The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamanishi, Y.
Right arrow Articles by Firestein, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamanishi, Y.
Right arrow Articles by Firestein, G. S.
The Journal of Immunology, 2002, 168: 1405-1412.
Copyright © 2002 by The American Association of Immunologists

Expression and Regulation of Aggrecanase in Arthritis: The Role of TGF-{beta}1

Yuji Yamanishi*, David L. Boyle*, Melody Clark{dagger}, Rich A. Maki{dagger}, Micky D. Tortorella{ddagger}, Elizabeth C. Arner{ddagger} and Gary S. Firestein2,*

* Division of Rheumatology, Allergy, and Immunology, University of California at San Diego School of Medicine, La Jolla, CA 92093; {dagger} Neurocrine, La Jolla, CA; and {ddagger} Pharmacia Discovery Research, Skokie, IL 60077


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aggrecanases are key matrix-degrading enzymes that act by cleaving aggrecan at the Glu373-Ala374 site. While these fragments have been detected in osteoarthritis (OA) and rheumatoid arthritis (RA) cartilage and synovial fluid, no information is available on the regulation or expression of the two key aggrecanases (aggrecanase-1 and aggrecanase-2) in synovial tissue (ST) or fibroblast-like synoviocytes (FLS). The aggrecanase-1 gene was constitutively expressed by both RA and OA FLS. Real-time PCR demonstrated that TGF-{beta} significantly increased aggrecanase-1 gene expression in FLS. Aggrecanase-1 induction peaked after 24 h of TGF-{beta} stimulation. The expression of aggrecanase-1 mRNA was significantly greater in RA ST than in OA or nonarthritis ST. Aggrecanase-2 mRNA and protein were constitutively produced by nonarthritis, OA, and RA FLS but were not increased by IL-1, TNF-{alpha}, or TGF-{beta}. Furthermore, OA, RA, and nonarthritis ST contained similar amounts of immunoreactive aggrecanase-2. The major form of the aggrecanase-2 enzyme was 70 kDa in nonarthritis ST, whereas a processed 53-kDa form was abundant in RA ST. Therefore, aggrecanase-1 and -2 are differentially regulated in FLS. Both are constitutively expressed, but aggrecanase-1 is induced by cytokines, especially TGF-{beta}. In contrast, aggrecanase-2 protein may be regulated by a post-translational mechanism in OA and RA ST. Synovial and FLS production of aggrecanase can contribute to cartilage degradation in RA and OA.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aggrecan provides the cartilage with its mechanical properties of compressibility and resilience during joint loading. Depletion of glycosaminoglycan (GAG)3-bearing aggrecan fragments from articular cartilage is one of the earliest events in cartilage destruction in inflammatory or degenerative joint diseases. Proteolytic cleavage of aggrecan in its interglobular domain (IGD) is responsible for its loss from cartilage (1, 2, 3, 4, 5). Two major proteolytic cleaving sites have been identified within the IGD. The first, located between amino acid residues Asn341-Phe342, can be cleaved by several matrix metalloproteinases (MMPs), including MMP-1, -2, -3, -7, -8, -9, and -13 (3, 6, 7, 8). The other site, located at Glu373-Ala374, is the proteolytic site for an activity defined as aggrecanase.

Amino acid sequence analysis of the aggrecan fragments in synovial fluid from patients with inflammatory or degenerative joint diseases has revealed that the cleavage by aggrecanase at Glu373-Ala374 predominates (2, 4), although some fragments cleaved at Asn341-Phe342 are also detected (9, 10). Stimulation of cartilage explant degradation by inflammatory cytokines also indicates that aggrecanase is a major enzyme that cleaves in aggrecan in vitro (11, 12). These findings suggest that aggrecanase plays a significant role in aggrecan degradation, although the relative contribution of MMPs is not known. Recently, two members of a disintegrin and metalloproteinase with thrombospondin motif (ADAMTS) family, aggrecanase-1 (ADAMTS-4) and aggrecanase-2 (ADAMTS-5/11), have been purified and cloned (13, 14). The ADAMTS family comprises an N-terminal propeptide domain with a furin-processing site, a metalloproteinase domain, a disintegrin-like domain, and a variable number of thrombospondin type 1 motifs.

The regulation of aggrecanase expression in human joint diseases remains poorly defined, especially for synovium and fibroblast-like synoviocytes (FLS). In the present study we examined FLS and synovial tissue (ST) obtained from patients with rheumatoid arthritis (RA) and osteoarthritis (OA) and from nonarthritis individuals and determined the expression and regulation of aggrecanase-1 and -2. These studies demonstrate differential regulation of the two enzymes, with TGF-{beta} playing a key role in the induction of aggrecanase-1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Materials were purchased from the following sources: DMEM, glutamine, penicillin-streptomycin, gentamicin, and FCS from Life Technologies (Grand Island, NY); IL-1{beta} and TNF-{alpha} from Roche (Mannheim, Germany); TGF-{beta} from R&D Systems (Minneapolis, MN); RNA STAT-60 from Tel-Test (Friendswood, TX); ProSTAR First-Strand RT-PCR kit from Stratagene (La Jolla, CA); SYBR Green PCR Master Mix from PE Applied Biosystems (Foster City, CA); baculovirus vector pVL 1392 and BaculoGold from BD PharMingen (San Diego, CA); anti-FLAG mAb M2 from Sigma-Aldrich (St. Louis, MO); and DC Protein Assay kit from Bio-Rad (Hercules, CA). Ab BC-3 binds to the new N-terminal ARGS on aggrecan fragments produced by aggrecanase cleavage at the Glu373-Ala374 bond (University of Wales, Cardiff, U.K.) (15, 16).

ST and patients

ST samples for Western blot and RT-PCR analysis were obtained from RA (n = 15) and OA (n = 6) patients who underwent joint replacement (except one RA patient who had arthroscopic synovectomy). ST from individuals without arthritis were also obtained at the time of arthroscopy from patients with cruciate ligament injury (n = 2), meniscus injury (n = 6), or discoid meniscus (n = 1). Additional samples obtained from RA and OA patients were used to derive FLS cell lines (see below). The diagnosis of RA conformed to the 1987 American College of Rheumatology revised criteria for RA (17), and the diagnosis of OA conformed to the American College of Rheumatology criteria for the knee (18). The ST from cruciate ligament injury, meniscus injury, and discoid meniscus patients were histopathologically normal. All tissue samples were immediately frozen and stored at -80°C until use.

FLS preparations

FLS were prepared from nonarthritis (n = 1), RA (n = 5), and OA (n = 5) ST as described previously (19). Briefly, the tissues were aseptically minced and incubated with 1 mg/ml collagenase in serum-free DMEM for 2 h at 37°C, filtered through a nylon mesh, extensively washed, and cultured in DMEM containing 10% FCS, 2 mM glutamine, 50 µg/ml gentamicin, 100 U/ml penicillin, and 100 µg/ml streptomycin (culture medium) in a humidified 5% CO2 atmosphere. After overnight culture nonadherent cells were removed and adherent cells were cultured in the standard culture medium. At confluence cells were trypsinized, split at a 1:3 ratio, and recultured in the culture medium. Synoviocytes were used from passages three through nine in these experiments, during which time they were a homogeneous population of FLS (<1% expression of CD11b, CD14, CD3, CD68 and Fc{gamma}RII, and <1% phagocytic) (19).

