80), respectively (7). In vitro studies have shown that Ku binds to the free ends of DNA in a sequence- and structure-independent manner (8, 9, 10, 11). This presumably allows Ku to bind to DSBs to initiate DNA repair. The x-ray crystal structure of Ku shows that it binds to DNA through a channel that is formed by the Ku70-Ku86 heterodimer (12).
Genetic studies have provided important evidence that Ku is essential for NHEJ in the repair of DSBs. For example, cells deficient in either Ku70 or Ku86 are hypersensitive to ionizing radiation (13, 14). Other compelling evidence includes studies of T cell and B cell populations in Ku-deficient mice. For example, DSBs generated during V(D)J recombination are not efficiently repaired in mice that lack the expression of either Ku70 or Ku86 (15, 16, 17). Consequently, these animals exhibit a SCID phenotype. Similarly, Ig heavy chain class switch recombination, which also contains a DSB intermediate, is similarly inhibited in Ku70-deficient mice (18).
Despite the evidence that Ku functions in NHEJ during repair of DSBs, its properties in intact cells are unclear. For example, little is known concerning the dynamics of Ku in intact nuclei as defined by its mobility and the rate at which it associates with substrates. Interestingly, recent studies have provided specific examples of DNA- or RNA-binding proteins that exhibit rapid mobility within the nucleus (19, 20, 21, 22). In one case it was suggested from these results that some nuclear proteins undergo a transient, high flux association with their substrates (19). Whether these observations are applicable to Ku is unknown. Importantly, understanding the dynamics of Ku would provide important information regarding the kinetics of its association with DNA breaks and the repair reaction that follows.
To study the dynamics of Ku in cell nuclei, fluorescence photobleaching experiments were performed using cells expressing a green fluorescent protein (GFP) fusion construct of either Ku70 or Ku86. These results show Ku is highly mobile in cell nuclei, yet exhibits a diffusion coefficient that is significantly less than that predicted based from its size. The observed mobility of Ku includes its association with the nuclear matrix and DSBs generated by ionizing radiation. Together, these results show that Ku undergoes a transient, high flux association with its substrates. Furthermore, by coassociating with DSBs and the nuclear matrix, Ku could function to tether free ends of DNA to the nuclear matrix for repair of the DNA lesion.
| Materials and Methods |
|---|
|
|
|---|
Ku70- and Ku86-GFP constructs were generated using the GFP cloning and expression vector pWay20 (23). This vector contains a SmaI site immediately upstream of and in-frame with enhanced GFP (CLONTECH Laboratories, Palo Alto, CA) and a stop codon at the 3' end of enhanced GFP. The fusion genes were therefore constructed by subcloning blunt end PCR products into the SmaI site of pWay20. A CMV promoter drives the expression of the gene products.
Ku70 and Ku86 were amplified using the following oligonucleotides as primers for the PCR: Ku70, coding, AGAATGTCAGGGTGGGAGTC; Ku70, noncoding, GTTCTCGAGGTTGTTGTTGTTGTTGTCCTGGAAGTGCTTGG; Ku86, coding, AGAATGGTGCGGTCGGGGA; and Ku86, noncoding, GTTCTCGAGGTTGTTGTTGTTGTTTATCATGTCCAATAAATCGT. The underlined residues represent the start codon encoded in each coding primer. A second Ku70-GFP construct containing residues 255550 was constructed using the following primers for amplification: coding, ACATCATCTAGAATGCTCAACAAAGATATAGTGAT; noncoding: TCTAGTGAATTCGTTGTTGTTGTTGTTCTTGGGCCTTTTGCTTCCAG. The underlined residues again indicate the start codon. The residues in bold indicate an XbaI and EcoRI site encoded in the coding and noncoding primers, respectively, for subcloning the PCR fragment upstream of GFP using a previously described vector (24). Each of the noncoding primers contains a polyglutamine insert between the C terminus of the Ku subunit and the N terminus of GFP. This was added to enhance folding of the separate protein domains. Glutamine was used for this purpose because it has the lowest propensity for forming secondary structures (25).
