HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Carleton, M. Articles by Wiest, D. L. Search for Related Content PubMed PubMed Citation Articles by Carleton, M. Articles by Wiest, D. L.

Early Growth Response Transcription Factors Are Required for Development of CD4^-CD8^- Thymocytes to the CD4⁺CD8⁺ Stage¹

Michael Carleton^2,*, Mariëlle C. Haks^2,*,, Sigrid A. A. Smeele, Allan Jones, Stanley M. Belkowski^*, Marc A. Berger^4,*, Peter Linsley, Ada M. Kruisbeek and David L. Wiest^3,*

^* Immunobiology Working Group, Division of Basic Sciences, Fox Chase Cancer Center, Philadelphia, PA 19111; Division of Immunology, The Netherlands Cancer Institute, Amersterdam, The Netherlands; and Rosetta Inpharmatics, Kirkland, WA 98034

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Progression of immature CD4^-CD8^- thymocytes beyond the -selection checkpoint to the CD4⁺CD8⁺ stage requires activation of the pre-TCR complex; however, few of the DNA-binding proteins that serve as molecular effectors of those pre-TCR signals have been identified. We demonstrate in this study that members of the early growth response (Egr) family of transcription factors are critical effectors of the signals that promote this developmental transition. Specifically, the induction of three Egr family members (Egr1, 2, and 3) correlates with pre-TCR activation and development of CD4^-CD8^- thymocytes beyond the -selection checkpoint. Enforced expression of each of these Egr factors is able to bypass the block in thymocyte development associated with defective pre-TCR function. However, Egr family members may play somewhat distinct roles in promoting thymocyte development, because there are differences in the genes modulated by enforced expression of particular Egr factors. Finally, interfering with Egr function using dominant-negative proteins disrupts thymocyte development from the CD4^-CD8^- to the CD4⁺CD8⁺ stage. Taken together, these data demonstrate that the Egr proteins play an essential role in executing the differentiation program initiated by pre-TCR signaling.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Development of thymocytes from the CD4^-CD8^- (double negative (DN)⁵) to the CD4⁺CD8⁺ (double positive (DP)) stage is controlled by a developmental checkpoint termed -selection (Fig. 1). -Selection stipulates that only those DN thymocytes that maintain the translational reading frame of TCR- during rearrangement will survive and differentiate; those failing to do so die by apoptosis (1, 2). TCR- rearrangement occurs by a process termed V(D)J recombination which entails the fusion of individual V, D, and J gene segments into a single coding unit (3). The joining of V, D, and J segments is imprecise, with two-thirds of the rearrangements failing to maintain the translational reading frame and resulting in a nonfunctional TCR- protein (4). Consequently, almost half of the DN thymocytes attempting to rearrange their TCR- genes fail on both alleles. Accumulation of these dead-end cells is prevented by -selection (1).

View larger version (13K): [in this window] [in a new window]   FIGURE 1. Schematic overview of thymocyte development.

Although pre-TCR activation promotes development of immature thymocytes through the -selection checkpoint, very few of the DNA-binding proteins responsible for linking pre-TCR activation to the resultant changes in gene expression have been identified (12, 13, 14, 15, 16). One group of DNA-binding proteins that might be important in this process is the early growth response (Egr) family of immediate early genes. All of the Egr family members Egr1 (Krox24 and nerve growth factor inducible (NGFI)-A), Egr2 (Krox20), Egr3, and Egr4 (NGFI-C) contain three Cys²His² zinc fingers which share at least 84% homology and bind to the GC-rich consensus motif, GCGGGGGCG (17, 18). Differential induction of Egr factors has been linked to particular stages of myeloid and lymphoid cell development (16, 18, 19, 20, 21, 22, 23, 24); however, we know very little of how these proteins might function in elaborating the differentiation program triggered by the pre-TCR. Evidence for their involvement is available only for Egr1. Egr1 expression is induced during development of DNIII cells to the DNIV stage, and its enforced expression is able to promote development of pre-TCR-deficient DNIII thymocytes to the ISP stage (16). However, Egr1-deficiency does not disrupt the developmental progression of immature thymocytes through the -selection checkpoint (16). Therefore, it is not clear whether the function of Egr family members is essential for development of thymocytes beyond the -selection checkpoint or how the roles of individual Egr family members might differ.

We report here the use of the SCID.adh thymic lymphoma, whose differentiation in vitro parallels traversal of the -selection checkpoint by normal thymocytes in vivo (25), to obtain a gene expression profile associated with -selection. In doing so, we determined that Egr1, 2, and 3 are induced during differentiation of normal thymocytes beyond the -selection checkpoint and during in vitro maturation of SCID.adh. We demonstrated that their enforced expression is able to drive aspects of the differentiation of SCID.adh in vitro and the development of pre-TCR-deficient thymocytes beyond the -selection checkpoint in vivo. Moreover, we demonstrated distinctions in the genes whose expression is modulated by enforced expression of individual Egr family members. Most importantly, using three different dominant negative Egr proteins, we demonstrated that the activity of the Egr proteins is essential for development of immature DN thymocytes to the DP stage. Together, these findings comprise the first report, which demonstrates that Egr family members are required to enable the pre-TCR complex to promote the differentiation of immature DN thymocytes beyond the -selection checkpoint.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice

Mice were maintained under specific pathogen-free conditions in the animal colony of The Netherlands Cancer Institute (Amsterdam, The Netherlands). CD3-deficient and RAG-2/common -chain double-deficient mice have been described in detail elsewhere (26, 27).

Cell lines and Abs

SCID.adh is a spontaneous thymic lymphoma whose isolation, growth, and stimulation in culture has been previously described (25). The phoenix ecotropic (Phoenix-E) retroviral packaging line was obtained with the permission of Dr. G. Nolan (Stanford University, Stanford, CA). The anti-human IL-2R subunit (TAC)-producing hybridoma hd245/332 was obtained from the American Type Culture Collection (Manassas, VA) with the permission of Dr. T. Waldman (National Institute of Child Health and Human Development, Bethesda, MD; Ref. 28). The following conjugated Ab (BD PharMingen, San Diego, CA) were used in flow cytometry: anti-CD4-biotin (L3T4), anti-CD5-PE (53-7.3), anti-CD8-biotin (Ly-2), anti-CD25-FITC (7D4), anti-CD27-PE (LG.3A10), anti-CD28-PE (37.51), anti-CD44-PE (Pgp-1, Ly-24), anti-B220-biotin (RA3-6B2), anti-TCR--biotin (GL3), and streptavidin-APC.

Flow cytometry

Flow cytometric analysis and isolation of retrovirally-transduced SCID.adh cells was conducted as previously described (25). Immature thymocytes were isolated and washed in staining buffer (1% BSA/0.02% sodium azide/HBSS) before incubation with 1⁰ Ab for 25 min at 4°C. Thymocytes were then washed twice at 4°C in staining buffer and stained an additional 10 min at 4°C with streptavidin-APC to visualize biotin-conjugated 1⁰ Ab. Thymocytes were washed two more times at 4°C in staining buffer before analysis or isolation using a dual laser/dye laser flow cytometer (FACStar^Plus; BD Biosciences, Mountain View, CA). Dead cells were excluded using the vital dye propidium iodide. DNIII and DNIV cells were isolated based upon CD25 and CD44 expression. B cells, T cells, DP thymocytes, and SP thymocytes were excluded from this analysis by negative gating on B220⁺, TCR⁺, CD4⁺, and CD8⁺ thymocytes.

Microarray analysis

Total RNA was isolated from unstimulated and TAC:CD3-stimulated SCID.adh, amplified into cRNA by in vitro transcription, and subjected to hybridization on FlexJet DNA microarrays (29). Microarrays specified oligonucleotide sequences from the longest mRNA sequence in 20,000 Unigene clusters (Build #59, July 20, 1999). Details of cRNA amplification, fluorescent labeling, hybridization, and data analysis have been described elsewhere (29).

Recombinant retrovirus production

Mouse Egr1 and Egr1NH₂ (Egr1) constructs were provided by Dr. J. Monroe (University of Pennsylvania, Philadelphia, PA). Mouse Egr2, rat Egr3, rat Egr4, and mouse NGFI-A-binding protein 1 were provided by Dr. J. Milbrandt (Washington University School of Medicine, St. Louis, MO). Wilms tumor-associated protein:Egr1 was provided by Dr. V. M. Rangnekar (University of Kentucky, Lexington, KY) with the permission of Dr. F. J. Rauscher III (Wistar Institute, Philadelphia, PA). Egr1, Egr2, Egr3, Egr4, and Egr dominant-negative constructs were cloned into the retroviral vector LZRSpBMN-linker-internal ribosomal entry site (IRES)-enhanced green fluorescence protein (eGFP; LZRS) encompassing an IRES allowing for cap independent translation of eGFP. Retroviral vectors were transiently transfected into Phoenix-E packaging cells using the calcium phosphate transfection system (Life Technologies, Paisley, Scotland) or Lipofectamine Plus (Life Technologies, Rockville, MD) according to the manufacturer’s protocol. Transfection efficiency was assessed by determining the percentage of Phoenix-E packaging cells expressing eGFP by FACS analysis. Virus-containing supernatants were harvested from transfected Phoenix-E cells for thymocyte and SCID.adh transduction.

Retroviral transduction of SCID.adh-TAC:CD3

Virus containing serum-free Opti-MEM was pretreated for 10 min at room temperature with 2 µg/ml Lipofectamine (Life Technologies, Rockville, MD). SCID.adh-TAC:CD3 cells were washed in serum-free opti-MEM and single-cell suspensions were incubated at a concentration of 5 x 10⁵ cells/ml for 3 h at 37°C in 2 ml of Lipofectamine-treated, virus-containing, serum-free Opti-MEM. At the end of the 3-h infection period, SCID.adh-TAC:CD3 cells and virus supernatant were diluted with 5 ml of RPMI with 10% FBS and supplemented as described (30).

Retroviral transduction of fetal thymocytes and fetal thymic organ culture

Single cell suspensions were prepared from day 14 WT (F₁ 129Ola x FVB), or CD3-deficient fetal thymic lobes in IMDM supplemented with 10 mM HEPES buffer, nonessential amino acids, 4 mM L-glutamine, penicillin, streptomycin (all from Life Technologies), 5 x 10^-5 M 2-ME, and 20% FCS. A total of 1 x 10⁵–2 x 10⁵ cells/well were seeded in a flat-bottom microtiter plate in the presence of 50 ng/ml recombinant mouse IL-7 (PeproTech, Rocky Hill, NJ) and 100 µl virus supernatant which had been pretreated with 20 µg/ml Lipofectamine (Life Technologies, Paisley, Scotland) for 10 min on ice. Following spin infection of the cells for 45 min at 1800 rpm, cells were cultured overnight in a 5% CO₂-humidified incubator. For short-term cultures, virus supernatant was subsequently replaced by fresh medium containing 50 ng/ml recombinant mouse IL-7, and cells were cultured for another 48 h before FACS analysis. For long-term cultures, equal numbers (30,000) of thymocytes were transferred together with day 16 fetal thymic lobes derived from RAG-2/common -chain double-deficient mice to a hanging drop in an inverted Terasaki well. After 48 h, lobes were placed on filter discs on gel foam in a conventional fetal thymic organ culture system described previously (27), and cultured for another 3 days before single cell suspensions were prepared and thymocytes were examined by FACS analysis.

RT-PCR Southern blot analysis

RNA isolation, cDNA synthesis and amplification, and Southern blot analysis were conducted as previously described (25). Briefly, total RNA equivalents for each sample were treated with DNase I (Life Technologies, Rockville, MD) before first strand cDNA synthesis using the Superscript preamplification system random primer protocol (Life Technologies, Rockville, MD). RAG-1, RAG-2, pre-T, TCR-C, Egr1, Egr2, Egr3, and -actin primers have been previously described (23, 25). Egr4 specific primers amplify a 390 bp product and were used at an annealing temperature of 61°C in the presence of 5% DMSO. Egr4 primer sequences are as follows: Egr4-forward, GCTGCTGCTTCAGCCTTCAAAG, Egr4-reverse, TTTGGAGAAGTCCGCCGTGG. Input RNA for immature thymocyte and SCID.adh samples shown in Fig. 2A was 100 ng/reverse transcription reaction. Input RNA for all other SCID.adh samples was 1 µg/reverse transcription reaction. Serially diluted cDNA derived from 100 ng/1 µg of input RNA was amplified by PCR using the following number of cycles: -actin (22/19), Egr1, Egr2, Egr3, Egr4 (23/19), pre-T, TCR-C, RAG-1, and RAG-2 (24/19). All signals were quantified and normalized to -actin using a Fuji phosphorimager and Fuji MacBas V2.2 software (Fuji Photo Film, Tokyo, Japan).

View larger version (55K): [in this window] [in a new window]   FIGURE 2. Induction of Egr family members as thymocytes develop beyond the -selection checkpoint. A, Both the indicated thymocyte subpopulations (from neonatal BALB/c mice) and the CD25low subset of SCID.adh cells which had undergone in vitro maturation following TAC:CD3 stimulation were isolated by flow cytometric sorting. Total RNA was isolated from each cell population and expression of the indicatedmRNAs was assessed by RT-PCR Southern blots. Template cDNA was serially diluted for each sample as follows: 1/1, 1/5, and 1/15. The amplified cDNAs were resolved on agarose gels, transferred to membranes, and visualized by hybridization with the appropriate 32P-labeled probe. B, TAC:CD3-expressing SCID.adh cells were stimulated with 5 µg/ml of plate-bound anti-TAC Ab for the times specified. Total RNA was isolated from cells at each time point, and from the CD25low subpopulation at the 24-h time point. Expression of the indicated mRNAs was assessed by RT-PCR Southern blots as above. Template cDNA for Egr1, Egr2, pre-T, and TCR-C was serially diluted 1/1, 1/5, and 1/15. -actin cDNA was serially diluted 1/5, 1/15, and 1/30. Pre-Ta denotes full-length pre-T message, and pre-Tb denotes a splice variant of pre-T (57 ).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

Egr transcription factors are induced during differentiation of thymocytes beyond the -selection checkpoint

Stimulation of the SCID.adh thymic lymphoma by Ab engagement of the TAC:CD3-signaling chimera, a stimulus that mimics pre-TCR activation (31), induces SCID.adh to undergo phenotypic changes associated with traversal of the -selection checkpoint by normal thymocytes in vivo (Fig. 1; Ref. 25). To identify downstream effectors of this pre-TCR-dependent differentiation program, we used a 21K mouse oligonucleotide gene chip to establish expression profiles from undifferentiated and differentiated SCID.adh cells (25). Expression changes identified by the gene array agreed well with our previous analyses using RT-PCR (25). By far, the most dramatic changes identified were a 39-fold induction of Egr1, and a 20-fold induction of Egr2. Consequently, we sought to assess the importance of the Egr factors in elaborating the -selection differentiation program initiated by the pre-TCR complex. Using RT-PCR we analyzed the expression of all Egr family members in differentiated SCID.adh cells and in distinct thymocyte subsets isolated from neonatal mice (Fig. 2A). Of the four Egr family members, we found that Egr1, Egr2, and Egr3 were induced during differentiation of SCID.adh in vitro; and, were induced 6.5-, 15-, and 6.8-fold, respectively, in association with development of normal thymocytes from the DNIII to the DNIV stage, which requires the activation of the pre-TCR complex (Fig. 2A). Expression of Egr4 was not detected in either SCID.adh cells or normal thymocytes (data not shown).

Because the induction of Egr factors correlated with thymocyte progression through the -selection checkpoint, we next determined how the timing of Egr induction compared with changes in gene expression that characterize progression through this pre-TCR regulated developmental checkpoint. In particular, we refer to the down-modulation of mRNAs encoding the pre-T and RAG genes, and the induction of mRNA encoding TCR-C (7, 8, 9, 10). As occurs during development of DNIII thymocytes through the -selection checkpoint in vivo, TAC:CD3 stimulation of SCID.adh also causes down-modulation of pre-T and RAG gene expression and induction of TCR- (25). To investigate the temporal relationship between modulation of the expression of these genes and the induction of the Egr factors, changes in their expression were assessed by RT-PCR Southern analysis during the TAC:CD3-induced differentiation of SCID.adh (Fig. 2B). We found that Egr induction did correlate temporally with the induction of TCR- and repression of the pre-T and RAG genes. Indeed, induction of Egr1 and Egr2 is already apparent after 6 h of TAC:CD3 stimulation, which both coincides with induction of TCR-C and precedes the down-modulation of pre-T and the RAG genes, suggesting that Egr1 and Egr2 could be responsible for these changes in gene expression (Fig. 2B, unpublished data).

Forced expression of Egr factors induces phenotypic changes associated with in vitro maturation of SCID.adh

Because the induction of Egr family members temporally correlated with changes in gene expression characteristic of in vitro maturation of SCID.adh, we determined whether individual Egr family members could induce in vitro maturation of SCID.adh when overexpressed. cDNAs encoding Egr1, 2, and 3 were retrovirally transduced into SCID.adh using the bicistronic GFP-containing retroviral vector LZRSpBMN-linker-IRES-eGFP (LZRS). By gating on GFP⁺ cells, we used flow cytometry to compare the expression of differentiation Ags on SCID.adh transduced with Egr factors to that of cells transduced with empty vector. Expression of Egr1, 2, and 3 in SCID.adh induced a marked decrease in CD25 expression, a hallmark of -selection (Fig. 3). Enforced expression of the Egr factors also induced a significant increase in CD28 expression, while having no effect on expression of the activation Ags CD5 or CD69 (Fig. 3; our unpublished observations). Because multiple Egr family members are able to induce CD25 down-modulation in SCID.adh, it is possible that the expression of Egr2 and Egr3 is able to complement Egr1 deficiency, explaining the absence of a defect in thymocyte development in Egr1-deficient mice (16).

View larger version (59K): [in this window] [in a new window]   FIGURE 3. Enforced expression of Egr factors induces phenotypic changes associated with in vitro maturation. TAC:CD3-expressing SCID.adh cellswere retrovirally transduced with Egr1, Egr2, and Egr3 using the GFP-containing bicistronic vector LZRS. At 42 h postinfection, the expression of the specified cell surface Ags on GFP+, Egr-expressing cells was analyzed by flow cytometry and compared with that of GFP+ cells transduced with a vector control.

Egr factors differentially regulate pre-T, TCR-, and RAG gene expression

Although SCID.adh cultures routinely contain a small subpopulation of cells with lower levels of CD25 (2–5%; Fig. 4A, lower left quadrants), the level of CD25 expressed by these cells is not as low as that induced following TAC:CD3 stimulation or Egr transduction, nor do these cells exhibit any changes in expression of the genes characteristic of in vitro maturation of SCID.adh (data not shown). Consequently, this subpopulation does not represent spontaneously differentiating cells. Moreover, the down-modulation of CD25 in the LZRS-Egr1 transduced cultures is dependent upon the Egr1 insert as LZRS vector control transduced cells fail to do so (Fig. 4A).

View larger version (44K): [in this window] [in a new window]   FIGURE 4. Egr Family members differentially regulate pre-T, TCR-, and RAG gene expression. SCID.adh cells were retrovirally transduced with LZRS (A), Egr1 (A and B), or Egr2 (C). A, After 24 h, the Egr1-expressing cells (GFP+) were flow cytometrically isolated and cultured for an additional 36 h, at which time their differentiation was assessed by monitoring expression of CD25 using flow cytometry. By 60 h postinfection, more than half of the transduced cells had differentiated as indicated by loss of CD25 expression. B, Egr1 and C, Egr2 were retrovirally transduced into TAC:CD3-expressing SCID.adh cells and at 42 h postinfection the following three populations were isolated by flow cytometry: 1) fraction A, nontransduced control cells, GFP-CD25+; 2) fraction B, transduced, GFP+CD25+; and 3) fraction C, transduced and differentiated, GFP+CD25-. Total RNA was isolated from the sorted cell populations and mRNA expression of the specified genes was analyzed by RT-PCR. Template cDNA was serially diluted 1/1, 1/5, and 1/15 for pre-T, TCR-C, RAG-1, RAG-2, Egr1, and Egr2; 1/5, 1/15, and 1/30 for -actin. PCR products were visualized by Southern blot analysis as in Fig. 2. Pre-Ta denotes full-length pre-T message, and pre-Tb denotes a splice variant of pre-T (57 ).

Enforced expression of Egr1, 2, and 3 rescues development of pre-TCR deficient fetal thymocytes beyond the -selection checkpoint

Enforced expression of Egr1, 2, and 3 in SCID.adh produced changes in gene expression characteristic of thymocytes induced to transit through the -selection checkpoint. Consequently, we examined their respective abilities to relieve the developmental arrest caused by pre-TCR deficiency. Day 14 fetal thymocytes from CD3-deficient (CD3^-/-) mice, in which pre-TCR function is attenuated (27), were retrovirally transduced with LZRS-Egr1, 2, and 3, or with empty vector, LZRS. Transduced thymocytes (i.e., GFP⁺ cells) were cultured in vitro for 3 days before flow cytometric assessment of their developmental progression. Consistent with a previous report (16), we found that enforced expression of Egr1 restored the development of CD3^-/- thymocytes past their point of developmental arrest at the DNIII stage, resulting in a 4-fold increase in the absolute numbers of thymocytes that progressed to the CD8 ISP stage and an increase in the ratio of DNIV:DNIII cells, relative to the LZRS control (Figs. 1 and 5 and Table II). Likewise, Egr2 and Egr3 promoted a 2-fold increase in the number of CD3^-/- thymocytes that progressed beyond the -selection checkpoint at DNIII and on to the CD8 ISP stage. Interestingly, Egr2 and Egr3 also caused an accumulation of the DNI thymic subset, indicating that their expression at the DNI stage may be incompatible with further thymocyte development (Fig. 5A, Table II). Nevertheless, enforced expression of Egr1, 2, and 3 is able to promote development of CD3^-/- thymocytes beyond their developmental block at the DNIII stage indicating that the Egr proteins can complement pre-TCR deficiency and replicate at least some aspects of the developmental program normally initiated by pre-TCR signaling.

View larger version (51K): [in this window] [in a new window]   FIGURE 5. Egr1, Egr2, and Egr3 restore development of pre-TCR deficient thymocytes beyond the -selection checkpoint. A, Day 14 fetal thymocytes isolated from CD3-/- mice were retrovirally transduced with Egr1, Egr2, Egr3, or empty vector control (LZRS). Transduced thymocytes were subjected to short term culture in vitro before analysis by flow cytometry. The expression of CD4, CD8, CD25, and CD44 on GFP+ cells was assessed to determine the developmental progression of the transduced thymocytes. The proportion of cells in each quadrant is indicated. Of the original 2,000,000 cells in the transduced cell population, 900,000–1,000,000 cells were consistently recovered. The transduced population typically represented 30–40% of the cells. Data presented are representative of three experiments performed. B, Because thymocyte progression through the -selection checkpoint entails differentiation from the DNIII (CD44-25+) to the DNIV (CD44-25-)stage, the ratio of cells in the DNIV:DNIII stages was expressed graphically as an indicator of the efficiency of thymocyte differentiation.

Our observation that enforced expression of Egr1, 2, and 3 can replicate some aspects of the developmental program triggered by the pre-TCR suggests that the Egr proteins are important molecular effectors of those pre-TCR signals. However, because Egr1-deficient thymocytes appear to develop normally, it remained unclear whether Egr family members were truly necessary to enable the pre-TCR to promote thymocyte development beyond the -selection checkpoint. To resolve this issue, we expressed Egr dominant-negative proteins in fetal thymocytes with normal pre-TCR function to determine whether they could interfere with normal thymocyte development. Three dominant negative proteins were used: 1) Egr1, which retains the Egr1 zinc finger containing DNA-binding domain, but deletes the amino terminal activation domain (32); 2) WT1:Egr1, which fuses the DNA-binding domain of Egr1 (aa 337–427) to the NH₂-terminal transcriptional repressor domain (307 aa) of the Wilms tumor-associated protein (33); and 3) Nab1, an endogenous corepressor which is widely expressed in the adult mouse and can inhibit Egr1, 2, and 3 by binding to a homologous repressor site positioned N-terminal to the DNA-binding domain (17, 34). The ability of these proteins to interfere with Egr-mediated transactivation and repression has been established in a variety of different tissues (32, 33, 35, 36). In addition, we have verified that Nab-1 can antagonize the ability of Egr1 to induce down-modulation of CD25 in SCID.adh (our unpublished observations). It should also be noted that, because Egr1, 2, and 3 share at least 90% homology within their DNA-binding domains (18) and each has been reported to bind to identical target sequences (17), it is likely that Egr1 and WT1:Egr1 could be able to interfere with the function of Egr family members in addition to Egr1. Day 14 fetal thymocytes from wild-type mice were retrovirally transduced with vector control (LZRS) or the three dominant negatives described above. Transduced thymocytes were introduced into both short term cultures in vitro (3 days; Fig. 6, A and B; Table III) and into depleted thymic lobes for long term culture (6 days; Fig. 6C; Table III). Flow cytometric analysis of the transduced (GFP⁺) thymocytes revealed that all three dominant negatives interfered with thymocyte development to the DP stage (Fig. 6, A and C; Table III). Specifically, these dominant negative proteins inhibited development to the CD8 ISP stage and caused an accumulation of thymocytes at the DNIII stage, as indicated by the decrease in the ratio of DNIV:DNIII cells (Fig. 6, A and B; Table III). These data demonstrate that the function of Egr family members is required for development of DN thymocytes to the DP stage. Finally, because Egr1 deficiency alone does not prevent thymocyte development to the DP stage (16), the ability of these dominant negative proteins to interfere with development of DN thymocytes to the DP stage and to cause an accumulation of DNIII thymocytes suggests that the dominant negative proteins interfere with the function of all three of the Egr factors induced as thymocytes traverse the -selection checkpoint.

View larger version (47K): [in this window] [in a new window]   FIGURE 6. Egr dominant negative proteins interfere with development of DN thymocytes to the DP stage. Day 14 fetal thymocytes from F1129O la x FVB mice were retrovirally transduced with Egr1, WT1:Egr1, NAB1, or empty vector control (LZRS). A, Transduced thymocytes were cultured in vitro in short term (3 days) cultures following which the developmental progression of the transduced cells was assessed by gating on the transduced GFP+ subpopulation and examining the expression of CD4, CD8, CD25, and CD44 by flow cytometry. The proportion of cells in each quadrant is indicated. Of the original 2,000,000 cells in the transduced cell population, 900,000–1,000,000 cells were consistently recovered. Data presented are representative of three experiments performed. B, Because thymocyte progression through the -selection checkpoint entails differentiation from the DNIII (CD44-25+) to the DNIV (CD44-25-) stage, the ratio of cells in the DNIV:DNIII stages was expressed graphically as an indicator of the efficiency of thymocyte differentiation. C, Day 14 fetal thymocytes transduced as above were also reseeded into depleted thymic lobes for long term culture (6 days) before analysis by flow cytometry. From 10 seeded lobes, between 1.3 million and 1.5 million cells were recovered after culture. The data are representative of three experiments performed.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Although it is clear that pre-TCR signals are required to promote thymocyte development beyond the -selection checkpoint at DNIII and on to the DP stage, our understanding of the way in which proximal pre-TCR signals are linked to changes in gene expression that define this developmental transition remains rudimentary. We report here that induction of Egr family members, Egr1, 2, and 3, coincides both with in vitro maturation of the SCID.adh thymic lymphoma and with pre-TCR activation in vivo. We have shown that enforced expression of individual Egr family members is sufficient to replicate at least some of the phenotypic changes characteristic of -selection, and we have identified some of the genes whose expression is modulated by Egr factors. Finally, we have shown that dominant negative proteins that interfere with the function of Egr family members are able to attenuate the ability of the pre-TCR to promote development of thymocytes from the DN to the DP stage. Taken together, these data demonstrate that the Egr proteins play an important role in enabling the pre-TCR to execute the developmental program responsible for progression of thymocytes beyond the -selection checkpoint, placing Egr1, 2, and 3 among the select few DNA-binding proteins known to do so.

Pre-TCR activation induces DN thymocytes to traverse the -selection checkpoint which triggers a pleiotropic developmental program resulting in rescue from apoptosis, proliferation, differentiation to the DP stage, and allelic exclusion at the TCR- locus (6). Although there has been progress in defining some of the proximal branch points for signals that regulate the various aspects of the -selection program, there is little known regarding the identity of specific transcription factors that lie downstream of those bifurcation points (6). Our analysis of the genes regulated by Egr proteins in thymocytes, taken together with analysis of Egr protein function in other cell types, suggests that they may play a role in manifesting a subset of the developmental fates specified by the pre-TCR. Indeed, the TCR- locus is transactivated by Egr1 and Egr3, but not significantly by Egr2. Likewise, enforced expression of Egr2 and Egr3 markedly down-modulates RAG-1 and RAG-2. Because of the importance of these events in V(D)J recombination, it is possible that the Egr proteins play a role in regulating onset or termination of this process. In other cell types, Egr1 has been implicated in regulating proliferation and cell survival (18). Although it is unclear from our studies how the Egr proteins affect proliferation of normal thymocytes, the Egr factors may be having an anti-proliferative effect because Egr-transduced thymocytes are gradually lost from thymic lobes by 7 days of organ culture (our unpublished observations). Likewise, it is unclear how Egr factors affect thymocyte survival; however, it is unlikely that the ability of Egr proteins to promote development beyond the -selection checkpoint is simply the result of rescue from apoptosis, because genetic manipulations that alter thymocyte survival do not typically result in the acute transition of DNIII thymocytes to the DNIV stage, as we have observed following Egr transduction (Fig. 5; Refs. 37, 38, 39). In fact, Egr1 has been shown to induce apoptosis in transformed cells (18), including SCID.adh. Although enforced expression of Egr proteins induces in vitro maturation of the SCID.adh, those cells that have been induced to differentiate go on to die by an apoptotic mechanism (our unpublished observations). Our evidence demonstrates that the Egr proteins are required for some of the developmental outcomes associated with -selection; however, the inability of Egr proteins to promote differentiation beyond the CD8 ISP stage indicates that there are aspects of this developmental transition that the Egr proteins may not control. Further analysis will be required to clarify which aspects of the -selection differentiation program are under direct control of the Egr proteins and to understand what role each Egr family member plays in these processes.

The four Egr family members share at least 84% homology between their zinc-finger DNA-binding domains and bind identical GC-rich target motifs (17). As a result, it was previously thought that differences in the spectrum of genes modulated by particular Egr proteins might be due to their differential expression in response to various stimuli; however, we demonstrate here that Egr1, 2, and 3 are all induced across the DNIII/DNIV transition, yet exhibit some degree of functional specificity, i.e., differences in CD25 down-modulation, RAG gene repression, and TCR activation. There are several potential explanations for these differential effects (Fig. 4). First, it is possible that protein domains other than the zinc finger DNA-binding domains influence the spectrum of genes whose expression the Egr proteins modulate. The fact that the NH₂-terminal activation domains of the Egr family exhibit a relative lack of homology (<40%; Refs. 17 and 18) raises the possibility that these domains might influence Egr target specificity through differential phosphorylation of the large number of serine residues present in their N termini or through differential interaction with transacting factors which bind to the N-termini of the Egr proteins. Indeed, both Nab1 and Nab2 are endogenous corepressors of Egr proteins that are expressed in the thymus (40, 41). Although the Nab proteins do not appear to influence Egr target gene specificity, there may be other regulatory proteins in thymocytes that are able to do so. Second, the relative stability of Egr proteins could also impact upon their ability to induce specific changes in gene expression. Interestingly, it was recently reported that Egr1 protein is about 10-fold less stable than Egr2 and Egr3 when expressed in CV-1 cells (34). Third, the ability of an Egr family member to act on a consensus binding sequence may be influenced by that motif’s chromosomal context (17, 42, 43, 44) or by the binding of other transcriptional regulators. Any combination of these possibilities could influence the target range of a particular Egr family member.

The changes in expression of CD28, TCR, pre-T, and the RAG genes that occur as thymocytes differentiate from the DN to the DP stage are well documented (7, 8, 10, 11, 45); however, the identity of the DNA-binding proteins that trigger these changes remains an important unanswered question. Our data indicate that enforced expression of Egr1, 2, and 3 increases the surface expression of CD28. It was recently demonstrated that Egr1 can transactivate reporter constructs containing G-rich CD28, a novel promoter element within CD28 exon 1 which serves as the predominant cis-acting element for regulating CD28 expression (46). Consequently, induction of the Egr factors during traversal of the -selection checkpoint is likely to play an important role in the transactivation of CD28 during development of DN thymocytes to the DP stage. Furthermore, we show here that enforced expression of Egr1, 2, and 3 is able to regulate expression of pre-T, RAG-1, RAG-2, and TCR mRNA. Although we have not demonstrated that these changes in gene expression are the direct result of Egr action, direct transcriptional regulation of pre-T, RAG-1, RAG-2, and TCR- by the Egr proteins is a likely possibility for three reasons: 1) the close temporal correlation between Egr induction and modulation of their expression; 2) particular Egr proteins have differential effects on these genes; and 3) inspection of the regulatory sequences of these genes revealed the presence of putative Egr binding sites. Egr proteins can repress transcription by displacement of Sp1, a well characterized, ubiquitous zinc finger-containing, DNA-binding protein (47). Importantly, this repression-by-displacement mechanism appears to require more than just the DNA-binding domain of the Egr protein, because it can be blocked by overexpression of an Egr1 construct lacking the N-terminal regulatory domain (48). Genes whose expression is down-regulated in this manner are distinguished by the absence of a proximal TATA or CAAT box and the presence of overlapping Sp1/Egr1 binding sites (18, 47). Interestingly, these distinguishing features are found in the pre-T promoter and enhancer, and the promoters of RAG-1 and RAG-2 (49, 50, 51). Moreover, as predicted for the Sp1 displacement mechanism, our data indicates that Egr-mediated inhibition of pre-T and RAG gene expression occurs in a dose-dependent manner because down-modulation of the pre-T and RAG genes is always more pronounced in fraction C where Egr expression is highest (compare fractions B and C in Fig. 4, B and C).

The minimal TCR- enhancer (E) and the recently characterized J49 promoter are two of the regulatory sequences important in controlling transactivation of the TCR locus and both contain GC boxes, which are potential Egr binding sites (10, 52). Because E and the J promoter elements are important in controlling transactivation of the locus (53), and transcriptional activation is crucial in increasing the accessibility of the locus to the V(D)J recombination machinery, it is possible that Egr1 and Egr3 play a critical role in preparing the locus for rearrangement. Indeed, a recent report indicates that GC-II, a possible Egr binding site within E, undergoes a change in its DNase I hypersensitivity when the TCR- locus is activated (54), suggesting a change in the architecture of preassembled protein complexes bound at E (54). Establishing that the Egr proteins act to prepare the locus for rearrangement would be a particularly important finding given that all of the DNA-binding proteins currently thought to be required for E function are already bound to E before pre-TCR activation (52, 54). Furthermore, the increase in TCR-C transcripts induced by enforced expression of Egr1 and Egr3 is significantly less than the increase in TCR-C transcripts induced by TAC:CD3 stimulation of SCID.adh (our unpublished observations) suggesting that Egr proteins act cooperatively with other transcriptional regulators to activate TCR-C transcription. One likely candidate is NF-AT, which is activated by pre-TCR signals (55). In agreement with this hypothesis is the presence of two consensus Egr/NF-AT composite binding sites within the J49 promoter. Moreover, it is noteworthy that both Egr1 and Egr3 have been shown to work synergistically with NF-AT at such composite binding sites to activate CD95 ligand expression (56). Experiments are in progress to determine conclusively whether Egr proteins are acting directly on the TCR as well as the pre-T and RAG genes.

Our findings demonstrate that the development of immature thymocytes through the -selection checkpoint requires the function of Egr family members, thereby adding Egr1, Egr2, and Egr3 to the select group of DNA binding proteins whose activity is known to be essential for this developmental transition. Moreover, Egr family members are the only DNA-binding proteins whose enforced expression is able to replicate many of the phenotypic changes that are associated with progression through the -selection checkpoint. Finally, our observations highlight both functional redundancies and differences in the abilities of individual Egr family members to induce changes in gene expression that are characteristic of -selection, raising the possibility that this family of transcription factors may help to subdivide the pre-TCR signaling cascade into the diverse cellular outcomes that occur as a result of progression through the -selection checkpoint. We plan to extend these findings by assessing the contribution of each of the Egr family members to the developmental outcomes associated with -selection, by determining whether TCR-, pre-T, and RAG are direct targets, and by investigating the molecular basis for the target gene specificity of Egr family members.

	Acknowledgments

 
We thank Dr. John Monroe for providing mouse Egr1 and Egr1; Dr. J. Milbrandt for providing mouse Egr2, rat Egr3, rat Egr4 and mouse Nab1; and Dr. V. M. Rangnekar for providing WT1:Egr1. We thank Dr. N. Ruetsch for providing technical assistance with the RT-PCR assays. We thank Drs. M. Krangel, D. Kappes, J. Svaren, and A. Singer for critical review of this manuscript. Finally, we gratefully acknowledge the assistance of the following core facilities of the Fox Chase Cancer Center: Cell Culture, DNA Sequencing, DNA Synthesis, Flow Cytometry, Laboratory Animal, and Special Services.

	Footnotes

 
¹ This work was supported by American Cancer Society Grant RSG-01-084-01-LIB, National Institutes of Health Grants CA73656 and CA87407, Human Frontier Science Program Grant 0335/1998-M, National Institutes of Health core Grant P01CA06927, and an appropriation from the Commonwealth of Pennsylvania. M.C. is a fellow of the Cancer Research Institute and a recipient of an Arthritis Foundation Investigator Award. M.C.H. was supported by Grant Sg2-210 from the Netherlands Organization for Scientific Research.

² M.C. and M.C.H. contributed equally to this work.

³ Address correspondence and reprint requests to: Dr. David L. Wiest, Fox Chase Cancer Center, Division of Basic Sciences, Immunobiology Working Group, 7701 Burholme Avenue, Philadelphia, PA 19111. E-mail address: DL_Wiest{at}FCCC.edu

⁴ Current address: Purdue BioPharma, Princeton, NJ 08540.

⁵ Abbreviations used in this paper: DN, double negative; DP, double positive; Egr, early growth response; IRES, internal ribosomal entry site; eGFP, enhanced green fluorescence protein; RAG, recombination-activating gene; ISP, immature single positive; TAC, human IL-2R subunit; Phoenix-E, phoenix ecotropic; NGFI, nerve growth factor inducible.

Received for publication October 18, 2001. Accepted for publication December 4, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Dudley, E. C., H. T. Petrie, L. M. Shah, M. J. Owen, A. C. Hayday. 1994. T cell receptor chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[Medline]
2. von Boehmer, H., H. J. Fehling. 1997. Structure and function of the pre-T cell receptor. Annu. Rev. Immunol. 15:433.[Medline]
3. Grawunder, U., R. B. West, M. R. Lieber. 1998. Antigen receptor gene rearrangment. Curr. Opin. Immunol. 10:172.[Medline]
4. Mallick, C. A., E. C. Dudley, J. L. Viney, M. J. Owen, A. C. Hayday. 1993. Rearrangement and diversity of T cell receptor chain genes in thymocytes: a critical role for the chain in development. Cell 73:513.[Medline]
5. Wiest, D. L., M. A. Berger, M. Carleton. 1999. Control of early thymocyte development by the pre-T cell receptor complex: a receptor without a ligand?. Semin. Immunol. 11:251.[Medline]
6. Kruisbeek, A. M., M. C. Haks, M. Carleton, A. M. Michie, J. C. Zuniga-Pfluker, D. L. Wiest. 2000. Branching out to gain control: how the pre-TCR is linked to multiple functions. Immunol. Today. 21:637.[Medline]
7. Wilson, A., W. Held, H. R. MacDonald. 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 179:1355.[Abstract/Free Full Text]
8. Koyasu, S., L. K. Clayton, A. Lerner, H. Heiken, A. Parkes, E. L. Reinherz. 1997. Pre-TCR signaling components trigger transcriptional activation of a rearranged TCR gene locus and silencing of the pre-TCR locus: implications for intrathymic differentiation. Int. Immunol. 9:1475.[Abstract/Free Full Text]
9. Villey, I., P. Quartier, F. Selz, J. P. de Villartay. 1997. Germ-line transcription and methylation status of the TCR-J locus in its accessible configuration. Eur. J. Immunol. 27:1619.[Medline]
10. Hozumi, K., Y. Tanaka, T. Sato, A. Wilson, S. Habu. 1998. Evidence of stage-specific element for germ-line transcription of the TCR gene located upstream of J49 locus. Eur. J. Immunol. 28:1368.[Medline]
11. Levelt, C. N., B. Wang, A. Ehrfeld, C. Terhorst, K. Eichmann. 1995. Regulation of T cell receptor (TCR)- locus allelic exclusion and initiation of TCR- locus rearrangement in immature thymocytes by signaling through the CD3 complex. Eur. J. Immunol. 25:1257.[Medline]
12. Bain, G., C. Murre. 1998. The role of E-proteins in B- and T-lymphocyte development. Semin. Immunol. 10:143.[Medline]
13. Clevers, H., P. Ferrier. 1998. Transcriptional control during T-cell development. Curr. Opin. Immunol. 10:166.[Medline]
14. Okamura, R. M., M. Sigvardsson, J. Galceran, S. Verbeek, H. Clevers, R. Grosschedl. 1998. Redundant regulation of T cell differentiation and TCR gene expression by the transcription factors LEF-1 and TCF-1. Immunity 8:11.[Medline]
15. Schwarz, R. A., C. D. Katayama, S. M. Hedrick. 1998. Schlafen, a new family of growth regulatory genes that affect thymocyte development. Immunity 9:657.[Medline]
16. Miyazaki, T.. 1997. Two distinct steps during thymocyte maturation from CD4^-CD8^- to CD4⁺CD8⁺ distinguished in the early growth response (Egr)-1 transgenic mice with a recombinase-activating gene-deficient background. J. Exp. Med. 186:877.[Abstract/Free Full Text]
17. Swirnoff, A. H., J. Milbrandt. 1995. DNA-binding specificity of NGFI-A and related zinc finger transcription factors. Mol. Cell. Biol. 15:2275.[Abstract]
18. Liu, C., V. M. Rangnekar, E. Adamson, D. Mercola. 1998. Suppression of growth and transformation and induction of apoptosis by EGR-1. Cancer Gene Ther. 5:3.[Medline]
19. Krishnaraju, K., H. Q. Nguyen, D. A. Liebermann, B. Hoffman. 1995. The zinc finger transcription factor Egr-1 potentiates macrophage differentiation of hematopoietic cells. Mol. Cell. Biol. 15:5499.[Abstract]
20. Krishnaraju, K., B. Hoffman, D. A. Liebermann. 1998. The zinc finger transcription factor Egr-1 activates macrophage differentiation in M1 myeloblastic leukemia cells. Blood 92:1957.[Abstract/Free Full Text]
21. Dinkel, A., K. Warnatz, B. Ledermann, A. Rolink, P. F. Zipfel, K. Burki, H. Eibel. 1998. The transcription factor early growth response 1 (Egr-1) advances differentiation of pre-B and immature B cells. J. Exp. Med. 188:2215.[Abstract/Free Full Text]
22. Miyazaki, T., F. A. Lemonnier. 1998. Modulation of thymic selection by expression of an immediate-early gene, early growth response 1 (Egr-1). J. Exp. Med. 188:715.[Abstract/Free Full Text]
23. Shao, H., D. H. Kono, L. Y. Chen, E. M. Rubin, J. Kaye. 1997. Induction of the early growth response (Egr) family of transcription factors during thymic selection. J. Exp. Med. 185:731.[Abstract/Free Full Text]
24. Rengarajan, J., P. R. Mittelstadt, H. W. Mages, A. J. Gerth, R. A. Kroczek, J. D. Ashwell, L. H. Glimcher. 2000. Sequential involvement of NFAT and Egr transcription factors in FasL regulation. Immunity 12:293.[Medline]
25. Carleton, M., N. R. Ruetsch, M. A. Berger, M. R. Rhodes, S. Kaptik, D. L. Wiest. 1999. Signals transduced by CD3, but not by surface pre-TCR complexes, are able to induce maturation of an early thymic lymphoma in vitro. J. Immunol. 163:2576.[Abstract/Free Full Text]
26. Goldman, J. P., M. P. Blundell, L. Lopes, C. Kinnon, J. P. Di Santo, A. J. Thrasher. 1998. Enhanced human cell engraftment in mice deficient in RAG2 and the common cytokine receptor chain. Br. J. Haematol. 103:335.[Medline]
27. Haks, M. C., P. Krimpenfort, J. Borst, A. M. Kruisbeek. 1998. The CD3 chain is essential for development of both the TCR and TCR lineages. EMBO J. 17:1871.[Medline]
28. Uchiyama, T., D. L. Nelson, T. A. Fleisher, T. A. Waldmann. 1981. A monoclonal antibody (anti-Tac) reactive with activated and functionally mature human T cells. II. Expression of Tac antigen on activated cytotoxic killer T cells, suppressor cells, and on one of two types of helper T cells. J. Immunol. 126:1398.[Medline]
29. Hughes, T. R., M. Mao, A. R. Jones, J. Burchard, M. J. Marton, K. W. Shannon, S. M. Lefkowitz, M. Ziman, J. M. Schelter, M. R. Meyer, et al 2001. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer. Nat. Biotechnol. 19:342.[Medline]
30. Wiest, D. L., K. P. Kearse, E. W. Shores, A. Singer. 1994. Developmentally regulated expression of CD3 components independent of clonotypic T cell antigen receptor complexes on immature thymocytes. J. Exp. Med. 180:1375.[Abstract/Free Full Text]
31. Shinkai, Y., F. W. Alt. 1994. CD3-mediated signals rescue the development of CD4⁺CD8⁺ thymocytes in RAG-2^-/- mice in the absence of TCR chain expression. Int. Immunol. 6:995.[Abstract/Free Full Text]
32. Carman, J. A., J. G. Monroe. 1995. The EGR1 protein contains a discrete transcriptional regulatory domain whose deletion results in a truncated protein that blocks EGR1-induced transcription. DNA Cell Biol. 14:581.[Medline]
33. Madden, S. L., D. M. Cook, J. F. Morris, A. Gashler, V. P. Sukhatme, III F. J. Rauscher. 1991. Transcriptional repression mediated by the WT1 Wilms tumor gene product. Science 253:1550.[Abstract/Free Full Text]
34. Sevetson, B. R., J. Svaren, J. Milbrandt. 2000. A novel activation function for NAB proteins in EGR-dependent transcription of the luteinizing hormone gene. J. Biol. Chem. 275:9749.[Abstract/Free Full Text]
35. Sells, S. F., S. Muthukumar, V. P. Sukhatme, S. A. Crist, V. M. Rangnekar. 1995. The zinc finger transcription factor EGR-1 impedes interleukin-1-inducible tumor growth arrest. Mol. Cell. Biol. 15:682.[Abstract]
36. Swirnoff, A. H., E. D. Apel, J. Svaren, B. R. Sevetson, D. B. Zimonjic, N. C. Popescu, J. Milbrandt. 1998. Nab1, a corepressor of NGFI-A (Egr-1), contains an active transcriptional repression domain. Mol. Cell. Biol. 18:512.[Abstract/Free Full Text]
37. Haks, M. C., P. Krimpenfort, J. H. van den Brakel, A. M. Kruisbeek. 1999. Pre-TCR signaling and inactivation of p53 induces crucial cell survival pathways in pre-T cells. Immunity 11:91.[Medline]
38. Newton, K., A. W. Harris, A. Strasser. 2000. FADD/MORT1 regulates the pre-TCR checkpoint and can function as a tumour suppressor. EMBO J. 19:931.[Medline]
39. Voll, R. E., E. Jimi, R. J. Phillips, D. F. Barber, M. Rincon, A. C. Hayday, R. A. Flavell, S. Ghosh. 2000. NF-B activation by the pre-T cell receptor serves as a selective survival signal in T lymphocyte development. Immunity 13:677.[Medline]
40. Russo, M. W., B. R. Sevetson, J. Milbrandt. 1995. Identification of NAB1, a repressor of NGFI-A- and Krox20-mediated transcription. Proc. Nat. Acad. Sci. USA 92:6873.[Abstract/Free Full Text]
41. Svaren, J., B. R. Sevetson, E. D. Apel, D. B. Zimonjic, N. C. Popescu, J. Milbrandt. 1996. NAB2, a corepressor of NGFI-A (Egr-1) and Krox20, is induced by proliferative and differentiative stimuli. Mol. Cell. Biol. 16:3545.[Abstract]
42. Lemaire, P., C. Vesque, J. Schmitt, H. Stunnenberg, R. Frank, P. Charnay. 1990. The serum-inducible mouse gene Krox-24 encodes a sequence-specific transcriptional activator. Mol. Cell. Biol. 10:3456.[Abstract/Free Full Text]
43. Crosby, S. D., J. J. Puetz, K. S. Simburger, T. J. Fahrner, J. Milbrandt. 1991. The early response gene NGFI-C encodes a zinc finger transcriptional activator and is a member of the GCGGGGGCG (GSG) element-binding protein family. Mol. Cell. Biol. 11:3835.[Abstract/Free Full Text]
44. Patwardhan, S., A. Gashler, M. G. Siegel, L. C. Chang, L. J. Joseph, T. B. Shows, M. M. Le Beau, V. P. Sukhatme. 1991. EGR3, a novel member of the Egr family of genes encoding immediate-early transcription factors. Oncogene 6:917.[Medline]
45. Gross, J. A., E. Callas, J. P. Allison. 1992. Identification and distribution of the costimulatory receptor CD28 in the mouse. J. Immunol. 149:380.[Abstract]
46. Lin, C. J., R. C. Tam. 2001. Transcriptional regulation of CD28 expression by CD28GR, a novel promoter element located in exon 1 of the CD28 gene. J. Immunol. 166:6134.[Abstract/Free Full Text]