|
|
||||||||





*
Immunobiology Working Group, Division of Basic Sciences, Fox Chase Cancer Center, Philadelphia, PA 19111;
Division of Immunology, The Netherlands Cancer Institute, Amersterdam, The Netherlands; and
Rosetta Inpharmatics, Kirkland, WA 98034
| Abstract |
|---|
|
|
|---|
-selection checkpoint to the
CD4+CD8+ stage requires activation of the
pre-TCR complex; however, few of the DNA-binding proteins that serve as
molecular effectors of those pre-TCR signals have been identified. We
demonstrate in this study that members of the early growth response
(Egr) family of transcription factors are critical effectors of the
signals that promote this developmental transition. Specifically, the
induction of three Egr family members (Egr1, 2, and 3) correlates with
pre-TCR activation and development of
CD4-CD8- thymocytes beyond the
-selection
checkpoint. Enforced expression of each of these Egr factors is able to
bypass the block in thymocyte development associated with defective
pre-TCR function. However, Egr family members may play somewhat
distinct roles in promoting thymocyte development, because there are
differences in the genes modulated by enforced expression of particular
Egr factors. Finally, interfering with Egr function using
dominant-negative proteins disrupts thymocyte development from the
CD4-CD8- to the
CD4+CD8+ stage. Taken together, these data
demonstrate that the Egr proteins play an essential role in executing
the differentiation program initiated by pre-TCR
signaling. | Introduction |
|---|
|
|
|---|
-selection (Fig. 1
-Selection
stipulates that only those DN thymocytes that maintain the
translational reading frame of TCR-
during rearrangement will
survive and differentiate; those failing to do so die by apoptosis
(1, 2). TCR-
rearrangement occurs by a process termed
V(D)J recombination which entails the fusion of individual V, D, and J
gene segments into a single coding unit (3). The joining
of V, D, and J segments is imprecise, with two-thirds of the
rearrangements failing to maintain the translational reading frame and
resulting in a nonfunctional TCR-
protein (4).
Consequently, almost half of the DN thymocytes attempting to rearrange
their TCR-
genes fail on both alleles. Accumulation of these
dead-end cells is prevented by
-selection (1).
|
subunit facilitates assembly and
activation of the pre-TCR complex, which in turn triggers the
-selection differentiation program (Fig. 1
-selection checkpoint include termination of TCR-
rearrangement, rescue from death, proliferation, and differentiation to
the DP stage (6). These events are associated with defined
changes in gene expression. Specifically, differentiation of
CD44-CD25+ DN (DNIII)
thymocytes to the
CD44-CD25- DN (DNIV)
stage is defined by down-regulation of CD25, a hallmark of pre-TCR
activation, (Fig. 1
(7, 8). DNIV cells then sequentially
up-regulate CD8 (CD8 immature single positive (ISP)) and CD4 to become
DP thymocytes (Fig. 1
locus, indicating that the
TCR-
locus has opened in preparation for gene rearrangement
(9, 10). Therefore, hallmarks of pre-TCR-induced thymocyte
development through the
-selection checkpoint include:
down-modulation of CD25, pre-T
, RAG-1, and RAG-2; termination of
rearrangement at the TCR-
locus (i.e., allelic exclusion; Ref.
11); up-regulation of TCR-
transcription associated
with redirection of the recombination machinery to the
locus
(11); and differentiation beyond the DNIII stage to the DP
stage.
Although pre-TCR activation promotes development of immature thymocytes
through the
-selection checkpoint, very few of the DNA-binding
proteins responsible for linking pre-TCR activation to the resultant
changes in gene expression have been identified (12, 13, 14, 15, 16).
One group of DNA-binding proteins that might be important in this
process is the early growth response (Egr) family of immediate early
genes. All of the Egr family members Egr1 (Krox24 and nerve growth
factor inducible (NGFI)-A), Egr2 (Krox20), Egr3, and Egr4
(NGFI-C) contain three
Cys2His2 zinc fingers which
share at least 84% homology and bind to the GC-rich consensus
motif, GCGGGGGCG (17, 18). Differential induction of Egr
factors has been linked to particular stages of myeloid and lymphoid
cell development (16, 18, 19, 20, 21, 22, 23, 24); however, we know very
little of how these proteins might function in elaborating the
differentiation program triggered by the pre-TCR. Evidence for their
involvement is available only for Egr1. Egr1 expression is induced
during development of DNIII cells to the DNIV stage, and its enforced
expression is able to promote development of pre-TCR-deficient DNIII
thymocytes to the ISP stage (16). However, Egr1-deficiency
does not disrupt the developmental progression of immature thymocytes
through the
-selection checkpoint (16). Therefore, it
is not clear whether the function of Egr family members is essential
for development of thymocytes beyond the
-selection checkpoint or
how the roles of individual Egr family members might differ.
We report here the use of the SCID.adh thymic lymphoma, whose
differentiation in vitro parallels traversal of the
-selection
checkpoint by normal thymocytes in vivo (25), to obtain a
gene expression profile associated with
-selection. In doing so, we
determined that Egr1, 2, and 3 are induced during differentiation of
normal thymocytes beyond the
-selection checkpoint and during in
vitro maturation of SCID.adh. We demonstrated that their enforced
expression is able to drive aspects of the differentiation of SCID.adh
in vitro and the development of pre-TCR-deficient thymocytes beyond the
-selection checkpoint in vivo. Moreover, we demonstrated
distinctions in the genes whose expression is modulated by enforced
expression of individual Egr family members. Most importantly, using
three different dominant negative Egr proteins, we demonstrated that
the activity of the Egr proteins is essential for development of
immature DN thymocytes to the DP stage. Together, these findings
comprise the first report, which demonstrates that Egr family members
are required to enable the pre-TCR complex to promote the
differentiation of immature DN thymocytes beyond the
-selection
checkpoint.
| Materials and Methods |
|---|
|
|
|---|
Mice were maintained under specific pathogen-free conditions in
the animal colony of The Netherlands Cancer Institute (Amsterdam, The
Netherlands). CD3
-deficient and RAG-2/common
-chain
double-deficient mice have been described in detail elsewhere
(26, 27).
Cell lines and Abs
SCID.adh is a spontaneous thymic lymphoma whose isolation,
growth, and stimulation in culture has been previously described
(25). The phoenix ecotropic (Phoenix-E) retroviral
packaging line was obtained with the permission of Dr. G. Nolan
(Stanford University, Stanford, CA). The anti-human IL-2R
subunit (TAC)-producing hybridoma hd245/332 was obtained from
the American Type Culture Collection (Manassas, VA) with the permission
of Dr. T. Waldman (National Institute of Child Health and Human
Development, Bethesda, MD; Ref. 28). The following
conjugated Ab (BD PharMingen, San Diego, CA) were used in flow
cytometry: anti-CD4-biotin (L3T4), anti-CD5-PE (53-7.3),
anti-CD8-biotin (Ly-2), anti-CD25-FITC (7D4), anti-CD27-PE
(LG.3A10), anti-CD28-PE (37.51), anti-CD44-PE (Pgp-1, Ly-24),
anti-B220-biotin (RA3-6B2), anti-TCR-
-biotin (GL3), and
streptavidin-APC.
Flow cytometry
Flow cytometric analysis and isolation of
retrovirally-transduced SCID.adh cells was conducted as previously
described (25). Immature thymocytes were isolated and
washed in staining buffer (1% BSA/0.02% sodium azide/HBSS) before
incubation with 10 Ab for 25 min at 4°C.
Thymocytes were then washed twice at 4°C in staining buffer and
stained an additional 10 min at 4°C with streptavidin-APC to
visualize biotin-conjugated 10 Ab. Thymocytes
were washed two more times at 4°C in staining buffer before analysis
or isolation using a dual laser/dye laser flow cytometer
(FACStarPlus; BD Biosciences, Mountain View, CA).
Dead cells were excluded using the vital dye propidium iodide. DNIII
and DNIV cells were isolated based upon CD25 and CD44 expression. B
cells, 
T cells, DP thymocytes, and SP thymocytes were excluded
from this analysis by negative gating on B220+,

TCR+, CD4+, and
CD8+ thymocytes.
Microarray analysis
Total RNA was isolated from unstimulated and
TAC:CD3
-stimulated SCID.adh, amplified into cRNA by in vitro
transcription, and subjected to hybridization on FlexJet DNA
microarrays (29). Microarrays specified oligonucleotide
sequences from the longest mRNA sequence in
20,000 Unigene clusters
(Build #59, July 20, 1999). Details of cRNA amplification,
fluorescent labeling, hybridization, and data analysis have been
described elsewhere (29).
Recombinant retrovirus production
Mouse Egr1 and Egr1
NH2 (
Egr1)
constructs were provided by Dr. J. Monroe (University of Pennsylvania,
Philadelphia, PA). Mouse Egr2, rat Egr3, rat Egr4, and mouse
NGFI-A-binding protein 1 were provided by Dr. J. Milbrandt
(Washington University School of Medicine, St. Louis, MO). Wilms
tumor-associated protein:Egr1 was provided by Dr. V. M.
Rangnekar (University of Kentucky, Lexington, KY) with the permission
of Dr. F. J. Rauscher III (Wistar Institute, Philadelphia, PA).
Egr1, Egr2, Egr3, Egr4, and Egr dominant-negative constructs were
cloned into the retroviral vector LZRSpBMN-linker-internal
ribosomal entry site (IRES)-enhanced green fluorescence protein (eGFP;
LZRS) encompassing an IRES allowing for cap independent translation of
eGFP. Retroviral vectors were transiently transfected into Phoenix-E
packaging cells using the calcium phosphate transfection system (Life
Technologies, Paisley, Scotland) or Lipofectamine Plus (Life
Technologies, Rockville, MD) according to the manufacturers protocol.
Transfection efficiency was assessed by determining the percentage of
Phoenix-E packaging cells expressing eGFP by FACS analysis.
Virus-containing supernatants were harvested from transfected Phoenix-E
cells for thymocyte and SCID.adh transduction.
Retroviral transduction of SCID.adh-TAC:CD3
Virus containing serum-free Opti-MEM was pretreated for 10 min
at room temperature with 2 µg/ml Lipofectamine (Life Technologies,
Rockville, MD). SCID.adh-TAC:CD3
cells were washed in serum-free
opti-MEM and single-cell suspensions were incubated at a concentration
of 5 x 105 cells/ml for 3 h at 37°C
in 2 ml of Lipofectamine-treated, virus-containing, serum-free
Opti-MEM. At the end of the 3-h infection period, SCID.adh-TAC:CD3
cells and virus supernatant were diluted with 5 ml of RPMI with 10%
FBS and supplemented as described (30).
Retroviral transduction of fetal thymocytes and fetal thymic organ culture
Single cell suspensions were prepared from day 14 WT
(F1 129Ola x FVB), or
CD3
-deficient fetal thymic lobes in IMDM supplemented with 10 mM
HEPES buffer, nonessential amino acids, 4 mM L-glutamine,
penicillin, streptomycin (all from Life Technologies), 5 x
10-5 M 2-ME, and 20% FCS. A total of 1 x
1052 x 105
cells/well were seeded in a flat-bottom microtiter plate in the
presence of 50 ng/ml recombinant mouse IL-7 (PeproTech, Rocky Hill, NJ)
and 100 µl virus supernatant which had been pretreated with 20
µg/ml Lipofectamine (Life Technologies, Paisley, Scotland) for 10 min
on ice. Following spin infection of the cells for 45 min at 1800 rpm,
cells were cultured overnight in a 5%
CO2-humidified incubator. For short-term
cultures, virus supernatant was subsequently replaced by fresh medium
containing 50 ng/ml recombinant mouse IL-7, and cells were cultured for
another 48 h before FACS analysis. For long-term cultures, equal
numbers (30,000) of thymocytes were transferred together with day 16
fetal thymic lobes derived from RAG-2/common
-chain double-deficient
mice to a hanging drop in an inverted Terasaki well. After 48 h,
lobes were placed on filter discs on gel foam in a conventional fetal
thymic organ culture system described previously (27), and
cultured for another 3 days before single cell suspensions were
prepared and thymocytes were examined by FACS analysis.
RT-PCR Southern blot analysis
RNA isolation, cDNA synthesis and amplification, and Southern
blot analysis were conducted as previously described (25).
Briefly, total RNA equivalents for each sample were treated with DNase
I (Life Technologies, Rockville, MD) before first strand cDNA synthesis
using the Superscript preamplification system random primer protocol
(Life Technologies, Rockville, MD). RAG-1, RAG-2, pre-T
, TCR-C
,
Egr1, Egr2, Egr3, and
-actin primers have been previously described
(23, 25). Egr4 specific primers amplify a 390 bp product
and were used at an annealing temperature of 61°C in the presence of
5% DMSO. Egr4 primer sequences are as follows: Egr4-forward,
GCTGCTGCTTCAGCCTTCAAAG, Egr4-reverse, TTTGGAGAAGTCCGCCGTGG. Input RNA
for immature thymocyte and SCID.adh samples shown in Fig. 2
A was 100 ng/reverse
transcription reaction. Input RNA for all other SCID.adh samples was 1
µg/reverse transcription reaction. Serially diluted cDNA derived from
100 ng/1 µg of input RNA was amplified by PCR using the following
number of cycles:
-actin (22/19), Egr1, Egr2, Egr3, Egr4 (23/19),
pre-T
, TCR-C
, RAG-1, and RAG-2 (24/19). All signals were
quantified and normalized to
-actin using a Fuji phosphorimager and
Fuji MacBas V2.2 software (Fuji Photo Film, Tokyo, Japan).
|
| Results |
|---|
|
|
|---|
-selection checkpoint
Stimulation of the SCID.adh thymic lymphoma by Ab engagement of
the TAC:CD3
-signaling chimera, a stimulus that mimics pre-TCR
activation (31), induces SCID.adh to undergo phenotypic
changes associated with traversal of the
-selection checkpoint by
normal thymocytes in vivo (Fig. 1
; Ref. 25). To identify
downstream effectors of this pre-TCR-dependent differentiation program,
we used a 21K mouse oligonucleotide gene chip to establish expression
profiles from undifferentiated and differentiated SCID.adh cells
(25). Expression changes identified by the gene array
agreed well with our previous analyses using RT-PCR (25).
By far, the most dramatic changes identified were a 39-fold induction
of Egr1, and a 20-fold induction of Egr2. Consequently, we sought to
assess the importance of the Egr factors in elaborating the
-selection differentiation program initiated by the pre-TCR complex.
Using RT-PCR we analyzed the expression of all Egr family members in
differentiated SCID.adh cells and in distinct thymocyte subsets
isolated from neonatal mice (Fig. 2
A). Of the four Egr
family members, we found that Egr1, Egr2, and Egr3 were induced during
differentiation of SCID.adh in vitro; and, were induced 6.5-, 15-, and
6.8-fold, respectively, in association with development of normal
thymocytes from the DNIII to the DNIV stage, which requires the
activation of the pre-TCR complex (Fig. 2
A). Expression of
Egr4 was not detected in either SCID.adh cells or normal thymocytes
(data not shown).
Because the induction of Egr factors correlated with thymocyte
progression through the
-selection checkpoint, we next determined
how the timing of Egr induction compared with changes in gene
expression that characterize progression through this pre-TCR regulated
developmental checkpoint. In particular, we refer to the
down-modulation of mRNAs encoding the pre-T
and RAG genes, and the
induction of mRNA encoding TCR-C
(7, 8, 9, 10). As occurs
during development of DNIII thymocytes through the
-selection
checkpoint in vivo, TAC:CD3
stimulation of SCID.adh also causes
down-modulation of pre-T
and RAG gene expression and induction of
TCR-
(25). To investigate the temporal relationship
between modulation of the expression of these genes and the induction
of the Egr factors, changes in their expression were assessed by RT-PCR
Southern analysis during the TAC:CD3
-induced differentiation of
SCID.adh (Fig. 2
B). We found that Egr induction did
correlate temporally with the induction of TCR-
and repression of
the pre-T
and RAG genes. Indeed, induction of Egr1 and Egr2 is
already apparent after 6 h of TAC:CD3
stimulation, which both
coincides with induction of TCR-C
and precedes the down-modulation
of pre-T
and the RAG genes, suggesting that Egr1 and Egr2 could be
responsible for these changes in gene expression (Fig. 2
B,
unpublished data).
Forced expression of Egr factors induces phenotypic changes associated with in vitro maturation of SCID.adh
Because the induction of Egr family members temporally correlated
with changes in gene expression characteristic of in vitro maturation
of SCID.adh, we determined whether individual Egr family members could
induce in vitro maturation of SCID.adh when overexpressed. cDNAs
encoding Egr1, 2, and 3 were retrovirally transduced into SCID.adh
using the bicistronic GFP-containing retroviral vector
LZRSpBMN-linker-IRES-eGFP (LZRS). By gating on
GFP+ cells, we used flow cytometry to compare the
expression of differentiation Ags on SCID.adh transduced with Egr
factors to that of cells transduced with empty vector. Expression of
Egr1, 2, and 3 in SCID.adh induced a marked decrease in CD25
expression, a hallmark of
-selection (Fig. 3
). Enforced expression of the Egr
factors also induced a significant increase in CD28 expression, while
having no effect on expression of the activation Ags CD5 or CD69 (Fig. 3
; our unpublished observations). Because multiple Egr family
members are able to induce CD25 down-modulation in SCID.adh, it is
possible that the expression of Egr2 and Egr3 is able to
complement Egr1 deficiency, explaining the absence of a defect in
thymocyte development in Egr1-deficient mice (16).
|
, TCR-
, and RAG gene
expression
Although SCID.adh cultures routinely contain a small subpopulation
of cells with lower levels of CD25 (
25%; Fig. 4
A, lower left
quadrants), the level of CD25 expressed by these cells is not as
low as that induced following TAC:CD3
stimulation or Egr
transduction, nor do these cells exhibit any changes in expression of
the genes characteristic of in vitro maturation of SCID.adh (data not
shown). Consequently, this subpopulation does not represent
spontaneously differentiating cells. Moreover, the down-modulation of
CD25 in the LZRS-Egr1 transduced cultures is dependent upon the
Egr1 insert as LZRS vector control transduced cells fail to do
so (Fig. 4
A).
|
, and TCR-
mRNAs in these populations was
assessed by RT-PCR Southern blotting (Fig. 4
stimulation of SCID.adh. Retroviral transduction
typically resulted in 2- to 5-fold more of the particular Egr factor
than is induced by TAC:CD3
stimulation (our unpublished
observation). For the three Egr family members examined, the cells that
expressed the largest amount of Egr mRNA by 42 h after retroviral
transduction (fraction C), exhibited the most significant
down-modulation of CD25 (Fig. 4
expression, and
the ability of Egr2/3 to repress RAG mRNA levels (Fig. 4
mRNA
expression (Fig. 4
|
-selection checkpoint
Enforced expression of Egr1, 2, and 3 in SCID.adh produced changes
in gene expression characteristic of thymocytes induced to transit
through the
-selection checkpoint. Consequently, we examined their
respective abilities to relieve the developmental arrest caused by
pre-TCR deficiency. Day 14 fetal thymocytes from CD3
-deficient
(CD3
-/-) mice, in which pre-TCR function is
attenuated (27), were retrovirally transduced with
LZRS-Egr1, 2, and 3, or with empty vector, LZRS. Transduced thymocytes
(i.e., GFP+ cells) were cultured in vitro for 3
days before flow cytometric assessment of their developmental
progression. Consistent with a previous report (16), we
found that enforced expression of Egr1 restored the development of
CD3
-/- thymocytes past their point of
developmental arrest at the DNIII stage, resulting in a
4-fold
increase in the absolute numbers of thymocytes that progressed to the
CD8 ISP stage and an increase in the ratio of DNIV:DNIII cells,
relative to the LZRS control (Figs. 1
and 5
and Table II
). Likewise, Egr2 and Egr3 promoted a
2-fold increase in the number of CD3
-/-
thymocytes that progressed beyond the
-selection checkpoint at DNIII
and on to the CD8 ISP stage. Interestingly, Egr2 and Egr3 also caused
an accumulation of the DNI thymic subset, indicating that their
expression at the DNI stage may be incompatible with further thymocyte
development (Fig. 5
A, Table II
). Nevertheless, enforced
expression of Egr1, 2, and 3 is able to promote development of
CD3
-/- thymocytes beyond their developmental
block at the DNIII stage indicating that the Egr proteins can
complement pre-TCR deficiency and replicate at least some aspects of
the developmental program normally initiated by pre-TCR signaling.
|
|
Our observation that enforced expression of Egr1, 2, and 3 can
replicate some aspects of the developmental program triggered by the
pre-TCR suggests that the Egr proteins are important molecular
effectors of those pre-TCR signals. However, because Egr1-deficient
thymocytes appear to develop normally, it remained unclear whether Egr
family members were truly necessary to enable the pre-TCR to promote
thymocyte development beyond the
-selection checkpoint. To resolve
this issue, we expressed Egr dominant-negative proteins in fetal
thymocytes with normal pre-TCR function to determine whether they could
interfere with normal thymocyte development. Three dominant negative
proteins were used: 1)
Egr1, which retains the Egr1 zinc finger
containing DNA-binding domain, but deletes the amino terminal
activation domain (32); 2) WT1:Egr1, which fuses the
DNA-binding domain of Egr1 (aa 337427) to the
NH2-terminal transcriptional repressor domain
(307 aa) of the Wilms tumor-associated protein (33); and
3) Nab1, an endogenous corepressor which is widely expressed in the
adult mouse and can inhibit Egr1, 2, and 3 by binding to a homologous
repressor site positioned N-terminal to the DNA-binding domain
(17, 34). The ability of these proteins to interfere with
Egr-mediated transactivation and repression has been established in a
variety of different tissues (32, 33, 35, 36). In
addition, we have verified that Nab-1 can antagonize the ability of
Egr1 to induce down-modulation of CD25 in SCID.adh (our unpublished
observations). It should also be noted that, because Egr1, 2,
and 3 share at least 90% homology within their DNA-binding domains
(18) and each has been reported to bind to identical
target sequences (17), it is likely that
Egr1 and
WT1:Egr1 could be able to interfere with the function of Egr family
members in addition to Egr1. Day 14 fetal thymocytes from wild-type
mice were retrovirally transduced with vector control (LZRS) or the
three dominant negatives described above. Transduced thymocytes were
introduced into both short term cultures in vitro (3 days; Fig. 6
, A and B; Table III
) and into depleted thymic lobes for
long term culture (6 days; Fig. 6
C; Table III
). Flow cytometric analysis of the transduced
(GFP+) thymocytes revealed that all three
dominant negatives interfered with thymocyte development to the DP
stage (Fig. 6
, A and C; Table III
). Specifically,
these dominant negative proteins inhibited development to the CD8 ISP
stage and caused an accumulation of thymocytes at the DNIII stage, as
indicated by the decrease in the ratio of DNIV:DNIII cells (Fig. 6
, A and B; Table III
). These data demonstrate that
the function of Egr family members is required for development of DN
thymocytes to the DP stage. Finally, because Egr1 deficiency alone does
not prevent thymocyte development to the DP stage (16),
the ability of these dominant negative proteins to interfere with
development of DN thymocytes to the DP stage and to cause an
accumulation of DNIII thymocytes suggests that the dominant negative
proteins interfere with the function of all three of the Egr factors
induced as thymocytes traverse the
-selection checkpoint.
|
|
-selection checkpoint in response to
pre-TCR signaling. Second, Egr family members are capable, in the
absence of a pre-TCR signal, of replicating several of the phenotypic
changes characteristic of thymocytes progressing through the
-selection checkpoint. In particular, because of the differential
ability of Egr1, 2, and 3 to modulate expression of pre-T
, RAG, and
TCR-
, these changes in gene expression are not a downstream
consequence of development. Instead, these genes may in fact be direct
targets of the Egrproteins. Finally, Egr function is necessary for
thymocyte development to the DP stage, because development of DN
thymocytes to the DP stage is impaired by three dominant-negative
proteins that inhibit Egr function through two distinct mechanisms. | Discussion |
|---|
|
|
|---|
-selection checkpoint at DNIII and
on to the DP stage, our understanding of the way in which proximal
pre-TCR signals are linked to changes in gene expression that define
this developmental transition remains rudimentary. We report here that
induction of Egr family members, Egr1, 2, and 3, coincides both with in
vitro maturation of the SCID.adh thymic lymphoma and with pre-TCR
activation in vivo. We have shown that enforced expression of
individual Egr family members is sufficient to replicate at least some
of the phenotypic changes characteristic of
-selection, and we have
identified some of the genes whose expression is modulated by Egr
factors. Finally, we have shown that dominant negative
proteins that interfere with the function of Egr family members are
able to attenuate the ability of the pre-TCR to promote development of
thymocytes from the DN to the DP stage. Taken together, these data
demonstrate that the Egr proteins play an important role in enabling
the pre-TCR to execute the developmental program responsible for
progression of thymocytes beyond the
-selection checkpoint, placing
Egr1, 2, and 3 among the select few DNA-binding proteins known to
do so.
Pre-TCR activation induces DN thymocytes to traverse the
-selection
checkpoint which triggers a pleiotropic developmental program resulting
in rescue from apoptosis, proliferation, differentiation to the DP
stage, and allelic exclusion at the TCR-
locus (6).
Although there has been progress in defining some of the proximal
branch points for signals that regulate the various aspects of the
-selection program, there is little known regarding the identity of
specific transcription factors that lie downstream of those bifurcation
points (6). Our analysis of the genes regulated by Egr
proteins in thymocytes, taken together with analysis of Egr protein
function in other cell types, suggests that they may play a role in
manifesting a subset of the developmental fates specified by the
pre-TCR. Indeed, the TCR-
locus is transactivated by Egr1 and Egr3,
but not significantly by Egr2. Likewise, enforced expression of Egr2
and Egr3 markedly down-modulates RAG-1 and RAG-2. Because of the
importance of these events in V(D)J recombination, it is possible that
the Egr proteins play a role in regulating onset or termination of this
process. In other cell types, Egr1 has been implicated in regulating
proliferation and cell survival (18). Although it is
unclear from our studies how the Egr proteins affect proliferation of
normal thymocytes, the Egr factors may be having an
anti-proliferative effect because Egr-transduced thymocytes are
gradually lost from thymic lobes by 7 days of organ culture (our
unpublished observations). Likewise, it is unclear how Egr
factors affect thymocyte survival; however, it is unlikely that the
ability of Egr proteins to promote development beyond the
-selection
checkpoint is simply the result of rescue from apoptosis, because
genetic manipulations that alter thymocyte survival do not typically
result in the acute transition of DNIII thymocytes to the DNIV stage,
as we have observed following Egr transduction (Fig. 5
; Refs.
37, 38, 39). In fact, Egr1 has been shown to induce apoptosis
in transformed cells (18), including SCID.adh. Although
enforced expression of Egr proteins induces in vitro maturation of the
SCID.adh, those cells that have been induced to differentiate go on to
die by an apoptotic mechanism (our unpublished observations).
Our evidence demonstrates that the Egr proteins are required for some
of the developmental outcomes associated with
-selection; however,
the inability of Egr proteins to promote differentiation beyond the CD8
ISP stage indicates that there are aspects of this developmental
transition that the Egr proteins may not control. Further analysis will
be required to clarify which aspects of the
-selection
differentiation program are under direct control of the Egr proteins
and to understand what role each Egr family member plays in these
processes.
The four Egr family members share at least 84% homology between their
zinc-finger DNA-binding domains and bind identical GC-rich target
motifs (17). As a result, it was previously thought that
differences in the spectrum of genes modulated by particular Egr
proteins might be due to their differential expression in response to
various stimuli; however, we demonstrate here that Egr1, 2, and 3 are
all induced across the DNIII/DNIV transition, yet exhibit some degree
of functional specificity, i.e., differences in CD25 down-modulation,
RAG gene repression, and TCR
activation. There are several potential
explanations for these differential effects (Fig. 4
). First, it is
possible that protein domains other than the zinc finger DNA-binding
domains influence the spectrum of genes whose expression the Egr
proteins modulate. The fact that the NH2-terminal
activation domains of the Egr family exhibit a relative lack of
homology (<40%; Refs. 17 and 18) raises the
possibility that these domains might influence Egr target specificity
through differential phosphorylation of the large number of serine
residues present in their N termini or through differential interaction
with transacting factors which bind to the N-termini of the Egr
proteins. Indeed, both Nab1 and Nab2 are endogenous corepressors of Egr
proteins that are expressed in the thymus (40, 41).
Although the Nab proteins do not appear to influence Egr target gene
specificity, there may be other regulatory proteins in thymocytes that
are able to do so. Second, the relative stability of Egr proteins could
also impact upon their ability to induce specific changes in gene
expression. Interestingly, it was recently reported that Egr1 protein
is about 10-fold less stable than Egr2 and Egr3 when expressed in
CV-1 cells (34). Third, the ability of an Egr
family member to act on a consensus binding sequence may be influenced
by that motifs chromosomal context (17, 42, 43, 44) or by
the binding of other transcriptional regulators. Any combination of
these possibilities could influence the target range of a particular
Egr family member.
The changes in expression of CD28, TCR
, pre-T
, and the RAG genes
that occur as thymocytes differentiate from the DN to the DP stage are
well documented (7, 8, 10, 11, 45); however, the identity
of the DNA-binding proteins that trigger these changes remains an
important unanswered question. Our data indicate that enforced
expression of Egr1, 2, and 3 increases the surface expression of CD28.
It was recently demonstrated that Egr1 can transactivate reporter
constructs containing G-rich CD28, a novel promoter element
within CD28 exon 1 which serves as the predominant
cis-acting element for regulating CD28 expression
(46). Consequently, induction of the Egr factors during
traversal of the
-selection checkpoint is likely to play an
important role in the transactivation of CD28 during development of DN
thymocytes to the DP stage. Furthermore, we show here that enforced
expression of Egr1, 2, and 3 is able to regulate expression of
pre-T
, RAG-1, RAG-2, and TCR
mRNA. Although we have not
demonstrated that these changes in gene expression are the direct
result of Egr action, direct transcriptional regulation of pre-T
,
RAG-1, RAG-2, and TCR-
by the Egr proteins is a likely possibility
for three reasons: 1) the close temporal correlation between Egr
induction and modulation of their expression; 2) particular Egr
proteins have differential effects on these genes; and 3) inspection of
the regulatory sequences of these genes revealed the presence of
putative Egr binding sites. Egr proteins can repress transcription by
displacement of Sp1, a well characterized, ubiquitous zinc
finger-containing, DNA-binding protein (47). Importantly,
this repression-by-displacement mechanism appears to require more than
just the DNA-binding domain of the Egr protein, because it can be
blocked by overexpression of an Egr1 construct lacking the N-terminal
regulatory domain (48). Genes whose expression is
down-regulated in this manner are distinguished by the absence of a
proximal TATA or CAAT box and the presence of overlapping Sp1/Egr1
binding sites (18, 47). Interestingly, these
distinguishing features are found in the pre-T
promoter and
enhancer, and the promoters of RAG-1 and RAG-2 (49, 50, 51).
Moreover, as predicted for the Sp1 displacement mechanism, our data
indicates that Egr-mediated inhibition of pre-T
and RAG gene
expression occurs in a dose-dependent manner because down-modulation of
the pre-T
and RAG genes is always more pronounced in fraction C
where Egr expression is highest (compare fractions B and C in Fig. 4
, B and C).
The minimal TCR-
enhancer (E
) and the recently characterized
J
49 promoter are two of the regulatory sequences important in
controlling transactivation of the TCR
locus and both contain GC
boxes, which are potential Egr binding sites (10, 52).
Because E
and the J
promoter elements are important in
controlling transactivation of the
locus (53), and
transcriptional activation is crucial in increasing the accessibility
of the
locus to the V(D)J recombination machinery, it is possible
that Egr1 and Egr3 play a critical role in preparing the
locus for
rearrangement. Indeed, a recent report indicates that GC-II, a possible
Egr binding site within E
, undergoes a change in its DNase I
hypersensitivity when the TCR-
locus is activated (54),
suggesting a change in the architecture of preassembled protein
complexes bound at E
(54). Establishing that the Egr
proteins act to prepare the
locus for rearrangement would be a
particularly important finding given that all of the DNA-binding
proteins currently thought to be required for E
function are already
bound to E
before pre-TCR activation (52, 54).
Furthermore, the increase in TCR-C
transcripts induced by enforced
expression of Egr1 and Egr3 is significantly less than the increase in
TCR-C
transcripts induced by TAC:CD3
stimulation of SCID.adh (our
unpublished observations) suggesting that Egr proteins act
cooperatively with other transcriptional regulators to activate
TCR-C
transcription. One likely candidate is NF-AT, which is
activated by pre-TCR signals (55). In agreement with this
hypothesis is the presence of two consensus Egr/NF-AT composite binding
sites within the J
49 promoter. Moreover, it is noteworthy that both
Egr1 and Egr3 have been shown to work synergistically with NF-AT at
such composite binding sites to activate CD95 ligand expression
(56). Experiments are in progress to determine
conclusively whether Egr proteins are acting directly on the TCR
as
well as the pre-T
and RAG genes.
Our findings demonstrate that the development of immature thymocytes
through the
-selection checkpoint requires the function of Egr
family members, thereby adding Egr1, Egr2, and Egr3 to the select group
of DNA binding proteins whose activity is known to be essential for
this developmental transition. Moreover, Egr family members are the
only DNA-binding proteins whose enforced expression is able to
replicate many of the phenotypic changes that are associated with
progression through the
-selection checkpoint. Finally, our
observations highlight both functional redundancies and differences in
the abilities of individual Egr family members to induce changes in
gene expression that are characteristic of
-selection, raising the
possibility that this family of transcription factors may help to
subdivide the pre-TCR signaling cascade into the diverse cellular
outcomes that occur as a result of progression through the
-selection checkpoint. We plan to extend these findings by assessing
the contribution of each of the Egr family members to the developmental
outcomes associated with
-selection, by determining whether TCR-
,
pre-T
, and RAG are direct targets, and by investigating the
molecular basis for the target gene specificity of Egr family
members.
| Acknowledgments |
|---|
Egr1;
Dr. J. Milbrandt for providing mouse Egr2, rat Egr3, rat Egr4
and mouse Nab1; and Dr. V. M. Rangnekar for providing WT1:Egr1. We
thank Dr. N. Ruetsch for providing technical
assistance with the RT-PCR assays. We thank Drs. M. Krangel,
D. Kappes, J. Svaren, and A. Singer for critical
review of this manuscript. Finally, we gratefully acknowledge the
assistance of the following core facilities of the Fox Chase Cancer
Center: Cell Culture, DNA Sequencing, DNA Synthesis, Flow Cytometry,
Laboratory Animal, and Special Services. | Footnotes |
|---|
2 M.C. and M.C.H. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to: Dr. David L. Wiest, Fox Chase Cancer Center, Division of Basic Sciences, Immunobiology Working Group, 7701 Burholme Avenue, Philadelphia, PA 19111. E-mail address: DL_Wiest{at}FCCC.edu ![]()
4 Current address: Purdue BioPharma, Princeton, NJ 08540. ![]()
5 Abbreviations used in this paper: DN, double negative; DP, double positive; Egr, early growth response; IRES, internal ribosomal entry site; eGFP, enhanced green fluorescence protein; RAG, recombination-activating gene; ISP, immature single positive; TAC, human IL-2R
subunit; Phoenix-E, phoenix ecotropic; NGFI, nerve growth factor inducible. ![]()
Received for publication October 18, 2001. Accepted for publication December 4, 2001.
| References |
|---|
|
|
|---|
chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[Medline]
chain genes in thymocytes: a critical role for the
chain in development. Cell 73:513.[Medline]
gene locus and silencing of the pre-TCR
locus: implications for intrathymic differentiation. Int. Immunol. 9:1475.
locus in its accessible configuration. Eur. J. Immunol. 27:1619.[Medline]
gene located upstream of J
49 locus. Eur. J. Immunol. 28:1368.[Medline]
locus allelic exclusion and initiation of TCR-
locus rearrangement in immature thymocytes by signaling through the CD3 complex. Eur. J. Immunol. 25:1257.[Medline]
gene expression by the transcription factors LEF-1 and TCF-1. Immunity 8:11.[Medline]
, but not by surface pre-TCR complexes, are able to induce maturation of an early thymic lymphoma in vitro. J. Immunol. 163:2576.
chain. Br. J. Haematol. 103:335.[Medline]
chain is essential for development of both the TCR
and TCR
lineages. EMBO J. 17:1871.[Medline]
-mediated signals rescue the development of CD4+CD8+ thymocytes in RAG-2-/- mice in the absence of TCR
chain expression. Int. Immunol. 6:995.
gene. J. Biol. Chem. 275:9749.
B activation by the pre-T cell receptor serves as a selective survival signal in T lymphocyte development. Immunity 13:677.[Medline]