Cell culture and protein expression
HeLa and 293T cells were grown in DMEM supplemented with antibiotics and 10% FBS. Ramos, Daudi, Raji, and A20 cells were grown in RPMI 1640 supplemented with antibiotics and 10% FBS. All cells were maintained at 37°C in the presence of 5% CO2.
Before transfection, HeLa cells were seeded at 6.0 x 105 cells onto a coverslip in a 3.5-cm dish the day before the experiment. The cells were transfected using lipid carrier (Superfect; Qiagen, Valencia, CA) with 5 µg of plasmid DNA. In experiments using 293T cells, 10-cm plates were seeded with 7.5 x 106 cells 12 h before transfection. The cells were transfected using CaPO4 (Invitrogen, Carlsbad, CA) and 25 µg of plasmid DNA for each plate. All remaining cell lines were transfected by electroporation (Bio-Rad Gene Pulser II; Bio-Rad, Hercules, CA) using 107 cells, 25 µg of plasmid DNA, and settings of 330 V and 960 µF. In experiments including immunofluorescence staining, the samples were prepared as previously described (26).
Cell lysis, immunoprecipitation, and immunoblotting
All steps were performed at 4°C. Transfected 293T cells were washed twice with PBS and lysed using 750 µl of a 10 mM NaCl, 3 mM MgCl2, and 10 mM Tris (pH 7.4) buffer (RSB) containing 0.5% Triton X-100 (TX-100), 1.0 mM PMSF, and 100 kallikrein units of aprotinin. After 10 min in lysis buffer, the samples were centrifuged for 5 min at 4000 rpm using a desktop centrifuge (Brinkman, Westbury, NY). The pellet containing intact nuclei was suspended in 500 ml of 150 mM NaCl, 1 mM EDTA, 20 mM Tris (pH 8.0), 0.1% TX-100, 10% glycerol, 1.0 mM PMSF, and 100 kallikrein units of aprotinin, and the nuclei were lysed by sonication. The lysate was centrifuged, and the supernatant was removed and immunoprecipitated using an mAb specific for the Ku70/Ku86 heterodimer (Santa Cruz Biotechnology, Santa Cruz, CA). Pansorbin (Calbiochem, San Diego, CA) was used as a solid phase for the immunoprecipitations. The immunoprecipitates were washed twice with 10 mM Tris (pH 8.0), 150 mM NaCl, and 5 mM EDTA containing 0.10% TX-100, and eluted using SDS-PAGE sample buffer (27). The samples were separated by gel electrophoresis and detected by immunoblotting using a mAb to GFP (Covance Research Products, Richmond, CA) as the first step. A biotinylated horse Ab to mouse (Vector Laboratories, Burlingame, CA) and streptavidin-conjugated HRP (Vector Laboratories) were used as the second and third steps, respectively. The membranes were developed using ECL (Amersham Pharmacia Biotech, Piscataway, NJ).
Nuclear matrix preparation
Cell nuclei were prepared by lysing cells in RSB by Dounce homogenization (2030 strokes). The lysate was sedimented and suspended in RSB containing 0.25 M sucrose and 1 mM PMSF. Nuclei were separated from cell debris by sedimenting through a 2 M sucrose layer (75,000 x g for 30 min). The resulting pellet was then suspended in RSB containing 0.25 M sucrose and 1 mM CaCl2 and digested with 25 µg of DNase I (Roche, Nutley, NJ) for 2 h at room temperature. Following DNase I treatment, the sample was extracted with high salt buffer by suspending in RSB containing 2 M NaCl and 10 mM EDTA and incubating at 0°C for 10 min. The sample was sedimented, washed with RSB containing 0.25 M sucrose, and then suspended in SDS-PAGE sample buffer. The samples were separated by SDS-PAGE and immunoblotted with the indicated Abs. Goat antiserum to Ku70, Ku86, and lamin B were purchased from Santa Cruz Biotechnology. mAb to phospho-RNA polymerase II (matrin 250) was purchased from Upstate Biotechnology (Lake Placid, NY). Biotinylated Ab to mouse or goat Ig was purchased from Vector Laboratories.
