|
|
||||||||
1




*
Division of Rheumatology, Allergy, and Immunology, University of California at San Diego School of Medicine, La Jolla, CA 92093;
Neurocrine, La Jolla, CA; and
Pharmacia Discovery Research, Skokie, IL 60077
| Abstract |
|---|
|
|
|---|
significantly increased aggrecanase-1 gene
expression in FLS. Aggrecanase-1 induction peaked after 24 h of
TGF-
stimulation. The expression of aggrecanase-1 mRNA was
significantly greater in RA ST than in OA or nonarthritis ST.
Aggrecanase-2 mRNA and protein were constitutively produced by
nonarthritis, OA, and RA FLS but were not increased by IL-1, TNF-
,
or TGF-
. Furthermore, OA, RA, and nonarthritis ST contained similar
amounts of immunoreactive aggrecanase-2. The major form of the
aggrecanase-2 enzyme was 70 kDa in nonarthritis ST, whereas a processed
53-kDa form was abundant in RA ST. Therefore, aggrecanase-1 and -2 are
differentially regulated in FLS. Both are constitutively expressed, but
aggrecanase-1 is induced by cytokines, especially TGF-
. In contrast,
aggrecanase-2 protein may be regulated by a post-translational
mechanism in OA and RA ST. Synovial and FLS production of aggrecanase
can contribute to cartilage degradation in RA and
OA. | Introduction |
|---|
|
|
|---|
Amino acid sequence analysis of the aggrecan fragments in synovial fluid from patients with inflammatory or degenerative joint diseases has revealed that the cleavage by aggrecanase at Glu373-Ala374 predominates (2, 4), although some fragments cleaved at Asn341-Phe342 are also detected (9, 10). Stimulation of cartilage explant degradation by inflammatory cytokines also indicates that aggrecanase is a major enzyme that cleaves in aggrecan in vitro (11, 12). These findings suggest that aggrecanase plays a significant role in aggrecan degradation, although the relative contribution of MMPs is not known. Recently, two members of a disintegrin and metalloproteinase with thrombospondin motif (ADAMTS) family, aggrecanase-1 (ADAMTS-4) and aggrecanase-2 (ADAMTS-5/11), have been purified and cloned (13, 14). The ADAMTS family comprises an N-terminal propeptide domain with a furin-processing site, a metalloproteinase domain, a disintegrin-like domain, and a variable number of thrombospondin type 1 motifs.
The regulation of aggrecanase expression in human joint diseases
remains poorly defined, especially for synovium and fibroblast-like
synoviocytes (FLS). In the present study we examined FLS and synovial
tissue (ST) obtained from patients with rheumatoid arthritis (RA) and
osteoarthritis (OA) and from nonarthritis individuals and determined
the expression and regulation of aggrecanase-1 and -2. These studies
demonstrate differential regulation of the two enzymes, with TGF-
playing a key role in the induction of aggrecanase-1.
| Materials and Methods |
|---|
|
|
|---|
Materials were purchased from the following sources: DMEM,
glutamine, penicillin-streptomycin, gentamicin, and FCS from Life
Technologies (Grand Island, NY); IL-1
and TNF-
from Roche
(Mannheim, Germany); TGF-
from R&D Systems (Minneapolis, MN); RNA
STAT-60 from Tel-Test (Friendswood, TX); ProSTAR First-Strand RT-PCR
kit from Stratagene (La Jolla, CA); SYBR Green PCR Master Mix from PE
Applied Biosystems (Foster City, CA); baculovirus vector pVL 1392 and
BaculoGold from BD PharMingen (San Diego, CA); anti-FLAG mAb M2
from Sigma-Aldrich (St. Louis, MO); and DC Protein Assay kit from
Bio-Rad (Hercules, CA). Ab BC-3 binds to the new N-terminal ARGS on
aggrecan fragments produced by aggrecanase cleavage at the
Glu373-Ala374 bond
(University of Wales, Cardiff, U.K.) (15, 16).
ST and patients
ST samples for Western blot and RT-PCR analysis were obtained from RA (n = 15) and OA (n = 6) patients who underwent joint replacement (except one RA patient who had arthroscopic synovectomy). ST from individuals without arthritis were also obtained at the time of arthroscopy from patients with cruciate ligament injury (n = 2), meniscus injury (n = 6), or discoid meniscus (n = 1). Additional samples obtained from RA and OA patients were used to derive FLS cell lines (see below). The diagnosis of RA conformed to the 1987 American College of Rheumatology revised criteria for RA (17), and the diagnosis of OA conformed to the American College of Rheumatology criteria for the knee (18). The ST from cruciate ligament injury, meniscus injury, and discoid meniscus patients were histopathologically normal. All tissue samples were immediately frozen and stored at -80°C until use.