Real-time PCR

Total RNA was isolated from ~2 x 106 cultured FLS or frozen ST using RNA STAT-60, and extracted RNA was reverse transcribed into cDNA with random primers and Moloney murine leukemia virus reverse transcriptase according to the manufacturer’s protocol (ProSTAR First-Strand RT-PCR kit). PCR amplification was performed using the GeneAmp 5700 Sequence Detection System (PE Applied Biosystems). Primers were designed and selected using Primer Express software (PE Applied Biosystems). The sequences of the forward and reverse primers are as follows: aggrecanase-1 (ADAMTS-4) forward, GACACTGGTGGTGGCAGATG; aggrecanase-1 (ADAMTS-4) reverse, TCACTGTTAGCAGGTAGCGCTTTA; aggrecanase-2 (ADAMTS-5/11) forward, TGGCTCACGAAATCGGACA; aggrecanase-2 (ADAMTS-5/11) reverse, GGAACCAAAGGTCTCTTCACAGA; GAPDH forward, GAAGGTGAAGGTCGGAGTC; and GAPDH reverse, GAAGATGGTGATGGGATTTC. The PCR mixture consisted of 1x SYBR Green PCR Master Mix, which includes AmpliTaq Gold DNA polymerase, SYBR Green I Dye, dNTPs with dUTP, Passive Reference and PCR buffer, 200 nM forward and reverse primers, and cDNA of samples in a total volume of 50 µl. PCR was run using the following protocol: initial activation of AmpliTaq Gold DNA polymerase at 94°C for 5 min, 40 cycles of 94°C for 15 s and 60°C for 1 min, and dissociation protocol, which is defined as a hold at 95°C for 15 s, a hold at 60°C for 20 s, and a slow ramp (20 min) from 60 to 95°C. Using dissociation protocol, single peaks were confirmed in each of the aggrecanase-1, aggrecanase-2, and GAPDH PCR to exclude nonspecific amplification. Each sample was performed by triplicate or duplicate. Direct detection of PCR product was monitored in real-time by measuring the increase in fluorescence caused by the binding of SYBR Green I Dye to dsDNA, using the GeneAmp 5700 Sequence Detection System. Subsequently, the threshold cycle (Ct), i.e., the cycle number at which the amount of amplified gene of interest reached a fixed threshold, was determined.

Relative quantification of aggrecanase-1 or aggrecanase-2 mRNA expression was calculated by the comparative Ct method described by the manufacturer (PE Applied Biosystems) after confirming that aggrecanase and GAPDH cDNAs were amplified with the same efficiency (i.e., the absolute values of the slope of log input amount were within <0.1 of each other). The relative quantification value of target, normalized to an endogenous control and relative to a calibrator, is expressed as 2-{Delta}{Delta}Ct (fold), where {Delta}Ct = Ct of target gene (aggrecanases) - Ct of endogenous control gene (GAPDH), and {Delta}{Delta}Ct = {Delta}Ct of samples for target gene - {Delta}Ct of the calibrator for the target gene.

Anti-aggrecanase Abs

Anti-aggrecanase-2 Ab (Ab250) was raised in rabbits by Alpha Diagnostic International (San Antonio, TX). An 18-aa oligopeptide (VDKTKKKYYSTSSHGNWG) corresponding to a region in the disintegrin-like domain of human aggrecanase-2 was identified and has no homology to any other protein in GenBank using the National Center for Biotechnology Information basic local alignment search tool program, including aggrecanase-1 or other ADAMTS family members. The peptide was coupled to keyhole limpet hemocyanin and injected into rabbits. Blood was tested by ELISA, and the titer of the Ab used in these studies was 1/100,000 against the original peptide. Ab250 was used in a 1/1000 dilution and detected the correct size bands of aggrecanase-2 in Western blot experiments (see Results). Rabbit anti-aggrecanase-1 Ab was prepared to the peptide sequence VMAHVDPEEP (residues 502–511) and purified over a protein G-Sepharose column, and the protein concentration was determined using bicinchoninic acid reagent. The immunizing peptide for the Ab blocked binding to the Ag (data not shown).

Preparation of recombinant human aggrecanase-2 protein

Recombinant human aggrecanase-2 from the furin cleavage site to the stop codon was generated by PCR, modified to contain an N-terminal signal sequence from the agouti gene-related peptide gene, followed by the FLAG sequence, and cloned into the baculovirus vector pVL 1392. Sf9 cells were cotransfected with BaculoGold according to the manufacturer’s recommendations. Secreted protein expression was checked on Western blot analysis using the anti-FLAG mAb M2, and recombinant human aggrecanase-2 FLAG was purified using the M2 agarose affinity resin with elution in 0.1 M glycine HCl, pH 3. The pH was adjusted by adding 1 M Tris-HCl, pH 8, and dialyzing against PBS, pH 7.2, overnight.

Western blot analysis of aggrecanase protein

Cultured FLS (~5 x 106/10-cm tissue culture dishes) were harvested and washed with PBS, and protein was extracted using RIPA buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS). Similarly, frozen ST were pulverized, and tissue protein was extracted in the same manner. The protein concentrations were determined by the DC Protein Assay kit. Samples containing 10 µg of protein from cultured FLS or 20 µg of protein from ST were fractionated by 8% SDS-PAGE and transferred onto a nitrocellulose membrane in transfer buffer (39 mM glycine, 48 mM Tris base, 0.037% SDS, and 20% methanol) at 100 mA for 2 h. The membranes were blocked in TBS containing 0.1% Tween 20 and 5% dry milk for 1 h at room temperature. The anti-aggrecanase-2 Ab (Ab250) was added and incubated overnight at 4°C. Following three washes in TBS plus 0.1% Tween 20, the membrane was incubated with HRP-conjugated secondary Ab for 1 h at room temperature. The aggrecanase-2 protein expression was visualized by chemiluminescence, using hydrogen peroxide and luminol as a substrate. For aggrecanase-1, the membranes were first incubated with a 1/1000 dilution of the rabbit Ab. After washing, they were then incubated with a 1/5000 dilution of goat anti-rabbit IgG alkaline phosphatase conjugate as the secondary Ab. Products were visualized by developing the blots in 5-bromo-4-chloro-3-indolyl-1-phosphate nitroblue tetrazolium color developing reagent. Overnight transfer resulted in complete transfer of both low and high m.w. fragments. The density of the target bands was analyzed using National Institutes of Health Image (version 1.61; National Institutes of Health, Bethesda, MD). Results are expressed as arbitrary densitometry units (AU).

Aggrecanase functional assay

Bovine nasal cartilage was sliced and aggrecan was extracted as previously described (20). FLS were incubated in serum-free or 0.5% FCS medium (2.5 x 106 FLS) in the presence or the absence of TGF-{beta} (10 ng/ml). Supernatants were collected after 48 h, and 25 µl was incubated with 500 nM purified bovine nasal aggrecan monomer (20). Chondroitin sulfate and keratan sulfate polysaccharide chains were removed by further incubating with chondroitinase ABC (0.1 U/ml), keratanase (0.1 U/ml), and keratanase II (0.01 U/ml). The protein was then separated by SDS-PAGE using 4–12% gels and transferred to polyvinylidene difluoride membranes. Aggrecan fragments containing the neoepitope created after cleavage at amino acids Glu373 and Ala374 were detected using the mAb BC-3. Subsequently, the membranes were incubated with goat anti-mouse IgG alkaline phosphatase conjugate and developed with 5-bromo-4-chloro-3-indolyl-1-phosphate nitroblue tetrazolium.

Statistical analysis

Statistical significance was analyzed using the software package StatView 4.5 (Abacus Concepts, Berkeley, CA). Data are expressed as the mean ± SEM. Comparisons among three or more groups were made by a Kruskal-Wallis test, and those between two groups were made by a Mann-Whitney test. A value of p < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aggrecanase-1 and -2 mRNA expression in cultured FLS

Initial experiments were performed to determine whether the aggrecanase genes are constitutively expressed by cultured FLS. cDNAs were prepared from cultured FLS and amplified using specific primers for aggrecanase-1, aggrecanase-2, and GAPDH. The PCR products were resolved by agarose gel electrophoresis. Single specific bands corresponding to each gene product were identified and indicated that aggrecanase-1 and aggrecanase-2 are both expressed by RA, OA, and nonarthritis FLS (see Fig. 1Go). No significant differences in mRNA expression were observed among FLS from the various sources. To confirm this observation, relative aggrecanase-1 or aggrecanase-2 mRNA expression of RA (n = 5) and OA (n = 5) compared with nonarthritis FLS (n = 1) was then determined by real-time PCR. There were no significant differences in relative aggrecanase-1 or aggrecanase-2 mRNA expression between RA and OA FLS (p > 0.1).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Constitutive expression of aggrecanase-1 and aggrecanase-2 mRNA by RT-PCR in cultured FLS. Total RNA was isolated from cultured FLS from RA, OA, and nonarthritis (NA) patients, and RNA samples were subjected to RT-PCR. PCR products were visualized by agarose gel electrophoresis. Single specific bands correspond to each gene product (aggrecanase-1, 74 bp; aggrecanase-2, 75 bp; GAPDH, 226 bp).

 
Aggrecanase-1 and -2 mRNA regulation by cytokines

Because cytokines play a key role in matrix destruction, we evaluated their effects on aggrecanase regulation. FLS were stimulated with IL-1{beta} (10 ng/ml), TNF-{alpha} (100 ng/ml), or TGF-{beta} (10 ng/ml) for 24 h, and real-time PCR was used to determine relative aggrecanase-1 gene expression compared with unstimulated controls (n = 7 separate experiments). Aggrecanase-1 mRNA expression was increased 1.3 ± 0.3-fold by IL-1{beta}, 2.9 ± 0.7-fold by TNF-{alpha}, and 12.7 ± 4.6-fold by TGF-{beta} (see Fig. 2Go). Aggrecanase-1 mRNA expression was significantly higher in TGF-{beta}-stimulated samples (p < 0.01) compared with unstimulated samples. Although there was a trend toward increased aggrecanase-1 mRNA expression in TNF-{alpha}-stimulated samples (p = 0.06), this did not reach statistical significance. Surprisingly, aggrecanase-2 gene expression was not affected by IL-1{beta}, TNF-{alpha}, or TGF-{beta} (n = 5 separate experiments; see Fig. 3Go).



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 2. Aggrecanase-1 mRNA regulation by cytokines. FLS were stimulated with IL-1{beta} (10 ng/ml), TNF-{alpha} (100 ng/ml), or TGF-{beta} (10 ng/ml) for 24 h, and real-time PCR was used to determine relative aggrecanase-1 gene expression compared with unstimulated controls (n = 7 separate experiments). *, p < 0.01 vs medium.

 


View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 3. Aggrecanase-2 mRNA regulation by cytokines. FLS were stimulated with IL-1{beta} (10 ng/ml), TNF-{alpha} (100 ng/ml), or TGF-{beta} (10 ng/ml) for 24 h, and real-time PCR was used to determine relative aggrecanase-2 gene expression compared with unstimulated controls (n = 5 separate experiments). Aggrecanase-2 mRNA expression was not significantly altered by IL-1{beta}, TNF-{alpha}, or TGF-{beta}.

 
Time course and dose response of aggrecanase-1 regulation by TGF-{beta}

Because TGF-{beta} was the most potent inducer of aggrecanase-1 gene expression, we characterized its effect more extensively. FLS were cultured in the presence of TGF-{beta} (10 ng/ml), and total RNA was extracted after 0–48 h. Relative aggrecanase-1 mRNA expression compared with unstimulated controls was then determined by real-time PCR (n = 3 separate experiments). As shown in Fig. 4GoA, aggrecanase-1 mRNA expression increased within 6 h, peaked after 24 h, and then decreased toward baseline. The dose response for TGF-{beta}-induced aggrecanase-1 expression was then determined. FLS were cultured in the presence of increasing concentrations of TGF-{beta} (0–10 ng/ml) for 24 h, and relative aggrecanse-1 mRNA expression compared with unstimulated controls was determined by real-time PCR. Fig. 4GoB shows that relative aggrecanase-1 gene expression increased significantly with 1 ng/ml and was highest at 10 ng/ml TGF-{beta}, which is similar to the concentration of TGF-{beta} in RA synovial fluid (21, 22).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 4. Time course and dose response of aggrecanase-1 mRNA regulation by TGF-{beta}. A, Time course. FLS were cultured in the presence of TGF-{beta} (10 ng/ml), and total RNA was extracted after 0, 6, 12, 24, and 48 h. Relative aggrecanase-1 mRNA expression compared with unstimulated controls was then determined by real-time PCR. Aggrecanase-1 mRNA expression increased within 6 h, peaked after 24 h, and then decreased toward baseline. *, p < 0.01 vs 0 h. Data are representative of three individual experiments. B, Dose response. FLS were cultured in the presence of increasing concentrations of TGF-{beta} (0, 0.1, 1, and 10 ng/ml) for 24 h, and aggrecanse-1 mRNA expression compared with unstimulated controls was determined by real-time PCR. *, p < 0.02 vs 0 ng/ml.

 
Aggrecanase-1 protein expression and regulation in cultured FLS

PCR studies indicated that TGF-{beta} increases aggrecanase-1 mRNA expression in cultured FLS. Therefore, we also examined the cells for aggrecanase-1 protein expression. Cell protein was extracted from RA FLS (n = 4), and Western blot analysis was performed using a selective anti-aggrecanase-1 Ab. A single band near 90 kDa corresponding to the molecular mass of unprocessed aggrecanase-1 was observed in one of four FLS lines examined (see Fig. 5Go). To determine the regulation of aggrecanase-1 protein expression by TGF-{beta}, FLS were incubated with either medium or TGF-{beta} (10 ng/ml) for 24 h. Aggrecanase-1 protein expression in cell lysates was determined by Western blot analysis (n = 4). The 90-kDa aggrecanase along with smaller amounts of lower molecular mass forms were increased by TGF-{beta} in two of the four lines tested (Fig. 5Go).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 5. Aggrecanase-1 protein expression and regulation in cultured FLS. Cell protein was extracted from medium- and TGF-{beta}-stimulated FLS, and aggrecanase-1 protein expression was evaluated by Western blot analysis. Lane 1, FLS line 1, medium; lane 2, FLS line 2, medium; lane 3, FLS line 1, TGF-{beta}; lane 4, FLS line 2, TGF-{beta}. The band near 90 kDa corresponding to the molecular mass of unprocessed aggrecanase-1 was observed in one of four lines tested and was increased by TGF-{beta} in two of four lines. The lower molecular mass bands probably correspond to processed aggrecanase-1.

 
Characterization of anti-aggrecanase-2 Ab

In addition to evaluating aggrecanase-2 mRNA expression we raised rabbit polyclonal Ab against a specific peptide fragment of aggrecanase-2. The ability of this Ab (Ab250) to bind aggrecanase-2 was evaluated by Western blot analysis. First, we examined whether Ab250 recognized recombinant human aggrecanase-2 protein, with a predicted molecular mass of 73 kDa. Fig. 6GoA shows that Ab250 detected recombinant human aggrecanase-2 protein by Western blot analysis. Because the recombinant protein also contained a FLAG tag, we were able to confirm that the same size protein was detected by anti-FLAG Ab in a separate experiment. Second, peptide absorption experiments of Ab250 were performed. After preincubating Ab250 with excess peptide (25 µg/ml Ab250), binding to the 70-kDa protein in the Western blot was decreased (see Fig. 6GoB). Third, Western blot analysis confirmed that the anti-aggrecanase-2 Ab was not present in the preimmune serum (Fig. 6GoC). Finally, using Western blot analysis of additional recombinant proteases, Ab250 did not recognize recombinant MMPs (MMP-2, -3, -13) and a disintegrin family member (kistrin; data not shown).



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 6. Characterization of anti-aggrecanase-2 (Agg-2) Ab by Western blot analysis. A, Two hundred or 400 ng of recombinant human aggrecanase-2 protein was subjected to SDS-PAGE and transferred onto a nitrocellulose membrane. The membranes were incubated with anti-aggrecanase-2 Ab (Ab250) or anti-FLAG Ab, and protein expression was visualized by chemiluminescence. Both Ab250 and anti-FLAG Ab detected recombinant human aggrecanase-2 protein, which contains a FLAG tag. B, Peptide absorption experiments of Ab250. Ten micrograms of protein from cultured FLS was used for Western blot analysis. After preincubating Ab250 with excess peptide (25 µg/ml Ab250) at 37°C for 2 h, binding to the 70-kDa protein of aggrecanase-2 in the Western blot was decreased. C, Ten micrograms of protein from cultured FLS was subjected to SDS-PAGE and transferred onto a nitrocellulose membrane. The membranes were incubated with Ab250 or preimmune serum. Ab250 detected the 70-kDa protein of aggrecanase-2 in the Western blot, but preimmune serum did not detect any protein, showing that the anti-aggrecanase-2 Ab was not present in the preimmune serum.

 
Aggrecanase-2 protein expression and regulation in cultured FLS

Because aggrecanase-2 mRNA expression in cultured FLS was observed by RT-PCR, we examined the cells for aggrecanase-2 protein expression. Cell protein was extracted from RA (n = 5), OA (n = 3), and nonarthritis FLS (n = 1), and aggrecanase-2 protein expression was evaluated by Western blot analysis. The single bands near 70 kDa corresponding to the molecular mass of aggrecanase-2 were observed in RA, OA, and nonarthritis FLS samples. There were no significant differences in aggrecanase-2 protein expression between RA and OA (RA, 3.16 ± 0.26 AU; OA, 2.54 ± 0.36 AU; nonarthritis, 3.92 AU; see Fig. 7GoA).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 7. Aggrecanase-2 protein expression and regulation in cultured FLS. A, Cell protein was extracted from RA, OA, and nonarthritis (NA) FLS, and aggrecanase-2 protein expression was evaluated by Western blot analysis. The single bands near 70 kDa corresponding to the molecular mass of aggrecanase-2 were observed in RA, OA, and NA FLS samples. B, FLS were incubated in the presence of medium, IL-1{beta} (10 ng/ml), TNF-{alpha} (100 ng/ml), or TGF-{beta} (10 ng/ml) for 24 h. Aggrecanase-2 protein expression was determined by Western blot analysis. There were no significant changes in aggrecanase-2 protein levels after IL-1{beta}, TNF-{alpha}, or TGF-{beta} stimulation.

 
To examine regulation of aggrecanase-2 protein expression by cytokines, FLS were incubated in the presence of medium, IL-1{beta} (10 ng/ml), TNF-{alpha} (100 ng/ml), or TGF-{beta} (10 ng/ml) for 24 h. Aggrecanase-2 protein expression was determined by Western blot analysis (n = 4). As with mRNA levels, there were no significant changes in aggrecanase-2 protein levels after IL-1{beta}, TNF-{alpha}, or TGF-{beta} stimulation (see Fig. 7GoB).

Aggrecanase-1 and -2 expression in ST

Because aggrecanase-1 and -2 expression was observed in cultured FLS, we determined whether the genes were expressed in ST. Relative aggrecanase-1 mRNA expression in RA (n = 6) and OA (n = 6) ST compared with nonarthritis tissues (n = 4) was determined by real-time PCR. As shown in Fig. 8Go, the relative aggrecanase-1 mRNA expression level in RA ST was 216 ± 116-fold greater than that in the nonarthritis tissues (p < 0.01). There was a trend toward increased aggrecanase-1 mRNA expression in OA, but this did not reach statistical significance. The aggrecanase-1 mRNA expression level in RA ST was significantly higher than that in OA ST (p < 0.02). In contrast, relative aggrecanase-2 mRNA expression in OA (n = 5) and RA (n = 5) was similar to that in nonarthritis ST (n = 4; see Fig. 9Go).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 8. Aggrecanase-1 mRNA expression in ST. Relative aggrecanase-1 mRNA expression in RA (n = 6) and OA (n = 6) ST compared with nonarthritis (NA) tissues (n = 4) was determined by real-time PCR. Aggrecanase-1 mRNA expression level in RA ST was 216 ± 116-fold greater than that in NA tissues (p < 0.01). In addition, aggrecanase-1 mRNA expression level in RA ST was significantly higher than OA ST (p < 0.02). There was a trend toward increased aggrecanase-1 mRNA expression in OA (7.5 ± 3.6-fold greater than NA tissues), but this did not reach statistical significance. *, p < 0.02 vs OA; **, p < 0.01 vs NA.

 


View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 9. Aggrecanase-2 mRNA expression in ST. Relative aggrecanase-2 mRNA expression in RA (n = 5) and OA (n = 5) ST compared with nonarthritis (NA) tissues (n = 4) was determined by real-time PCR. Aggrecanase-2 mRNA expression in RA and OA was similar to NA ST.

 
Aggrecanase-2 protein expression in ST

Constitutive aggrecanase-2 protein expression was noted in cultured FLS, so we examined aggrecanase-2 protein expression in ST. Protein was extracted from RA, OA, and nonarthritis ST, and aggrecanase-2 protein expression was determined by Western blot analysis (see Fig. 10Go). In contrast to FLS, two bands were detected in most of the lanes. The higher molecular mass band, which was near 70 kDa, corresponded to the band detected in cultured FLS. The lower band (53 kDa) probably corresponds to the activated enzyme after further partial digestion, as has been previously described for other ADAMTS proteins (23). The ratios of the high to low molecular mass species were 0.24 ± 0.09 in RA (n = 15), 1.1 ± 0.68 in OA (n = 6), and 1.9 ± 0.57 in nonarthritis ST samples (n = 5; p < 0.01 for RA compared with nonarthritis). Previous studies of aggrecanase-2 processing have identified aggrecanase activity in enzymes with molecular mass varying from 50 to 64 kDa (14). This suggests that post-transcriptional processing of aggrecanase-2 occurs in the synovium of RA patients even though mRNA levels are similar.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 10. Aggrecanase-2 protein expression in ST. Protein was extracted from RA, OA, and nonarthritis (NA) ST, and aggrecanase-2 protein expression was determined by Western blot analysis. Two bands, i.e., a high molecular mass band near 70 kDa and a low molecular mass band near 53 kDa, were detected in most samples. The low molecular mass of aggrecanase-2 protein was mainly detected in RA synovium, whereas the high molecular mass of aggrecanase-2 protein was dominant in NA synovium.

 
Analysis of aggrecanase activity

Supernatants from four FLS lines incubated for 48 h with or without TGF-{beta} (10 ng/ml) were analyzed for aggrecanase activity by incubation with bovine aggrecan monomers for 24 h. Samples were assayed for products formed by specific aggrecanase-mediated cleavage by Western blot analysis using the BC-3 mAb that recognizes the neoepitope generated after cleavage at Glu373-Ala374. In contrast to cleavage generated by incubation with the positive control (supernatant from IL-1-stimulated cartilage), the neoepitope was not detected in supernatants from the FLS lines (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aggrecan is the major proteoglycan in cartilage and accounts for about 10% of its dry weight. It consists of a multidomain structure, with G1 and G2 domains located at the N terminus of the molecule, an IGD between G1 and G2, and a G3 domain at the C terminus. The extended region of the core protein between G2 and G3 represents the major GAG attachment site. Aggrecan monomers form multimolecular aggregates comprised of up to 100 monomers by noncovalent binding of G1 domain to hyaluronan (24). Consequently, the high negative charge density of the hydrophilic sulfated GAGs, i.e., chondroitin sulfate and keratan sulfate chains, enable the cartilage matrix to attract and preserve water molecules.

Depletion of GAG-bearing aggrecan fragments from articular cartilage is one of the earliest events in cartilage loss due to arthritis. However, unlike digestion of native type II collagen by collagenases, proteoglycan depletion can be reversible. Proteolytic cleavage of aggrecan at either Asn341-Phe342 or Glu373-Ala374 is responsible for the loss of aggrecan from cartilage. While several MMPs account for the former activity, the latter is mediated by aggrecanase. Characterization of aggrecanase activity was previously problematic due to the difficulty in isolating the specific enzymes, and until recently most data were derived from explants of human and bovine cartilage. Two enzymes that can cleave aggrecan at Glu373-Ala374 have now been cloned (aggrecanase-1 (ADAMTS-4) and aggrecanase-2 (ADAMTS-5/11)), thereby permitting more detailed molecular understanding of aggrecan metabolism (13, 14).

Previous studies focused primarily on chondrocytes and cartilage as a source of aggrecanase activity (11, 12, 13, 14, 25, 26). However other tissues, such as bovine fibroblasts, joint capsules, and tendon, are also able to produce aggrecanase activity (27, 28, 29, 30). The regulation of both aggrecanase-1 and -2 in human synoviocytes and synovium remains poorly defined. Recently, immunoreactive aggrecanase protein was observed in the synovial intimal lining, although it is not known whether FLS or macrophage-like synoviocytes were the cellular source (30). While chondrocytes can produce large amounts of aggrecanase, FLS and the synovium also serve as major sources of matrix-degrading enzymes in arthritis (31, 32, 33). Therefore, we hypothesized that aggrecanase could be produced by synovial cells in RA and OA and that the synovium can also contribute to aggrecan degradation.

Our initial studies demonstrated that aggrecanase-1 and -2 are constitutively expressed by RA, OA, and nonarthritis FLS. Of interest, aggrecanase gene expression in unstimulated cells was similar in all FLS, regardless of the source. This contrasts with other proteases, such as MMP-1, where RA FLS constitutively express greater amounts of collagenase mRNA than cells derived from OA synovium (34, 35). The availability of a specific anti-aggrecanase-2 Ab allowed us to confirm that aggrecanase-2 protein production by RA, OA, and nonarthritis FLS is also similar. Regulation of aggrecanase by cytokines was then evaluated using real-time PCR. TGF-{beta} and, to a lesser extent, TNF-{alpha} induced aggrecanase-1 gene expression in FLS. Notably, IL-1{beta} had only a minimal effect, and none of the cytokines altered aggrecanse-2 mRNA or protein production. These findings are quite distinct from the previous reports in chondrocytes and cartilage explants, where IL-1 dramatically increased aggrecan degradation at the Glu373-Ala374 site (12, 25, 26). Aggrecanase activity was not increased in culture medium of bovine synovial capsule explants or bovine fibroblasts by IL-1 or retinoic acid, although both were very effective in chondrocytes (28). Our results are also consistent with a recent report noting that IL-1 did not increase aggrecanase 2 production by synovial explants (30). Therefore, IL-1, which is the most potent inducer of MMPs in FLS, has only a marginal role in aggrecanse regulation in FLS compared with chondrocytes.

TGF-{beta} was the most potent inducer of aggrecanase-1 gene expression, inducing a 13-fold increase in mRNA levels and an increase in protein levels in at least some of the lines examined. TGF-{beta} rapidly increased aggrecanase-1 gene expression, and mRNA levels peaked after 24 h of cytokine exposure. mRNA expression gradually declined over the subsequent 24 h despite continued cytokine treatment. This contrasts with the induction of MMPs in FLS, where mRNA production increases for several days in the presence of cytokines such as IL-1 or TNF-{alpha}. The molecular mechanism of the decrease in aggrecanase-1 mRNA could involve either transcriptional events or changes in mRNA half-life.

Dose response experiments indicate that FLS respond to TGF-{beta} concentrations that are present in synovial fluid and tissues (21, 22). In RA, TGF-{beta} protein expression has been observed at the cartilage-pannus junction as well as the synovium, and the cell source of TGF-{beta} is likely to be FLS and macrophages (36, 37, 38). TGF-{beta} levels in synovium are low in OA compared with RA (39), and this might contribute to the lower levels of aggrecanase-1 observed in synovium obtained from OA patients.

The results with TGF-{beta} are surprising in light of the traditional belief that this growth factor plays a protective role in matrix metabolism (40, 41). For instance, TGF-{beta} suppresses collagenase gene expression and increases the production of tissue inhibitor of metalloproteinase (TIMP)-1 or TIMP-3 in a variety of cell types (42, 43, 44, 45). TGF-{beta} also enhances extracellular matrix deposition by inducing collagen gene expression (46, 47, 48, 49). These matrix-enhancing effects have been observed in the skin of patients with scleroderma (50) and in the fibrotic joints of rats after intra-articular injection of the growth factor (51). TGF-{beta} also inhibits IL-1-induced chondrocyte protease activity and cartilage proteoglycan degradation, and promotes the synthesis of proteoglycan in cartilage (52, 53, 54). In explant cultures of tissue from both young and mature bovine tendons, aggrecanase activity was not induced by TGF-{beta} (29). In the same study aggrecanase activity was induced by IL-1{beta} in explant cultures of tissue from young bovine tendon, but not in those from mature tendons (29). Recent findings support the hypothesis that the effects of TGF-{beta} can potentially promote joint destruction. For instance, intra-articular injections of TGF-{beta} in mice induce OA-like changes, including proteoglycan depletion (55). Therefore, the regulatory mechanism of aggrecanase by cytokines might depend on cell lineage, age, tissue origin, and species.

In addition to evaluating aggrecanase regulation in FLS, we used real-time PCR and Western blot analysis to determine its expression in intact ST. Aggrecanase-1 mRNA levels were markedly higher in RA samples compared with OA or nonarthritis tissue, whereas no differences were observed for aggrecanase-2. This probably reflects the rich cytokine milieu of RA, including abundant TNF-{alpha} and TGF-{beta} (56). Even though aggrecanase-2 mRNA levels were similar in ST, two bands (~70 and 53 kDa) were detected in Western blots. The ratio of the upper bands to the lower bands in RA synovium was significantly lower than that in nonarthritis synovium, and there was a trend for lower ratios in OA compared with nonarthritis synovium. It is likely that the 70-kDa band represents a proenzyme form of aggrecanase-2 based on its predicted molecular mass. The lower molecular mass band probably results from further processing, as has been described for ADAMTS-1 and ADAMTS-8, both of which have two processed forms (85 and 67 kDa for ADAMTS-1 and 79 and 64 kDa for ADAMTS-8) (23). Furthermore, aggrecanase-2 activity has been identified in proteins varying from 50 to 64 kDa (14). The relatively higher amounts of the 53-kDa protein in RA suggest post-translational modification of aggrecanase-2 and that this, rather than traditional transcriptional mechanisms, might be important in inflammatory synovium for this particular aggrecanase.

Although aggrecanase-2 and aggrecanase-1 proteins were demonstrated in cell lysates from FLS, no activity was detected in the supernatants. However, the lack of activity might reflect the presence of the inactive latent forms of aggrecanase-2 or aggrecanase-1 or the possibility that activated enzyme is bound to TIMP-3, which is a potent inhibitor of both aggrecanases. Because aggrecanase binds tightly to the extracellular matrix, the changes in production also might not be reflected by significant differences in biological activity in culture supernatants. Therefore, the lack of processing and matrix-binding properties or the presence of endogenous inhibitors might contribute to the absence of aggrecanase activity in the supernatants of cultured FLS.

In summary, this is the first demonstration of aggrecanase-1 gene regulation in human synovium and FLS. Surprisingly, aggrecanase-1 was induced by TGF-{beta} in synoviocytes, whereas aggrecanase-2 was not regulated by cytokines. Expression of aggrecanase-1, but not aggrecanase-2, was higher in RA synovium than in nonarthritis and OA synovium. A low molecular mass aggrecanase-2 protein was detected in RA synovium, whereas a high molecular mass of aggrecanase-2 protein was dominant in nonarthritis synovium. Thus, aggrecanase-1 and -2 mRNA are differentially expressed by FLS; aggrecanase-1 is induced by cytokines, while synovial aggrecanase-2 appears to be regulated by a post-translational mechanism.


    Footnotes
 
1 This work was supported in part by a grant from the National Institutes of Health (to G.S.F.) and grants from the Japan Foundation for Aging and Health, the Nakatomi Foundation, and Japan Rheumatism Foundation (to Y.Y.). Back

2 Address correspondence and reprint requests to Dr. Gary S. Firestein, Division of Rheumatology, Allergy, and Immunology, University of California at San Diego School of Medicine, Mail Code 0656, 9500 Gilman Drive, La Jolla, CA 92093-0656. E-mail address: gfirestein{at}ucsd.edu Back

3 Abbreviations used in this paper: GAG, glycosaminoglycan; ADAMTS, a disintegrin and metalloproteinase with thrombospondin motif; AU, arbitrary densitometry unit; Ct, threshold cycle; FLS, fibroblast-like synoviocyte; IGD, interglobular domain; MMP, matrix metalloproteinase; OA, osteoarthritis; RA, rheumatoid arthritis; ST, synovial tissue; TIMP, tissue inhibitor of metalloproteinase. Back

Received for publication February 27, 2001. Accepted for publication November 26, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fosang, A. J., P. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton. 1991. Cleavage of cartilage proteoglycan between G1 and G2 domains by stromelysins. J. Biol. Chem. 266:15579.[Abstract/Free Full Text]
  2. Sandy, J. D., C. R. Flannery, P. J. Neame, L. S. Lohmander. 1992. The structure of aggrecan fragments in human synovial fluid: evidence for the involvement in osteoarthritis of a novel proteinase which cleaves the Glu373-Ala374 bond of the interglobular domain. J. Clin. Invest. 89:1512.
  3. Flannery, C. R., M. W. Lark, J. D. Sandy. 1992. Identification of a stromelysin cleavage site within the interglobular domain of human aggrecan: evidence for proteolysis at this site in vivo in human articular cartilage. J. Biol. Chem. 267:1008.[Abstract/Free Full Text]
  4. Lohmander, L. S., P. J. Neame, J. D. Sandy. 1993. The structure of aggrecan fragments in human synovial fluid: evidence that aggrecanase mediates cartilage degradation in inflammatory joint disease, joint injury, and osteoarthritis. Arthritis Rheum. 36:1214.[Medline]
  5. Fosang, A. J., K. Last, P. Gardiner, D. C. Jackson, L. Brown. 1995. Development of a cleavage-site-specific monoclonal antibody for detecting metalloproteinase-derived aggrecan fragments: detection of fragments in human synovial fluids. Biochem. J. 310:337.
  6. Fosang, A. J., P. J. Neame, K. Last, T. E. Hardingham, G. Murphy, J. A. Hamilton. 1992. The interglobular domain of cartilage aggrecan is cleaved by PUMP, gelatinases, and cathepsin B. J. Biol. Chem. 267:19470.[Abstract/Free Full Text]
  7. Fosang, A. J., K. Last, V. Knauper, P. J. Neame, G. Murphy, T. E. Hardingham, H. Tschesche, J. A. Hamilton. 1993. Fibroblast and neutrophil collagenases cleave at two sites in the cartilage aggrecan interglobular domain. Biochem. J. 295:273.
  8. Fosang, A. J., K. Last, V. Knauper, G. Murphy, P. J. Neame. 1996. Degradation of cartilage aggrecan by collagenase-3 (MMP-13). FEBS Lett. 380:17.[Medline]
  9. Fosang, A. J., K. Last, R. A. Maciewicz. 1996. Aggrecan is degraded by matrix metalloproteinases in human arthritis: evidence that matrix metalloproteinase and aggrecanase activities can be independent. J. Clin. Invest. 98:2292.[Medline]
  10. Lark, M. W., E. K. Bayne, J. Flanagan, C. F. Harper, L. A. Hoerrner, N. I. Hutchinson, I. I. Singer, S. A. Donatelli, J. R. Weidner, H. R. Williams, et al 1997. Aggrecan degradation in human cartilage: evidence for both matrix metalloproteinase and aggrecanase activity in normal, osteoarthritic, and rheumatoid joints. J. Clin. Invest. 100:93.[Medline]
  11. Loulakis, P., A. Shrikhande, G. Davis, C. A. Maniglia. 1992. N-terminal sequence of proteoglycan fragments isolated from medium of interleukin-1-treated articular-cartilage cultures: putative site(s) of enzymic cleavage. Biochem. J. 284:589.
  12. Little, C. B., C. R. Flannery, C. E. Hughes, J. S. Mort, P. J. Roughley, C. Dent, B. Caterson. 1999. Aggrecanase versus matrix metalloproteinases in the catabolism of the interglobular domain of aggrecan in vitro. Biochem. J. 344:61.
  13. Tortorella, M. D., T. C. Burn., M. A. Pratta, I. Abbaszade, J. M. Hollis, R. Liu, S. A. Rosenfeld, R. A. Copeland, C. P. Decicco, R. Wynn, et al 1999. Purification and cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science 284:1664.[Abstract/Free Full Text]
  14. Abbaszade, I., R. Q. Liu, F. Yang, S. A. Rosenfeld, O. H. Ross, J. R. Link, D. M. Ellis, M. D. Tortorella, M. A. Pratta, J. M. Hollis, et al 1999. Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J. Biol. Chem. 274:23443.[Abstract/Free Full Text]
  15. Hughes, C. E., B. Caterson, A. J. Fosang, P. J. Roughley, J. S. Mort. 1995. Monoclonal antibodies that specifically recognize neoepitope sequences generated by "aggrecanase" and matrix metalloproteinase cleavage of aggrecan: application to catabolism in situ and in vitro. Biochem. J. 305:799.
  16. Tortorella, M. D., M. Pratta, R. Q. Liu, J. Austin, O. H. Ross, I. Abbaszade, T. Burn, E. Arner. 2000. Sites of aggrecan cleavage by recombinant human aggrecanase-1 (ADAMTS-4). J. Biol. Chem. 275:18566.[Abstract/Free Full Text]
  17. Arnett, F. C., S. M. Edworthy, D. A. Bloch, D. J. McShane, J. F. Fries, N. S. Cooper, L. A. Healey, S. R. Kaplan, M. H. Liang, H. S. Luthra, et al 1988. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31:315.[Medline]
  18. Altman, R., E. Asch, D. Bloch, G. Bole, D. Borenstein, K. Brandt, W. Christy, T. D. Cooke, R. Greenwald, M. Hochberg, et al 1986. Development of criteria for the classification and reporting of osteoarthritis: classification of osteoarthritis of the knee: Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association. Arthritis Rheum. 29:1039.[Medline]
  19. Alvaro-Gracia, J. M., N. J. Zvaifler, G. S. Firestein. 1990. Cytokines in chronic inflammatory arthritis. V. Mutual antagonism between interferon-{gamma} and tumor necrosis factor-{alpha} on HLA-DR expression, proliferation, collagenase production, and granulocyte macrophage colony-stimulating factor production by rheumatoid arthritis synoviocytes. J. Clin. Invest. 86:1790.
  20. Hascall, V. C., S. W. Sajdera. 1969. Proteinpolysaccharide complex from bovine nasal cartilage: the function of glycoprotein in the formation of aggregates. J. Biol. Chem. 244:2384.[Abstract/Free Full Text]
  21. Fava, R., N. Olsen, J. Keski-Oja, H. Moses, T. Pincus. 1989. Active and latent forms of transforming growth factor {beta} activity in synovial effusions. J. Exp. Med. 169:291.[Abstract/Free Full Text]
  22. Lotz, M., J. Kekow, D. A. Carson. 1990. TGF-{beta} and cellular immune responses in synovial fluids. J. Immunol. 144:4189.[Abstract]
  23. Vazquez, F., G. Hastings, M. A. Ortega, T. F. Lane, S. Oikemus, M. Lombardo, M. L. Iruela-Arispe. 1999. METH-1, a human ortholog of ADAMTS-1, and METH-2 are members of a new family of proteins with angio-inhibitory activity. J. Biol. Chem. 274:23349.[Abstract/Free Full Text]
  24. Hardingham, T. E., A. J. Fosang. 1992. Proteoglycans: many forms and many functions. FASEB J. 6:861.[Abstract]
  25. Arner, E. C., C. E. Hughes, C. P. Decicco, B. Caterson, M. D. Tortorella. 1998. Cytokine-induced cartilage proteoglycan degradation is mediated by aggrecanase. Osteoarthritis Cartilage 6:214.[Medline]
  26. Sandy, J. D., D. Gamett, V. Thompson, C. Verscharen. 1998. Chondrocyte-mediated catabolism of aggrecan: aggrecanase-dependent cleavage induced by interleukin-1 or retinoic acid can be inhibited by glucosamine. Biochem. J. 335:59.
  27. Vankemmelbeke, M. N., M. Z. Ilic, C. J. Handley, C. G. Knight, D. J. Buttle. 1999. Coincubation of bovine synovial or capsular tissue with cartilage generates a soluble "aggrecanase" activity. Biochem. Biophys. Res. Commun. 255:686.[Medline]
  28. Ilic, M. Z., M. N. Vankemmelbeke, I. Holen, D. J. Buttle, H. C. Robinson, C. J. Handley. 2000. Bovine joint capsule and fibroblasts derived from joint capsule express aggrecanase activity. Matrix Biol. 19:257.[Medline]
  29. Rees, S. G., C. R. Flannery, C. B. Little, C. E. Hughes, B. Caterson, C. M. Dent. 2000. Catabolism of aggrecan, decorin and biglycan in tendon. Biochem. J. 350:181.
  30. Vankemmelbeke, M. N., I. Holen, A. G. Wilson, M. Z. Ilic, C. J. Handley, G. S. Kelner, M. Clark, C. Liu, R. A. Maki, D. Burnett, et al 2001. Expression and activity of ADAMTS-5 in synovium. Eur. J. Biochem. 268:1259.[Medline]
  31. Firestein, G. S., M. M. Paine, B. H. Littman. 1991. Gene expression (collagenase, tissue inhibitor of metalloproteinases, complement, and HLA-DR) in rheumatoid arthritis and osteoarthritis synovium: quantitative analysis and effect of intraarticular corticosteroids. Arthritis Rheum. 34:1094.[Medline]
  32. Gravallese, E. M., J. M. Darling, A. L. Ladd, J. N. Katz, L. H. Glimcher. 1991. In situ hybridization studies of stromelysin and collagenase messenger RNA expression in rheumatoid synovium. Arthritis Rheum. 34:1076.[Medline]
  33. Firestein, G. S., M. M. Paine. 1992. Stromelysin and tissue inhibitor of metalloproteinases gene expression in rheumatoid arthritis synovium. Am. J. Pathol. 140:1309.[Abstract]
  34. Ritchlin, C., E. Dwyer, R. Bucala, R. Winchester. 1994. Sustained and distinctive patterns of gene activation in synovial fibroblasts and whole synovial tissue obtained from inflammatory synovitis. Scand. J. Immunol. 40:292.[Medline]
  35. Han, Z., D. L. Boyle, K. R. Aupperle, B. Bennett, A. M. Manning, G. S. Firestein. 1999. Jun N-terminal kinase in rheumatoid arthritis. J. Pharmacol. Exp. Ther. 291:124.[Abstract/Free Full Text]
  36. Lafyatis, R., N. L. Thompson, E. F. Remmers, K. C. Flanders, N. S. Roche, S. J. Kim, J. P. Case, M. B. Sporn, A. B. Roberts, R. L. Wilder. 1989. TGF-{beta} production by synovial tissues from rheumatoid patients and streptococcal cell wall arthritic rats: studies on secretion by synovial fibroblast-like cells and immunohistologic localization. J. Immunol. 143:1142.[Abstract]
  37. Wahl, S. M., J. B. Allen, H. L. Wong, S. F. Dougherty, L. R. Ellingsworth. 1990. Antagonistic and agonistic effects of TGF-{beta} and IL-1 in rheumatoid synovium. J. Immunol. 145:2514.[Abstract]
  38. Chu, C. Q., M. Field, E. Abney, R. Q. Zheng, S. Allard, M. Feldmann, R. N. Maini. 1991. Transforming growth factor-{beta}1 in rheumatoid synovial membrane and cartilage/pannus junction. Clin. Exp. Immunol. 86:380.[Medline]
  39. Szekanecz, Z., G. K. Haines, L. A. Harlow, M. R. Shah, T. W. Fong, R. Fu, S. J. Lin, G. Rayan, A. E. Koch. 1995. Increased synovial expression of transforming growth factor (TGF)-{beta} receptor endoglin and TGF-{beta}1 in rheumatoid arthritis: possible interactions in the pathogenesis of the disease. Clin. Immunol. Immunopathol. 76:187.[Medline]
  40. Brandes, M. E., J. B. Allen, Y. Ogawa, S. M. Wahl. 1991. Transforming growth factor {beta}1 suppresses acute and chronic arthritis in experimental animals. J. Clin. Invest. 87:1108.
  41. Kuruvilla, A. P., R. Shah, G. M. Hochwald, H. D. Liggitt, M. A. Palladino, G. J. Thorbecke. 1991. Protective effect of transforming growth factor {beta}1 on experimental autoimmune diseases in mice. Proc. Natl. Acad. Sci. USA 88:2918.[Abstract/Free Full Text]
  42. Edwards, D. R., G. Murphy, J. J. Reynolds, S. E. Whitham, A. J. Docherty, P. Angel, J. K. Heath. 1987. Transforming growth factor {beta} modulates the expression of collagenase and metalloproteinase inhibitor. EMBO J. 6:1899.[Medline]
  43. Overall, C. M., J. L. Wrana, J. Sodek. 1989. Independent regulation of collagenase, 72-kDa progelatinase, and metalloendoproteinase inhibitor expression in human fibroblasts by transforming growth factor-{beta}. J. Biol. Chem. 264:1860.[Abstract/Free Full Text]
  44. Gunther, M., H. D. Haubeck, E. van de Leur, J. Blaser, S. Bender, I. Gutgemann, D. C. Fischer, H. Tschesche, H. Greiling, P. C. Heinrich, L. Graeve. 1994. Transforming growth factor {beta}1 regulates tissue inhibitor of metalloproteinases-1 expression in differentiated human articular chondrocytes. Arthritis Rheum. 37:395.[Medline]
  45. Su, S., J. A. DiBattista, Y. Sun, W. Q. Li, M. Zafarullah. 1998. Up-regulation of tissue inhibitor of metalloproteinases-3 gene expression by TGF-{beta} in articular chondrocytes is mediated by serine/threonine and tyrosine kinases. J. Cell. Biochem. 70:517.[Medline]
  46. Ignotz, R. A., J. Massague. 1986. Transforming growth factor-{beta} stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J. Biol. Chem. 261:4337.[Abstract/Free Full Text]
  47. Keski-Oja, J., R. Raghow, M. Sawdey, D. J. Loskutoff, A. E. Postlethwaite, A. H. Kang, H. L. Moses. 1988. Regulation of mRNAs for type-1 plasminogen activator inhibitor, fibronectin, and type I procollagen by transforming growth factor-{beta}: divergent responses in lung fibroblasts and carcinoma cells. J. Biol. Chem. 263:3111.[Abstract/Free Full Text]
  48. Bassols, A., J. Massague. 1988. Transforming growth factor {beta} regulates the expression and structure of extracellular matrix chondroitin/dermatan sulfate proteoglycans. J. Biol. Chem. 263:3039.[Abstract/Free Full Text]
  49. Redini, F., P. Galera, A. Mauviel, G. Loyau, J. P. Pujol. 1988. Transforming growth factor {beta} stimulates collagen and glycosaminoglycan biosynthesis in cultured rabbit articular chondrocytes. FEBS Lett. 234:172.[Medline]
  50. Falanga, V., S. L. Tiegs, S. P. Alstadt, A. B. Roberts, M. B. Sporn. 1987. Transforming growth factor-{beta}: selective increase in glycosaminoglycan synthesis by cultures of fibroblasts from patients with progressive systemic sclerosis. J. Invest. Dermatol. 89:100.[Medline]
  51. Allen, J. B., C. L. Manthey, A. R. Hand, K. Ohura, L. Ellingsworth, S. M. Wahl. 1990. Rapid onset synovial inflammation and hyperplasia induced by transforming growth factor {beta}. J. Exp. Med. 171:231.[Abstract/Free Full Text]
  52. Chandrasekhar, S., A. K. Harvey. 1988. Transforming growth factor-{beta} is a potent inhibitor of IL-1 induced protease activity and cartilage proteoglycan degradation. Biochem. Biophys. Res. Commun. 157:1352.[Medline]
  53. van Beuningen, H. M., P. M. van der Kraan, O. J. Arntz, W. B. van den Berg. 1993. Protection from interleukin 1 induced destruction of articular cartilage by transforming growth factor {beta}: studies in anatomically intact cartilage in vitro and in vivo. Ann. Rheum. Dis. 52:185.[Abstract/Free Full Text]
  54. van Beuningen, H. M., P. M. van der Kraan, O. J. Arntz, W. B. van den Berg. 1994. Transforming growth factor-{beta}1 stimulates articular chondrocyte proteoglycan synthesis and induces osteophyte formation in the murine knee joint. Lab. Invest. 71:279.[Medline]
  55. van Beuningen, H. M., H. L. Glansbeek, P. M. van der Kraan, W. B. van den Berg. 2000. Osteoarthritis-like changes in the murine knee joint resulting from intra-articular transforming growth factor-{beta} injections. Osteoarthritis Cartilage 8:25.[Medline]
  56. Firestein, G. S., J. M. Alvaro-Gracia, R. Maki. 1990. Quantitative analysis of cytokine gene expression in rheumatoid arthritis. J. Immunol. 144:3347.[Abstract]



This article has been cited by other articles:


Home page
Protein Sci.Home page
L. Mosyak, K. Georgiadis, T. Shane, K. Svenson, T. Hebert, T. McDonagh, S. Mackie, S. Olland, L. Lin, X. Zhong, et al.
Crystal structures of the two major aggrecan degrading enzymes, ADAMTS4 and ADAMTS5
Protein Sci., January 1, 2008; 17(1): 16 - 21.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Gendron, M. Kashiwagi, N. H. Lim, J. J. Enghild, I. B. Thogersen, C. Hughes, B. Caterson, and H. Nagase
Proteolytic Activities of Human ADAMTS-5: COMPARATIVE STUDIES WITH ADAMTS-4
J. Biol. Chem., June 22, 2007; 282(25): 18294 - 18306.
[Abstract] [Full Text] [PDF]


Home page
Mult SclerHome page
G Haddock, A K Cross, J Plumb, J Surr, D J Buttle, R A. Bunning, and M N Woodroofe
Expression of ADAMTS-1, -4, -5 and TIMP-3 in normal and multiple sclerosis CNS white matter
Multiple Sclerosis, August 1, 2006; 12(4): 386 - 396.
[Abstract] [PDF]


Home page
Ann Rheum DisHome page
W Hui, H E Barksby, D A Young, T E Cawston, N McKie, and A D Rowan
Oncostatin M in combination with tumour necrosis factor {alpha} induces a chondrocyte membrane associated aggrecanase that is distinct from ADAMTS aggrecanase-1 or -2
Ann Rheum Dis, November 1, 2005; 64(11): 1624 - 1632.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
J Westra, P C Limburg, P de Boer, and M H van Rijswijk
Effects of RWJ 67657, a p38 mitogen activated protein kinase (MAPK) inhibitor, on the production of inflammatory mediators by rheumatoid synovial fibroblasts
Ann Rheum Dis, November 1, 2004; 63(11): 1453 - 1459.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Hashimoto, M. Shimoda, and Y. Okada
ADAMTS4 (Aggrecanase-1) Interaction with the C-terminal Domain of Fibronectin Inhibits Proteolysis of Aggrecan
J. Biol. Chem., July 30, 2004; 279(31): 32483 - 32491.
[Abstract] [Full Text] [PDF]