|
|
||||||||

Departments of
*
Pathology and
Medicine, Division of Infectious Diseases, Albert Einstein College of Medicine, Bronx, NY 10461
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The Bcl-2 family consists exclusively of proteins that either promote or inhibit apoptosis (8). Three of the anti-apoptotic family members have been observed in myeloid leukocytes: A1 and Mcl-1 occur in neutrophils (9, 10, 11, 12, 13), while A1 and Bcl-xL can both be up-regulated in macrophages by proinflammatory stimuli in vitro (14, 15). Hamasaki et al. (16) have shown that A1 deficiency accelerates spontaneous neutrophil apoptosis and abolishes the anti-apoptotic effects of either LPS treatment in vitro or elicitation in vivo with proteose peptone. We have shown that A1 is strongly expressed in inflammatory neutrophils and macrophages in Toxoplasma gondii-infected mice (12). Therefore, we have focused our efforts on determining the role of this protein in inflammation. It has recently been demonstrated that mice contain at least three genes encoding isoforms of A1 that are 97% identical in amino acid sequence (13). Only one of these isoforms, A1-a, has been used in previous functional studies. In the current study, we show that A1-a is regulated more tightly than the other isoforms, such that its mRNA expression level in inflammatory macrophages is several orders of magnitude greater than that in normal macrophages. Furthermore, gene targeting of this isoform results in attenuation of inflammation and prolonged survival in T. gondii-infected mice.
| Materials and Methods |
|---|
|
|
|---|
Female BALB/c mice (68 wk) were obtained from The Jackson
Laboratory (Bar Harbor, ME). To generate A1-a gene-targeted mice, an
A1-a genomic clone was isolated from a 129 Ola phage library (a kind
gift from Dr. W. Edelmann, Albert Einstein College of Medicine, Bronx,
NY). A 6.5-kb EcoRI fragment, containing 5' flanking
sequence and terminating in exon 1, was subcloned and inserted in the
EcoRI site of pPNT (17), with transcriptional
orientation opposed to that of the neoR
gene. This construct was digested with BbrPI, which
cuts at -387 in the 5' flank, partially digested with EcoRI
to selectively cleave the site in exon 1, blunted and ligated to
generate pA15pr. A 4.9-kb EcoRI fragment, containing the
intron and exon 2, was subcloned from the A1-a phage. A 2.7-kb
NsiI-PstI fragment from this subclone was
inserted in the Sse8387I site of pA15pr. The resulting construct was
linearized with NotI and electroporated into the embryonic
stem cell line WW6 (18). Hemizygous
G418R clones were identified by Southern blot
detection of the novel NcoI band described in Results
and Discussion and injected into C57BL/6 blastocysts by the Albert
Einstein College of Medicine Transgenic and Gene Targeting Core
Facility (Bronx, NY). The resulting chimeras were mated with C57BL/6
mice. The embryonic stem cell-derived progeny of a single mating were
characterized as hemizygous or wild-type by PCR detection of the
neoR gene. These hemizygous and wild-type
mice were self-mated to generate homozygous
A1-a+/+ and A1-a-/-
stocks, respectively. Homozygosity was confirmed by Southern blot and
A1-a-specific PCR as described in Results and Discussion.
The genetic background of the resulting strains is
60% C57BL/6,
38% 129/Sv, and 2% SJL.