FLS preparations
FLS were prepared from nonarthritis (n = 1), RA
(n = 5), and OA (n = 5) ST as described
previously (19). Briefly, the tissues were aseptically
minced and incubated with 1 mg/ml collagenase in serum-free DMEM for
2 h at 37°C, filtered through a nylon mesh, extensively washed,
and cultured in DMEM containing 10% FCS, 2 mM glutamine, 50 µg/ml
gentamicin, 100 U/ml penicillin, and 100 µg/ml streptomycin (culture
medium) in a humidified 5% CO2 atmosphere. After
overnight culture nonadherent cells were removed and adherent cells
were cultured in the standard culture medium. At confluence cells were
trypsinized, split at a 1:3 ratio, and recultured in the culture
medium. Synoviocytes were used from passages three through nine in
these experiments, during which time they were a homogeneous population
of FLS (<1% expression of CD11b, CD14, CD3, CD68 and Fc
RII, and
<1% phagocytic) (19).
Real-time PCR
Total RNA was isolated from
2 x
106 cultured FLS or frozen ST using RNA STAT-60,
and extracted RNA was reverse transcribed into cDNA with random primers
and Moloney murine leukemia virus reverse transcriptase according to
the manufacturers protocol (ProSTAR First-Strand RT-PCR kit). PCR
amplification was performed using the GeneAmp 5700 Sequence Detection
System (PE Applied Biosystems). Primers were designed and selected
using Primer Express software (PE Applied Biosystems). The sequences of
the forward and reverse primers are as follows: aggrecanase-1
(ADAMTS-4) forward, GACACTGGTGGTGGCAGATG; aggrecanase-1 (ADAMTS-4)
reverse, TCACTGTTAGCAGGTAGCGCTTTA; aggrecanase-2 (ADAMTS-5/11)
forward, TGGCTCACGAAATCGGACA; aggrecanase-2 (ADAMTS-5/11) reverse,
GGAACCAAAGGTCTCTTCACAGA; GAPDH forward, GAAGGTGAAGGTCGGAGTC;
and GAPDH reverse, GAAGATGGTGATGGGATTTC. The PCR mixture consisted of
1x SYBR Green PCR Master Mix, which includes AmpliTaq Gold DNA
polymerase, SYBR Green I Dye, dNTPs with dUTP, Passive Reference
and PCR buffer, 200 nM forward and reverse primers, and cDNA of samples
in a total volume of 50 µl. PCR was run using the following protocol:
initial activation of AmpliTaq Gold DNA polymerase at 94°C for 5 min,
40 cycles of 94°C for 15 s and 60°C for 1 min, and
dissociation protocol, which is defined as a hold at 95°C for 15
s, a hold at 60°C for 20 s, and a slow ramp (20 min) from 60 to
95°C. Using dissociation protocol, single peaks were confirmed in
each of the aggrecanase-1, aggrecanase-2, and GAPDH PCR to exclude
nonspecific amplification. Each sample was performed by triplicate or
duplicate. Direct detection of PCR product was monitored in real-time
by measuring the increase in fluorescence caused by the binding of SYBR
Green I Dye to dsDNA, using the GeneAmp 5700 Sequence Detection System.
Subsequently, the threshold cycle (Ct), i.e., the cycle number at which
the amount of amplified gene of interest reached a fixed threshold, was
determined.
Relative quantification of aggrecanase-1 or aggrecanase-2 mRNA
expression was calculated by the comparative Ct method described by the
manufacturer (PE Applied Biosystems) after confirming that aggrecanase
and GAPDH cDNAs were amplified with the same efficiency (i.e., the
absolute values of the slope of log input amount were within <0.1 of
each other). The relative quantification value of target, normalized to
an endogenous control and relative to a calibrator, is expressed as
2-
Ct (fold), where
Ct = Ct of
target gene (aggrecanases) - Ct of endogenous control gene
(GAPDH), and 
Ct =
Ct of samples for target gene -
Ct of the calibrator for the target gene.
Anti-aggrecanase Abs
Anti-aggrecanase-2 Ab (Ab250) was raised in rabbits by Alpha Diagnostic International (San Antonio, TX). An 18-aa oligopeptide (VDKTKKKYYSTSSHGNWG) corresponding to a region in the disintegrin-like domain of human aggrecanase-2 was identified and has no homology to any other protein in GenBank using the National Center for Biotechnology Information basic local alignment search tool program, including aggrecanase-1 or other ADAMTS family members. The peptide was coupled to keyhole limpet hemocyanin and injected into rabbits. Blood was tested by ELISA, and the titer of the Ab used in these studies was 1/100,000 against the original peptide. Ab250 was used in a 1/1000 dilution and detected the correct size bands of aggrecanase-2 in Western blot experiments (see Results). Rabbit anti-aggrecanase-1 Ab was prepared to the peptide sequence VMAHVDPEEP (residues 502511) and purified over a protein G-Sepharose column, and the protein concentration was determined using bicinchoninic acid reagent. The immunizing peptide for the Ab blocked binding to the Ag (data not shown).
Preparation of recombinant human aggrecanase-2 protein
Recombinant human aggrecanase-2 from the furin cleavage site to the stop codon was generated by PCR, modified to contain an N-terminal signal sequence from the agouti gene-related peptide gene, followed by the FLAG sequence, and cloned into the baculovirus vector pVL 1392. Sf9 cells were cotransfected with BaculoGold according to the manufacturers recommendations. Secreted protein expression was checked on Western blot analysis using the anti-FLAG mAb M2, and recombinant human aggrecanase-2 FLAG was purified using the M2 agarose affinity resin with elution in 0.1 M glycine HCl, pH 3. The pH was adjusted by adding 1 M Tris-HCl, pH 8, and dialyzing against PBS, pH 7.2, overnight.
Western blot analysis of aggrecanase protein
Cultured FLS (
5 x 106/10-cm
tissue culture dishes) were harvested and washed with PBS, and protein
was extracted using RIPA buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl,
1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS). Similarly,
frozen ST were pulverized, and tissue protein was extracted in the same
manner. The protein concentrations were determined by the DC Protein
Assay kit. Samples containing 10 µg of protein from cultured FLS or
20 µg of protein from ST were fractionated by 8% SDS-PAGE and
transferred onto a nitrocellulose membrane in transfer buffer (39 mM
glycine, 48 mM Tris base, 0.037% SDS, and 20% methanol) at 100 mA for
2 h. The membranes were blocked in TBS containing 0.1% Tween 20
and 5% dry milk for 1 h at room temperature. The
anti-aggrecanase-2 Ab (Ab250) was added and incubated overnight at
4°C. Following three washes in TBS plus 0.1% Tween 20, the membrane
was incubated with HRP-conjugated secondary Ab for 1 h at room
temperature. The aggrecanase-2 protein expression was visualized by
chemiluminescence, using hydrogen peroxide and luminol as a substrate.
For aggrecanase-1, the membranes were first incubated with a 1/1000
dilution of the rabbit Ab. After washing, they were then incubated with
a 1/5000 dilution of goat anti-rabbit IgG alkaline phosphatase
conjugate as the secondary Ab. Products were visualized by developing
the blots in 5-bromo-4-chloro-3-indolyl-1-phosphate nitroblue
tetrazolium color developing reagent. Overnight transfer resulted in
complete transfer of both low and high m.w. fragments. The
density of the target bands was analyzed using National Institutes of
Health Image (version 1.61; National Institutes of Health, Bethesda,
MD). Results are expressed as arbitrary densitometry units
(AU).
Aggrecanase functional assay
Bovine nasal cartilage was sliced and aggrecan was extracted as
previously described (20). FLS were incubated in
serum-free or 0.5% FCS medium (2.5 x 106
FLS) in the presence or the absence of TGF-
(10 ng/ml). Supernatants
were collected after 48 h, and 25 µl was incubated with 500 nM
purified bovine nasal aggrecan monomer (20). Chondroitin
sulfate and keratan sulfate polysaccharide chains were removed by
further incubating with chondroitinase ABC (0.1 U/ml), keratanase (0.1
U/ml), and keratanase II (0.01 U/ml). The protein was then separated by
SDS-PAGE using 412% gels and transferred to polyvinylidene
difluoride membranes. Aggrecan fragments containing the neoepitope
created after cleavage at amino acids Glu373 and
Ala374 were detected using the mAb BC-3.
Subsequently, the membranes were incubated with goat anti-mouse IgG
alkaline phosphatase conjugate and developed with
5-bromo-4-chloro-3-indolyl-1-phosphate nitroblue tetrazolium.