Fluorescence microscopy
Image acquisition. Images were collected using a Leica TCS laser scanning confocal microscope (William K. Warren Medical Research Institute, Oklahoma City, OK). GFP was excited at 488 nm, and Texas Red (TR) at 568 nm. Emission wavelengths between 530 and 560 nm were collected for GFP imaging, and emission wavelengths between 600 and 660 nm were collected for TR imaging. In double-labeling experiments, GFP and TR fluorescence were collected simultaneously in separate channels.
Fluorescence recovery after photobleaching (FRAP) measurements. Image analysis was performed using IP Lab Spectrum software (Scanalytics, Vienna, VA). Curve fitting for determining recovery values was performed using IGOR software (WaveMetrics, Palo Alto, CA). Protein mobility was measured as described previously (19). In brief, a region of the nucleus was photobleached using a brief (0.5 s) pulse of the 488-nm line of an argon laser at 100% power. Recovery of fluorescence within the bleached region was monitored by collecting a frame every 1.7 s. The amount of recovery at each time point was measured by determining the average fluorescence intensity in the bleached region. The recovery values were normalized using the equation: R = (AoIt)/(AtIo), where Ao is the total intensity of the nucleus in the prebleach image, At is the total intensity of the nucleus at time point t, Io is the average intensity of the bleached region in the prebleach image, and It is the average intensity of the bleached region at time point t. R therefore represents the ratio Ft:Fo corrected for the decay in the fluorescence signal due to collection of the images during the experiment (19), where Ft represents the average fluorescence intensity of the spot at each time t, and Fo is the average fluorescence intensity of this region in the prebleach image.
Fluorescence loss induced by photobleaching (FLIP) measurements. Intranuclear exchange of protein was measured by photobleaching a region of the nucleus with a 5-s pulse of laser (488-nm line of an argon laser at 100% power). Each pulse was followed by image acquisition. Photobleaching and image acquisition were repeated until the entire fluorescence signal was extinguished. The same region was photobleached in each pulse. The ratio of the average fluorescence intensity of the nucleus at each time point divided by its average intensity in the prebleach image was plotted vs time to represent the rate of decay of fluorescence signal during the FLIP experiment.
| Results |
|---|
|
|
|---|
Ku is functional only as the Ku70/86 heterodimer
(10). Consequently, for Ku70- and Ku86-GFP to be faithful
reporters of Ku activity, each must dimerize with endogenous protein
when separately expressed in transfected cells. To determine whether
Ku70- and Ku86-GFP dimerize with endogenous protein, nuclei from cells
transfected with either GFP construct were lysed and immunoprecipitated
using a mAb that recognizes only the Ku70/Ku86 heterodimer. The
immunoprecipitates were separated by SDS-PAGE, and Ku70- or Ku86-GFP
was detected by immunoblotting with an Ab specific for GFP. Fig. 1
A shows that both Ku70- and
Ku86-GFP are immunoprecipitated in this manner, showing that Ku70- or
Ku86-GFP associate with endogenous Ku.
|
Ku70/86-TR). Fig. 1Ku70- and Ku86-GFP are highly mobile in cell nuclei
To measure the mobility of Ku in cell nuclei, FRAP was measured in cells expressing either Ku70- or Ku86-GFP. Experiments measuring FRAP consist of first photobleaching a small region of the nucleus by a brief (0.5-s) laser pulse. Recovery of fluorescence by diffusion of protein into the bleached region is measured by acquiring images of the sample following the initial photobleaching.
Two separate photobleaching experiments that were performed using HeLa
cells expressing Ku70-GFP are shown in Fig. 2
A and in Supplements 1 and
2.4 In Fig. 2
A, the
green circle indicates the region that was photobleached in each
experiment, and the images were acquired at the indicated times. In the
top panel, the sample was untreated before photobleaching,
and complete recovery of the fluorescence signal occurred by
17 s.
However, the sample in the bottom panel of Fig. 2
A was fixed before the FRAP experiment. In this case, the
bleached region remains void of fluorescence even after the recovery is
complete in the untreated sample. This difference in mobility between
the untreated and the fixed sample is also indicated by the recovery
curves plotted in Fig. 2
B. Furthermore, a region in the
fixed sample the same size as that shown in Fig. 2
A but
outside of the bleach spot had a normalized fluorescence value close to
1.0 for all time points (data not shown). Thus, the lack of recovery in
the fixed sample is not due to quenching of fluorescence by fixation.
Experiments with cells expressing Ku86-GFP showed it has a mobility
similar to that of Ku70-GFP (Supplement 3). These results therefore
show Ku-GFP is mobile in cell nuclei and fixing the samples inhibits
this mobility.
|
+
F1 x
e(-t/
), where
F
represents the fraction of
recovery at infinite time and indicates the mobile fraction of the
molecule in the bleached region or, inversely, its immobile fraction.
is the time constant for recovery, and it is inversely proportional
to the diffusion coefficient. Histograms of the time constants and
percent recoveries measured in populations of HeLa cells expressing
either Ku70- or Ku86-GFP are shown in Fig. 2
The histograms in Fig. 2
C correspond to an average time
constant of
6 s for both Ku70-GFP and Ku86-GFP (Table I
). Furthermore, the diffusion
coefficient (D) was calculated for each experiment using the change in
the Gaussian profile of the bleach spot with time (28, 29). By this method, it was determined that the recoveries of
Ku70-GFP and Ku86-GFP correspond to a diffusion coefficient of
0.35
µm2s-1. This is similar
to that measured for GFP fusion constructs of other proteins that
function in the nucleus (19, 20, 21) and represents a
diffusion coefficient nearly 200-fold less than that of GFP alone in
the nucleus (30). This observed difference in the mobility
of GFP and Ku-GFP cannot be accounted for by size alone (
200 kDa for
the Ku-GFP heterodimer vs 27 kDa for GFP alone). For example, the
8-fold difference in size between Ku-GFP and GFP corresponds to a
2-fold difference in molecular volume (assuming a spherical protein)
(31). Thus, Ku70-GFP diffuses
2 orders of magnitude
slower than that predicted based on its volume relative to that of GFP
alone. One mechanism for this slower than predicted mobility of Ku70-
and Ku86-GFP is a transient association of Ku with other molecules in
the nucleus.
|
In developing lymphocytes, Ku functions in repair of DSBs that occur as
a consequence of V(D)J recombination (15, 18). To
determine whether Ku exhibits a similar mobility in B cells as in HeLa
cells, FRAP experiments were performed using Raji and A20 B cells
expressing either Ku70- or Ku86-GFP. These results are summarized in
Table I
, and they show that both the time constant and the recovered
fraction of Ku70- and Ku86-GFP in B cells are similar to those measured
in HeLa cells. Thus, the mobility of Ku measured in HeLa cells is not
restricted to this cell type, but also includes B cells.
Ku binds to the free ends of DNA (8, 9, 10), and genetic
studies have shown that it is required for DSB repair following
irradiation (13, 15, 32). To determine whether generation
of DSBs affects the mobility of Ku proteins, FRAP experiments were
performed using gamma-irradiated HeLa cells expressing Ku70-GFP. Table II
summarizes the results of these
measurements and shows that there is no significant change in the rate
or amount of recovery of Ku70-GFP at either 30 min or 6 h
postirradiation compared with untreated cells (Table I
). This result
suggests that Ku does not form a complex with DSBs that results in
changes in its mobility. However, another interpretation of these data
is that DSB repair is complete by 30 min. For example, genetic studies
have shown that some forms of NHEJ occur with a half-time of minutes,
and that this is a DNA-PKCS-dependent pathway
(33). To determine whether the failure to detect changes
in the mobility of Ku following irradiation was due to rapid repair of
DSBs, cells were pretreated with wortmannin before irradiation to
inhibit DNA-PKCS-dependent DSB repair. The
results of this experiment are also summarized in Table II
and show
that the rate of recovery of the wortmannin plus irradiation sample is
slightly slower than that of the sample treated with wortmannin alone.
This difference may reflect a small increase in the lifetime of
Ku70-GFP in complex with nuclear substrates such as DSBs. However,
these results show that Ku is not sequestered by DSBs, since the amount
of recovery is unchanged following irradiation. Thus, the fluorescence
recoveries in the irradiated cells are consistent with our
interpretation of the FRAP experiments in Fig. 2
that Ku exhibits a
transient association with its nuclear substrates. Such a transient
association of nuclear proteins with their substrates has been reported
for other molecules based on the results from FRAP experiments
(19, 21).
|
Both Ku70-GFP and Ku86-GFP exhibit
95% recoveries in the FRAP
experiments. This demonstrates that essentially the entire pool of
either subunit within the bleached region is mobile. To determine
whether the entire nuclear pool of Ku shares this characteristic, FLIP
experiments were performed using HeLa cells expressing either Ku70-GFP
or Ku86-GFP. In the FLIP experiments the sample is repeatedly
photobleached with pulses of longer duration (5 s). Decay of total
fluorescence signal is measured by acquiring an image of the sample
between each photobleaching pulse (31). Thus, FLIP
experiments measure the diffusion of fluorophore from all regions of
the nucleus into the path of the laser beam.
An example of a FLIP experiment performed using HeLa cells expressing
either Ku70-GFP or GFP alone is shown in Fig. 3
A. In the case of the cell
expressing Ku70-GFP, only the nucleus is evident. Both the nucleus and
cytoplasm are labeled in the cell expressing GFP. In each experiment
the region indicated by the green circle was bleached using laser
pulses 5 s in duration. In the cell expressing GFP alone,
fluorescence from the nucleus is quickly bleached. Bleaching of the
remaining signal in the cell occurs as GFP diffuses into the nucleus
from the cytoplasm. Similar to GFP, Ku70-GFP in the nucleus is also
entirely photobleached, and this occurs in
1 min. These results are
also illustrated by the fluorescence decay curves in Fig. 3
B. Importantly, in cases where a second cell expressing
Ku70-GFP was adjacent to the cell that was photobleached, negligible
photobleaching occurred in the adjacent cell (Supplement 4). Thus, the
fluorescence decay is due specifically to photobleaching during the
FLIP experiment. Efficient bleaching of the nuclear fluorescence also
occurred in samples that were pretreated with wortmannin and irradiated
before the FLIP experiment (Supplement 5). This result is consistent
with FRAP measurements showing that Ku exhibits similar fluorescence
recoveries in irradiated and untreated cells. Together the FLIP
experiments show that the entire nuclear pool of Ku molecules is
mobile, such that it is able to transverse the nucleus in
1 min even
in the presence of DSBs.
|
Ku associates with nuclear matrix through the Ku70 subunit
The Ku-associated filaments evident in Fig. 3
are also similar in
appearance to nuclear matrix visible by immunostaining of DNase-treated
nuclei (34). Furthermore, Ku70-GFP is present in the
nuclear matrix fraction of transfected 293T cells (Fig. 4
A), and endogenous Ku
colocalizes with the matrix-associated protein matrin 250
(35) (Fig. 4
B). Fig. 4
C shows that
endogenous Ku70 is present with the matrix marker lamin B
(36) in the nuclear matrix fraction prepared from HeLa
cells that had not been transfected. Interestingly, Ku86 is not present
in the matrix fraction. Furthermore, Ku70, but not Ku86, is present in
the nuclear matrix fraction of the B cell lines Raji, Daudi, and Ramos
(Fig. 4
D). These results suggest Ku associates with the
nuclear matrix through the Ku70 subunit alone and that Ku86 is removed
during preparation of the nuclear matrix fraction.
|
Ku70 contains a core region consisting of residues 255450 that is sufficient for heterodimerization with Ku86, binding to DNA ends, and DSB repair (32). Furthermore, residues 535550 contain the nuclear localization signal of Ku70 (37). To compare the properties of a central domain (CD) of Ku70 containing its core and nuclear localization signal with that of full-length protein, a GFP fusion gene was constructed encoding residues 255550 of Ku70 (Ku70CD-GFP).
Fig. 5
A shows three separate
HeLa cells that are expressing Ku70CD-GFP, each
of which demonstrates targeting of Ku70CD-GFP to
the nucleus (white arrowheads). Interestingly, Fig. 5
A also
shows that Ku70CD-GFP is present in a membranous
network within the cytoplasm. This is not found with either Ku70- or
Ku86-GFP and may represent stable association of
Ku70CD-GFP with a compartment within the
cytoplasm. To measure the association of
Ku70CD-GFP with endogenous Ku86, a nuclear lysate
of transfected cells was immunoprecipitated with the dimer-specific Ab
described for Fig. 1
. Coimmunoprecipitation of
Ku70CD-GFP with the Ku-specific Ab (Fig. 5
B) shows that it associates with endogenous Ku86.
|
To measure the association of Ku70CD-GFP with the
nuclear matrix, the matrix fraction was prepared using transfected 293T
cells. Fig. 5
C shows that the matrix fraction contains core
Ku70-GFP, as detected by immunoblotting with Ab specific for GFP. Thus,
the matrix-targeting domain of Ku70 occurs within its central domain,
and it is therefore proximal to the region in Ku that confers DSB
repair activity.
| Discussion |
|---|
|
|
|---|
Previous studies have demonstrated that nuclear substrates for Ku
include free ends of DNA (8, 9, 10) and telomeres
(38, 39, 40, 41). Our results show the nuclear matrix represents
another substrate for Ku binding. Fig. 6
illustrates a model describing how association of Ku with the nuclear
matrix may represent a functionally significant feature in its role in
DSB repair. For example, Ku may serve to tether the free ends of the
DSBs to the nuclear matrix so that the matrix can serve as a scaffold
for further assembly of DNA repair machinery. Based on the mobility of
Ku, the Ku-DSB-nuclear matrix complex must have a half-life of <10 s.
However, if other DNA repair enzymes exhibit the same mobility as Ku,
then a short-lived complex of enzymes and DNA may be sufficient for
repair of the DSB. Evidence of a DNA-PK-dependent pathway for NHEJ that
has a half-time of minutes is consistent with this idea
(33). Alternatively, rapid replacement of Ku with
additional Ku molecules may establish a steady-state assembly that has
a lifetime considerably longer than that of the dwell time of
individual Ku molecules.
|
A current model for DNA repair is that Ku initiates NHEJ by binding DSBs and recruiting additional DNA repair enzymes (7). The mobility exhibited by Ku in the nucleus indicates that it can move rapidly throughout the nucleus in search of DSBs. This contrasts with the model that Ku is sequestered at telomeres until the occurrence of DSBs, at which time it delocalizes from the telomeres to bind to the DNA lesions (44).
The rapid mobility exhibited by Ku and shared by other nuclear enzymes of diverse structure and function (19, 20, 21, 22) implies that this high mobility is a general feature of proteins that function in DNA or RNA synthesis and processing. This observation suggests that current opinion regarding the compartmentalization of the nucleus is oversimplified. For example, previous studies using immunofluorescence staining have shown that replication and transcription are associated with nuclear foci that appear in interphase nuclei (45, 46). This has led to the idea that proteins that function in these events are sequestered into stable, long-lived structures. However, based on the results from mobility studies, another interpretation is that the foci are composed of molecules that are rapidly exchanging with regions of the nucleus outside of the foci. Similar to this, nucleoli have been shown to be composed of molecules that are rapidly exchanging with the extranucleolar compartment (19, 21).
Some nuclear proteins do not share the rapid mobility of Ku. For
example, the histone protein H2B shows little recovery even as late as
30 min postbleaching (19, 47, 48). Thus, while at least
some proteins are freely diffusing within the nucleus and forming
short-lived complexes, others are forming a stable scaffold with little
or no flux from other regions of the nucleus. The nuclear matrix may
represent a similar type of low exchange structure within the nucleus.
In contrast, it has been argued that the nuclear matrix is merely an
artifact arising from DNase treatment and salt extraction of nuclei
(49). However, Fig. 3
, showing association of Ku70-GFP
with a filamentous network that also correlates with its occurrence in
the matrix fraction, argues that the matrix fraction is, in fact,
representative of a matrix structure in intact nuclei.
In summary, using fluorescence photobleaching to measure the mobility of Ku, it was determined that Ku rapidly diffuses throughout the nucleus. In addition to this mobility, Ku exhibits association with the nuclear matrix, and we postulate that this may represent a mechanism for tethering DSBs to the nuclear matrix for repair. Finally, the mobility exhibited by Ku and other nuclear proteins suggests that nuclear architecture can be defined as a structure composed of stable scaffolding molecules, among which enzymes that mediate DNA and RNA synthesis and processing rapidly diffuse and form transient interactions to complete their function.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. J. Donald Capra, Molecular Immunogenetics Program, Oklahoma Medical Research Foundation, 825 NE 13th Street, MS 17, Oklahoma City, OK 73104. E-mail address: jdonald-capra{at}omrf.ouhsc.edu ![]()
3 Abbreviations used in this paper: DSB, double-strand break; CD, central domain; FLIP, fluorescence loss induced by photobleaching; FRAP, fluorescence recovery after photobleaching; GFP, green fluorescent protein; NHEJ, nonhomologous end joining; TR, Texas Red; TX-100, Triton X-100. ![]()
4 The on-line version of this article contains supplemental material. ![]()
Received for publication July 3, 2001.
| References |
|---|
|
|
|---|
-sheet-forming propensities of amino acids. Nature 367:660.[Medline]
This article has been cited by other articles:
![]() |
P.-O. Mari, B. I. Florea, S. P. Persengiev, N. S. Verkaik, H. T. Bruggenwirth, M. Modesti, G. Giglia-Mari, K. Bezstarosti, J. A. A. Demmers, T. M. Luider, et al. Dynamic assembly of end-joining complexes requires interaction between Ku70/80 and XRCC4 PNAS, December 5, 2006; 103(49): 18597 - 18602. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Mortusewicz, U. Rothbauer, M. C. Cardoso, and H. Leonhardt Differential recruitment of DNA Ligase I and III to DNA repair sites Nucleic Acids Res., July 19, 2006; 34(12): 3523 - 3532. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Drouet, C. Delteil, J. Lefrancois, P. Concannon, B. Salles, and P. Calsou DNA-dependent Protein Kinase and XRCC4-DNA Ligase IV Mobilization in the Cell in Response to DNA Double Strand Breaks J. Biol. Chem., February 25, 2005; 280(8): 7060 - 7069. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Byrum, S. Jordan, S. T. Safrany, and W. Rodgers Visualization of inositol phosphate-dependent mobility of Ku: depletion of the DNA-PK cofactor InsP6 inhibits Ku mobility Nucleic Acids Res., May 18, 2004; 32(9): 2776 - 2784. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gordy, S. Mishra, and W. Rodgers Visualization of Antigen Presentation by Actin-Mediated Targeting of Glycolipid-Enriched Membrane Domains to the Immune Synapse of B Cell APCs J. Immunol., February 15, 2004; 172(4): 2030 - 2038. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |