| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
*
Ludwig Institute for Cancer Research, University of Lausanne, Epalinges, Switzerland;
Division of Clinical Onco-Immunology, Ludwig Institute for Cancer Research, University Hospital, Lausanne, Switzerland;
Department of Internal Medicine, Department of Veterans Affairs Medical Center, University of Iowa College of Medicine, Iowa City, IA 52242; and
Coley Pharmaceutical Group, Wellesley, MA 02481
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The curative potential of bacteria in the treatment of malignancies was proposed a very long time ago (reviewed in Ref. 5), and more recently it has been suggested that bacterial DNA could be responsible for immunostimulation and antitumor effect (6). More specifically, the unmethylated CpG dinucleotides in a certain base context (CpG motifs) contained in synthetic oligodeoxynucleotides (ODN) are able to stimulate B cells and NK cells (7). They also activate DCs and induce their maturation into professional APC (8, 9, 10, 11, 12), thereby enhancing their ability to stimulate Ag-reactive T cells in vitro and in vivo. ODN-containing CpG motifs (hereafter referred to as CpG ODN) also stimulate macrophages to secrete Th1 cytokines, which are important in the development of a CTL response (13). In addition, CpG ODN have been shown to behave as adjuvant of Ab (14) and CTL response directed against liposome-entrapped whole protein or class I-restricted peptides (15). When coadministered with whole protein and IFA, CpG ODN provide a signal to switch on specific Th1 response to Ag (16). They are efficient for the induction of a protective antiviral immune response after T cell peptide vaccination (17). Repeated administration of CpG ODN potentiates the CTL response against CTL peptide or protein emulsified in IFA and promotes the survival in response to tumor challenge in both prophylactic and therapeutic vaccination protocols (18). So far, one study provided evidence for the induction of a specific CTL response against a CD8+ T cell peptide in the presence of CpG ODN without additional adjuvant by assessing the cytolytic activity of lymph node cells after in vitro stimulation (12).
In this report, the ability of CpG to act as an adjuvant of the CTL
response against a tumor-derived synthetic peptide in the absence or
presence of an additional adjuvant was directly studied by identifying
and enumerating peptide-specific CTLs in different body
compartments ex vivo. The HLA-A*0201-restricted peptide used was
an analog of the decapeptide Melan-A26–35
(EAAGIGILTV, referred to as EAA26–35) derived
from the melanoma-associated differentiation Ag MART-1/Melan-A
(hereafter referred to as Melan-A) (19, 20). This
peptide analog substituted at position 2
(Melan-A26–35 A27L peptide analog referred to as
ELA26–35) has been shown to be more immunogenic
than its natural counterpart (21, 22). We took advantage
of human human Db (HHD) mice derived from a
strain deficient for the endogenous
2-microglobulin and MHC class I
H-2Db molecules and transgenic for a chimeric MHC
class I molecule, HLA-A*0201/Db, linked to the
human 2-microglobulin (23). In
these mice, only chimeric MHC class I molecule can be detected at the
cell surface. By monitoring the CTL response with peptide-specific
tetramer staining in immunized HHD mice, we show that peptide mixed
with CpG ODN elicits a systemic CTL response. Whereas CpG ODN alone
appeared to be more efficient than IFA alone, a combination of both CpG
ODN and IFA led to the strongest recruitment of peptide-specific
CD8+ T cells. The high frequency of specific CTLs
recruited after immunization with
ELA26–35 suggests that, like in the human
situation (24), a large T cell repertoire is available
against the Melan-A Ag. In addition, the CTL induced in vivo against
ELA26–35 in the presence of CpG ODN were
cytolytic against human melanoma target cells in vitro. These data
demonstrate that CpG ODN is a good candidate adjuvant for the induction
of a CTL response, especially when used in combination with IFA, and
illustrate the power of using human tetramers to study the CTL response
directed against peptides derived from human tumor-associated Ags in a
preclinical model.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mouse EL-4 cells transfected with HLA-A*0201/Kb gene (EL-4.A2/Kb transfectants) (25) were kindly provided by Dr. L. Sherman (The Scripps Clinic and Research Foundation, La Jolla, CA) and maintained in DMEM medium supplemented with 1% HEPES, 1% strepto-penicillin, 10% heat-inactivated FCS, and 0.5 mg/ml G418. Human melanoma cell lines were cultured in RPMI 1640 medium supplemented with 10% FCS.
Synthetic peptides and CpG ODN
Peptides were synthesized by standard solid phase chemistry on a multiple peptide synthesizer (Applied Biosystems, Foster City, CA) by using F-moc for transient NH2-terminal protection and analyzed by mass spectrometry. All peptides were >90% pure as indicated by analytical HPLC. Lyophilized peptides were diluted in DMSO and stored at -20°C. The immunostimulatory synthetic CpG ODN 1826 optimized for stimulation of the mouse immune system (TCCATGACGTTCCTGACGTT) and the control ODN 1982 (TCCAGGACTTCTCTCAGGTT) were used (CpG motifs are underlined). The backbone for these ODN was sulfur-modified phosphorothioate to protect from nucleases. ODN were formulated as a sterile PBS solution (Coley Pharmaceutical Group, Wellesley, MA) and stored at -20°C.
Immunization
HHD transgenic mice were kindly provided by Dr. F. Lemonnier (Institut Pasteur, Paris, France). Different protocols of immunization were used. Transgenic mice were immunized s.c. at the base of the tail with 50 µg of peptide emulsified in IFA or mixed with 50 µg of ODN in a volume of 100 µl. In experiments where a combination of IFA and CpG ODN was used as adjuvant, mice received 50 µg of peptide together with 50 µg of CpG ODN emulsified in IFA in a volume of 100 µl.
Flow cytometry immunofluorescence analysis
Cells (0.5–1 x 106) were prepared
from peripheral blood, inguinal and paraaortic lymph nodes, and spleen
from immunized mice and were stained with PE-coupled
HLA-A2/ELA26–35 (ELAGIGILTV) tetramer
synthesized as previously described (26) at doses
indicated in the text in the presence of anti-FcR Ab (clone 2.4 G2)
in 50 µl of PBS, 2% FCS for 1 h at room temperature. As a
control of the specificity of T cell response, we used an HLA-A2
tetramer made with the peptide 157–165 derived from the
tumor-associated NY-ESO-1 (SLLMWITQC,
HLA-A2/NY-ESO-1157–165) tetramer
(27). Cells were washed once in PBS, 2% FCS and then
stained with anti-CD44-FITC (clone 1 M.178),
anti-TCR-CyChrome (clone H57), and
anti-CD8
-allophycocyanin (clone 53.6.7; BD PharMingen,
San Diego, CA) in 50 µl of PBS, 2% FCS for 30 min at 4°C. Cells
were washed once in the same buffer as before and immediately analyzed
in a FACSCalibur (BD Biosciences, San Jose, CA).
Generation of specific mouse CTL by in vitro stimulation
Lymph node cells (4–5 x 106) from immunized HHD mice were cultured with 2–5 x 105 irradiated (100 Gy) EL-4 A2/Kb cells, prepulsed with 1 µM relevant peptides for 1 h at 37°C, in six-well cell culture plates in 5 ml of DMEM medium supplemented with 10 mM HEPES, 50 µM 2-ME, 10% FCS, and EL-4 cell culture supernatant containing 30 U/ml IL-2. After one or more rounds of weekly stimulation, the cultured cells were tested for cytolytic activity.
Assessment of in vitro cytolytic activity
Cytolytic activity of CTL lines or of CD8+
T lymphocytes enriched from the spleen of immunized HHD mice by one
round of positive selection using the MiniMACS system (Miltenyi Biotec,
Sunnyvale, CA) was determined in a 51Cr release
assay. The Melan-A protein expression in melanoma target cells was
assessed by Western blotting with A103 Ab (28). Target
cells were labeled with 51Cr for 1 h at
37°C in the presence or absence of tested peptides, then washed and
coincubated with effector cells at the indicated lymphocyte:target cell
ratio in V-bottom 96-well plates in a total volume of 200 µl of DMEM
medium. Chromium release was measured in 100 µl of supernatant
harvested after 4–6 h of incubation at 37°C. Percentage of specific
lysis was calculated as follows:
 |
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To assess the specificity and the staining efficiency of mouse
lymphocytes by human HLA-A2 tetramers, we first established a mouse CTL
line specific for ELA26–35 CTL peptide by
repeated in vitro stimulation of lymph node cells from HHD mice
immunized with ELA26–35 emulsified in IFA. The
specificity of CTL line was verified in cytolytic assays against
specific and third party Ags (data not shown). As shown in Fig. 1
A, human HLA-A2 tetramers
bound to mouse CTLs that were positively selected in the thymus in the
context of a chimeric HLA-A2/Db class I molecule.
The specificity of tetramer staining correlated with the specificity of
the cytolytic activity displayed by CTL lines against target cells
pulsed with their cognate peptide. The mean fluorescence intensity
increased proportionally with the concentration of tetramer added.
Based on these observations, tetramer stainings were performed at a
final concentration of 14 µg/ml throughout the study.
|
B represent the percentage of
tetramer+ cells in the cell mixture. First, the
background level of tetramer+ cells within
CD8+ T cells in the spleen of naive C57BL/6 mice
was relatively low (0.17 ± 0.03%
HLA-A2/ELA26–35 tetramer+)
(Fig. 1B). Second, the percentages of
tetramer+ cells measured within the
CD8+TCR+ lymphocytes
correlated well with the theoretical percentage of
HLA-A2/ELA26–35 tetramer+
cells added to naive C57BL/6 splenocytes (y =
0.876x + 0.261; r = 0.999). Together, these data
indicated that human HLA-A2 tetramer can be used for the detection of
mouse lymphocytes selected on chimeric HLA-A2/Db
molecules. Moreover, the HLA-A2/ELA26–35
tetramer was able to accurately detect tetramer+
cells within CD8+TCR+
lymphocytes. CpG ODN as adjuvant of the CTL response against tumor Ag-derived peptides
To test the ability of CpG ODN to behave as an adjuvant for the
induction of specific CTL following peptide inoculation, we chose a
Melan-A peptide analog with enhanced immunogenicity as shown previously
(21, 22). This peptide is a candidate vaccine actively
tested in phase I clinical trials. Mice of the HHD line were immunized
with peptide ELA26–35 in combination with either
CpG ODN 1826 or ODN control 1982 that did not contain CpG motifs. The
peptide-specific CTL response was measured ex vivo 7 days after
immunization using tetramers and flow cytometry in the peripheral blood
of these mice. A representative experiment is shown in Fig. 2A. In the population of
viable cells (gated in G1), we selected the
CD8+TCR+ T cells (gate
G2) in which the percentage of tetramer+ cells
was determined (Fig. 2A, lower panels). This type
of analysis was used in all additional experiments. A strong CTL
response directed against ELA26–35 was
specifically elicited in mice immunized with peptide in the presence of
CpG ODN 1826 (6.6% of CD8+ T cells were
HLA-A2/ELA26–35 tetramer+)
but not in the presence of the control ODN 1982 (0.2% of
CD8+ T cells). As expected, nearly all
tetramer+ cells displayed an activated phenotype
as shown by the up-regulation of the CD44 activation marker at their
surface. The data demonstrate that CpG ODN are required for strong CTL
activation detectable ex vivo. In addition, the CTL response obtained
in ELA26–35-immunized mice is specific for the
immunizing peptide because <0.1% of CD8+ T
cells were stained with an irrelevant tetramer
(HLA-A2/NY-ESO-1157–165). Thus, both CTL peptide
and CpG ODN 1826 are required to induce a strong and specific CTL
response.
|
+ T cells (Fig. 2B). One mouse presented a weaker and delayed
tetramer+ CD8 lymphocyte wave with 0.8%
ELA26–35 tetramer+ within
CD8+TCR+ T cells at day
7 and 2.8% at day 11.
The unexpected high frequency of
tetramer+CD8+ cells
detected in mice immunized against ELA26–35
peptide in presence of CpG ODN led us to investigate the response in
larger groups of immunized HHD mice and to compare it to the response
obtained in mice immunized with peptide emulsified in IFA (Fig. 3, A and B). Based
on the results presented in Fig. 2B, we analyzed the
circulating tetramer+CD8+
lymphocyte response 7 days after immunization. As compared with naive
mice, an 8-, 10-, and 9-fold increase of the mean frequency of
HLA-A2/ELA26–35 tetramer+
cells were respectively observed in blood, spleen, and draining lymph
nodes of mice immunized in the presence of CpG ODN. It is noteworthy
that the differences of CTL frequency between immunized and naive mice
were significant in blood (p < 0.01) and
spleen (p < 0.05) but not in draining lymph
nodes (p < 0.2), suggesting the development of
a systemic CTL response. In addition, no increase in the percentage of
irrelevant HLA-A2/NY-ESO-1157–165
tetramer+ cells was observed as compared with
naive mice. This indicates that the CTL response induced in the
presence of CpG ODN was specific for the immunizing peptide. Likewise,
no difference in the frequency of
HLA-A2/ELA26–35 tetramer+
cells was detected between naive mice and mice immunized with CpG ODN
alone (0.18 ± 0.09 in blood, 0.15 ± 0.05 in lymph nodes,
and 0.51 ± 0.36 in spleen). By contrast, the percentage of
HLA-A2/ELA26–35 tetramer+
cells was not significantly increased in peptide/IFA-immunized mice as
compared with naive mice. Indeed, the highest frequency of
HLA-A2/ELA26–35 tetramer+
cells detectable in the spleen of those mice was also associated with a
non-negligible background, as shown by the significant increase of the
mean percentage of HLA-A2/NY-ESO-1157–165
tetramer+ cells in this organ
(p < 0.05). Thus, immunization in the presence
of IFA was significantly less efficient than immunization in the
presence of CpG ODN in recruiting
HLA-A2/ELA26–35 tetramer+
cells.
|
C). A specific CTL response was elicited in those mice as
indicated by the significant difference in the percentages of
HLA-A2/ELA26–35 and
HLA-A2/NY-ESO-1157–165
tetramer+ cells within the
CD8+TCR+ T cell
population. As compared with naive mice, the frequency of
HLA-A2/ELA26–35 tetramer+
cells was highly significantly increased in blood
(p < 0.007), spleen (p
< 0.007), and draining lymph nodes (p <
0.007). As mentioned above, this was not the case in mice immunized
against peptide mixed with CpG ODN alone where the frequency of
HLA-A2/ELA26–35 tetramer+
cells was significantly increased only in blood
(p < 0.01) and spleen
(p < 0.05) and in mice immunized with the
peptide emulsified in IFA (increase of the frequency of specific
HLA-A2/ELA26–35 and nonspecific
HLA-A2/NY-ESO-1157–165
tetramer+ cells in spleen). In addition, the
frequency of circulating HLA-A2/ELA26–35
tetramer+ cells in mice immunized in presence of
both CpG ODN and IFA was higher than the one detectable in the
peripheral blood of mice immunized with peptide mixed with CpG ODN
(p < 0.005) or in the blood
(p < 0.001), the spleen
(p < 0.001), and the draining lymph nodes
(p < 0.007) of mice immunized with the peptide
emulsified in IFA. It should be noted that the number of splenocytes,
lymph node cells, and TCR+ and
CD8+ T lymphocytes in lymphoid organs were not
significantly different between groups of mice immunized with the dose
of CpG used (50 µg) or IFA and naive mice (data not shown). However,
as compared with naive mice, a significant increase of the absolute
number of tetramer+CD8+ T
cells were detected in lymph nodes and spleen of mice immunized with
ELA26–35 mixed with CpG. This increase was even
greater in both organs of mice immunized with peptide in the presence
of CpG and IFA (Table I). Altogether,
these data demonstrated that the use of CpG ODN as adjuvant led to a
strong systemic and specific CTL response against peptide. Whereas CpG
ODN appeared more efficient than IFA, a combination of both adjuvants
further enhanced the recruitment of peptide-specific CTLs.
|
To determine whether the CTLs generated against
ELA26–35 mixed with CpG ODN were functional, we
assessed their cytotoxic activity against the
EL4-A2/Kb mouse cell line pulsed with exogenous
peptide. Fig. 4A showed that
CTLs specific for ELA26–35 peptide lysed
EL4-A2/Kb mouse cells pulsed with
ELA26–35. Because CTL generated against
ELA26–35 emulsified in IFA cross-recognize the
natural EAA26–35 peptide endogenously processed
and presented at the cell surface of Melan-A+
human melanoma cells (21, 22), we investigated the ability
of CTLs elicited against ELA26–35 in the
presence of CpG ODN to kill this type of target. As expected, the
HLA-A*0201+Melan-A- Na8
and SK-Mel-37 melanoma cells were not killed in the absence of
exogenous peptide. By contrast, the two
HLA-A*0201+Melan-A+
melanoma cell lines tested were efficiently killed by the CTL line
specific for ELA26–35 in the absence of
exogenous peptide. Me 290 melanoma cells were more efficiently killed
than SK-Mel-23 cells, which were poorly lysed by CTL line even in the
presence of exogenous peptide.
|
B.
Tetramer+CD8+ T lymphocytes
were able to specifically kill EL4-A2/Kb mouse
cells pulsed with ELA26–35 or
EAA26–35 peptide. A ratio of two
tetramer+CD8+ T lymphocytes
to one ELA26–35-pulsed target cell led to a 25%
specific lysis. Altogether, these data demonstrated the functionality
of CTL recruited by immunization against peptide in the presence
of CpG. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We report that human HLA-A*0201 tetramers are able to efficiently stain mouse CD8+ T lymphocytes. This observation may appear contradicting to the demonstration of the critical role of the CD8 molecule in class I/peptide complexes binding to TCR and in T cell activation (29, 30). However, this is in agreement with our previous study showing that mouse CTL lines are able to lyse human melanoma cells via a CD8-dependent interaction (22), suggesting that mouse CD8 does interact with human class I molecules. The regions involved in these interactions remain to be mapped. The use of human tetramers to enumerate specific mouse T cells ex vivo without introducing any culture bias has potential implications in preclinical models of vaccination to investigate the kinetics and the localization of T cell response and thus to define the best protocol of immunization.
The relative high frequency of CTLs specific for ELA26–35 recruited in immunized mice is in agreement with data obtained in the metastatic lymph nodes of melanoma patients (24). This might reflect the high frequency of CTL precursors circulating in the periphery due to a partial tolerance against endogenously expressed Melan-A Ag. Indeed, a homolog of the human Melan-A gene is endogenously expressed in the mouse (31). The mouse putative protein contains 113 amino acids with 68.8% identity to its human homolog. In addition, an HLA-A*0201-restricted epitope mapping to residues 24–33 is highly homologous to the human Melan-A26–35, with only one amino acid difference.
The high frequency of ELA26–35-specific CTLs allowed us to demonstrate their cytolytic activity directly ex vivo without in vitro stimulation and thus without culture bias. These cells are able to kill human melanoma cell lines which endogenously express Melan-A and present the natural EAA26–35 epitope at the cell surface, confirming our previous data on the T cell cross-recognition of analog and natural Melan-A peptides (21, 22). It is noteworthy that the susceptibility to lysis by mouse CTLs differs between human melanoma cells, possibly reflecting a differential expression of T cell epitope at the cell surface. Alternatively, we cannot exclude an overall difference at the level of interactions between mouse and human costimulatory molecules because certain human cells were weakly lysed by mouse CTLs even in the presence of exogenous peptide (e.g., SK-Mel-23 and SK-Mel-37 as compared with Me 290).
An important characteristic of the CTL response induced in the presence of CpG ODN is its systemic distribution. Exposure to CpG ODN leads to extramedullary splenic hemopoiesis (32) and to a lymphadenopathy restricted to the drainage field from the injection site (33, 34). The T cell proliferation observed in the spleen is probably associated with the down-regulation of the lymph node homing receptor, CD62L, and could favor the efficient recirculation of specifically activated T cells to the tumor site. There remains, finally, the question of the possibility to induce a long-lasting CTL response in the presence of CpG ODN, which would be required to control tumor growth. This could be solved by the combination of both CpG ODN and conventional adjuvants. Indeed, adjuvants such as IFA are responsible for a "depot" effect, leading to a progressive release of Ag, which could be associated with the maintenance of specific CTL responses. Besides their "depot" effect, these adjuvants have the ability to induce inflammatory processes, potentiating further specific T cell responses. In line with this, we have shown that a mixture of both CpG ODN and IFA led to a stronger specific response as compared with CpG ODN or IFA alone. Previous reports showed that CpG ODN synergizes with alum for Ab production (14) and with IFA for CTL response and T cell proliferation against whole protein (16, 18, 34). Based on the recent report of Kaech and Ahmed (35) suggesting that the most effective T cell vaccines will be those that recruit the largest number of Ag-specific CD8+ T cells, the peptide mixed with CpG ODN and IFA would be a good candidate as antitumor vaccine.
The strong expansion of peripheral CD8+ T lymphocytes is probably not due to a direct effect of CpG ODN on T cells. Apart from two reports (36, 37), CpG ODN do not seem to be a T cell mitogen (33, 38). The most likely hypothesis is that T cell expansion is the consequence of CpG ODN-mediated DCs proliferation (33), activation, and maturation. In vivo, the coinjection of peptide and CpG ODN leads to the maturation of DCs and the presentation of peptide by CD11c+ DCs (12). Once maturated, DCs could activate CTL precursors in a Th cell-independent manner (39, 40, 41). This might explain why, in our study, no Th peptide is required to elicit a strong CTL response. In human, CpG ODN also induces the survival, maturation, and secretion of cytokines by plasmacytoid precursor DCs (42). Recently, the Toll-like receptor-9 has been evidenced as an essential factor in immune activation by CpG ODN (43).
In conclusion, the demonstration of the adjuvant effect of CpG ODN on the induction of a CTL response directed against melanoma Ag-derived peptide and its effect on the recruitment of a high frequency of CTL precursors when combined with IFA have important implications in vaccine development. In addition, the validation of a quantitative study of CTL response by using human tetramers in mouse experimental systems might be useful to design the most efficient vaccination procedure in a preclinical model.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Pedro Romero, Division of Clinical Onco-Immunology, Ludwig Institute for Cancer Research, University of Lausanne, Hopital Orthopédique Niveau 5 Est, Avenue Pierre Decker 4, 1005 Lausanne, Switzerland. E-mail address: pedro.romero{at}isrec.unil.ch
3 Abbreviations used in this paper: DC, dendritic cell; ODN, oligodeoxynucleotide; HHD, human human Db.
Received for publication September 12, 2001. Accepted for publication December 5, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2 microglobulin (2m) HLA-A2.1 monochain transgenic H-2Db 2m double knockout mice. J. Exp. Med. 185:2043.3 domain of class I influence the magnitude of the xenogeneic response. J. Exp. Med. 170:1091.
production in vitro. J. Immunol. 163:3642.This article has been cited by other articles:
|
|
 |
|
  M. D. Sharma, D.-Y. Hou, Y. Liu, P. A. Koni, R. Metz, P. Chandler, A. L. Mellor, Y. He, and D. H. Munn Indoleamine 2,3-dioxygenase controls conversion of Foxp3+ Tregs to TH17-like cells in tumor-draining lymph nodes Blood, June 11, 2009; 113(24): 6102 - 6111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. N. Haining, J. Davies, H. Kanzler, L. Drury, T. Brenn, J. Evans, J. Angelosanto, S. Rivoli, K. Russell, S. George, et al. CpG Oligodeoxynucleotides Alter Lymphocyte and Dendritic Cell Trafficking in Humans Clin. Cancer Res., September 1, 2008; 14(17): 5626 - 5634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Vasir, Z. Wu, K. Crawford, J. Rosenblatt, C. Zarwan, A. Bissonnette, D. Kufe, and D. Avigan Fusions of Dendritic Cells with Breast Carcinoma Stimulate the Expansion of Regulatory T Cells while Concomitant Exposure to IL-12, CpG Oligodeoxynucleotides, and Anti-CD3/CD28 Promotes the Expansion of Activated Tumor Reactive Cells J. Immunol., July 1, 2008; 181(1): 808 - 821. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Revaz, A. Debonneville, M. Bobst, and D. Nardelli-Haefliger Monitoring of Vaccine-Specific Gamma Interferon Induction in Genital Mucosa of Mice by Real-Time Reverse Transcription-PCR Clin. Vaccine Immunol., May 1, 2008; 15(5): 757 - 764. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bhowmick, R. Ravindran, and N. Ali gp63 in Stable Cationic Liposomes Confers Sustained Vaccine Immunity to Susceptible BALB/c Mice Infected with Leishmania donovani Infect. Immun., March 1, 2008; 76(3): 1003 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. N. Kochenderfer and R. E. Gress A Comparison and Critical Analysis of Preclinical Anticancer Vaccination Strategies Experimental Biology and Medicine, October 1, 2007; 232(9): 1130 - 1141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Bourquin, L. Schmidt, V. Hornung, C. Wurzenberger, D. Anz, N. Sandholzer, S. Schreiber, A. Voelkl, G. Hartmann, and S. Endres Immunostimulatory RNA oligonucleotides trigger an antigen-specific cytotoxic T-cell and IgG2a response Blood, April 1, 2007; 109(7): 2953 - 2960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. R. Flores, K. A. Diggs, L. M. Tait, and P. A. Morel IFN-{gamma} Negatively Regulates CpG-Induced IL-10 in Bone Marrow-Derived Dendritic Cells J. Immunol., January 1, 2007; 178(1): 211 - 218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Kochenderfer, C. D. Chien, J. L. Simpson, and R. E. Gress Synergism between CpG-Containing Oligodeoxynucleotides and IL-2 Causes Dramatic Enhancement of Vaccine-Elicited CD8+ T Cell Responses J. Immunol., December 15, 2006; 177(12): 8860 - 8873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Zaks, M. Jordan, A. Guth, K. Sellins, R. Kedl, A. Izzo, C. Bosio, and S. Dow Efficient Immunization and Cross-Priming by Vaccine Adjuvants Containing TLR3 or TLR9 Agonists Complexed to Cationic Liposomes. J. Immunol., June 15, 2006; 176(12): 7335 - 7345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Colombetti, T. Fagerberg, P. Baumgartner, L. Chapatte, D. E. Speiser, N. Rufer, O. Michielin, and F. Levy Impact of Orthologous Melan-A Peptide Immunizations on the Anti-Self Melan-A/HLA-A2 T Cell Cross-Reactivity. J. Immunol., June 1, 2006; 176(11): 6560 - 6567. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Chapatte, S. Colombetti, J.-C. Cerottini, and F. Levy Efficient Induction of Tumor Antigen-Specific CD8+ Memory T Cells by Recombinant Lentivectors Cancer Res., January 15, 2006; 66(2): 1155 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, R. Alvarez, G. Roderiquez, E. Guan, Q. Caldwell, J. Wang, M. Phelan, and M. A. Norcross CpG-Independent Synergistic Induction of {beta}-Chemokines and a Dendritic Cell Phenotype by Orthophosphorothioate Oligodeoxynucleotides and Granulocyte-Macrophage Colony-Stimulating Factor in Elutriated Human Primary Monocytes J. Immunol., May 15, 2005; 174(10): 6113 - 6121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wysocka, B. M. Benoit, S. Newton, L. Azzoni, L. J. Montaner, and A. H. Rook Enhancement of the host immune responses in cutaneous T-cell lymphoma by CpG oligodeoxynucleotides and IL-15 Blood, December 15, 2004; 104(13): 4142 - 4149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Rosset, C. Ballerini, S. Gregoire, P. Metharom, C. Carnaud, and P. Aucouturier Breaking Immune Tolerance to the Prion Protein Using Prion Protein Peptides Plus Oligodeoxynucleotide-CpG in Mice J. Immunol., May 1, 2004; 172(9): 5168 - 5174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rothenfusser, V. Hornung, M. Ayyoub, S. Britsch, A. Towarowski, A. Krug, A. Sarris, N. Lubenow, D. Speiser, S. Endres, et al. CpG-A and CpG-B oligonucleotides differentially enhance human peptide-specific primary and memory CD8+ T-cell responses in vitro Blood, March 15, 2004; 103(6): 2162 - 2169. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Beloeil, M. Tomkowiak, G. Angelov, T. Walzer, P. Dubois, and J. Marvel In Vivo Impact of CpG1826 Oligodeoxynucleotide on CD8 T Cell Primary Responses and Survival J. Immunol., September 15, 2003; 171(6): 2995 - 3002. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Kemp, B. D. Elzey, and T. S. Griffith Plasmacytoid Dendritic Cell-Derived IFN-{alpha} Induces TNF-Related Apoptosis-Inducing Ligand/Apo-2L-Mediated Antitumor Activity by Human Monocytes Following CpG Oligodeoxynucleotide Stimulation J. Immunol., July 1, 2003; 171(1): 212 - 218. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Kumaraguru, C. D. Pack, and B. T. Rouse Toll-like receptor ligand links innate and adaptive immune responses by the production of heat-shock proteins J. Leukoc. Biol., May 1, 2003; 73(5): 574 - 583. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. D. Davis, M. Jefford, P. Parente, and J. Cebon Rational approaches to human cancer immunotherapy J. Leukoc. Biol., January 1, 2003; 73(1): 3 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zwaveling, S. C. F. Mota, J. Nouta, M. Johnson, G. B. Lipford, R. Offringa, S. H. van der Burg, and C. J. M. Melief Established Human Papillomavirus Type 16-Expressing Tumors Are Effectively Eradicated Following Vaccination with Long Peptides J. Immunol., July 1, 2002; 169(1): 350 - 358. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), or of HLA-AZ/NY-ESO-1157–165 tetramer (
). The
mean fluorescence intensity of cells is shown at each tetramer
concentration. B, Tetramer+ CTLs from CTL
line were mixed at different ratios with splenocytes from naive C57BL/6
mice (x-axis) and stained with
HLA-A2/ELA26–35 tetramer at a final concentration of 14
µg/ml. The percentage of tetramer+ cells measured in the
cell mixtures within the CD8+TCR
) tetramers coupled to PE
together with anti-CD8-allophycocyanin, anti-TCR