|
|
||||||||


*
Mycobacteria Research Laboratories, Department of Microbiology, Colorado State University, Fort Collins, CO 80523; and
Department of Inflammation and Autoimmune Diseases, Hoffmann-LaRoche, Nutley, NJ 07110
| Abstract |
|---|
|
|
|---|
, and had increased mortality. In
contrast, mice lacking the p35 subunit exhibited a moderate
ability to control bacterial growth, were able to generate Ag-specific
IFN-
responses, and survived infection longer. The superior
Ag-specific responses of the p35 gene-disrupted mice, when compared
with the p40 gene-disrupted mice, suggest that the p40 subunit may act
other than as a component of IL-12. A candidate molecule capable of
driving the protective responses in the p35 gene-disrupted mice is the
novel cytokine IL-23. This cytokine is composed of the IL-12 p40
subunit and a p19 subunit. In support of a role for this cytokine in
protective responses to M. tuberculosis, we determined
that the p19 subunit is induced in the lungs of infected
mice. | Introduction |
|---|
|
|
|---|
is essential in the control of Mycobacterium
tuberculosis; in its absence, mice are acutely susceptible to both
low dose aerogenic infection and high dose i.v. infection (1, 2). In addition, humans lacking the ability to signal via the
IFN-
pathway are acutely susceptible to the most avirulent
mycobacteria (3, 4, 5). The generation of large amounts of
IFN-
at the site of infection is considered dependent upon
Ag-specific lymphocytes. These cells are known to be reliant upon the
cytokine IL-12 for their differentiation into an IFN-
-producing
phenotype (6, 7, 8).
The importance of IL-12 in generation of the protective response to
tuberculosis has been demonstrated indirectly in the aerosol model of
murine infection (9) and both indirectly and directly in
the high dose i.v. model (10, 11). As expected, in the
absence of IL-12, reduced IFN-
production is observed
(10), while the addition of excess IL-12 improves
Ag-specific, IFN-
production (9). It has also been
clearly shown that the protective role of IL-12 in mycobacterial
infection cannot occur in the absence of IFN-
(11).
IL-12 is a heterodimeric cytokine made up of two disulfide-linked
subunits (p35 and p40 (12)) that acts through a high
affinity receptor complex made up of IL-12R
1 and
2
(13). Neither subunit is thought to act alone; however,
the p40 subunit can form a homodimer with affinity for the IL-12R
complex (14, 15). The p40 homodimer is considered an
antagonist of the bioactive IL-12 p70 molecule due to its ability to
bind the receptor complex without inducing intracellular signals
(14, 15). Recent enigmatic data have suggested, however,
that the p40 molecule is able to mediate some IL-12-associated effects
in the absence of the p35 subunit (16, 17). In particular,
mice lacking either the p35 or the p40 subunit differ in their ability
to control various infectious diseases (18, 19).
These observed differences suggest that the absence of the IL-12 p40
subunit may result in increased susceptibility to tuberculosis when
compared with the risk associated with the absence of the p35 subunit.
To test this hypothesis, mice lacking either subunit were infected via
the aerosol route with virulent M. tuberculosis, and the
progression of disease was monitored by enumeration of bacteria,
histological analysis, and assessment of Ag-specific responses. Mice
lacking the ability to make bioactive IL-12 were more susceptible to
pulmonary tuberculosis than were control mice. It was clearly observed,
however, that the mice lacking the p40 subunit were more susceptible
than those lacking the p35 subunit, and that this correlated with the
increased ability of the p35 gene-disrupted (knockout
(KO)3) mice to
generate Ag-specific IFN-
. Recently, a new cytokine, IL-23, has been
identified that is composed of the p40 subunit and a novel, p19 subunit
(20). This cytokine may be responsible for the increased
survival in the p35 KO mice, and indeed its expression is up-regulated
in tuberculosis-affected murine lungs.
| Materials and Methods |
|---|
|
|
|---|
IL-12 p40 gene-disrupted mice (p40 KO) and IL-12 p35 gene-disrupted mice were generated as described (21, 22) and were either bred at Hoffmann-LaRoche (Nutley, NJ) or purchased from The Jackson Laboratory (Bar Harbor, ME). C57BL/6 mice were also purchased from The Jackson Laboratory and were used as controls throughout. Female mice between the ages of 6 and 8 wk were used throughout.
Experimental infection
The Erdman (TMCC 107) strain of M. tuberculosis was grown in Proskauer Beck medium containing 0.05% Tween 80 to mid-log phase and frozen in 1-ml aliquots at -70°C. For aerosol infections, subject animals were infected using a Glas-Col (Terre Haute, IN) airborne infection system, as previously described (23). Mice were euthanized when considered to be failing to thrive. The criteria for "failure to thrive" were contained in a written protocol and were applied equally to all groups.
Bacterial load determination
As previously described (23), infected mice were killed by CO2 asphyxiation and the lungs were aseptically excised. Each of these organs was individually homogenized in physiological saline, and serial dilutions of the organ homogenate were plated on nutrient 7H11 agar. Bacterial colony formation was counted after 3 wk of incubation at 37°C.
Cell preparation and culture
A single cell suspension was prepared from the spleen, as previously described (24). Briefly, spleens were passed through 70-µm nylon cell strainers and RBCs were lysed using Geys solution. Cells were counted and were then either cultured with Ag (at 5 x 106/ml) or analyzed by flow cytometry. Lung cell preparations were prepared as described previously (25). Briefly, the lungs were perfused through the heart with cold saline containing heparin. Once lungs appeared white, they were removed and sectioned in ice-cold media using sterile razor blades. Dissected lung tissue was then incubated in Collagenase IX (0.7 mg/ml; Sigma) and DNase (30 µg/ml; Sigma) at 37°C for 30 min. Digested lung tissue was gently disrupted by passage through a 70-µm pore size nylon cell strainer, the resultant single cell suspension was washed twice, and cells were either placed in culture (at 5 x 106/ml) with mycobacterial Ags or analyzed by flow cytometry.
Splenocytes were cultured directly with Ag, whereas lung cells were
cultured on bone marrow-derived macrophages generated as previously
described (26). Cells were cultured either in the absence
of mycobacterial Ag or with M. tuberculosis-derived culture
filtrate proteins at 25 µg/ml (obtained from J. Belisle, Colorado
State University, under National Institutes of Health Contract
AI-75320). Cultures were incubated for 72 h at 37°C and 5%
CO2 before cytokine analysis. Supernatants were
assayed for the presence of IFN-
by ELISA using Ab pairs purchased
from BD PharMingen (San Diego, CA).
Flow cytometry
Single cell suspensions were prepared from spleens or lungs, as
described above. Cells from individual mice were incubated with
specific Ab for 30 min at 4°C in the dark. Some cells were incubated
with anti-CD3 (clone 145-2C11), anti-CD28 (clone 37.51), and
monensin for 4 h before staining. Cells were either washed and
analyzed or permeabilized, and the presence of intracellular IFN-
was probed for with labeled Ab (FITC-labeled clone XMG1.2). Cells were
stained with Abs recognizing CD4 (allophycocyanin or PE-labeled
clone GK1.5), CD8 (allophycocyanin-labeled clone 53-6.7), CD3
(PerCP-labeled clone 145-2C11), CD44 (FITC-labeled clone IM7), and
CD62L (PE-labeled clone MEL-14) (all from BD PharMingen). Control wells
containing isotype Abs were also prepared. Cells were then analyzed
using CellQuest on a FACSCalibur (BD Biosciences, Mountain View, CA)
dual laser flow cytometer with excitation at 488 and 633 nM.
Lymphocytes were gated based on their forward and side scatter
characteristics, and the number of such lymphocytes per spleen was
determined. Twenty thousand CD3- and CD4 (or CD8)-positive lymphocytes
were then analyzed for their expression of the activation markers CD44
and CD62L. Coexpression of the CD44 and CD62L cell surface
molecules fell into four categories, and gates identifying these
categories were applied in an identical manner for all groups and time
points, as previously described (27).
Measurement of delayed-type hypersensitivity (DTH)
Mice infected with M. tuberculosis were inoculated intradermally with 50 µl saline containing 10 µg purified protein derived from M. tuberculosis (Pasteur Mérieux Connaught, Toronto, Ontario, Canada) or sterile saline as a control in the contralateral footpad. Induration was measured at 48 h following inoculation, with dial calipers that can detect swelling in increments of 0.05 mm. Results are expressed as the difference in the mean swelling between the saline- and purified protein derivative-inoculated footpads of individual mice (n = 4 in each of two separate experiments).
Real-time PCR analysis of lung tissue
Lung tissue from infected mice was frozen in Ultraspec (Biotexc, Friendswood, TX), and total RNA was extracted following the manufacturers protocol. RNA was then reverse transcribed and amplified using p19 primers and probe generated using the published sequence of p19 (20) in the Applied Biosystems (Foster City, CA) Primer Express software program. The primer sequences are as follows: forward primer, CAGCAGCTCTCTCGGAAT; reverse primer, ACAACCATCTTCACACTGGATACG; and probe, CATGCTAGCCTGGAACGCACATGC. Briefly, RNA samples (n = 4) from each group and each time point were reverse transcribed using Taqman reagents. cDNA was then amplified using Taqman (Applied Biosystems) reagents on the ABI Prism 7700 sequence detection system (Applied Biosystems), and the signal for both p19 and18S RNA was recorded. The signal for p19 was normalized to the signal for 18S RNA and to the sample with the least p19 signal, following the manufacturers directions. Samples were also treated with DNase or run in the absence of the reverse-transcription enzyme to confirm that signal was derived from RNA.
| Results |
|---|
|
|
|---|
Fig. 1
A illustrates the
fact that neither the p35 KO nor the p40 KO mice were capable of
controlling bacterial growth as efficiently as the intact C57BL/6 mice
were. It is clear, however, that the mice lacking the p40 subunit of
IL-12 were more susceptible to bacterial growth than were the mice
lacking the p35 subunit. All three groups allowed bacterial
dissemination to, and growth within, the spleen (Fig. 1
B).
The pattern of bacterial growth in this organ did, however, mirror that
in the lung, with the control C57BL/6 exhibiting greater control of
growth compared with the p35 KO, which in turn was more resistant than
the p40 KO.
|
A focused Ag-specific IFN-
response is required for effective
control of M. tuberculosis; the ability of the p40 and p35
KO mice to generate such a response was therefore compared. In an
initial analysis of the ability of the IL-12-deficient mice to generate
Ag-specific cellular responses, the swelling response of the footpad
was measured following Ag challenge of infected mice. At 30 and 40 days
of infection, both the control and the p35 KO mice exhibited
significantly more footpad swelling than the p40 KO mice (Fig. 2
).
|
response than are mice lacking the p35 subunit
To determine whether this cellular recruitment was potentially
protective, the ability of the mice to generate Ag-specific
IFN-
-producing cells was determined. Fig. 3
illustrates the ability of cells from
the spleen, draining lymph node, and the lung to produce IFN-
in
response to mycobacterial Ag. The peak of response in the control
animals is seen in the spleens and draining nodes by day 20 of
infection (Fig. 3
, top and center panel); this
response then wanes, correlating with the control of bacterial growth
(Fig. 1
). Cells from the infected lungs were also able to produce
IFN-
in response to Ag when analyzed at day 30 (analysis of lung
cell responses was performed at day 30 only) (Fig. 3
, bottom
panel), reflecting the fact that the Ag-specific cells are
recruited to the infected organ. Interestingly, the p35 KO mice were
also able to generate an Ag-specific IFN-
response in the spleens,
node, and lung (Fig. 3
). The response in the p35 KO mice was initially
less vigorous in the spleen, waned earlier in the spleen and draining
node, and was less vigorous at the principal site of infection, the
lung. Although less potent than the response seen in the control
animals, the p35 KO response was much more vigorous than that seen in
the p40 KO mice. In the p40 KO animals, only a short-lived and minor
Ag-specific response could be seen in the draining node, and little to
no response was detected in the spleen or lung (Fig. 3
).
|
In a more detailed analysis of the cells being recruited to the
lung, lungs were digested and cells were analyzed by flow cytometry for
the expression of activation markers and for the presence of
intracellular IFN-
. As might be expected, a high percentage of
CD4-positive cells in the infected lung was of the activation phenotype
characterized by high expression of CD44 and low expression of CD62L
(Fig. 4
, bottom). The
IL-12-deficient mice both had significantly reduced numbers of CD4
cells in the lungs (data not shown), and this resulted in significantly
lower numbers of activated CD4 lymphocytes (Fig. 4
, top).
Although total numbers of activated cells were similar for the p35 and
p40 KO mice, there was a slight, but significant increased percentage
of activated cells in the infected p35 KO lungs compared with the p40
KO lungs (Fig. 4
, bottom ). This pattern of reduced
expression of lymphocyte activation markers on CD4 cells was also
observed in the spleens of the p40 and p35 KO mice (data not shown).
The number of activated CD8 T cells was between 5- and 10-fold less
than the number of activated CD4 T cells in the C57BL/6 mice (data not
shown). The low numbers of CD8 cells meant that no statistically
significant differences could be detected between the intact and
IL-12-deficient mice.
|
-producing cells to the lung than are mice lacking the p35
subunit
The significant reduction in activated CD4 cells in the lungs of
the IL-12-deficient mice serves to partially explain the increased
susceptibility of these mice to tuberculosis. The similarity between
the numbers of activated cells in the lungs of the p35 and p40 KO mice
does not, however, explain the increased resistance of the p35 compared
with the p40 KO. To determine whether the activated cells present in
the p35 KO mice were potentially more effective at controlling
bacterial growth, their ability to express IFN-
was assessed. Not
surprisingly, a significant number of CD4 cells recruited to the lungs
of infected control mice were capable of expressing IFN-
(Fig. 5
A). The cytokine-positive
cells were also CD44 high (Fig. 5
B). The percentage of
IFN-
-producing cells in the p35 KO mouse lungs was variable, but
generally higher, than was seen in the p40 KO (not shown). This
increased percentage translated into significantly higher total numbers
of IFN-
-producing cells in these mice compared with p40 KO mice
(Fig. 5
A). This pattern was also seen in the spleen (data
not shown). The number of IFN-
-producing cells in the p35 KO mice
tended to be lower than for the wild-type mice
(p = 0.057), and this suboptimal response may
explain their eventual failure to control the growth of bacteria.
|
-producing CD8 T cells was between 5- and 10-fold
less than the number of IFN-
-producing CD4 T cells in the C57BL/6
mice (data not shown). The low numbers of CD8 cells meant that no
statistically significant differences could be detected between the
intact and IL-12-deficient mice. There was, however, a pattern of
reduced numbers of IFN-
-producing CD8 cells in both of the
IL-12-deficient mice; this reduction was most pronounced in the lung
(data not shown). Mice infected with M. tuberculosis increase the expression of the p19 subunit of IL-23
The difference in the ability of the p35 and p40 KO mice to
generate IFN-
-producing cells suggested that an additional
IFN-
-inducing agent was active in the p35 KO mice. A candidate
cytokine composed of the p40 subunit and a novel p19 subunit has
recently been described (20) that acts in a similar, but
not identical manner to IL-12. To determine whether this cytokine was
available to the p35 KO mice and was therefore potentially responsible
for the increased protection seen in these mice, the level of mRNA for
the p19 subunit was measured. The p19 message was not detected in
uninfected lungs, but was significantly increased by 30 days
postinfection (Fig. 6
). All three groups
of infected mice exhibited increased and similar mRNA levels by day 30;
however, by day 40, the p19 signal from the p40 and p35 lungs was
higher than the p19 signal from the B6 lungs (Fig. 6
).
|
| Discussion |
|---|
|
|
|---|
The initial similarity in bacterial numbers in all three groups of mice
suggests that any early protective mechanisms in the lung are not
dependent upon IL-12 subunits p35 or p40. This is not surprising in
view of the fact that even the absence of IFN-
does not result in a
strong susceptible phenotype early in aerosol infection
(27). It is therefore likely that the protective effect of
both IL-12 subunits is mediated through the differentiation of
IFN-
-producing, Ag-specific lymphocytes. Indeed, the reduction of
both DTH and Ag-specific, IFN-
responses were the most significant
differences observed between the control and IL-12-deficient mice. The
data also suggest that the IFN-
response and the DTH response are
not necessarily synonymous, as DTH is clearly seen in the p35 KO mice
at day 40 when the IFN-
response in the spleen has waned. We have
also reported that DTH is clearly seen in the M.
tuberculosis IFN-
gene-deleted mouse (27), further
demonstrating that while both responses are required for protection,
they are not inseparably linked.
The induction of the IFN-
gene in lymphocytes can be achieved in the
presence or absence of Ag; however, both mechanisms require IL-12
(28, 29). Bioactive IL-12p70 induces IFN-
gene
expression in CD4 T cells via the IL-12R and STAT4 activation
(30, 31). IL-23 also binds the IL-12R
1 chain of the
IL-12R, activates STAT4, and can drive IFN-
production
(20). The p40 homodimer can also bind to the IL-12R, but
acts as an antagonist (14, 32, 33). In intact mice, both
IL-12p70 and IL-23 are potentially available to drive the protective
response; in addition, the p40 homodimer may provide control of the
response. In the p40-deficient mice, none of the three IL-12-related
molecules can be made, whereas in the p35-deficient mice, both IL-23
and the p40 homodimer are potentially available. The drastically
reduced responses in the p40-deficient mouse suggest that Ag-specific
DTH and IFN-
production depend upon the p40 subunit. The presence of
these responses in the p35-deficient mouse suggests that IL-12p70 is
not essential in initiating these responses, particularly in
tuberculosis. Of the alternative molecules available to the
p35-deficient mouse, IL-23 is the most likely to drive these protective
responses. Although the p40 homodimer has been shown to drive IFN-
production in CD8 T cells in vitro (17), the p35 KO mice
failed to exhibit an increase in IFN-
-producing CD8 T cells,
negating a role for this mechanism in this model.
IL-23 does not drive the proliferation of naive CD4 cells in in vitro
models; however, IL-12p70 is not particularly potent in this regard
either (20). The expansion of CD4 lymphocytes with an
activated phenotype is, however, compromised in both the p35 and p40 KO
mice, implicating IL-12p70 as a principal inducer of maximal cellular
proliferation in response to mycobacterial infection. Mice lacking the
p35 subunit were, however, clearly capable of generating
IFN-
-producing CD4 T cells expressing a high level of CD44.
Unfortunately, these cells were not capable of fully protecting the
mice, even against the low dose challenge used in this study. There are
two possible reasons for this. The first is that the response in the
absence of p40 is not optimal and bacterial numbers simply overwhelm
the response. This mechanism is supported by the data, as the total
number of protective cells in the p35 KO mice was less than that
produced by the intact mice. A second explanation, which is not
mutually exclusive of the first, is that IL-12p70 is required to keep
differentiated cells alive. Again, the data support this explanation,
as the Ag-specific IFN-
response fades more rapidly in the p35 KO
mice even in the face of increasing bacterial numbers. IL-12p70 has
also been specifically implicated as a mediator of increased Th1 cell
survival. In particular, in leishmaniasis and toxoplasmosis,
IL-12p70-treated p40 KO mice can only control disease as long as
external IL-12p70 is provided (34, 35).
How then do the p40, p35, and p19 subunits interact to protect mice
from tuberculosis? Once bacteria enter the lung, they will be
phagocytosed by macrophages or immature dendritic cells
(36); the dendritic cells then transport the bacteria to
the spleen and draining lymph node. At these sites, the newly matured
dendritic cells drive Ag-specific T cell activation. Optimum expansion
of activated lymphocytes requires the presence of the p40 subunit
probably in the form of IL-12p70. In the absence of IL-12p70, however,
both activation and differentiation to an IFN-
-producing cell can
occur, and this is most likely mediated through the action of IL-23.
The relative roles of either IL-12p70 or IL-23 in driving the IFN-
response have not been addressed in this work and await the
availability of the p19 gene-deleted mouse and/or neutralizing
anti-p19 Ab. The presence of p19 in the lungs of infected mice
suggests that IL-23 may be available at the site of infection and may
serve to augment the response locally. It is likely that the p19 in the
lung is derived from activated macrophages and dendritic cells
(20) present in the developing granuloma. It may be
induced via Toll-like receptor 2 (TLR2), as dendritic cells produce the
p19 subunit following ligation of the TLR2 (37) and a
19-kDa lipoprotein of M. tuberculosis is a stimulatory
ligand for TLR2 (38).
The identification of the mechanisms involved in the induction of the protective response to tuberculosis will help in the rational design of vaccines. The observation that protective mechanisms can be expressed in the absence of IL-12p70 supports the development of vaccines that target not only the induction of IL-12p70, but also other potentially protective cytokines such as IL-23.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Andrea M. Cooper at the current address: Trudeau Institute, 100 Algonquin Road, Saranac Lake, NY 12983. E-mail address: acooper{at}trudeauinstitute.org ![]()
3 Abbreviations used in this paper: KO, knockout; DTH, delayed-type hypersensitivity; TLR, Toll-like receptor. ![]()
Received for publication August 28, 2001. Accepted for publication November 27, 2001.
| References |
|---|
|
|
|---|
gene-disrupted mice. J. Exp. Med. 178:2243.
in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249.
in host defense against mycobacteria and salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]
(IFN-
) pathway. Clin. Exp. Immunol. 121:417.[Medline]
receptor gene and susceptibility to mycobacterial infection. N. Engl. J. Med. 335:1941.
production by mouse T helper clones that are unresponsive to B7 costimulation. J. Exp. Med. 180:223.
-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.
1 subunit of the IL-12 receptor. Transplantation 67:1453.[Medline]
-producing cells. J. Immunol. 158:643.[Abstract]
production and type 1 cytokine responses. Immunity 4:471.[Medline]
-deficient mouse. Cell. Immunol. 211:43.[Medline]
production in CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29:548.[Medline]
production and activates IRAK and NF
B. Immunity 7:571.[Medline]
1 chain (IL-12R
1)-deficient mice: IL-12R
1 is an essential component of the functional mouse IL-12 receptor. J. Immunol. 159:1658.[Abstract]
production from CD4+ versus CD8+ T cells. J. Exp. Med. 189:1355.
production in T cells mediating chronic resistance to the intracellular pathogen Toxoplasma gondii. J. Immunol. 165:628.This article has been cited by other articles:
![]() |
Z. Mikhak, A. Farsidjani, and A. D. Luster Endotoxin Augmented Antigen-Induced Th1 Cell Trafficking Amplifies Airway Neutrophilic Inflammation J. Immunol., June 15, 2009; 182(12): 7946 - 7956. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Silver, J. Walrath, H. Lee, B. A. Jacobson, H. Horton, M. R. Bowman, K. Nocka, and J. P. Sypek Human Alveolar Macrophage Gene Responses to Mycobacterium tuberculosis Strains H37Ra and H37Rv Am. J. Respir. Cell Mol. Biol., April 1, 2009; 40(4): 491 - 504. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Marquis, R. LaCourse, L. Ryan, R. J. North, and P. Gros Disseminated and Rapidly Fatal Tuberculosis in Mice Bearing a Defective Allele at IFN Regulatory Factor 8 J. Immunol., March 1, 2009; 182(5): 3008 - 3015. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van de Wetering, R. A. de Paus, J. T. van Dissel, and E. van de Vosse IL-23 modulates CD56+/CD3- NK Cell and CD56+/CD3+ NK-like T Cell function differentially from IL-12 Int. Immunol., February 1, 2009; 21(2): 145 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. O'Day Andrea Cooper: Using pathogens to probe the immune response J. Exp. Med., November 24, 2008; 205(12): 2690 - 2691. [Full Text] [PDF] |
||||
![]() |
M. D. Woolard, L. L. Hensley, T. H. Kawula, and J. A. Frelinger Respiratory Francisella tularensis Live Vaccine Strain Infection Induces Th17 Cells and Prostaglandin E2, Which Inhibits Generation of Gamma Interferon-Positive T Cells Infect. Immun., June 1, 2008; 76(6): 2651 - 2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Doz, S. Rose, J. Nigou, M. Gilleron, G. Puzo, F. Erard, B. Ryffel, and V. F. J. Quesniaux Acylation Determines the Toll-like receptor (TLR)-dependent Positive Versus TLR2-, Mannose Receptor-, and SIGNR1-independent Negative Regulation of Pro-inflammatory Cytokines by Mycobacterial Lipomannan J. Biol. Chem., September 7, 2007; 282(36): 26014 - 26025. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Turcotte, S. Gauthier, D. Malo, M. Tam, M. M. Stevenson, and P. Gros Icsbp1/IRF-8 Is Required for Innate and Adaptive Immune Responses against Intracellular Pathogens J. Immunol., August 15, 2007; 179(4): 2467 - 2476. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Fremond, D. Togbe, E. Doz, S. Rose, V. Vasseur, I. Maillet, M. Jacobs, B. Ryffel, and V. F. J. Quesniaux IL-1 Receptor-Mediated Signal Is an Essential Component of MyD88-Dependent Innate Response to Mycobacterium tuberculosis Infection J. Immunol., July 15, 2007; 179(2): 1178 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ma, S. Mishra, K. Gee, J. P. Mishra, D. Nandan, N. E. Reiner, J. B. Angel, and A. Kumar Cyclosporin A and FK506 Inhibit IL-12p40 Production through the Calmodulin/Calmodulin-dependent Protein Kinase-activated Phosphoinositide 3-Kinase in Lipopolysaccharide-stimulated Human Monocytic Cells J. Biol. Chem., May 4, 2007; 282(18): 13351 - 13362. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Umemura, A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, et al. IL-17-Mediated Regulation of Innate and Acquired Immune Response against Pulmonary Mycobacterium bovis Bacille Calmette-Guerin Infection J. Immunol., March 15, 2007; 178(6): 3786 - 3796. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Wozniak, A. A. Ryan, and W. J. Britton Interleukin-23 Restores Immunity to Mycobacterium tuberculosis Infection in IL-12p40-Deficient Mice and Is Not Required for the Development of IL-17-Secreting T Cell Responses J. Immunol., December 15, 2006; 177(12): 8684 - 8692. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Duerr, K. D. Taylor, S. R. Brant, J. D. Rioux, M. S. Silverberg, M. J. Daly, A. H. Steinhart, C. Abraham, M. Regueiro, A. Griffiths, et al. A Genome-Wide Association Study Identifies IL23R as an Inflammatory Bowel Disease Gene Science, December 1, 2006; 314(5804): 1461 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Feng, M. Kaviratne, A. G. Rothfuchs, A. Cheever, S. Hieny, H. A. Young, T. A. Wynn, and A. Sher NK Cell-Derived IFN-{gamma} Differentially Regulates Innate Resistance and Neutrophil Response in T Cell-Deficient Hosts Infected with Mycobacterium tuberculosis J. Immunol., November 15, 2006; 177(10): 7086 - 7093. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Chackerian, S.-J. Chen, S. J. Brodie, J. D. Mattson, T. K. McClanahan, R. A. Kastelein, and E. P. Bowman Neutralization or Absence of the Interleukin-23 Pathway Does Not Compromise Immunity to Mycobacterial Infection Infect. Immun., November 1, 2006; 74(11): 6092 - 6099. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Kullberg, D. Jankovic, C. G. Feng, S. Hue, P. L. Gorelick, B. S. McKenzie, D. J. Cua, F. Powrie, A. W. Cheever, K. J. Maloy, et al. IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis J. Exp. Med., October 30, 2006; 203(11): 2485 - 2494. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Lu, C. Newton, I. Perkins, H. Friedman, and T. W. Klein Cannabinoid Treatment Suppresses the T-Helper Cell-Polarizing Function of Mouse Dendritic Cells Stimulated with Legionella pneumophila Infection J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 269 - 276. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lockhart, A. M. Green, and J. L. Flynn IL-17 Production Is Dominated by {gamma}{delta} T Cells rather than CD4 T Cells during Mycobacterium tuberculosis Infection J. Immunol., October 1, 2006; 177(7): 4662 - 4669. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Khader, S. Partida-Sanchez, G. Bell, D. M. Jelley-Gibbs, S. Swain, J. E. Pearl, N. Ghilardi, F. J. deSauvage, F. E. Lund, and A. M. Cooper Interleukin 12p40 is required for dendritic cell migration and T cell priming after Mycobacterium tuberculosis infection J. Exp. Med., July 10, 2006; 203(7): 1805 - 1815. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Keller, R. Hoffmann, R. Lang, S. Brandau, C. Hermann, and S. Ehlers Genetically Determined Susceptibility to Tuberculosis in Mice Causally Involves Accelerated and Enhanced Recruitment of Granulocytes Infect. Immun., July 1, 2006; 74(7): 4295 - 4309. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W. Murray, C. W. Tsai, J. Liu, and X. Ma Responses to Leishmania donovani in Mice Deficient in Interleukin-12 (IL-12), IL-12/IL-23, or IL-18 Infect. Immun., July 1, 2006; 74(7): 4370 - 4374. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Careau, L.-I. Proulx, P. Pouliot, A. Spahr, V. Turmel, and E. Y. Bissonnette Antigen sensitization modulates alveolar macrophage functions in an asthma model Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L871 - L879. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Wieland, S. Florquin, J. M. Pater, S. Weijer, and T. van der Poll CD4+ Cells Play a Limited Role in Murine Lung Infection with Mycobacterium kansasii Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 167 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Wozniak, A. A. Ryan, J. A. Triccas, and W. J. Britton Plasmid Interleukin-23 (IL-23), but Not Plasmid IL-27, Enhances the Protective Efficacy of a DNA Vaccine against Mycobacterium tuberculosis Infection Infect. Immun., January 1, 2006; 74(1): 557 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A.F. Hegazi, K. N. Rao, A. Mayle, A. R. Sepulveda, L. E. Otterbein, and S. E. Plevy Carbon monoxide ameliorates chronic murine colitis through a heme oxygenase 1-dependent pathway J. Exp. Med., December 19, 2005; 202(12): 1703 - 1713. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Saul, T. M. Oberyszyn, C. Daugherty, D. Kusewitt, S. Jones, S. Jewell, W. B. Malarkey, A. Lehman, S. Lemeshow, and F. S. Dhabhar Chronic Stress and Susceptibility to Skin Cancer J Natl Cancer Inst, December 7, 2005; 97(23): 1760 - 1767. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Happel, P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, et al. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae J. Exp. Med., September 19, 2005; 202(6): 761 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Happel, E. A. Lockhart, C. M. Mason, E. Porretta, E. Keoshkerian, A. R. Odden, S. Nelson, and A. J. Ramsay Pulmonary Interleukin-23 Gene Delivery Increases Local T-Cell Immunity and Controls Growth of Mycobacterium tuberculosis in the Lungs Infect. Immun., September 1, 2005; 73(9): 5782 - 5788. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Khader, J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper IL-23 Compensates for the Absence of IL-12p70 and Is Essential for the IL-17 Response during Tuberculosis but Is Dispensable for Protection and Antigen-Specific IFN-{gamma} Responses if IL-12p70 Is Available J. Immunol., July 15, 2005; 175(2): 788 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Simmons, G. E. Thwaites, N. T. H. Quyen, T. T. H. Chau, P. P. Mai, N. T. Dung, K. Stepniewska, N. J. White, T. T. Hien, and J. Farrar The Clinical Benefit of Adjunctive Dexamethasone in Tuberculous Meningitis Is Not Associated with Measurable Attenuation of Peripheral or Local Immune Responses J. Immunol., July 1, 2005; 175(1): 579 - 590. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gonzalez-Juarrero, J. M. Hattle, A. Izzo, A. P. Junqueira-Kipnis, T. S. Shim, B. C. Trapnell, A. M. Cooper, and I. M. Orme Disruption of granulocyte macrophage-colony stimulating factor production in the lungs severely affects the ability of mice to control Mycobacterium tuberculosis infection J. Leukoc. Biol., June 1, 2005; 77(6): 914 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Schuetze, S. Schoeneberger, U. Mueller, M. A. Freudenberg, G. Alber, and R. K. Straubinger IL-12 family members: differential kinetics of their TLR4-mediated induction by Salmonella Enteritidis and the impact of IL-10 in bone marrow-derived macrophages Int. Immunol., May 1, 2005; 17(5): 649 - 659. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Feng, D. Jankovic, M. Kullberg, A. Cheever, C. A. Scanga, S. Hieny, P. Caspar, G. S. Yap, and A. Sher Maintenance of Pulmonary Th1 Effector Function in Chronic Tuberculosis Requires Persistent IL-12 Production J. Immunol., April 1, 2005; 174(7): 4185 - 4192. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Holscher, A. Holscher, D. Ruckerl, T. Yoshimoto, H. Yoshida, T. Mak, C. Saris, and S. Ehlers The IL-27 Receptor Chain WSX-1 Differentially Regulates Antibacterial Immunity and Survival during Experimental Tuberculosis J. Immunol., March 15, 2005; 174(6): 3534 - 3544. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fedele, P. Stefanelli, F. Spensieri, C. Fazio, P. Mastrantonio, and C. M. Ausiello Bordetella pertussis-Infected Human Monocyte-Derived Dendritic Cells Undergo Maturation and Induce Th1 Polarization and Interleukin-23 Expression Infect. Immun., March 1, 2005; 73(3): 1590 - 1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Pearl, S. A. Khader, A. Solache, L. Gilmartin, N. Ghilardi, F. deSauvage, and A. M. Cooper IL-27 Signaling Compromises Control of Bacterial Growth in Mycobacteria-Infected Mice J. Immunol., December 15, 2004; 173(12): 7490 - 7496. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Pouniotis, O. Proudfoot, V. Bogdanoska, V. Apostolopoulos, T. Fifis, and M. Plebanski Dendritic Cells Induce Immunity and Long-Lasting Protection against Blood-Stage Malaria despite an In Vitro Parasite-Induced Maturation Defect Infect. Immun., September 1, 2004; 72(9): 5331 - 5339. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsui, O. Moriya, M. L. Belladonna, S. Kamiya, F. A. Lemonnier, T. Yoshimoto, and T. Akatsuka Adjuvant Activities of Novel Cytokines, Interleukin-23 (IL-23) and IL-27, for Induction of Hepatitis C Virus-Specific Cytotoxic T Lymphocytes in HLA-A*0201 Transgenic Mice J. Virol., September 1, 2004; 78(17): 9093 - 9104. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Lieberman, F. Cardillo, A. M. Owyang, D. M. Rennick, D. J. Cua, R. A. Kastelein, and C. A. Hunter IL-23 Provides a Limited Mechanism of Resistance to Acute Toxoplasmosis in the Absence of IL-12 J. Immunol., August 1, 2004; 173(3): 1887 - 1893. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Coussens Model for Immune Responses to Mycobacterium avium Subspecies paratuberculosis in Cattle Infect. Immun., June 1, 2004; 72(6): 3089 - 3096. [Full Text] [PDF] |
||||
![]() |
D. Nolt and J. L. Flynn Interleukin-12 Therapy Reduces the Number of Immune Cells and Pathology in Lungs of Mice Infected with Mycobacterium tuberculosis Infect. Immun., May 1, 2004; 72(5): 2976 - 2988. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Quesniaux, D. M. Nicolle, D. Torres, L. Kremer, Y. Guerardel, J. Nigou, G. Puzo, F. Erard, and B. Ryffel Toll-Like Receptor 2 (TLR2)-Dependent-Positive and TLR2-Independent-Negative Regulation of Proinflammatory Cytokines by Mycobacterial Lipomannans J. Immunol., April 1, 2004; 172(7): 4425 - 4434. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. W. Verreck, T. de Boer, D. M. L. Langenberg, M. A. Hoeve, M. Kramer, E. Vaisberg, R. Kastelein, A. Kolk, R. de Waal-Malefyt, and T. H. M. Ottenhoff Human IL-23-producing type 1 macrophages promote but IL-10-producing type 2 macrophages subvert immunity to (myco)bacteria PNAS, March 30, 2004; 101(13): 4560 - 4565. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Hancock, F. M. Szaba, K. N. Berggren, M. A. Parent, I. K. Mullarky, J. Pearl, A. M. Cooper, K. H. Ely, D. L. Woodland, I.-J. Kim, et al. Intact type 1 immunity and immune-associated coagulative responses in mice lacking IFN{gamma}-inducible fibrinogen-like protein 2 PNAS, March 2, 2004; 101(9): 3005 - 3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Stallmach, T Marth, B Weiss, B M Wittig, A Hombach, C Schmidt, M Neurath, M Zeitz, S Zeuzem, and H Abken An interleukin 12 p40-IgG2b fusion protein abrogates T cell mediated inflammation: anti-inflammatory activity in Crohn's disease and experimental colitis in vivo Gut, March 1, 2004; 53(3): 339 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ghilardi, N. Kljavin, Q. Chen, S. Lucas, A. L. Gurney, and F. J. de Sauvage Compromised Humoral and Delayed-Type Hypersensitivity Responses in IL-23-Deficient Mice J. Immunol., March 1, 2004; 172(5): 2827 - 2833. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ma, K. Gee, W. Lim, K. Chambers, J. B. Angel, M. Kozlowski, and A. Kumar Dexamethasone Inhibits IL-12p40 Production in Lipopolysaccharide-Stimulated Human Monocytic Cells by Down-Regulating the Activity of c-Jun N-Terminal Kinase, the Activation Protein-1, and NF-{kappa}B Transcription Factors J. Immunol., January 1, 2004; 172(1): 318 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Junqueira-Kipnis, A. Kipnis, A. Jamieson, M. G. Juarrero, A. Diefenbach, D. H. Raulet, J. Turner, and I. M. Orme NK Cells Respond to Pulmonary Infection with Mycobacterium tuberculosis, but Play a Minimal Role in Protection J. Immunol., December 1, 2003; 171(11): 6039 - 6045. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Cowley and K. L. Elkins CD4+ T Cells Mediate IFN-{gamma}-Independent Control of Mycobacterium tuberculosis Infection Both In Vitro and In Vivo J. Immunol., November 1, 2003; 171(9): 4689 - 4699. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Rotta, E. W. Edwards, S. Sangaletti, C. Bennett, S. Ronzoni, M. P. Colombo, R. M. Steinman, G. J. Randolph, and M. Rescigno Lipopolysaccharide or Whole Bacteria Block the Conversion of Inflammatory Monocytes into Dendritic Cells In Vivo J. Exp. Med., October 20, 2003; 198(8): 1253 - 1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhu, K. Rao, H. Xiong, K. Gagnidze, F. Li, C. Horvath, and S. Plevy Activation of the Murine Interleukin-12 p40 Promoter by Functional Interactions between NFAT and ICSBP J. Biol. Chem., October 10, 2003; 278(41): 39372 - 39382. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fieschi, S. Dupuis, E. Catherinot, J. Feinberg, J. Bustamante, A. Breiman, F. Altare, R. Baretto, F. Le Deist, S. Kayal, et al. Low Penetrance, Broad Resistance, and Favorable Outcome of Interleukin 12 Receptor {beta}1 Deficiency: Medical and Immunological Implications J. Exp. Med., February 17, 2003; 197(4): 527 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aggarwal, N. Ghilardi, M.-H. Xie, F. J. de Sauvage, and A. L. Gurney Interleukin-23 Promotes a Distinct CD4 T Cell Activation State Characterized by the Production of Interleukin-17 J. Biol. Chem., January 10, 2003; 278(3): 1910 - 1914. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. R. Lankford and D. M. Frucht A unique role for IL-23 in promoting cellular immunity J. Leukoc. Biol., January 1, 2003; 73(1): 49 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gran, G.-X. Zhang, S. Yu, J. Li, X.-H. Chen, E. S. Ventura, M. Kamoun, and A. Rostami IL-12p35-Deficient Mice Are Susceptible to Experimental Autoimmune Encephalomyelitis: Evidence for Redundancy in the IL-12 System in the Induction of Central Nervous System Autoimmune Demyelination J. Immunol., December 15, 2002; 169(12): 7104 - 7110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Turner, M. Gonzalez-Juarrero, D. L. Ellis, R. J. Basaraba, A. Kipnis, I. M. Orme, and A. M. Cooper In Vivo IL-10 Production Reactivates Chronic Pulmonary Tuberculosis in C57BL/6 Mice J. Immunol., December 1, 2002; 169(11): 6343 - 6351. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kinjo, K. Kawakami, K. Uezu, S. Yara, K. Miyagi, Y. Koguchi, T. Hoshino, M. Okamoto, Y. Kawase, K. Yokota, et al. Contribution of IL-18 to Th1 Response and Host Defense Against Infection by Mycobacterium tuberculosis: A Comparative Study with IL-12p40 J. Immunol., July 1, 2002; 169(1): 323 - 329. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |