| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Biochemistry, Center for Molecular Microbiology and Infection, Imperial College, South Kensington, London, United Kingdom;
Division of Infection, Inflammation, and Repair, University of Southampton School of Medicine, Southampton, United Kingdom; and
Department of Adult and Pediatric Gastroenterology, St. Bartholomew’s and Royal London School of Medicine and Dentistry, London, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and displays mucosal pathology compared with
uninfected controls. In this study, the role of IL-12 and IFN- in
host defense and mucosal injury during C. rodentium
infection was examined using gene knockout mice.
IL-12p40-/- and IFN--/- mice were
significantly more susceptible to mucosal and gut-derived systemic
C. rodentium infection. In particular, a proportion of
IL-12p40-/- mice died during infection. Analysis of the
gut mucosa of IL-12p40-/- mice revealed an influx of
CD4+ T cells and a local IFN- response. Infected
IL-12p40-/- and IFN--/- mice also
mounted anti-Citrobacter serum and gut-associated
IgA responses and strongly expressed inducible NO synthase (iNOS) in
mucosal tissue, despite diminished serum nitrite/nitrate levels.
However, iNOS does not detectably contribute to host defense against
C. rodentium, as iNOS-/- mice were not
more susceptible to infection. However, C57BL/6 mice infected with
C. rodentium up-regulated expression of the mouse
-defensin (mBD)-1 and mBD-3 in colonic tissue. In contrast,
expression of mBD-3, but not mBD-1, was significantly attenuated during
infection of IL-12- and IFN--deficient mice, suggesting mBD-3 may
contribute to host defense. These studies are among the first to
examine mechanisms of host resistance to an attaching-effacing pathogen
and show an important role for IL-12 and IFN- in limiting bacterial
infection of the colonic epithelium. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In contrast to the detailed information describing the molecular basis for EPEC and EHEC adherence to epithelial cells (2), very little is known about how the host resolves infections caused by these agents. The absence of small animal models to study these human-specific agents directly has made these studies problematic. For this reason, infection of mice with C. rodentium has been used as a surrogate model to study host responses to pathogens dependent upon A/E lesion formation for colonization of the host (8). Importantly, C. rodentium possesses both established and putative virulence determinants common to human-specific strains of EPEC and EHEC, including a large pathogenicity island (9) and an immunomodulating toxin (10). Furthermore, the A/E lesion induced by C. rodentium is ultrastructurally identical to those formed by EHEC and EPEC in animals and humans (7, 11, 12).
In naturally or experimentally infected susceptible mouse strains,
C. rodentium infection is associated with colonic crypt
hyperplasia, goblet cell depletion, and mucosal erosion (13, 14). Oral infection of mice with live C. rodentium or
intracolonic inoculation of dead bacteria induces a large infiltrate of
CD4+ cells into the colonic lamina propria, a
modest increase in epithelial CD8 cells, and a highly polarized Th1
response (8, 15). Transcripts for the type I cytokines
IL-12, TNF-
, and IFN- are highly expressed in colonic tissue of
infected mice (8). The role of these cytokines in host
defense and mucosal pathology is unclear. Thus it is not known whether
the mucosal hyperplasia is part of the protective immune response or is
elicited by the pathogen to change its microenvironment for its own
benefit. Likewise, it is not known whether the Th1 response in the
mucosa is needed for protective immunity, and, even if it is, there is
the mechanistic issue of how a Th1 response in the lamina propria can
direct effective antibacterial immunity to an organism living on the
epithelial surface.
Therefore, the aim of the present study was to examine the role of
IL-12 and IFN- in host defense, the regulation of antibacterial
mechanisms, and mucosal injury in C. rodentium-infected
mice. The results show that IL-12 and IFN- contribute to host
defense in colonic and systemic tissue but that, paradoxically, mucosal
damage is greater in IL-12p40-/- and
IFN--/- mice. Furthermore, they implicate a
role for epithelial antimicrobial peptides of the -defensin family
as components of the host immune response to infection. This study is
the first to implicate a role for IL-12 and IFN- in immunity against
a noninvasive, lumenal bacterial pathogen of the colon.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female or male 6- to 8-wk-old C57BL/6J mice were purchased from
Harlan Olac (Bichester, U.K.) or Bantin & Kingman Universal (Hull,
U.K.). IL-12p40-/-,
IFN--/-, and inducible NO synthase
(iNOS)-/- mice (back-crossed to C57BL/6
background at least 10 times) were originally purchased from The
Jackson Laboratory (Bar Harbor, ME) and were maintained by homozygous
matings under contract at Bantin & Kingman Universal. All mice came
from specific pathogen-free colonies. During experimental studies,
groups of animals were housed in high-efficiency particulate
arresting-filtered individually ventilated cages with free access to
sterilized food and water.
Bacterial strains and oral infection of mice
A nalidixic acid-resistant isolate of C. rodentium
(formerly Citrobacter freundii biotype 4280) was used in
these studies. The nalidixic acid resistant phenotype of this strain
facilitates enumeration of the number of viable C. rodentium
present in colonic tissues of experimentally infected mice.
DBS255(pCVD438) is a C. rodentium eae (intimin) mutant
complemented with the eae gene from EPEC strain E2348/69
(intimin ). This strain, which has been described previously
(16), expresses biologically active intimin and is
virulent in mice. Bacterial inocula were prepared by culturing bacteria
overnight at 37°C in 10 ml of Luria broth containing nalidixic acid
(100 µg/ml) plus chloramphenicol (50 µg/ml). Cultures were
harvested by centrifugation and resuspended in a one-tenth volume of
PBS. Mice were orally inoculated with 200 µl of the bacterial
suspension using a gavage needle. The viable count of the inoculum was
determined by retrospective plating on Luria-Bertani agar containing
appropriate antibiotics. In all experiments, mice received 1–4 x
109 CFU.
Recombinant proteins
EspA was cloned from EPEC strain E2348/69, expressed as His-tagged fusion protein in E. coli and purified by nickel affinity chromatography as previously described (16, 17).
Measurement of pathogen burden
At selected time points postinfection, mice were killed by cardiac exsanguination under terminal anesthesia or by cervical dislocation. The terminal 6 cm of the colon was removed and the colon was weighed after removal of fecal pellets. In some experiments, 1-cm samples of distal colon were removed into 10% buffered formalin or snap-frozen in liquid nitrogen for subsequent immunohistological analysis and cytokine RT-PCR. Spleens and colon were homogenized mechanically using a Seward 80 stomacher (Seward Medical, London, U.K.). The number of viable bacteria in organ homogenates was determined by viable count on Luria-Bertani agar containing naladixic acid and chloramphenicol. The limit of sensitivity was 10 CFU per organ.
Analysis of humoral immune responses
At selected times postimmunization, 0.2 ml of blood was collected from the tail vein. The serum was collected and stored at -20°C until it was analyzed. For analysis of Ag-specific Ab responses, wells of microtiter plates (Maxisorb plates; Nunc, Naperville, IL) were coated overnight at 4°C with 100 µl of a bicarbonate solution (pH 9.6) containing rEspA (2.5 µg/ml). After washing with PBS containing Tween 20 (0.05% v/v), wells were blocked by addition of 1.5% (w/v) BSA in PBS for 1 h. Plates were then washed twice with PBS/Tween 20 before sera from individual mice were added and serially diluted in PBS/Tween 20 containing 0.2% (w/v) BSA and incubated for 2 h at 37°C. For the determination of IgA or IgG Ab titers, wells were washed with PBS/Tween 20 before addition of 100 µl of either an IgG- or IgA-specific HRP conjugate (DAKO, High Wycombe, U.K.) diluted 1/1000 in PBS/Tween 20 containing 0.2% (w/v) BSA for 2 h at 37°C. Finally, after washing with PBS/Tween 20, bound Ab was detected by addition of o-phenylenediamine substrate (Sigma, Poole, U.K.) and the A490 was measured. Titers were determined arbitrarily as the reciprocal of the serum dilution corresponding to an OD of 0.3. The minimum detectable titer was 100.
Determination of total and EspA-specific IgA in fecal samples
Fecal pellets were collected from mice infected with
C. rodentium 21 days previously. Pellets were weighed, then
sterile PBS containing 0.1% sodium azide was added to obtain a
concentration of 100 mg/ml. The pellets were homogenized by continuous
vortexing for 10 min. Particulate debris were removed by centrifugation
(5 min at 14,000 rpm), and supernatants were collected and stored at
-70°C until they were required. Total IgA levels in fecal extracts
were determined by ELISA. Briefly, levels of total IgA were measured by
coating 96-well ELISA plates with 5 µg/ml goat anti-mouse
-chain-specific Abs (Sigma). The plates were blocked with 1.5% BSA
in PBS for 1 h at 37°C. Dilutions of stool supernatants were
added to the wells and incubated overnight at 4°C, washed, and
incubated with -chain-specific biotin-conjugated goat anti-mouse
Ab for 2 h at 37°C (Sigma-Aldrich, St. Louis, MO).
HRP-conjugated streptavidin was used to detect bound Ab. Total IgA in
each sample was determined by comparison with a standard curve
generated using mouse myeloma IgA (ICN Pharmaceuticals, Bristol, U.K.).
Titers of EspA-specific IgA were determined by coating ELISA plates
with 2.5 µg/ml rEspA and using the -chain-specific
biotin-conjugated goat anti-mouse Ab as described in the previous
section. The EspA-specific IgA titers thus obtained were divided by the
total amount of IgA in the sample to correct for variation in the
amount of stool collected.
Detection of cytokine-specific T cell responses by ELISPOT
Cytokine-specific ELISPOT was performed essentially as described
previously (18). Briefly, mesenteric lymph nodes (MLNs)
from uninfected and infected C57BL/6,
IL-12p40-/-, and
IFN--/- mice (n = 4) were
aseptically removed and single cell suspensions were prepared by
passing tissue through 100-µm nylon sieves (Marathon Laboratories,
London, U.K.). Cells were washed once with RPMI 1640 (Sigma) then
resuspended in RPMI 1640 containing 10% FCS (Sigma), 5 x
10-5 M 2-ME, 2 mM
L-glutamine (Sigma), 100 U/ml penicillin (Sigma),
and 100 µg/ml streptomycin (Sigma). Graded numbers of cells were
seeded into wells of nitrocellulose-based 96-well microtiter plates
(Multiscreen-HA; Millipore, Bedford, MA), which had previously been
coated overnight at 4°C with 50 µl/well either anti-IFN- (4
µg/ml, clone R46A2) or anti-IL-4 (4 µg/ml, clone 11B11) mAb
diluted in carbonate buffer (pH 9.6). All Abs were from BD PharMingen
(Cowley, U.K.). Cells were incubated for 20–24 h at 37°C in 5%
CO2. Following incubation, cells were removed by
washing three times for 5 min with PBS, followed by an additional three
times with PBS/Tween 20 (0.05% v/v), then 50 µl of the biotinylated
anti-IFN- (clone XMG1.2) or anti-IL-4 (clone BVD6-24G2) Abs
(1 µg/ml in filtered PBS/Tween 20) was added to each well for 2
h. After washing plates five times with filtered PBS/Tween 20, a 1/1000
dilution of extravidin-alkaline phosphatase (Sigma) was added to all
wells for 1–2 h at room temperature. Finally, after washing three
times with PBS/Tween 20 and once with PBS alone, a solution of
5-bromo-4 chloro-3-indolyl phosphate/nitroblue tetrazolium (Fast
BCIP/NBT; Sigma) was added as substrate. Spots representing single
IFN-- or IL-4-producing cells were counted using a dissecting
microscope.
RNA extraction and quantitative RT-PCR
All molecular biology grade reagents were purchased from Life Technologies (Paisley, U.K.) or Promega (Southampton, U.K.). Total cellular RNA was isolated from frozen colonic tissue by homogenization of the tissue in TRIzol followed by CHCL3 extraction and isopropanol precipitation. Total RNA was measured by spectrophotometric analysis. Constructs encoding standard RNAs (pCMQ1, pCMQ2, pCMQ3, and pCMQ4), kindly provided by M. F. Kagnoff (Department of Medicine, University of California, San Diego, CA), were used for quantitative competitive RT-PCR. To generate standard RNA, plasmids were linearized with SalI (pCMQ1) and NotI (pCMQ2, -3, and -4) and transcribed in vitro with T7 RNA polymerase under conditions recommended by the supplier (Promega). Serial 10-fold dilutions of standard RNA (1 pg to 1 fg) were co-reverse transcribed with total cellular RNA (1 µg) at 42°C for 50 min in a 20-µl reaction volume containing 50 mM Tris (pH 8.3), 75 mM KCl, 3 mM MgCl2, 3 mM DTT, 10 mM dNTP mix, and 0.5 µg of oligo(dT) (Pharmacia Biotech, St. Albans, Hertfordshire, U.K.), using 100 U of reverse transcriptase (Superscript II; RNase H-negative). PCR amplification was routinely conducted in a 50-µl reaction volume (10 mM Tris (pH 9), 50 mM KCl, 1.5 mM MgCl2, 200 µM each dNTP, and 20 pmol specific 5' and 3' primers), using 1 U of Taq polymerase (Pharmacia Biotech). The temperature profile of the amplification consisted of 35 cycles of 45 s denaturation at 94°C, 75 s annealing at 58°C, and 75 s extension at 72°C. PCR products were then separated on a 1% agarose gel and bands intensities were quantified by densitometry (Seescan, Cambridge, U.K.). The above protocol allows quantitation to 103 cytokine mRNA transcripts per microgram of total RNA.
Measurement of mBD mRNA expression by semiquantitative RT-PCR
The mRNA expression of constitutive mouse -defensin
(mBD)-1 and inducible (mBD-3) -defensins was measured by
semiquantitative RT-PCR. The primers used in the study were as follows:
mBD-1 sense
(5'-30ggctgccaccactatgaaaactc57-3')
and antisense
(5'-177gagacagaatcctccatgttgaa151),
and mBD-3 sense
(5'-54gcatttgaggaaaggaactccacaac77-3')
and antisense
(5'-186gtctccacctgcagcttttagcaa161-3').
PCR conditions were optimized and the mRNA expression was measured
during the linear phase of the reaction. The PCR amplification cycle
was as follows: 90 s at 94°C, 90 s at 58°C, and 90 s
at 72°C for 35 cycles. The PCR products were fractionated on a 2.5%
agarose and their intensity was measured by densitometry as described
above. The PCR product sizes were 147 bp (mBD-1) and 132 bp (mBD-3).
The results are presented as a ratio of defensin intensity over GAPDH
(housekeeping gene) intensity.
Immunohistochemistry and measurement of crypt lengths
Three-step avidin-peroxidase staining was performed on 5-µm frozen sections as described previously (8) using mAbs 145-2C11 (anti-CD3), YTS191 (anti-CD4), and YTS169 (anti-CD8). The anti-iNOS Ab was an affinity-purified rabbit IgG polyclonal (Santa Cruz Biotechnology, Santa Cruz, CA). Biotin-conjugated rabbit anti-rat IgG, goat anti-rabbit (DAKO), or goat anti-hamster IgG (Vector Laboratories, Peterborough, U.K.) were used at 1/50 dilution in TBS (pH 7.6) containing 4% (v/v) normal mouse serum (Harlan Seralab, Oxon, U.K.). Avidin-peroxidase (Sigma) was used at a dilution of 1/200 in TBS. A two-step protocol was performed with rabbit anti-intimin Ab (8) together with HRP-conjugated swine anti-rabbit IgG secondary Ab. Peroxidase activity was detected with 3,3'-diaminobenzidine tetrahydrochloride (Sigma) in 0.5 mg/ml Tris-HCl (pH 7.6), containing 0.01% H2O2 (Sigma). The density of positive cells in the lamina propria was determined by image analysis. Crypt length was measured by micrometry on H&E-stained sections, with 10 measurements being taken in the distal colons of individual mice. Only well-orientated crypts were counted.
Measurement of nitrate/nitrite levels in sera
Serum NO2-NO3- levels were measured in individual mice using a nitrate/nitrite colorimetric assay in accordance with the manufacturer’s instructions (R&D Systems, Abingdon, U.K.). As recommended, sera were passed through a 10-kDa molecular mass filter (Microcon 10; Millipore, Bedford MA) before use in the assay.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
are more
susceptible to oral C. rodentium infection
Mice infected with C. rodentium develop colitis and
mount a highly polarized gut Th1 response (8). A component
of the response in colonic tissue of infected mice includes increased
transcripts for IL-12, IFN-, IL-1, and TNF- (8). To
determine whether the elevated transcripts for IL-12 and IFN-
contribute to host defense, mice with targeted mutations in the
IL-12p40 subunit or IFN- gene were orally infected with C.
rodentium strain DBS255(pCVD438). At various times postinfection,
mice were killed and tissue was homogenized for determination
of pathogen burden. Infected IL-12p40-/- and
IFN--/- mice had significantly higher
numbers of C. rodentium in the colon on days 7, 14, and 21,
and in the spleen on day 14 compared with C57BL/6 mice (Fig. 1
, A and B). In
addition, there were significantly more C. rodentium shed in
the stool of IL-12p40-/- mice (data not shown).
Like C57BL/6 mice, all IFN--/- mice resolved
the infection, although the time to clearance was delayed (Fig. 1A). In contrast, in three separate experiments, 10–15% of
IL-12p40-/- mice succumbed to infection between
days 14 and 21. On the few occasions when tissue from moribund
IL-12p40-/- mice could be collected,
substantial numbers (>104 CFU/organ) of C.
rodentium were recovered from the spleen and liver (data not
shown), suggesting mortality was associated with systemic bacteremia.
IL-12p40-/- mice that did not die between days
14 and 21 cleared the infection by day 35, 2 wk later than C57BL/6
control animals and marginally later than
IFN--/- mice (Fig. 1A).
|
-/- mice showed
that most of the adherent bacteria were restricted to the mucosal
surface epithelium (Fig. 2, A
and B). Specific immunostaining for C. rodentium
in IL-12p40-/- (Fig. 2C) mice
revealed adherent bacteria similarly on the mucosal surface, but
organisms were occasionally seen penetrating deeper into the
crypts.
|
-/- mice
Coincident with the increased pathogen burden in
IL-12p40-/- and
IFN--/- mice was the development of more
dramatic pathological changes in the distal colon. Infected
IL-12p40-/- and
IFN--/- mice had more crypt hyperplasia than
C57BL/6 mice 14 days after infection, although the effect was much
greater in the IL-12-/- mice than the
IFN--/- mice (Fig. 3). In
IL-12p40-/- mice in particular, there were
focal crypt abscesses and mucosal erosion. It was noticeable at early
time points that whereas the enhanced hyperplasia in
IFN--/- mice was quite uniform throughout
the colon, there was considerable heterogeneity in the
IL-12p40-/- mice. Some regions of the mucosa
were markedly hyperplastic and there was epithelial shedding; however,
in others the mucosa was only slightly thickened. In addition, compared
with uninfected mice, there was some loss of goblet cells in infected
wild-type animals. However, in infected
IFN--/- mice or
IL-12-/- mice, loss of goblet cells was much
more dramatic (data not shown). The magnitude of mucosal
thickening in infected mice was determined by measurement of crypt
length. Compared with infected C57BL/6 mice, crypt lengths were
significantly increased in IL-12p40-/- and
IFN--/- mice (Fig. 4A). Colons of
IL-12p40-/- and
IFN--/- mice also weighed significantly more
per unit length than those from C57BL/6 mice 14 and 28 days
postinfection (data not shown). The colonic lamina propria of infected
wild-type mice contained significantly more CD4 T cells than uninfected
mice (Fig. 4B). Although there was a modest statistically
insignificant increase in CD4 cells in the lamina propria of
IFN--/- mice, in infected
IL-12p40-/- mice there were significantly more
CD4+ T cells in the lamina propria than in
infected IFN--/- or C57BL/6 mice (Fig. 4B).
|
|
-/- mice (data not shown).
IFN- expression in mucosal and lymphoid tissues of
IL-12p40-/- mice infected with C.
rodentium
IL-12 and IFN- are, indirectly and directly, important
activators of antimicrobial mechanisms in phagocytes. Therefore, a
basis for the susceptibility of IL-12p40-/- and
IFN--/- mice to C. rodentium
infection may be an inability to optimally activate antimicrobial
mechanisms in phagocytes that neighbor colonic epithelial cells
due to either attenuated (IL-12p40-/-) or
absent (IFN--/-) IFN- expression. To
determine whether IFN- expression was indeed reduced in infected
IL-12p40-/- mice, IFN- transcripts in
colonic tissue were measured in infected C57BL/6 and
IL-12p40-/- mice by RT-PCR. IFN- transcripts
were increased in colonic tissue of infected wild-type and
IL-12p40-/- mice compared with uninfected
C57BL/6 mice (Fig. 5A). TNF
transcripts were also significantly more abundant in colonic tissue of
infected wild-type, IL-12p40-/-, and
IFN--/- mice than in infected C57BL/6 mice
(Fig. 5B). In addition, there were significantly more TNF
transcripts in the colon of infected IL-12-/-
mice than in infected C57BL/6 mice. IL-4 transcripts were very low and
similar in colonic tissues of all infected mouse strains (data not
shown). The number of IFN--secreting cells were also measured in
the MLNs of uninfected and infected mice by direct ex vivo
ELISPOT. First, there was no difference in the mean number of
IFN- spot-forming cells (SFCs) detected in uninfected
IL-12p40-/- mice (22 ± 11) vs uninfected
C57BL/6 mice (21 ± 10). However, the mean number of IFN- SFCs
in the MLNs of infected IL-12p40-/- mice
(29 ± 20) was significantly lower (p <
0.05) than in the lymph nodes of infected C57BL/6 mice (82 ± 30).
There were no significant differences in the number of IL-4 SFCs
detected in lymph nodes of the two mouse strains (data not shown).
Although IFN- responses were measured by two different methods,
these data may suggest that an IFN- response can occur in the
absence of IL-12 in infected colonic mucosa, but in lymph nodes
draining the site of infection the IFN- response is more IL-12
dependent.
|
To determine whether systemic or intestinal Ab responses to
C. rodentium were attenuated in the absence of IL-12 or
IFN-, Ig responses were measured against a whole-cell lysate of
C. rodentium and rEspA, an immunogenic and important
virulence determinant in attaching-effacing pathogens
(19). EspA-specific serum IgG responses in infected
IL-12p40-/- and
IFN--/- mice were as robust as those in
infected C57BL/6 mice (Fig. 6A). Indeed, EspA-specific
responses in IL-12p40-/- mice were greater than
in IFN--/- and C57BL/6 mice. An almost
identical IgG response pattern was observed when a whole-cell lysate of
C. rodentium was used as Ag (data not shown).
|
is a central regulator of polymeric IgR expression in
intestinal epithelial cells (20). The polymeric IgR
mediates the transport of polymeric Ig, predominantly dimeric IgA, from
the basolateral to the apical surface of mucosal epithelia. Total and
EspA-specific IgA in fecal extracts from infected
IL-12p40-/- and
IFN--/- mice were, however, not
significantly different from those of C57BL/6 mice (Fig. 6
B). Collectively, these data suggest that the basis for the
enhanced susceptibility of IL-12p40-/- and
IFN--/- mice does not lie in defective
systemic or gut-associated IgA responses.
Expression of -defensins in colonic tissue of C.
rodentium-infected mice
-defensins are a family of small cationic antimicrobial
peptides, which appear to be widely expressed throughout the gut.
Previous studies have suggested that the expression of some
-defensins are up-regulated by proinflammatory cytokines
(21). The expression of two -defensins, mBD-1 and
mBD-3, was therefore monitored in colonic tissue to determine whether
-defensins were induced during C. rodentium infection of
C57BL/6 mice and whether their expression was affected in mice
deficient in IL-12 or IFN-. By RT-PCR, transcripts encoding mBD-1,
and to a much lesser extent mBD-3, were detected in colonic tissue of
uninfected C57BL/6, IL-12p40-/-, and
IFN--/- mice (Fig. 7, A and B). In
mice orally infected with C. rodentium, transcripts encoding
mBD-1 were increased compared with the relevant uninfected mice on day
7. For wild-type and IL-12-/- mice mBD-1
transcripts were still elevated on day 14 (Fig. 7A). In
C57BL/6 mice, transcripts encoding mBD-3 were also highly induced by
infection. However, expression of mBD-3 in
IL-12p40-/- and
IFN--/- mice was not induced to the same
degree as occurred in C57BL/6 mice, particularly 14 days postinfection
(Fig. 7B). Indeed, whereas mBD-3 transcripts increased in
C57BL/6 mice between days 7 and 14, in
IL-12p40-/- and
IFN--/- mice transcripts actually fell (Fig. 7B). This occurred despite
IL-12p40-/- and
IFN--/- mice having a greater pathogen
burden at this time point. Upon clearance of C. rodentium
from tissues of C57BL/6 mice, the expression of mBD-3 returned to
preinfection levels (data not shown). These data show that mBD-3
expression is attenuated in infected IL-12- and IFN--deficient mice.
Potentially, the attenuated expression of mBD-3 in the colons of these
animals might contribute to their enhanced susceptibility to C.
rodentium infection.
|
-deficient mice
Type 2 iNOS contributes to antimicrobial effector functions in
host cells by producing NO, which reacts with oxygen radicals to yield
reactive nitrogen intermediates with antimicrobial activity. The stable
end products of reactive nitrogen intermediates, nitrate
(NO3-) and nitrite
(NO2-), can be detected in ex
vivo biological fluids of mice, thereby providing a convenient means to
monitor iNOS activity. C57BL/6 mice infected with C.
rodentium had elevated levels of
NO2-NO3-
in sera as early as day 7 postinfection, and these remained elevated
until day 35 (Fig. 8). Compared with
levels in C57BL/6 mice,
NO2-NO3-
levels in sera of infected IL-12-deficient mice were significantly
lower on days 7, 21, and 33 (Fig. 8).
NO2-NO3-
levels in sera of infected IFN--/- mice were
also significantly lower on day 7 postinfection compared with C57BL/6
mice (Fig. 8). These data suggested iNOS activity was attenuated in
IL-12- and IFN--deficient mice infected with C.
rodentium, despite the presence of a greater pathogen load in
these animals. However, immunohistochemistry showed that epithelial
iNOS was not seen in uninfected mice but was strongly expressed in
epithelial cells of all infected wild-type,
IL-12-/-, and
IFN--/- mice (data not shown).
|
). Furthermore, there were no
apparent differences in the extent or type of pathology that occurred
in colonic tissues of infected mice (data not shown). These data imply
that although iNOS is expressed at sites of C. rodentium
infection, its absence in an iNOS-/- mouse does
not discernibly alter host resistance to C. rodentium.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in immunity to C.
rodentium and explores some of the antimicrobial mechanisms
through which host resistance may be expressed. IL-12-deficient mice
were more susceptible to C. rodentium infection than either
IFN--deficient mice or C57BL/6 mice. The enhanced susceptibility of
IL-12p40-/- and
IFN--/- mice does not appear to be due to an
inability to express TNF in colonic tissue, mount anti-C.
rodentium Ab responses, or express iNOS at sites of infection.
Rather, the enhanced susceptibility of IL-12- and IFN--deficient
mice might, in part, be due to attenuated expression of the inducible
-defensin mBD-3. In microbiological and immunological terms, the C. rodentium mouse model is unique. C. rodentium and some species of Helicobacter are examples of bacterial pathogens that are capable of establishing relatively persistent, noninvasive infections in the murine gastrointestinal tract. However, C. rodentium is distinguished from Helicobacter sp. by its ability to colonize the host in the competitive microenvironment of the colon. In addition, the induction of A/E lesions on gastrointestinal mucosal epithelial cells by pathogens like C. rodentium (along with EPEC and EHEC) represents a highly specialized pathogen-host interaction. This may require from the host a specific subset of immune effectors to achieve bacterial clearance from the apical surface of the epithelial cell.
IL-12 is a potent immunoregulatory cytokine that is crucially involved
in a wide range of infectious diseases. In several experimental models
of bacterial, parasitic, viral, and fungal infection, endogenous IL-12
is required for early control of infection and for generation of Th1
cells and the expression of phagocyte-mediated protective immunity
(22). In the context of C. rodentium infection,
IL-12 transcripts are increased in colonic tissue of infected mice
(8). The importance of IL-12 expression was shown here by
the marked increase in susceptibility of
IL-12p40-/- mice to C. rodentium
infection. A common theme in several bacterial infections is that IL-12
regulates the magnitude of the IFN- response at the initiation of
infection, thus enhancing phagocyte activation, favoring Th1-cell
development, and inhibiting Th2 responses. Nevertheless, the basis for
the enhanced susceptibility of IL-12p40-/- mice
to C. rodentium clearly has an IFN--independent
component, as only IL-12p40-/-, but not
IFN--/-, mice died during infection.
Furthermore, colonic tissue of infected
IL-12p40-/- mice contained transcripts encoding
IFN-, suggesting IFN- may not in fact be limiting in the mucosa
of these mice and that an IL-12-independent mechanism of IFN-
induction exists. This observation is not unprecedented. Indeed,
several reports have described IL-12-independent induction of IFN-
responses in infection models (23, 24, 25, 26). Furthermore, some
viral infections can drive IFN- responses independently of both
IL-12 and IL-18 (27).
The generation of reactive nitrogen intermediates in phagocytes by iNOS
is regarded as an important mechanism by which phagocytosed pathogens
are killed (28). However, iNOS expression is not
restricted to phagocytes. Increased iNOS expression has been reported
in colonic epithelial cells of patients with inflammatory bowel disease
or acute Shigella colitis (29, 30).
Furthermore, in polarized colonic epithelial cells infected with
pathogenic E. coli, the stable NO end products, nitrate and
nitrite, are preferentially located on the apical side, suggesting that
epithelial cell-derived NO and its metabolites might affect pathogens
on the lumenal side of the epithelium (31). However, the
role of iNOS in immunity to a bacterial pathogen that resides on the
gastrointestinal mucosa has not previously been addressed in vivo. The
data presented in this study, using iNOS-/-
mice, suggest that iNOS is not essential for control or clearance of
C. rodentium. This is despite the up-regulation of iNOS on
the apical surface of enterocytes in areas of infected epithelium in
C57BL/6 mice and an increase in nitrate/nitrite levels in sera.
Furthermore, neither IL-12 nor IFN- appears to be essential for iNOS
expression by colonic epithelial cells, as abundant iNOS staining was
observed in the epithelia of C. rodentium-infected
IL-12p40-/- and
IFN--/- mice. Other inflammatory mediators,
like TNF, may act in concert with signals from C. rodentium
to increase iNOS expression.
Multiple cell types, including neutrophils, macrophages, and epithelia
in different anatomical locations express antimicrobial peptides. The
defensins are grouped into - and -defensins, based on different
interlinking of internal cysteines. In mice, the -defensins are
predominantly expressed by intestinal Paneth cells, while the
-defensins have been found mainly in epithelial cells throughout the
gut (32). Defensins exhibit antimicrobial activity against
Gram-positive and Gram-negative bacterial pathogens including E.
coli, Salmonella typhimurium, Listeria
monocytogenes, and parasites like Giardia
intestinalis, supporting the contention that these peptides
may contribute directly to host defense (33). In this
study, transcripts encoding mBD-1 were elevated above basal levels in
colonic tissue of mice infected with C. rodentium. Unlike
mBD-1, however, expression of mBD-3 in C57BL/6 mice appears to be more
tightly regulated, as transcripts encoding mBD-3 were more dramatically
up-regulated upon C. rodentium infection. Although there are
scant data on the in vivo expression of -defensins during infection,
these results are consistent with previous in vitro studies showing
rapid induction of mBD-3 expression in epithelial cells upon their
interaction with enteric pathogens (21). IL-12 and
IFN-, directly or indirectly, appear to play regulatory roles in the
expression of mBD-3. Infected IL-12p40-/- and
IFN--/- mice had lower levels of transcripts
encoding mBD-3, despite having a dramatically greater pathogen burden.
The attenuated mBD-3 response in these mice might at least partially
account for their enhanced susceptibility. However, a direct test of
this hypothesis is difficult because defensin-specific neutralizing Abs
and -defensin gene-targeted mice are currently unavailable.
Nevertheless, given that infection occurs predominantly on the lumenal
side of the epithelium, it seems likely that pathogen eradication would
be assisted by effector mechanisms, such as mBD-1 and mBD-3, which can
operate at the epithelial surface.
The mechanisms by which the host resolves infections by
attaching-effacing bacterial pathogens, which include the important
human pathogens EPEC and EHEC, remain virtually unexplored. The data
presented in this study, using C. rodentium as a model
system, add to our understanding of the type of immune mechanisms
required for resolution of infections caused by this class of pathogen.
Importantly, however, apart from a small percentage of
IL-12p40-/- mice, all animals infected with
C. rodentium in these studies survived and resolved
infection. Clearly, then, there are IL-12- and IFN--independent
immune mechanisms in operation that result in effective inhibition of
pathogen adherence and/or killing of attached bacteria, and the
identification of these mechanisms is the focus of our current
studies.
|
Footnotes |
|---|
2 Abbreviations used in this paper: EPEC, enteropathogenic E. coli; EHEC, enterohemorrhagic E. coli; MLN, mesenteric lymph node; A/E, attaching and effacing; iNOS, inducible NO synthase; SFC, spot-forming cell; mBD, mouse -defensin.
Received for publication June 14, 2001. Accepted for publication December 13, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
increase steady state levels of polymeric Ig receptor mRNA in human airway and intestinal epithelial cells. J. Immunol. 162:5112.-defensin 3 is an inducible antimicrobial peptide expressed in the epithelia of multiple organs. Infect. Immun. 67:3542./- and interleukin 12-mediated pathways in promoting T cell interferon responses during viral infection. J. Exp. Med. 189:1315. but is partially independent of IL-12. J. Immunol. 155:3427.[Abstract]
production induced by an attenuated parasite strain. Exp. Parasitol. 84:102.[Medline]
release in the lung but not for the differentiation of viral-reactive Th1-type lymphocytes. J. Immunol. 164:2575.-defensin hBD-1 in human secretory glands and epithelial cells. FEBS Lett. 396:319.[Medline]This article has been cited by other articles:
|
|
 |
|
  A. Dennis, T. Kudo, L. Kruidenier, F. Girard, V. F. Crepin, T. T. MacDonald, G. Frankel, and S. Wiles The p50 Subunit of NF-{kappa}B Is Critical for In Vivo Clearance of the Noninvasive Enteric Pathogen Citrobacter rodentium Infect. Immun., November 1, 2008; 76(11): 4978 - 4988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. McBee, P. Z. Zheng, A. B. Rogers, J. G. Fox, and D. B. Schauer Modulation of Acute Diarrheal Illness by Persistent Bacterial Infection Infect. Immun., November 1, 2008; 76(11): 4851 - 4858. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Dann, M. E. Spehlmann, D. C. Hammond, M. Iimura, K. Hase, L. J. Choi, E. Hanson, and L. Eckmann IL-6-Dependent Mucosal Protection Prevents Establishment of a Microbial Niche for Attaching/Effacing Lesion-Forming Enteric Bacterial Pathogens J. Immunol., May 15, 2008; 180(10): 6816 - 6826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Borenshtein, P. R. Nambiar, E. B. Groff, J. G. Fox, and D. B. Schauer Development of Fatal Colitis in FVB Mice Infected with Citrobacter rodentium Infect. Immun., July 1, 2007; 75(7): 3271 - 3281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Khan, C. Ma, L. A. Knodler, Y. Valdez, C. M. Rosenberger, W. Deng, B. B. Finlay, and B. A. Vallance Toll-Like Receptor 4 Contributes to Colitis Development but Not to Host Defense during Citrobacter rodentium Infection in Mice. Infect. Immun., May 1, 2006; 74(5): 2522 - 2536. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Bry, M. Brigl, and M. B. Brenner CD4+-T-Cell Effector Functions and Costimulatory Requirements Essential for Surviving Mucosal Infection with Citrobacter rodentium Infect. Immun., January 1, 2006; 74(1): 673 - 681. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-C. Chen, S. Louie, B. A. McCormick, W. A. Walker, and H. N. Shi Helminth-Primed Dendritic Cells Alter the Host Response to Enteric Bacterial Infection J. Immunol., January 1, 2006; 176(1): 472 - 483. [Abstract] [Full Text] [PDF]
|
|