Statistical analysis
Statistical significance was analyzed using the software package StatView 4.5 (Abacus Concepts, Berkeley, CA). Data are expressed as the mean ± SEM. Comparisons among three or more groups were made by a Kruskal-Wallis test, and those between two groups were made by a Mann-Whitney test. A value of p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Initial experiments were performed to determine whether the
aggrecanase genes are constitutively expressed by cultured
FLS. cDNAs were prepared from cultured FLS and amplified using specific
primers for aggrecanase-1, aggrecanase-2, and GAPDH. The PCR products
were resolved by agarose gel electrophoresis. Single specific bands
corresponding to each gene product were identified and indicated that
aggrecanase-1 and aggrecanase-2 are both expressed by RA, OA, and
nonarthritis FLS (see Fig. 1
). No
significant differences in mRNA expression were observed among FLS from
the various sources. To confirm this observation, relative
aggrecanase-1 or aggrecanase-2 mRNA expression of RA (n
= 5) and OA (n = 5) compared with nonarthritis FLS
(n = 1) was then determined by real-time PCR. There
were no significant differences in relative aggrecanase-1 or
aggrecanase-2 mRNA expression between RA and OA FLS
(p > 0.1).
|
Because cytokines play a key role in matrix destruction, we
evaluated their effects on aggrecanase regulation. FLS were stimulated
with IL-1
(10 ng/ml), TNF-
(100 ng/ml), or TGF-
(10 ng/ml) for
24 h, and real-time PCR was used to determine relative
aggrecanase-1 gene expression compared with unstimulated controls
(n = 7 separate experiments). Aggrecanase-1 mRNA
expression was increased 1.3 ± 0.3-fold by IL-1
, 2.9 ±
0.7-fold by TNF-
, and 12.7 ± 4.6-fold by TGF-
(see Fig. 2
). Aggrecanase-1 mRNA expression was
significantly higher in TGF-
-stimulated samples
(p < 0.01) compared with unstimulated samples.
Although there was a trend toward increased aggrecanase-1 mRNA
expression in TNF-
-stimulated samples (p =
0.06), this did not reach statistical significance. Surprisingly,
aggrecanase-2 gene expression was not affected by IL-1
, TNF-
, or
TGF-
(n = 5 separate experiments; see Fig. 3
).
|
|

Because TGF-
was the most potent inducer of aggrecanase-1 gene
expression, we characterized its effect more extensively. FLS were
cultured in the presence of TGF-
(10 ng/ml), and total RNA was
extracted after 048 h. Relative aggrecanase-1 mRNA expression
compared with unstimulated controls was then determined by real-time
PCR (n = 3 separate experiments). As shown in Fig. 4
A, aggrecanase-1 mRNA
expression increased within 6 h, peaked after 24 h, and then
decreased toward baseline. The dose response for TGF-
-induced
aggrecanase-1 expression was then determined. FLS were cultured in the
presence of increasing concentrations of TGF-
(010 ng/ml) for
24 h, and relative aggrecanse-1 mRNA expression compared with
unstimulated controls was determined by real-time PCR. Fig. 4
B shows that relative aggrecanase-1 gene expression
increased significantly with 1 ng/ml and was highest at 10 ng/ml
TGF-
, which is similar to the concentration of TGF-
in RA
synovial fluid (21, 22).
|
PCR studies indicated that TGF-
increases aggrecanase-1 mRNA
expression in cultured FLS. Therefore, we also examined the cells for
aggrecanase-1 protein expression. Cell protein was extracted from RA
FLS (n = 4), and Western blot analysis was performed
using a selective anti-aggrecanase-1 Ab. A single band near 90 kDa
corresponding to the molecular mass of unprocessed aggrecanase-1
was observed in one of four FLS lines examined (see Fig. 5
). To determine the regulation of
aggrecanase-1 protein expression by TGF-
, FLS were incubated with
either medium or TGF-
(10 ng/ml) for 24 h. Aggrecanase-1
protein expression in cell lysates was determined by Western blot
analysis (n = 4). The 90-kDa aggrecanase along with
smaller amounts of lower molecular mass forms were increased by TGF-
in two of the four lines tested (Fig. 5
).
|
In addition to evaluating aggrecanase-2 mRNA expression we raised
rabbit polyclonal Ab against a specific peptide fragment of
aggrecanase-2. The ability of this Ab (Ab250) to bind aggrecanase-2 was
evaluated by Western blot analysis. First, we examined whether Ab250
recognized recombinant human aggrecanase-2 protein, with a predicted
molecular mass of 73 kDa. Fig. 6
A shows that Ab250 detected
recombinant human aggrecanase-2 protein by Western blot analysis.
Because the recombinant protein also contained a FLAG tag, we were able
to confirm that the same size protein was detected by anti-FLAG Ab
in a separate experiment. Second, peptide absorption experiments of
Ab250 were performed. After preincubating Ab250 with excess peptide (25
µg/ml Ab250), binding to the 70-kDa protein in the Western blot was
decreased (see Fig. 6
B). Third, Western blot analysis
confirmed that the anti-aggrecanase-2 Ab was not present in the
preimmune serum (Fig. 6
C). Finally, using Western blot
analysis of additional recombinant proteases, Ab250 did not recognize
recombinant MMPs (MMP-2, -3, -13) and a disintegrin family member
(kistrin; data not shown).
|
Because aggrecanase-2 mRNA expression in cultured FLS was observed
by RT-PCR, we examined the cells for aggrecanase-2 protein expression.
Cell protein was extracted from RA (n = 5), OA
(n = 3), and nonarthritis FLS (n = 1),
and aggrecanase-2 protein expression was evaluated by Western blot
analysis. The single bands near 70 kDa corresponding to the molecular
mass of aggrecanase-2 were observed in RA, OA, and nonarthritis FLS
samples. There were no significant differences in aggrecanase-2 protein
expression between RA and OA (RA, 3.16 ± 0.26 AU; OA, 2.54
± 0.36 AU; nonarthritis, 3.92 AU; see Fig. 7
A).
|
(10 ng/ml),
TNF-
(100 ng/ml), or TGF-
(10 ng/ml) for 24 h. Aggrecanase-2
protein expression was determined by Western blot analysis
(n = 4). As with mRNA levels, there were no significant
changes in aggrecanase-2 protein levels after IL-1
, TNF-
, or
TGF-
stimulation (see Fig. 7Aggrecanase-1 and -2 expression in ST
Because aggrecanase-1 and -2 expression was observed in cultured
FLS, we determined whether the genes were expressed in ST. Relative
aggrecanase-1 mRNA expression in RA (n = 6) and OA
(n = 6) ST compared with nonarthritis tissues
(n = 4) was determined by real-time PCR. As shown in
Fig. 8
, the relative aggrecanase-1 mRNA
expression level in RA ST was 216 ± 116-fold greater than that in
the nonarthritis tissues (p < 0.01). There was
a trend toward increased aggrecanase-1 mRNA expression in OA, but this
did not reach statistical significance. The aggrecanase-1 mRNA
expression level in RA ST was significantly higher than that in OA ST
(p < 0.02). In contrast, relative
aggrecanase-2 mRNA expression in OA (n = 5) and RA
(n = 5) was similar to that in nonarthritis ST
(n = 4; see Fig. 9
).
|
|
Constitutive aggrecanase-2 protein expression was noted in
cultured FLS, so we examined aggrecanase-2 protein expression in ST.
Protein was extracted from RA, OA, and nonarthritis ST, and
aggrecanase-2 protein expression was determined by Western blot
analysis (see Fig. 10
). In contrast to
FLS, two bands were detected in most of the lanes. The higher molecular
mass band, which was near 70 kDa, corresponded to the band detected in
cultured FLS. The lower band (53 kDa) probably corresponds to the
activated enzyme after further partial digestion, as has been
previously described for other ADAMTS proteins (23). The
ratios of the high to low molecular mass species were 0.24 ± 0.09
in RA (n = 15), 1.1 ± 0.68 in OA
(n = 6), and 1.9 ± 0.57 in nonarthritis ST
samples (n = 5; p < 0.01 for RA
compared with nonarthritis). Previous studies of aggrecanase-2
processing have identified aggrecanase activity in enzymes with
molecular mass varying from 50 to 64 kDa (14). This
suggests that post-transcriptional processing of aggrecanase-2 occurs
in the synovium of RA patients even though mRNA levels are similar.
|
Supernatants from four FLS lines incubated for 48 h with or
without TGF-
(10 ng/ml) were analyzed for aggrecanase activity by
incubation with bovine aggrecan monomers for 24 h. Samples were
assayed for products formed by specific aggrecanase-mediated cleavage
by Western blot analysis using the BC-3 mAb that recognizes the
neoepitope generated after cleavage at
Glu373-Ala374. In contrast
to cleavage generated by incubation with the positive control
(supernatant from IL-1-stimulated cartilage), the neoepitope was not
detected in supernatants from the FLS lines (data not shown).
| Discussion |
|---|
|
|
|---|
Depletion of GAG-bearing aggrecan fragments from articular cartilage is one of the earliest events in cartilage loss due to arthritis. However, unlike digestion of native type II collagen by collagenases, proteoglycan depletion can be reversible. Proteolytic cleavage of aggrecan at either Asn341-Phe342 or Glu373-Ala374 is responsible for the loss of aggrecan from cartilage. While several MMPs account for the former activity, the latter is mediated by aggrecanase. Characterization of aggrecanase activity was previously problematic due to the difficulty in isolating the specific enzymes, and until recently most data were derived from explants of human and bovine cartilage. Two enzymes that can cleave aggrecan at Glu373-Ala374 have now been cloned (aggrecanase-1 (ADAMTS-4) and aggrecanase-2 (ADAMTS-5/11)), thereby permitting more detailed molecular understanding of aggrecan metabolism (13, 14).
Previous studies focused primarily on chondrocytes and cartilage as a source of aggrecanase activity (11, 12, 13, 14, 25, 26). However other tissues, such as bovine fibroblasts, joint capsules, and tendon, are also able to produce aggrecanase activity (27, 28, 29, 30). The regulation of both aggrecanase-1 and -2 in human synoviocytes and synovium remains poorly defined. Recently, immunoreactive aggrecanase protein was observed in the synovial intimal lining, although it is not known whether FLS or macrophage-like synoviocytes were the cellular source (30). While chondrocytes can produce large amounts of aggrecanase, FLS and the synovium also serve as major sources of matrix-degrading enzymes in arthritis (31, 32, 33). Therefore, we hypothesized that aggrecanase could be produced by synovial cells in RA and OA and that the synovium can also contribute to aggrecan degradation.
Our initial studies demonstrated that aggrecanase-1 and -2 are
constitutively expressed by RA, OA, and nonarthritis FLS. Of interest,
aggrecanase gene expression in unstimulated cells was similar in all
FLS, regardless of the source. This contrasts with other proteases,
such as MMP-1, where RA FLS constitutively express greater amounts of
collagenase mRNA than cells derived from OA synovium
(34, 35). The availability of a specific
anti-aggrecanase-2 Ab allowed us to confirm that aggrecanase-2 protein
production by RA, OA, and nonarthritis FLS is also similar.
Regulation of aggrecanase by cytokines was then evaluated using
real-time PCR. TGF-
and, to a lesser extent, TNF-
induced
aggrecanase-1 gene expression in FLS. Notably, IL-1
had only a
minimal effect, and none of the cytokines altered aggrecanse-2 mRNA or
protein production. These findings are quite distinct from the previous
reports in chondrocytes and cartilage explants, where IL-1 dramatically
increased aggrecan degradation at the
Glu373-Ala374 site
(12, 25, 26). Aggrecanase activity was not increased in
culture medium of bovine synovial capsule explants or bovine
fibroblasts by IL-1 or retinoic acid, although both were very effective
in chondrocytes (28). Our results are also consistent with
a recent report noting that IL-1 did not increase aggrecanase 2
production by synovial explants (30). Therefore, IL-1,
which is the most potent inducer of MMPs in FLS, has only a marginal
role in aggrecanse regulation in FLS compared with chondrocytes.
TGF-
was the most potent inducer of aggrecanase-1 gene expression,
inducing a 13-fold increase in mRNA levels and an increase in protein
levels in at least some of the lines examined. TGF-
rapidly
increased aggrecanase-1 gene expression, and mRNA levels peaked after
24 h of cytokine exposure. mRNA expression gradually declined over
the subsequent 24 h despite continued cytokine treatment. This
contrasts with the induction of MMPs in FLS, where mRNA production
increases for several days in the presence of cytokines such as IL-1 or
TNF-
. The molecular mechanism of the decrease in aggrecanase-1 mRNA
could involve either transcriptional events or changes in mRNA
half-life.
Dose response experiments indicate that FLS respond to TGF-
concentrations that are present in synovial fluid and tissues
(21, 22). In RA, TGF-
protein expression has been
observed at the cartilage-pannus junction as well as the synovium, and
the cell source of TGF-
is likely to be FLS and macrophages
(36, 37, 38). TGF-
levels in synovium are low in OA
compared with RA (39), and this might contribute to the
lower levels of aggrecanase-1 observed in synovium obtained from OA
patients.
The results with TGF-
are surprising in light of the traditional
belief that this growth factor plays a protective role in matrix
metabolism (40, 41). For instance, TGF-
suppresses
collagenase gene expression and increases the production of tissue
inhibitor of metalloproteinase (TIMP)-1 or TIMP-3 in a variety of cell
types (42, 43, 44, 45). TGF-
also enhances extracellular matrix
deposition by inducing collagen gene expression (46, 47, 48, 49).
These matrix-enhancing effects have been observed in the skin of
patients with scleroderma (50) and in the fibrotic joints
of rats after intra-articular injection of the growth factor
(51). TGF-
also inhibits IL-1-induced chondrocyte
protease activity and cartilage proteoglycan degradation, and promotes
the synthesis of proteoglycan in cartilage (52, 53, 54). In
explant cultures of tissue from both young and mature bovine tendons,
aggrecanase activity was not induced by TGF-
(29). In
the same study aggrecanase activity was induced by IL-1
in explant
cultures of tissue from young bovine tendon, but not in those from
mature tendons (29). Recent findings support the
hypothesis that the effects of TGF-
can potentially promote joint
destruction. For instance, intra-articular injections of TGF-
in
mice induce OA-like changes, including proteoglycan depletion
(55). Therefore, the regulatory mechanism of aggrecanase
by cytokines might depend on cell lineage, age, tissue origin, and
species.
In addition to evaluating aggrecanase regulation in FLS, we used
real-time PCR and Western blot analysis to determine its expression in
intact ST. Aggrecanase-1 mRNA levels were markedly higher in RA samples
compared with OA or nonarthritis tissue, whereas no differences were
observed for aggrecanase-2. This probably reflects the rich cytokine
milieu of RA, including abundant TNF-
and TGF-
(56).
Even though aggrecanase-2 mRNA levels were similar in ST, two bands
(
70 and 53 kDa) were detected in Western blots. The ratio of the
upper bands to the lower bands in RA synovium was significantly lower
than that in nonarthritis synovium, and there was a trend for lower
ratios in OA compared with nonarthritis synovium. It is likely that the
70-kDa band represents a proenzyme form of aggrecanase-2 based on its
predicted molecular mass. The lower molecular mass band probably
results from further processing, as has been described for ADAMTS-1 and
ADAMTS-8, both of which have two processed forms (85 and 67 kDa for
ADAMTS-1 and 79 and 64 kDa for ADAMTS-8) (23).
Furthermore, aggrecanase-2 activity has been identified in proteins
varying from 50 to 64 kDa (14). The relatively higher
amounts of the 53-kDa protein in RA suggest post-translational
modification of aggrecanase-2 and that this, rather than traditional
transcriptional mechanisms, might be important in inflammatory synovium
for this particular aggrecanase.
Although aggrecanase-2 and aggrecanase-1 proteins were demonstrated in cell lysates from FLS, no activity was detected in the supernatants. However, the lack of activity might reflect the presence of the inactive latent forms of aggrecanase-2 or aggrecanase-1 or the possibility that activated enzyme is bound to TIMP-3, which is a potent inhibitor of both aggrecanases. Because aggrecanase binds tightly to the extracellular matrix, the changes in production also might not be reflected by significant differences in biological activity in culture supernatants. Therefore, the lack of processing and matrix-binding properties or the presence of endogenous inhibitors might contribute to the absence of aggrecanase activity in the supernatants of cultured FLS.
In summary, this is the first demonstration of aggrecanase-1 gene
regulation in human synovium and FLS. Surprisingly, aggrecanase-1 was
induced by TGF-
in synoviocytes, whereas aggrecanase-2 was not
regulated by cytokines. Expression of aggrecanase-1, but not
aggrecanase-2, was higher in RA synovium than in nonarthritis and OA
synovium. A low molecular mass aggrecanase-2 protein was detected in RA
synovium, whereas a high molecular mass of aggrecanase-2 protein was
dominant in nonarthritis synovium. Thus, aggrecanase-1 and -2 mRNA are
differentially expressed by FLS; aggrecanase-1 is induced by cytokines,
while synovial aggrecanase-2 appears to be regulated by a
post-translational mechanism.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Gary S. Firestein, Division of Rheumatology, Allergy, and Immunology, University of California at San Diego School of Medicine, Mail Code 0656, 9500 Gilman Drive, La Jolla, CA 92093-0656. E-mail address: gfirestein{at}ucsd.edu ![]()
3 Abbreviations used in this paper: GAG, glycosaminoglycan; ADAMTS, a disintegrin and metalloproteinase with thrombospondin motif; AU, arbitrary densitometry unit; Ct, threshold cycle; FLS, fibroblast-like synoviocyte; IGD, interglobular domain; MMP, matrix metalloproteinase; OA, osteoarthritis; RA, rheumatoid arthritis; ST, synovial tissue; TIMP, tissue inhibitor of metalloproteinase. ![]()
Received for publication February 27, 2001. Accepted for publication November 26, 2001.
| References |
|---|
|
|
|---|
and tumor necrosis factor-
on HLA-DR expression, proliferation, collagenase production, and granulocyte macrophage colony-stimulating factor production by rheumatoid arthritis synoviocytes. J. Clin. Invest. 86:1790.
activity in synovial effusions. J. Exp. Med. 169:291.
and cellular immune responses in synovial fluids. J. Immunol. 144:4189.[Abstract]
production by synovial tissues from rheumatoid patients and streptococcal cell wall arthritic rats: studies on secretion by synovial fibroblast-like cells and immunohistologic localization. J. Immunol. 143:1142.[Abstract]
and IL-1 in rheumatoid synovium. J. Immunol. 145:2514.[Abstract]
1 in rheumatoid synovial membrane and cartilage/pannus junction. Clin. Exp. Immunol. 86:380.[Medline]
receptor endoglin and TGF-
1 in rheumatoid arthritis: possible interactions in the pathogenesis of the disease. Clin. Immunol. Immunopathol. 76:187.[Medline]
1 suppresses acute and chronic arthritis in experimental animals. J. Clin. Invest. 87:1108.
1 on experimental autoimmune diseases in mice. Proc. Natl. Acad. Sci. USA 88:2918.
modulates the expression of collagenase and metalloproteinase inhibitor. EMBO J. 6:1899.[Medline]
. J. Biol. Chem. 264:1860.
1 regulates tissue inhibitor of metalloproteinases-1 expression in differentiated human articular chondrocytes. Arthritis Rheum. 37:395.[Medline]
in articular chondrocytes is mediated by serine/threonine and tyrosine kinases. J. Cell. Biochem. 70:517.[Medline]
stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J. Biol. Chem. 261:4337.
: divergent responses in lung fibroblasts and carcinoma cells. J. Biol. Chem. 263:3111.
regulates the expression and structure of extracellular matrix chondroitin/dermatan sulfate proteoglycans. J. Biol. Chem. 263:3039.
stimulates collagen and glycosaminoglycan biosynthesis in cultured rabbit articular chondrocytes. FEBS Lett. 234:172.[Medline]
: selective increase in glycosaminoglycan synthesis by cultures of fibroblasts from patients with progressive systemic sclerosis. J. Invest. Dermatol. 89:100.[Medline]
. J. Exp. Med. 171:231.
is a potent inhibitor of IL-1 induced protease activity and cartilage proteoglycan degradation. Biochem. Biophys. Res. Commun. 157:1352.[Medline]
: studies in anatomically intact cartilage in vitro and in vivo. Ann. Rheum. Dis. 52:185.
1 stimulates articular chondrocyte proteoglycan synthesis and induces osteophyte formation in the murine knee joint. Lab. Invest. 71:279.[Medline]
injections. Osteoarthritis Cartilage 8:25.[Medline]
This article has been cited by other articles:
![]() |
L. Mosyak, K. Georgiadis, T. Shane, K. Svenson, T. Hebert, T. McDonagh, S. Mackie, S. Olland, L. Lin, X. Zhong, et al. Crystal structures of the two major aggrecan degrading enzymes, ADAMTS4 and ADAMTS5 Protein Sci., January 1, 2008; 17(1): 16 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gendron, M. Kashiwagi, N. H. Lim, J. J. Enghild, I. B. Thogersen, C. Hughes, B. Caterson, and H. Nagase Proteolytic Activities of Human ADAMTS-5: COMPARATIVE STUDIES WITH ADAMTS-4 J. Biol. Chem., June 22, 2007; 282(25): 18294 - 18306. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Haddock, A K Cross, J Plumb, J Surr, D J Buttle, R A. Bunning, and M N Woodroofe Expression of ADAMTS-1, -4, -5 and TIMP-3 in normal and multiple sclerosis CNS white matter Multiple Sclerosis, August 1, 2006; 12(4): 386 - 396. [Abstract] [PDF] |
||||
![]() |
W Hui, H E Barksby, D A Young, T E Cawston, N McKie, and A D Rowan Oncostatin M in combination with tumour necrosis factor {alpha} induces a chondrocyte membrane associated aggrecanase that is distinct from ADAMTS aggrecanase-1 or -2 Ann Rheum Dis, November 1, 2005; 64(11): 1624 - 1632. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Westra, P C Limburg, P de Boer, and M H van Rijswijk Effects of RWJ 67657, a p38 mitogen activated protein kinase (MAPK) inhibitor, on the production of inflammatory mediators by rheumatoid synovial fibroblasts Ann Rheum Dis, November 1, 2004; 63(11): 1453 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hashimoto, M. Shimoda, and Y. Okada ADAMTS4 (Aggrecanase-1) Interaction with the C-terminal Domain of Fibronectin Inhibits Proteolysis of Aggrecan J. Biol. Chem., July 30, 2004; 279(31): 32483 - 32491. [Abstract] [Full Text] [PDF] |
||||