Preparation of inflammatory exudates
The RH strain (Sabin) of T. gondii was maintained on human fibroblasts as described previously (19). Supernatants containing 107 tachyzoites/ml were diluted in calcium- and magnesium-free PBS. A volume of 0.4 ml containing 12 x 103 tachyzoites was injected i.p. For initiation of TG peritonitis, BALB/c mice were injected i.p. with 1.0 ml of sterile 3% TG broth (Difco, Detroit, MI) aged several months. Mice were sacrificed by cervical dislocation and the peritoneal cavity washed with 4 ml of ice-cold PBS containing 0.2% BSA (Sigma Aldrich, St. Louis, MO). Cellularity and extracellular tachyzoites were assessed with a hemacytometer. A portion of each sample was cytocentrifuged (700 rpm, 5 min). Slides were either air-dried, fixed in methanol and stained with Diff-Quik (Dade, Miami, FL) for differential counting and assessment of intracellular parasitization, or fixed in cold paraformaldehyde (4% in PBS) for 20 min, washed several times with PBS, and stored in PBS at 5°C. The remainder of the sample was centrifuged (at 150 x g for 10 min), lysed with TRIzol (Roche Molecular Biochemicals, Indianapolis, IN), and RNA extracted according to the manufacturers protocol.
Macrophage cell culture
Marrow expressed from femurs was spun over Histopaque, 1.077
g/ml (Sigma Aldrich), at 400 x g for 20 min. The
interface was washed and cultured for 24 h at 2 x
106 cells/ml in growth medium consisting of
MEM (Life
Technologies, Gaithersburg, MD) containing 20% heat-inactivated FCS
(HyClone Laboratories, Logan, UT), 1000 U/ml M-CSF (a gift from Chiron,
Emeryville, CA; Ref. 20), and 0.1 µM Na selenite.
Nonadherent cells were collected, diluted 3-fold, and cultured in
tissue-culture dishes (BD Biosciences, Bedford, MA). M-CSF (1000 U/ml)
was added on days 4 and 5. On day 6, adherent cells were washed,
removed with Dispase (Roche Molecular Biochemicals), diluted 5-fold in
growth medium, washed and resuspended in growth medium at 3 x
105 cells/ml, and cultured overnight. Some cultures were
treated with bacterial recombinant murine GM-CSF (21) at
10 ng/ml for 7 h and harvested with TRIzol.
RNA analysis
Total A1 expression was assessed either by Northern blot or ribonuclease protection assay (RPA). As previously described (12), Northern blots were sequentially probed with an A1-a cDNA clone and a 28S rRNA oligonucleotide, followed by PhosphorImager analysis (Molecular Dynamics, Sunnyvale, CA). For RPA, RNA (10 µg) was hybridized overnight at 56°C to the mAPO-2 Riboquant probe set (BD PharMingen, San Diego, CA) labeled with [32P]UTP and analyzed on a 5% polyacrylamide gel according to the manufacturers protocol. Bands were analyzed by PhosphorImager, using GAPDH for normalization. For RT-PCR analysis, cDNA was generated from RNA samples (1 µg) using the Superscript preamplification system (Life Technologies) with an oligo(dT) primer. PCR was performed on 10% of the cDNA product using the primers described by Hatekayama et al. (Ref. 13 ; forward primer = AATTCCAACAGCCTCCAGATATG; reverse primer = GAAACAAAATATCTGCAACTCTGG), Taq polymerase (Life Technologies), and 1.5 mM MgCl2. Primers (200 nM) were added after the reaction mix was brought to 85°C. A total of 35 cycles were performed using an annealing temperature of 55°C. To analyze the isoform content of the PCR product, as previously described (13), the reaction was then digested with a combination of NsiI and BglII (Roche Molecular Biochemicals) using the manufacturers Buffer H. The relative proportions of the specific bands representing A1-a, A1-b, and A1-d were quantitated in agarose gels stained with Sybr Gold (Molecular Probes, Eugene, OR) using a fluorimager (Molecular Dynamics). Similar digestions of RT-PCR products from COS cells transfected with amplifiable constructs expressing either A1-a, A1-b, or A1-d cDNAs were used to verify that digestion went to completion under these conditions (data not shown). To compare the expression of each isoform between samples, each normalized Northern blot or RPA signal was multiplied by the relative fraction for each isoform as determined by the intensities of the RT-PCR bands after digestion, according to the formula: (A1-x isoform expression) = (normalized A1 PhosphorImager signal x A1-x fluorimager signal)/(sum of fluorimager signals for A1-a, A1-b, and A1-d).
Assessment of cell death
Paraformaldehyde-fixed cytospin preparations were stained by fluorescein-labeled TUNEL (Roche Molecular Biochemicals), using the manufacturers protocol. Slides were counterstained with propidium iodide (50 µg/ml) for 5 min to permit distinction of granulocytes by nuclear morphology. Slides were counted blind (500 cells), and fields were systematically chosen for microscopic viewing by Nomarski optics before epifluorescent illumination. To assess the infection rate in apoptotic macrophage-like cells, TUNEL-positive cells were first identified under green fluorescence and then examined for organisms under red fluorescence.
| Results and Discussion |
|---|
|
|
|---|
To assess the relative potential contributions of three A1
isoforms (A1-a, A1-b, and A1-d) to the inflammatory response, we
measured the mRNA levels of these isoforms in inflammatory exudates
from T. gondii-infected mice in comparison with resident
peritoneal cells from uninfected mice. As previously described
(12), total A1 mRNA was elevated in infected mice compared
with either control or TG-treated animals (Fig. 1
A). Analysis of the same
samples by RT-PCR revealed a preferential relative enhancement of A1-a
expression in infected mice, but not in TG-induced inflammation (Fig. 1
B). The RT-PCR and Northern signals were combined as
described in Materials and Methods to compare isoform
expression among samples (Fig. 1
C). Basal expression of A1-b
and A1-d was evident in resident peritoneal cells from untreated mice,
whereas A1-a expression was near the limit of detection (<0.5% of
total A1 mRNA). In contrast, A1-a expression in T.
gondii-elicited exudate cells was comparable to that of the other
two isoforms, increasing to 24% of total A1 mRNA. Thus, while A1-b and
A1-d levels increased 3- and 11-fold, respectively, A1-a mRNA increased
300-fold. Corresponding induction of A1-a protein in T.
gondii-elicited macrophages was previously demonstrated using an
A1-a-specific Ab (12). Similarly, A1-a is weakly expressed
in untreated bone marrow-derived macrophages, but is preferentially
increased by treatment with LPS (not shown).
Thus, A1-a is tightly regulated in normal
macrophages, but is dramatically induced by certain proinflammatory
stimuli.
|
The progeny from a single chimera were intercrossed to generate
A1-a-/- and A1-a+/+
homozygous lines. Southern blot analysis indicated the specific
alteration of a single A1 gene (Fig. 2
B), and PCR analysis
confirmed that the affected gene was A1-a (Fig. 2
C). The
A1-a-/- mice had normal viability and did not
display any abnormality by gross or histopathology. A previously
reported targeting of the A1-a gene by Hamasaki et al.
(16) resulted in a severe repression (>10-fold) of the
expression of A1-b and A1-d in addition to the A1-a deficiency. These
authors replaced
1.8 kb of the A1-a 5' flank, whereas we replaced
only 386 bp. To determine whether our knockout strain was selectively
deficient in A1-a, we performed a combined RPA + RT-PCR analysis on RNA
derived from normal and GM-CSF-stimulated bone marrow-derived
macrophages from A1-a-/- and
A1-a+/+ mice. As shown in Fig. 3
, A1-b and A1-d expression were
unaffected in the knockout mice, whereas A1-a expression was completely
eliminated.
|
|
Attenuation of toxoplasmic peritonitis in A1-a-deficient mice
i.p. infection with tachyzoites of the virulent RH strain of
T. gondii induces a vigorous acute peritoneal leukocytosis
concomitant with a progressive systemic infection culminating in death
of the host at
1 wk postinfection (p.i.). At a dose of 2000
tachyzoites, the peritoneal inflammation manifests as a mild
neutrophilia for
2 days followed by a rapid influx of neutrophils
and macrophages leading to increased cellularity by 4 days p.i.
(12). When the course of inflammation was compared in
A1-a+/+ and A1-a-/- mice,
we found that while a 2-fold increase in peritoneal cellularity was
observed as expected in the wild-type strain, no such increase occurred
in A1-a-deficient mice (Fig. 4
A). Nevertheless, the two
strains were equivalent with respect to the shift in cellular
composition accompanying inflammation, as evidenced by the similarity
in the proportion of granulocytes present at all time points (Fig. 4
B). Therefore, the effect of the removal of A1-a was to
dampen rather than to retard or prevent the inflammatory response. A
more detailed time-course confirmed that this dampening did not reflect
any deficit in cellularity before the onset of massive leukocytic
infiltration at 4 days p.i. (Fig. 4
C). A decline in
cellularity occurred before day 4 in both strains; this finding is
similar to early-stage observations in other models of peritoneal
inflammation (22, 23).
|
A second difference observed between the two strains was that the
A1-a-/- mice survived a day longer
(p < 0.05 by log-rank test; Fig. 5
). This effect was reproducible and
suggests that mortality is to some extent related to the progression of
inflammation. This notion is consistent with a report identifying
pneumonia as the principal cause of death in RH-infected animals
(24). Our findings are also reminiscent of a recent
study in which mice deficient in CCR1 were orally infected with RH. In
this case, the mutant animals showed both a transitory decline in
tissue neutrophil levels and a 1- to 2-day delay in the onset of death
relative to controls (25).
|
Several recent studies have linked intracellular protozoa with the
modulation of apoptosis in host cells. One group has reported induction
of apoptosis by RH in cultured peritoneal macrophages
(26), while others have observed that apoptosis was
prevented by RH infection of HL-60 cells (27) or lymphoid
cells (28), as well as by Leishmania major
infection of macrophages (29). Protection of HL-60 cells
was especially pronounced in cells that harbored parasites
(27). We asked whether such a mechanism might operate in
vivo and might be A1-a dependent, thus providing a potential
explanation for the dampened inflammation in our mutant mice. We
examined exudate cells that had been stained for TUNEL reactivity and
counterstained with propidium iodide to distinguish mononuclear and
granulocytic cells by nuclear morphology as well as to determine
parasite content. Total mononuclear cell apoptosis increased
progressively in infected mice (Fig. 6
A), although in a sporadic
fashion that made it difficult to detect a genotype-dependent effect.
To assess the association of apoptosis with intracellular
parasitization, we focused on "macrophage-like" cells (mononuclear
cells with extensive cytoplasm) in which parasitization could be
readily determined. As shown in Table I
,
although most macrophages were infected at 56 days p.i., <20% of
apoptotic macrophage-like cells harbored parasites. The number of
parasites per infected cell was also substantially less in the
apoptotic population (data not shown). Furthermore, the protective
effect of intracellular infection was equivalent in wild-type and
A1-a-deficient mice. An example of infected TUNEL-negative and
uninfected TUNEL-positive macrophage-like cells is shown in Fig. 6
B. These results argue strongly for a pathogen-mediated
anti-apoptotic mechanism (that is demonstrated in vivo for the
first time in this study), and indicate that this mechanism is
A1-a-independent.
|
|
Finally, it is possible that reduced inflammation is the consequence of
accelerated apoptosis in uninfected "bystander" infiltrating
leukocytes, or alternatively in myeloid precursors during reactive
hematopoiesis. We have not obtained data that conclusively address this
question; however, we observed the sporadic occurrence of greatly
elevated frequencies of TUNEL-positive granulocytes in
A1-a-/--infected mice (Fig. 6
D),
consistent with such a model. Alternatively, the critical effect of
A1-a may reside in very early infiltrating or even resident peritoneal
cells. We have found that at least for cultured resident peritoneal
macrophages, RH infection does not elicit A1-a-sensitive apoptosis, and
in fact, results in A1-a-independent protection from spontaneous
apoptosis in bystander cells (data not shown). Future experiments will
address these various models.
