| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institut National de la Santé et de la Recherche Médicale, Unité 462, Laboratoire * 10, Ligue Nationale Contre le Cancer, Institut Universitaire d’Hématologie, Hôpital Saint-Louis, Paris, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T
cells. Pre-TCR function was mimicked by the induction of CD3 signaling
in thymocytes of recombinase activating gene (RAG)-2-deficient mice
(RAG-2-/-). Upon anti-CD3
treatment in vivo,
p16INK4a-expressing RAG-2-/-
thymocytes were not rescued from apoptosis, nor could they
differentiate. Our data demonstrate that expression of
p16INK4a prevents the pre-TCR-mediated
expansion and/or survival of differentiating
thymocytes. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells) as well as at least four immature
thymocyte subsets that can be distinguished based on surface expression
of CD44 (Pgp-1), CD25 (IL-2R
), and CD117 (c-kit). The
CD117-CD44-CD25+
DN stage is a critical step for T cell differentiation during which
productive TCR
gene rearrangements are generated (2).
Once this step has occurred, the TCR protein covalently associates
with the pT chain and subunits of the CD3 complex to form the
pre-TCR (3). Surface expression of the pre-TCR triggers an
intracellular activation cascade allowing thymocytes to proliferate and
differentiate into CD4+CD8+
double positive (DP) cells (4). At this stage, the
molecular mechanism controlling thymocyte expansion and proliferation
is not fully characterized, but a critical step could be the
inactivation of cell death pathways (5, 6). Cyclin-dependent kinase (CDK) inhibitors represent a class of cell growth negative regulatory elements that suppress the kinase activity of the cyclin/CDK complexes. Two of these molecules, namely p16INK4a and p19ARF, are generated by the inhibitor of cyclin-dependent kinase 4-alternative reading frame (INK4a-ARF) tumor suppressor locus through the use of different promoters (7). The p16INK4a is a CDK inhibitor that acts upstream of the retinoblastoma protein to control cell cycle arrest, whereas p19ARF activates p53 by interfering with its negative regulator, murine double-minute 2 (MDM2) (8, 9). Mutations that inactivate the CDK inhibitory function of p16INK4a have been implicated in human cancers in general (10) and in the vast majority of thymocyte malignancies (the so-called T cell acute lymphoblastic leukemias) in particular (11, 12). The high susceptibility to spontaneous tumor development of p16Ink4a- and p19Arf-deficient mice further emphasized the role of the Ink4a-Arf locus in controlling the transformation process (13). Recently, analysis of INK4a-deficient mice demonstrated the specific function of p16Ink4a in controlling both tumor progression and thymopoiesis (14, 15).
Expression of p16Ink4a and p19Arf is actively repressed by the polycomb group gene bmi-1 (16). The bmi-1-deficient mice, in which expression of p16Ink4a and p19Arf is detected in cells of the lymphoid lineage, display morphological and neurological abnormalities combined with an alteration of T and B cell differentiation (17). The phenotypes of bmi-1-deficient mice are markedly attenuated in bmi-1-/-ink4a-ARF-/- double-knockout mice, indicating that p16INK4a or p19Arf mediates the neurological and lymphoid differentiation defects through an as yet unknown mechanism (16). Further analysis of the thymus cell population of bmi-1-/- mice revealed a high level of Ink4a-Arf-mediated apoptosis, suggesting that cell death may participate in the lymphoid phenotype of mutant animal (18).
To investigate the mechanism by which p16Ink4a
controls the program of T cell development, we have generated
transgenic mice expressing the human p16INK4a
into the T cell lineage. Our results show that the differentiation of
transgenic T cells is severely impaired, whereas maturation of
T cells remains efficient. Moreover, we demonstrate that
expression of p16INK4a does not allow immature
DN thymocytes to escape the program cell death after a physiological
mitotic signal. Thus, expression of p16INK4a
appears to prevent the pre-TCR-mediated expansion and/or survival of
differentiating T cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The human p16INK4a cDNA (kindly provided by R. Medema, The Netherlands Cancer Institute, Amsterdam, The Netherlands) (19) was cloned into the BamHI site of the plck-human growth hormone-expressing vector (20). The complete plasmid plck-p16INK4a was digested with NotI and the transgene fragment free of vector sequences was purified by Geneclean II (BIO101, Vista, CA). DNA fragment was microinjected into fertilized eggs of C57BL/10 x BALB/c F1 mice. Resulting offspring were tested for integration of the transgene by Southern blotting. Two independent founders carrying the transgene were identified and subsequently bred into a recombinase activating gene (RAG)-2-deficient background.
Western blot analysis
Thymocyte or splenocyte cell suspensions were enumerated and washed in PBS buffer. Cell pellets were lyzed in a solution containing 50 mM Tris-HCl (pH 8), 150 mM NaCl, 0.1% SDS, 1 µg/ml aprotinin, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.02% NaN3, and 100 µg/ml PMSF. Thirty micrograms of protein was loaded on a 15% polyacrylamide gel and run in Tris-glycine buffer. Proteins were then transferred on nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany), detected by Western blot analysis using a specific anti-human p16INK4a (BD PharMingen, San Diego, CA) or anti-Actin Abs (Santa Cruz Biotechnology, Santa Cruz, CA), and revealed using the ECL detection kit (Amersham, Arlington Heights, IL).
RT-PCR Assay
Four micrograms of total RNA was incubated for 50 min at 42°C
in 20 µl of a solution containing 100 ng of hexanucleotide and 200 U
of reverse transcriptase (Superscript II; Life Technologies, Rockville,
MD) in the manufacturer’s buffer. One microliter of this reaction was
subjected to PCR amplification. PCRs were performed in a 50-µl
reaction containing 2 ng/µl each primer, 0.2 µM each dNTP, 2 mM
MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.8), 0.1%
Triton X-100, and 1 U/50 µl of Taq polymerase. Reactions
consisted of 4 min at 95°C followed by 32 cycles of 1 min at 95°C,
1 min at 57°C, and 1.5 min at 72°C, and an extension of 5 min at
72°C. The PCR products were electrophoresed on 0.8% agarose gels,
transferred to 
-probe membranes, and probed with the
32P-end-labeled oligo-probe. For probing,
membranes were hybridized overnight at 42°C in a 6x SSC, 1%
SDS, 3x Denhardt solution, washed at 42°C in a 2x SSC, 0.1% SDS
solution, and subjected to autoradiography. Primer sequences are as
follows: p16 28, GGGCACTGAATCTCCGCGAGG; p16 53,
GCTGAAGCTATGCCCGTCGGTC; p16 probe, GGTTTCGCCAACGCCCCGAA;
hypoxanthine phosphoribosyltransferase (HPRT)5,
GCTGGTGAAAAGGACCTCT; HPRT3, CACAGGACTAGAACACCTGC; HPRT probe,
GGATATGCCCAAGACTATAATG; CDK 10, ACCATGCCCGCATAGATG; human
growth hormone, TGGCAACTTCCAAGGCCAGGAGAG; and CDK probe,
TCCCGAGGTTTCTCAGAG.
Flow cytometry
Single cell suspensions obtained from lymphoid organs were
prepared and stained with Abs following standard procedures and were
analyzed on a FACScan or a FACSCalibur flow cytometer (BD Biosciences,
Mountain View, CA). The following Abs (BD PharMingen) conjugated with
FITC, PE-RM4-5 (PE), or biotin (bi) and streptavidin CyChrome were
used: anti-CD8-FITC, anti-CD4-PE, anti-CD44-FITC,
anti-CD25-PE, anti-CD8-bi, anti-CD4-bi, anti-CD3-FITC,
anti-CD4-APC, anti-CD3-bi, anti-NK1.1-bi, anti-CD44-bi, and
anti-TCR-PE. The data were analyzed using CellQuest (BD
Biosciences). DN cell sorting was performed on FACSVantage SE using
FACSdiva (BD Biosciences). Each sorted DN population was at least
99% pure.
Cell cycle
Single cell suspensions obtained from thymus were prepared, and 107 thymocytes were stained with Ab anti-CD25-FITC following standard procedures. Cells were washed in PBS, suspended in 70% ethanol, and left at -20°C for 2 h. Cells were then washed in PBS and incubated 30 min in PBS, 10 µg/ml propidium iodide (PI), and 100 µg/ml RNase A. The data were analyzed using CellQuest (BD Biosciences).
In vivo Ab treatment
Five-week-old RAG-2-/- or RAG-2-/- p16INK4a double-transgenic mice were injected i.p. with 30 µg of an anti-CD3 Ab (2C11; BD PharMingen) as described by Shinkai and Alt (21). Treated animals were sacrificed 4 days postinjection, and thymocyte cell suspensions were analyzed.
Cell death analysis
Flow cytometric analysis of apoptotic cells was performed with the Apoptosis Detection kit according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN). Briefly, cells were washed in PBS and resuspended in 1x binding buffer at 106 cells/ml. PI and annexin V were added to final concentrations of 0.1 and 0.05 µg/ml, respectively, incubated for 10 min at room temperature, and immediately analyzed on a FACScan. The data were analyzed with a CellQuest system.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The transcription status of the Ink4a locus in
wild-type thymocytes was addressed using an RT-PCR strategy. A low
Ink4a expression was detected in wild-type thymus RNA that
represented a 20-fold lower level compared with the control human Hela
cell line (Fig. 1
A). Similar
low amounts of Ink4a transcripts were found in thymus of
RAG-2-deficient mice that only contain immature DN thymocytes
(22) (Fig. 1A). To analyze the consequences of
Ink4a expression in maturating thymocytes, we generated two
lines of transgenic mice expressing the human
p16INK4a. The cDNA encoding the human
p16INK4a protein was cloned into a Lck-based
expression vector that was shown to give high transcriptional levels in
thymocytes (20). Transgenic founders were first identified
by Southern blot analysis, and expression of the human
p16INK4a protein was detected by Western blot in
cellular extracts of thymocytes from both transgenic lines (Fig. 1B). The human p16INK4a was detected
in thymocytes of lines 59 and 57. Normalization to the Actin protein
level revealed a higher p16INK4a expression in
thymocytes from line 57 compared with line 59. Low level of transgenic
protein was detected in the spleen of line 59 but not in line 57 (data
not shown). The m.w. of the transgenic p16INK4a
protein was slightly smaller than its wild-type counterpart detected in
Hela cells. This was due to truncation of the DNA segment encoding the
first eight amino acids in the construct. These residues were shown to
be unnecessary for the cell cycle inhibitory function of
p16INK4a (19). Indeed, cell cycle
analysis revealed that the percentage of cycling cells among the
CD25+ DN subset was dramatically reduced in
p16INK4a-transgenic mice (Fig. 1C).
Thus, expression of transgenic p16INK4a protein
in mouse immature T cells significantly decreased the percentage of
cells undergoing cell cycle.
|
Upon dissection, the thymus of
p16INK4a-transgenic mice appeared dramatically
smaller than those of littermate controls. The absolute cell number in
the thymus of 4-wk-old mice reached 30 million per thymus in line 59
and decreased to 3 million per thymus in line 57, compared with 150
million in nontransgenic controls (Fig. 2A). Thymus and lymph node
cell suspensions were stained with various combinations of Abs and
analyzed by flow cytometry. Staining with anti-CD4 and anti-CD8
Abs clearly showed that expression of p16INK4a
affected T cell differentiation (Fig. 2, A and
B). The defect was most severe in line 57, in which
peripheral T cells represented <2% of the lymph node cell population
(Fig. 2B). In the thymus, the percentage of immature
CD4-CD8- (DN) cells rose
from 3.6% in nontransgenic mice to 13% in line 59 and >90% in line
57 (Fig. 2A). In both cases, the increased percentage of
early DN cells accompanied the diminution of DP cells, which accounted
for 50 and 1%, respectively, of the total thymic cell population.
Early DN thymocytes represent a heterogeneous population that can be
sorted into four cell subsets, from the most immature
CD44+CD25- DN1 fraction to
the CD44+CD25+ cycling DN2
fraction, the CD44-CD25+
DN3 fraction, and the
CD44-CD25- cycling DN4
fraction. Flow cytometry analysis of p16INK4a DN
transgenic thymocytes revealed a striking increased ratio of
CD44-CD25+ cells and a
relative diminution of those expressing CD44 (Fig. 2C). With
regard to cell numbers, the percentages of DN or
CD25+ thymocytes in animals from line 57 were
almost identical with RAG-2-deficient mice that are unable to rearrange
Ag receptor genes. This differentiation defect in
p16INK4a-transgenic mice was not due to lack of
TCR gene rearrangements, as V(D)J recombination was
detected using a PCR assay on sorted DN cells (data not shown). To
further characterize the developmental block imposed by
p16INK4a, we analyzed the cycling immature
single positive (ISP) CD8 cell subset, which arises from DN3 thymocytes
after pre-TCR expression. The ratio of CD8-expressing thymocytes among
CD4-, CD44-,
CD25-, CD3-, and
NK1.1- cells decreased from 67% in wild-type
mice to 25% in line 59 and 1% in line 57 (Fig. 2D).
|
A). Morphological
analysis of DN1 to DN4 subsets revealed a significant size reduction
within the transgenic thymocytes. The large blasting population dropped
from 40% in wild-type DN4 subset to 10 (line 59) or 5% (line 57) in
transgenics (data not shown). The blasting cell fraction was also
reduced in DN2 and DN3 fractions. CD25-expressing cells (DN2 + DN3)
can be divided into two subsets: one termed "E," corresponding to
resting cells bearing nonproductively rearranged TCR genes, and the
second one termed "L," which represents large cycling thymocytes
expressing a functional -chain (2). Whereas 15% of
wild-type CD25+ thymocytes were large
proliferating L cells, this cell fraction dropped to 8% in transgenic
line 59 (Fig. 3B). The reduction was even more pronounced in
line 57, in which L cells represented 2% of
CD25+ thymocytes, a percentage similar to what
was detected in RAG-2-deficient mice (Fig. 3B). Because
transition from the E to the L subset is tightly linked to
selection, we hypothesized that the expression of
p16INK4a interfered with this process.
|
T cells can develop in p16INK4a-transgenic mice
In the thymus,
CD44-CD25+ E early T cell
precursors first begin to rearrange their TCR, , and genes.
At that stage, the decision to commit to the or the
lineage is influenced by the ability of the cell to produce in frame
rearrangements of both and genes, as well as by other elements
(23). Unlike thymocytes, cells of the
lineage do not seem to undergo significant cellular expansion during
differentiation and represent <1% of total thymocytes
(24). This difference in the proliferation potential
between the precursors of the two lineages suggests that the
receptor induces a signal distinct from the pre-TCR. In this case,
inhibition of the cell cycle by p16INK4a may
have a different impact on the differentiation of compared with
thymocytes. To address this issue, we verified that
p16INK4a was indeed expressed in cells
(data not shown) and analyzed thymocytes by flow cytometry using a
combination of Abs specifically recognizing TCR and CD3.
Wild-type CD4-CD8-
thymocytes contained 7% of cells, a percentage that was similar
to what was found in both transgenic lines (Fig. 4). Furthermore, the absolute number of
thymocytes did not significantly differ between wild-type and
transgenic line 59, and only a minor 1.5-fold reduction was observed in
transgenic line 57 (data not shown). Together, these results indicated
that p16INK4a expression did not severely affect
engagement of T cell precursors into the lineage.
|
During normal thymocyte differentiation, TCR rearrangements and
pre-TCR expression occur in
CD4-8-CD44-CD25+
cells (25). Signaling by the pre-TCR induces maturation of
CD4-8-CD44-CD25+
into DP cells as well as cellular expansion. The accumulation of
immature E cells in the thymus of the
p16INK4a-transgenic mice suggested a defect in
pre-TCR-mediated differentiation. Previous studies have shown that the
maturation of RAG-2-/- DN thymocytes into DP
cells and a 50-fold thymocyte expansion can be induced in vivo by i.p.
injection of anti-CD3 Abs (2C11) (21, 26). We took
advantage of this in vivo, pre-TCR-independent differentiation system
to further investigate the transition of DN to DP in the
p16INK4a-transgenic mice. We bred the transgenic
line 59 with RAG-2-deficient mice to generate a double mutant line
p16INK4a;RAG-2-/-.
Although the Lck cassette is able to drive expression of
p16INK4a in RAG-2-/- DN
thymocytes (data not shown), the thymus cell populations of
p16INK4a;RAG-2-/- mice
were similar to those of RAG-2-/- littermate
controls (Fig. 5 and data not shown). As
expected, 4 days after anti-CD3 injection, the total number of
thymocytes in treated RAG-2-deficient mice had increased from 4 x
106 to 80 x 106 (±
15 x 106) cells per thymus, and large
numbers of CD4+CD8+ DP
cells were detected (Fig. 5). In contrast, the same treatment applied
to p16INK4a;RAG-2-/-
littermates did not lead to any thymocyte expansion, and only 3–4
x 106 cells were recovered after anti-CD3
injection. Among these cells, very few
CD4+CD8+ DP thymocytes
could be detected by flow cytometry (Fig. 5). In addition, the
CD25+ cell populations, which were
similar in the thymus of untreated RAG-2-/- and
p16INK4a;RAG-2-/- mice,
were no longer detected after the anti-CD3 injection, indicating
that the
p16INK4a;RAG-2-/-CD25+
thymocytes, like those of RAG-2-/-, were
sensitive to the Ab treatment and underwent transition to the DN4
(CD44-CD25- DN)
compartment (Fig. 5). This result demonstrates that expression of the
tumor suppressor p16INK4a did not allow DN
RAG-2-deficient cells to maturate beyond the DN4
(CD44-CD25-) stage after
CD3 treatment.
|
signaling does not rescue
p16INK4a;RAG-2-/- DN thymocytes from
apoptosis
We next investigated the mechanism leading to the differentiation
arrest of p16INK4a-transgenic thymocytes.
Because differentiation might occur without intense cellular
proliferation, we hypothesized that rapid cell death of thymocytes
undergoing differentiation could lead to an apparent block of
p16INK4a-transgenic T cell maturation. To test
this hypothesis, we analyzed the steady state level of apoptosis in DN
thymocytes in both p16INK4a-transgenic and
wild-type control mice. Using the annexin V-mediated detection system,
we found a 2-fold increase in the percentage of apoptotic cells among
DN thymocytes of transgenic compared with wild-type mice (Fig. 6A). Together with the
reduction of the L cell subset shown is Fig. 3
, this result suggested
that the pre-TCR signaling could not rescue transgenic DN thymocytes
from apoptosis. To further investigate this apoptotis process, we took
advantage of the pre-TCR-like signal generated by the in vivo treatment
of RAG-2-/- thymocytes with the anti-CD3
Abs. As previously described, PBS or anti-CD3 Ab was injected
into RAG-2-/- or
p16INK4a;RAG-2-/- mice.
Annexin V-mediated detection of cell death among the total thymus cell
population of
p16INK4a;RAG-2-/--treated
mice revealed the presence of a high percentage (10%) of apoptotic
cells compared with RAG-2-/--treated mice (2%)
or untreated RAG-2-/- and
p16INK4a;RAG-2-/- mice
(7 and 6%, respectively) (Fig. 6B). This finding
indicates that, in the presence of the tumor suppressor
p16INK4a, the CD3-mediated signal cannot
rescue RAG-2-deficient thymocytes from undergoing cell death.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cell differentiation
before the main step of thymocyte expansion, which is triggered by
expression of the TCR-chain. The size of transgenic
CD25+ thymocytes was similar to that of
RAG-2-deficient thymocytes and corresponded to nonselected cells
(Fig. 3). Although the pre-TCR signaling pathway was functional in that
p16INK4a RAG-2-/-
thymocytes could undergo the DN3 to DN4 transition upon 2C11 treatment,
it was inefficient to induce further differentiation. The maturation of
p16INK4a-transgenic precursors into T
cells was not dramatically affected. One major difference between the
differentiation of and lineage is that thymocyte
development can proceed with no pre-T-mediated proliferation step
(27). These observations suggest that the defect of
transgenic thymocytes is linked to the pre-TCR-mediated phase of T cell
development. Furthermore, we did not detect any major defect in early
transgenic T cells, in that the number and the phenotype of
p16INK4a;RAG-2-/-
thymocytes were similar in RAG-2-/- controls.
Proliferation of early thymocytes occurs through an Ag
receptor-independent, cytokine-mediated process (28).
Despite p16INK4a expression in the DN subsets,
this expansion step appeared moderately impaired in transgenic
thymocytes. In contrast, the CD8 ISP cell subset, which is generated
after pre-TCR expression, was severely reduced in transgenic DN
thymocytes. Thus, p16INK4a appears to interfere
differently with the proliferation process according to the kind of
signal that is delivered to the cell. The weak
p16INK4a expression detected in DN4 thymocytes
likely resulted from a low T cell ratio in this subset. The DN4
fraction, which contains only negative cells, may include non-T cells
that are unable to express the transgenic lck cassette. In
addition, the low number of ISP cells in the transgenic lines (Fig. 2D) may also contribute to decreasing the T cell ratio
within the DN4 population. Altogether, our results indicate that
p16INK4a specifically inhibits the development
of thymocytes undergoing a pre-TCR-mediated expansion. This
interpretation is strengthened by the marked increase in size of the DP
cell population in the thymus of
p16Ink4a-deficient mice (14). We show that the differentiation arrest of p16INK4a-transgenic thymocytes is associated with an increased percentage of apoptotic cells. Considering that in the thymus dead cells are quickly eliminated, the 2-fold increase of annexin-positive cells in transgenic thymus should be regarded as a rather high rate of apoptosis. The enhanced cell death among transgenic thymocytes may explain the low level of Ink4a transcript detected in the thymus because p16Ink4a-expressing cells are expected to be rapidly eliminated. Thus, even if Ink4a expression in thymocytes is rather low, our data show that p16Ink4a plays a major role during T cell development. Although apoptosis seems critical for the differentiation arrest of transgenic thymocytes, the possibility that a lack of proliferation imposed by the cell cycle inhibitory function of p16Ink4a may direct the phenotype remains open. This hypothesis is strengthened by a recent report showing that overexpression of the cell cycle inhibitor p27Kip1 in transgenic mice arrested the thymocyte development at the DN stage (29). The similar phenotype of p27Kip1 and p16INK4a thymocytes suggests that the transition of immature DN thymocytes into DP cells may not proceed without a minimum number of cell divisions.
Proliferation, differentiation, and apoptosis are tightly linked during
the development of T cells. Inhibition of the Fas-associated
death domain protein (FADD)/MORT death pathway in RAG-deficient
thymocytes both increased the ratio of cycling cells and allowed the DN
to DP transition in the absence of TCR -chain expression
(6). Thus, the death of CD3-stimulated
p16INK4a;RAG-2-/-
thymocytes could be a consequence of the inability of the pre-T-like
proliferation signal to drive thymocytes out of a differentiation
window where cells are highly sensitive to FADD-mediated apoptosis. In
this line, impaired pre-TCR signaling is thought to allow p53
accumulation, thereby inducing thymocyte apoptosis through a
Bcl-2-independent process (5). In this system,
inactivation of the p53 protein permits pre-TCR-deficient thymocyte
proliferation and DN to DP transition. Thus, considering the critical
role of p53 and FADD in the transition from the DN to DP stage, it
seems likely that one of these death pathways (or both) is involved in
the apoptosis of p16INK4a-transgenic thymocytes.
The p16INK4a protein would then mediate cell
cycle arrest, maintaining cells into a death-sensitive developmental
stage.
Mice deficient for the polycomb group gene bmi-1 express the p19Arf and p16Ink4a tumor suppressors, both of which are encoded by the Ink4a locus. As a direct consequence of Ink4a expression, thymus of bmi-1-/- mice display decreased cellularity, differentiation block, and a high level of apoptosis (16, 18). The mechanisms leading to those defects remain poorly understood, but the well-documented p19ARF-Mdm2-p53-mediated apoptosis loop (30, 31) was favored over a role of p16Ink4a in the death process of bmi-1-/- thymocyte. Our data demonstrating that p16INK4a expression directly or indirectly induced the cell death in developing thymocytes somehow challenge a unique function of p19Arf in the phenotype of bmi-1-deficient mice. In fact, the similar high percentage of immature CD25-positive cells in the thymus of bmi-1-deficient and p16INK4a-transgenic mice suggests a role of p16Ink4a in this differentiation arrest of the bmi-1-/- mutants. In this line, overexpression of Bcl-2 in bmi-1-deficient mice could not totally rescue the T cell differentiation in terms of both cell number and thymus population (18). Considering that p19Arf triggers a p53-dependent apoptosis and that Bcl-2 inhibits p53-mediated cell death, this result may indicate that part of the T cell differentiation block in bmi-1-/- mice is caused by expression of p16Ink4a.
Together, the data we present here demonstrate that expression of p16INK4a interferes with the pre-TCR-mediated differentiation and proliferation of thymocytes. Moreover, we bring strong evidence that p16INK4a directly or indirectly triggers apoptosis in maturating DN thymocytes. Thus, p16INK4a expression, which can be induced by oncogenic insults (32), may function as a safeguard, blocking the engagement of inappropriate or potentially transformed thymocytes into the pre-TCR-dependent intense proliferation step.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jean-Christophe Bories, Institut National de la Santé et de la Recherche Médicale, Unité 462, Institut Universitaire d’Hématologie, Hôpital Saint-Louis, 1 Avenue Claude Vellefaux, 75475 Paris Cedex 10, France. E-mail address: jcbories{at}infobiogen.fr
3 Abbreviations used in this paper: DN, double negative; DP, double positive; CDK, cyclin-dependent kinase; RAG, recombinase activating gene; HPRT, hypoxanthine phosphoribosyltransferase; bi, biotin; PI, propidium iodide; ISP, immature single positive; FADD, Fas-associated death domain protein; INK4, inhibitor of cyclin-dependent kinase 4; ARF, alternative reading frame; MDM2, murine double-minute 2.
Received for publication October 12, 2001. Accepted for publication January 4, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain gene rearrangement: coincident regulation of cell cycle and clonality during development in vivo. Genes Dev. 10:948.-chain and a 33 kD glycoprotein. Cell 75:283.[Medline]
-mediated signals rescue the development of CD4+CD8+ thymocytes in RAG-2-/- mice in the absence of TCR -chain expression. Int. Immunol. 6:995. versus T cell lineage decision. Cell 88:833.[Medline]
selection events in cell development. Immunity 7:83.[Medline]
-/- mice by anti-CD3 antibody treatment or with transgenes encoding activated Lck or tailless pT. Immunity 6:703.[Medline]
- chain-deficient mutant mice by transmembrane signaling through CD3. Proc. Natl. Acad. Sci. USA 90:11401. versus T lineage commitment. Immunity 9:649.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Fasseu, P. D. Aplan, M. Chopin, N. Boissel, J.-C. Bories, J. Soulier, H. von Boehmer, F. Sigaux, and A. Regnault p16INK4A tumor suppressor gene expression and CD3{epsilon} deficiency but not pre-TCR deficiency inhibit TAL1-linked T-lineage leukemogenesis Blood, October 1, 2007; 110(7): 2610 - 2619. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Higuchi, F. O. Bartel, M. Masuya, T. Deguchi, K. W. Henderson, R. Li, R. C. Muise-Helmericks, M. J. Kern, D. K. Watson, and D. D. Spyropoulos Thymomegaly, Microsplenia, and Defective Homeostatic Proliferation of Peripheral Lymphocytes in p51-Ets1 Isoform-Specific Null Mice Mol. Cell. Biol., May 1, 2007; 27(9): 3353 - 3366. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Migliaccio, P. M. S. Alves, P. Romero, and N. Rufer Distinct Mechanisms Control Human Naive and Antigen-Experienced CD8+ T Lymphocyte Proliferation J. Immunol., February 15, 2006; 176(4): 2173 - 2182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Sachs, N. E. Sharpless, R. A. DePinho, and N. Rosenberg p16Ink4a Interferes with Abelson Virus Transformation by Enhancing Apoptosis J. Virol., April 1, 2004; 78(7): 3304 - 3311. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