It is still unclear why mice have three potentially functional forms of A1, while humans have one. It is possible that the three isoforms are functionally redundant, and that the phenotype we observe reflects a simple quantitative change in total A1 expression. Hamesaki et al. (16), using what was in effect a "total A1"-deficient strain, found that even heterozygote neutrophils were deficient in inflammation-mediated protection from spontaneous apoptosis, indicating that a 50% reduction in total A1 could produce an observable defect. A1-a mRNA was reported to represent about one-third of total neutrophil A1 mRNA (13), and the proportion is conceivably greater in the neutrophils generated in our system. Therefore, a total absence of A1-a may be quantitatively similar to a 50% loss of total A1. In contrast, the dramatic pathogen-elicited increase in the A1-a/total A1 ratio that we have observed both in this study and with mycobacterial infection (30) suggests a specific function for this isoform. Ultimately, isoform-specific gain-of-function or loss-of-function mutations will be necessary to resolve this issue.
The findings reported here represent the first demonstration that a genetic modification specifically targeted to the regulation of apoptosis can alter the acute inflammatory response to a pathogen. The implication of this result is that, at least for some period of the inflammatory response, the rate at which cells enter apoptosis is a critical limiting factor for the intensity of the response. It follows that appropriate regulation of this rate represents a crucial decision by the host, which must balance defense against the negative impact of inflammation. That negative impact is manifested here as reduced time-to-death, but in many clinically relevant settings is likely to involve autoimmunity or tissue damage. A key unresolved question is under what circumstances, if any, the host makes this decision incorrectly, and how can the outcome be corrected by intervention in such cases. The fact that the decision is made differently in different settings is indicated by the fact that the survival rate of peritoneal neutrophils can be either greater or less than that of circulating cells depending on the inflammatory stimulus used (2, 3). Our results suggest that the regulation of A1 expression may be an essential feature in the formation of host defense strategy during acute responses.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to: Dr. Amos Orlofsky, Department of Pathology, F717N, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461. E-mail address: orlofsky{at}aecom.yu.edu ![]()
3 Abbreviations used in this paper: TG, thioglycollate; RPA, ribonuclease protection assay; p.i., postinfection. ![]()
Received for publication May 1, 2001. Accepted for publication December 5, 2001.
| References |
|---|
|
|
|---|
2 integrin CD11b/CD18 in neutrophil apoptosis: a homeostatic mechanism in inflammation. Immunity 5:653.[Medline]
or cycloheximide. J. Immunol. 154:2403.[Abstract]
-D-galactosidase activity after transduction of Escherichia coli lacZ. Proc. Natl. Acad. Sci. USA 85:2603.
T cells prevents apoptosis of macrophages and contributes to host defense in mice infected with Toxoplasma gondii. J. Immunol. 159:2375.This article has been cited by other articles:
![]() |
T. Tomita, T. Yamada, L. M. Weiss, and A. Orlofsky Externally Triggered Egress Is the Major Fate of Toxoplasma gondii during Acute Infection J. Immunol., November 15, 2009; 183(10): 6667 - 6680. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Madsen-Bouterse, G. J. M. Rosa, and J. L. Burton Glucocorticoid Modulation of Bcl-2 Family Members A1 and Bak during Delayed Spontaneous Apoptosis of Bovine Blood Neutrophils Endocrinology, August 1, 2006; 147(8): 3826 - 3834. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Sandler, M. M. Mentink-Kane, A. W. Cheever, and T. A. Wynn Global Gene Expression Profiles During Acute Pathogen-Induced Pulmonary Inflammation Reveal Divergent Roles for Th1 and Th2 Responses in Tissue Repair J. Immunol., October 1, 2003; 171(7): 3655 - 3667. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Reed, K. Doctor, A. Rojas, J. M. Zapata, C. Stehlik, L. Fiorentino, J. Damiano, W. Roth, S.-i. Matsuzawa, R. Newman, et al. Comparative Analysis of Apoptosis and Inflammation Genes of Mice and Humans Genome Res., June 1, 2003; 13(6): 1376 - 1388. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |