| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
and IL-4 Levels During In Vitro Polarization of Primary Murine CD4+ T Cells1
*
Immunology and
Cell Biology Programs, Memorial Sloan-Kettering Cancer Center, Sloan-Kettering Division, Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
but also the Th2 cytokine IL-4 in naive CD62
ligand+CD4+ T cells during their in vitro
polarization. This effect is most dramatic when the ligand is present
from the onset of the differentiation process. If the ligand is added
after the polarization has ensued, the inhibition is significantly
diminished. In activated (CD62 ligand-CD4+) T
cells, 1,25(OH)2D3 is still able to inhibit
IFN- but has no effect on IL-4 production. Our results also indicate
that inhibition of these two cytokines in naive cells by vitamin D
receptor and its ligand is neither a result of a cell cycle block nor
an inhibition of Th1 or Th2 transcription factor expression but,
rather, at least in the case of Th2 differentiation, an attenuation of
IL-4 transcription by the receptor. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
transcription and initiate Th1 differentiation, while IL-4
triggers the Stat6 signaling pathway, resulting in IL-4 transcription
and Th2 differentiation (2). Once established, the two
subsets have distinct cytokine secretion profiles that not only serve
to define them (with IFN- being the Th1 signature cytokine while
IL-4 is the defining Th2 cytokine) but also endow them with different
functional properties. Th1 cells secrete IL-2, IFN-, and lymphotoxin
and direct cell-mediated immune responses, while Th2 cells secrete
IL-4, IL-5, IL-6, and IL-13 and mediate humoral responses. In addition
to the cytokine environment, many other factors have been shown to play
an important role in the differentiation process. Some of these include
the Th1- and Th2-specific transcription factors, the strength of TCR
signaling, the Ag dose, costimulatory signals, and the influence of the
APCs (3, 4, 5, 6, 7). Furthermore, some less conventional factors,
such as PGE2 (8, 9) and the steroids
progesterone (10) and dexamethasone (reviewed in Ref.
11), have also been implicated in influencing the
differentiation process. Our studies focus on the role of another
secosteroid, vitamin D3, in Th
differentiation.
1,25-Dihydroxyvitamin D3
(1,25(OH)2D3),3
the active metabolite of vitamin D3, is a
lipophilic molecule which exerts its actions through a nuclear
receptor, the vitamin D receptor (VDR) (reviewed in Refs.
12 and 13). VDR is a member of the
steroid-nuclear receptor superfamily, whose members include receptors
that bind glucocorticoids, retinoids, thyroid hormones, sex steroids,
fatty acids, and eicosanoids (14). In the presence of its
ligand, VDR, together with its heterodimeric partner the retinoid X
receptor (RXR), can activate or repress target genes by binding to
vitamin D response elements on DNA (15, 16). Although
traditionally 1,25(OH)2D3
has been associated with regulating calcium homeostasis, the discovery
of VDR expression in lymphocytes and monocytes (17, 18, 19)
suggested a role for this hormone in the immune system as well. Indeed,
a number of studies have now demonstrated the ability of this
receptor-ligand pair to act as a strong immunosuppressor (reviewed in
Refs. 20 and 21). In promonocytes,
1,25(OH)2D3 has been shown
to exert strong antiproliferative and prodifferentiation properties
(reviewed in Ref. 22). In contrast, in dendritic cells
this hormone inhibits differentiation, maturation, and activation in
both human and mouse cells (23, 24, 25). In T lymphocytes,
1,25(OH)2D3 also diminishes
proliferation (26, 27, 28), most likely by virtue of its
ability to inhibit IL-2 transcription (29). Thus far,
1,25(OH)2D3 and its
receptor have been shown to down-modulate the production of other key
cytokines, such as IFN- (30, 31, 32), IL-12
(33), and GM-CSF (34, 35).
The effects of 1,25(OH)2D3 on the immune system are often inhibitory and frequently result from binding of VDR to nonconsensus vitamin D response elements (29, 35, 36). Furthermore, the mechanisms of the repression on all of the above mentioned gene promoters caused by 1,25(OH)2D3 have been described (36, 37, 38). Our laboratory first demonstrated what now appears to be a common repressive mechanism of VDR and its ligand in the immune system (29, 39). Specifically, VDR interferes with binding of NFAT/AP-1 to key regulatory sites in the promoters of many of the cytokine genes, resulting in a repression of activated transcription of such genes (29, 36, 38).
From the above mentioned studies, it is apparent that
1,25(OH)2D3 inhibits
cytokines which either are required for Th1 differentiation, such as
IL-12, or are products of differentiated Th1 cells (IL-2 and IFN-),
suggesting that one of the functions of
1,25(OH)2D3 in the immune
system is to inhibit Th1 differentiation (33, 40). Before
initiating our studies, a considerable body of evidence existed for the
inhibitory effects of
1,25(OH)2D3 on Th1
differentiation. However, not much was known about the possible role
this hormone may play in Th2 polarization. Given the established role
of 1,25(OH)2D3 as an
immunoregulator, we decided to study the possible effect VDR may have
during Th differentiation. Our studies indicate that
1,25(OH)2D3 inhibits not
only Th1 but also Th2 differentiation during in vitro polarization of
naive CD4+ T cells. This inhibition is dependent
on the presence of the hormone during the initial stages of Th
differentiation and seems to be mediated most likely via a mechanism of
transcriptional repression by VDR of the key Th1 and Th2 cytokines
IFN- and IL-4, respectively. Our results suggest that
1,25(OH)2D3 acts as another
influence on the differentiation of the Th1 and Th2 subsets. Thus,
levels of 1,25(OH)2D3 at
sites of inflammation may have a significant effect on the initiation
of the immune response.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and the National Cancer Institute (Frederick, MD). IL-2 was purchased from BioSource International (Camarillo, CA), IL-4 was purchased from Endogen (Woburn, MA), IL-12 was purchased from R&D Systems (Minneapolis, MN), and anti-IL-4, anti-IL-12, anti-CD3, anti-CD28, anti-CD62 ligand (CD62L)-PE, and all other fluorochrome-conjugated Abs were purchased from BD PharMingen (San Diego, CA). All ELISA and ELISPOT Abs were purchased from Endogen.
Preparation of CD4+ T cells
Splenocytes from 6- to 8-wk-old BALB/c mice were purified by RBC lysis. CD4+ T cells were isolated by positive selection using CD4 Dynabeads followed by detachment with DETACHaBEAD (Dynal Biotech, Oslo, Norway). The purified CD4+ T cells were labeled with R-PE-conjugated anti-CD62L Ab and sorted into CD62L+ and CD62L- using a MoFlo (Cytomation, Fort Collins, CO) cell sorter. The sorted cells were pelleted at 1200 rpm at 4°C, resuspended in complete medium, and used in in vitro differentiation experiments. The complete medium consisted of RPMI supplemented with 10% FBS plus penicillin-streptomycin, sodium pyruvate, and glutamine to a final concentration of 100 µg/ml. In addition, 2-ME (Sigma-Aldrich, St. Louis, MO) was added to final concentration of 50 µM and gentamicin (Life Technologies, Grand Island, NY) to 50 ng/ml.
In vitro differentiation of CD4+ T cells
CD62L+ or CD62L- cells (at 0.5–1 x 106 cells/ml) were stimulated in vitro with plate-bound anti-CD3 mAb (2C11) at 3 µg/ml and anti-CD28 mAb (37.51) at 1 µg/ml plus IL-2 at 25 U/ml (nonskewing condition). In addition, cells were incubated with IL-12 at 5 ng/ml and anti-IL-4 mAb (11B11) at 3 µg/ml (Th1-skewing condition) or IL-4 at 500 U/ml and anti-IL-12 (C17.8) at 6 µg/ml (Th2-skewing condition). Differentiation proceeded in the presence of 2.4 x 10-8 M 1,25(OH)2D3 (a kind gift of M. Uskokovic, Hoffmann-LaRoche, Nutley, NJ) diluted in ethanol or in the presence of an equal volume of ethanol only. Four days poststimulation, the cultures were expanded 4-fold with fresh medium, cytokines, and Abs. Three days later, the cells were harvested, washed five times with RPMI 1640 and counted, and equal number of cells were restimulated with plate-bound anti-CD3 at 1 µg/ml. Twenty-four hours postrestimulation, supernatants were collected and cytokine levels were measured by ELISA.
FACS analysis
Cell staining for CD3, CD4, and CD8 was performed by incubating
50 µl of cell suspension (
1 x 106
cells) with 0.2 µg of the appropriate Ab (anti-CD3 CyChrome,
anti-CD4 FITC, anti-CD8 PE) for 30 min on ice. The cells were
washed, resuspended in PBS, and analyzed using a FACSCalibur.
IL-4 and IFN- ELISA
Ninety-six-well Nunc ELISA MaxiSorp flat-bottom plates (Fisher
Scientific, Pittsburgh, PA) were coated overnight at room temperature
with 1 µg/ml IL-4 coating mAb in PBS (pH 7.4) or with 0.5 µg/ml
coating IFN- mAb in coating buffer B (0.03 M sodium carbonate, 0.068
M sodium bicarbonate). The primary mAbs were discarded and the plates
were blocked with 200 µl/well assay buffer (4% BSA in PBS (pH7.4))
for 1 h at room temperature. The plates were washed three times
with wash buffer (50 mM Tris (pH 8), 0.2% Tween 20) and blotted on
paper towel, and 50 µl/well of the standards or samples were added in
duplicates. Some samples required prior dilution in complete medium to
fall within the standard curve range. Following a 1-h incubation at
room temperature, 50 µl/well of the detecting mAb was added: 100
ng/ml anti IL-4 secondary Ab or 250 ng/ml anti IFN- Ab. The plates
were incubated for 1 h at room temperature and washed three times
with wash buffer, and 100 µl/well HRP-conjugated streptavidin was
added at 1/32,000 dilution for IL-4 or 1/8,000 dilution for IFN- in
assay buffer. After a 30-min incubation at room temperature, the plates
were washed as before and 100 µl/well tetramethylbenzidine
substrate solution was added. The color was allowed to develop for 30
min in the dark before the reaction was quenched with 100 µl/well
stop solution (0.18 M
H2SO4). The plates were
read at 450–550 nm and the sample concentrations were determined with
the help of the standard curve. All reagents for the ELISAs were
purchased from Endogen.
CFSE labeling and analysis
Murine CD4+ T cells, isolated as described
above, were further purified into CD62L+ and
CD62L- by positive isolation with detachment
using a biotin-conjugated anti-CD62L mAb (BD PharMingen) and a
CELLection Biotin Binder kit (Dynal Biotech). The purity of the
isolated cells was confirmed by FACS using a PE-conjugated
anti-CD62L mAb (BD PharMingen). The cells were subsequently
resuspended in 1 ml of HBSS (at 
2 x
107 cells/ml) and labeled with 5 µM CFSE
(Molecular Probes, Eugene, OR) at room temperature for 8 min. The
reaction was quenched with 1 ml of FBS and the cells were washed four
times with complete medium. After the final wash, the cells were
allowed to rest overnight in complete medium at 37°C and 5%
CO2. A small aliquot of the labeled cells was
analyzed by FACS for CFSE incorporation. The rest of the cells were
pelleted, resuspended in 1 ml of complete medium, counted, diluted to
0.5–1 x 106 cells/ml, and activated on
Ab-coated plates in the presence of the appropriate skewing cytokines
and Abs as described above.
Cell culture and transfection
Jurkat, a human T cell lymphoma, was maintained in RPMI 1640 supplemented with 10% FBS plus penicillin-streptomycin, sodium pyruvate, and glutamine to a final concentration of 100 µg/ml. The cells were transfected by electroporation as previously described (38).
RT-PCR
Total RNA was isolated, according to the manufacturer’s instructions, using TRIzol reagent (Life Technologies) from in vitro activated CD4+ T cells. RNA (1.5 µg) was used in the reverse transcription reaction with Superscript II RNase H- (Invitrogen, San Diego, CA) following the manufacturer’s instructions. The cDNA was diluted 5-fold in water and 5 µl were amplified 25 cycles in PTC-200 Peltier Thermal Cycler (MJ Research, Cambridge, MA) in a reaction containing 5 µl of 10x PCR buffer with 15 mM MgCl2, 1 µl of 20 mM sense and antisense primers, 1 µl of 10 mM dNTPs, 36.5 µl of water, and 0.5 µl of Taq. The cycling conditions were 94°C for 2 min followed by 25 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1.5 min, and a final extension at 72°C for 5 min. The following primers were used: GATA-3 sense, GAAGGCATCCAGACCCGAAAC, and antisense, ACCCATGGCGGTGACCATGC; c-Maf sense, CCCAGTCCTGCCGCTTCAAGAGGG, and antisense, CATTGAACATTGTGCAAGTCC; T-bet sense, TGCCTGCAGTGCTTCTAACA, and antisense, TGCCCCGCTTCCTCTCCAACCAA, as published in Ref. 41 ; IL-4 sense, CATCGGCATTTTGAACGAGGTCA, and antisense, CTTATCGATGAATCCAGGCATCG; and HPRT sense, GTTGGAGACAGGCCAGACTTTGTTG, and antisense, GAGGGTAGGCTGGCCTATAGGCT. The IL-4 and HPRT primer sequences were as published in Ref. 42 .
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-4
production during Th differentiation of naive
CD62L+CD4+ T cells
To test directly whether
1,25(OH)2D3 can affect the
Th polarization process, we conducted in vitro Th differentiation
experiments. Briefly, naive (CD62+)
CD4+ T cells (Fig. 1
A) were isolated from spleens
of BALB/c mice and were activated in culture under nonskewing,
Th1-skewing, or Th2-skewing conditions in the absence (shaded bars) or
presence (filled bars) of
1,25(OH)2D3. After 7 days,
the cells were washed and restimulated for 24 h in the absence of
exogenous cytokines and Abs. Supernatants were collected and levels of
secreted IFN- and IL-4 were determined using an ELISA. As expected,
we observed that
1,25(OH)2D3 inhibited
IFN- production in naive T cells by at least 50% (Fig. 1B). Likewise,
1,25(OH)2D3 also inhibited
IL-4 production, but only in cultures polarized toward the Th2
condition (Fig. 1C). Under nonpolarizing conditions,
1,25(OH)2D3 did not have an
inhibitory effect on IL-4 production. In fact, the presence of the
hormone enhanced IL-4 levels, 1.4 ng/ml with ligand as compared with
0.3 ng/ml for the vehicle control (Fig. 1C). Similar results
were obtained using an ELISPOT assay (data not shown). Thus,
1,25(OH)2D3 appears to
inhibit not only IFN- but also IL-4 production during the in vitro
differentiation of naive CD4+ T cells toward the
Th1 and Th2 subsets, respectively.
|
but not IL-4
production during Th differentiation in activated
CD62L-CD4+ T cells
In addition to testing the effects of
1,25(OH)2D3 on naive
CD4+ T cells, we also wondered how this hormone
would affect the in vitro Th differentiation of activated
CD4+ T cells. To test this, we set up the Th
differentiation experiments previously described but using
CD62L- T cells (Fig. 1
A). Similar to
its effects on naive cells,
1,25(OH)2D3 inhibited
IFN- production in the CD62L- T cells (Fig. 2A). However, unlike its
effect on naive cells, the hormone did not alter IL-4 production in
this cell population (Fig. 2B). Similar results were
obtained using the ELISPOT assay (data not shown). It should be noted
that the unskewed population (Fig. 2B) produced as much IL-4
as the Th2-polarized cells. We believe this is due to the genetic
background of the mice used, BALB/c, which develop preferentially a Th2
response. Our results suggest that in previously activated
CD4+ T cells,
1,25(OH)2D3 inhibits only
IFN- production but is ineffective in altering IL-4 levels during
the in vitro differentiation of these cells.
|
Because 1,25(OH)2D3
was able to inhibit IL-4 production in naive cells but was ineffective
in suppressing this cytokine in previously activated T cells, we
wondered at what time point after the Th differentiation process has
begun can the ligand be first added and still be able to inhibit IL-4
production. Thus, we established the following experimental system
(Fig. 3A): naive
CD4+ T cells were differentiated under polarizing
or nonpolarizing conditions, as previously described, and
1,25(OH)2D3 was added at
the beginning of the differentiation process (treatment 1), halfway
through the differentiation (treatment 2), or at the end of the skewing
process (treatment 3). In all three cases, the ligand was maintained in
the cultures for a total of 7 days following its addition. The
strongest inhibitory effects of
1,25(OH)2D3 on both IFN-
and IL-4 production were observed when the hormone was present at the
onset as well as throughout the differentiation process (Fig. 3, B and E). However, if polarization was allowed to
proceed in the absence of the ligand for as little as 4 days, the
subsequent addition and maintenance of
1,25(OH)2D3 in the cultures
for 7 days was ineffective in diminishing the production of these two
cytokines (Fig. 3, C and F). Similarly, addition
of the hormone at the end of the differentiation process did not
decrease the amount of secreted IFN- and IL-4 (Fig. 3, D
and G). Thus,
1,25(OH)2D3 is able to
inhibit IFN- and IL-4 production in naive cells skewed toward the
Th1 or Th2 subsets, respectively, only if present during the early
stages of the polarization process.
|
Akin to the experiments just described,
CD62L- T cells were differentiated in vitro in
the presence of 1,25(OH)2D3
added at the start of the polarization (treatment 1); halfway through
the differentiation (treatment 2), or at the end of the skewing process
(treatment 3) (Fig. 4A). In
all three cases, the hormone was maintained in the cultures for a total
of 7 days before the cells were washed and restimulated. As was the
case with the naive cells,
1,25(OH)2D3 suppressed
IFN- production only when the hormone was provided at the onset of
the differentiation process (Fig. 4B). Once the cells had
been activated in vitro under strong skewing conditions for 4 days, the
ligand was much less effective in inhibiting IFN- synthesis (Fig. 4C). If
1,25(OH)2D3 was first added
to the cells 7 days after the start of the in vitro differentiation,
the ligand no longer inhibited (Fig. 4D).
1,25(OH)2D3 had no effect
on IL-4 production from CD62L- T cells during
their in vitro differentiation (Fig. 4, E–G).
The inhibitory effect of
1,25(OH)2D3 on
CD62L- T cells during their in vitro Th
differentiation seems to be confined to IFN- only. Furthermore, this
suppression is dependent on the presence of the ligand during the early
stages of the polarization process.
|
and IL-4
production from naive CD4+ T cells in the absence of a cell
cycle block
Having observed that
1,25(OH)2D3 inhibits both
IFN- and IL-4 production from naive CD4+ T
cells as well as IFN- synthesis from
CD62L-CD4+ T cells during
their in vitro polarization, we wanted to determine the mechanism of
this repression. There are at least three possible ways that may
account for inhibition of IFN- and IL-4 caused by
1,25(OH)2D3 during the
differentiation process: 1) a block in the cell cycle of the
differentiating cells, 2) an inhibition of the expression of the Th1
and Th2 transcription factors, and 3) a transcriptional repression of
the IFN- and IL-4 loci.
We were especially intrigued by the possibility that
1,25(OH)2D3 may inhibit the
cell cycle in differentiating Th cells, as previous work from our
laboratory has shown that
1,25(OH)2D3 inhibits the
cell cycle by up-regulating p21 and p27 in the myelomonocytic cell line
U937 (43). Furthermore, Rigby and colleagues
(44) have shown that
1,25(OH)2D3 blocks the cell
cycle in human T cells. Considering that cell cycle progression
provides an important level of regulation governing Th differentiation
(45), we wondered whether
1,25(OH)2D3 may be able to
inhibit the key Th1 and Th2 cytokines, namely IFN- and IL-4, in
naive cells by virtue of its ability to inhibit the cell cycle. To
address this question, naive T cells were labeled with CFSE (Fig. 5A) and subsequently activated
in vitro and differentiated as described for the experiments in Fig. 1.
The cell division status of the cells was followed every 24 h by
FACS. CFSE labels cells by spontaneously and irreversibly coupling to
cellular proteins. In addition, it is distributed equally between
daughter cells; thus, the CFSE intensity is halved with each cell
division cycle (46). Importantly, CFSE does not interfere
with the proliferative and differentiative capacity of the cells
(45, 47). Treatment of naive T cells with
1,25(OH)2D3 did not inhibit
the cell cycle in any of the Th differentiation conditions (compare
Fig. 5, B and C). Although only the day 3 data
are shown, similar results were obtained at all other days tested (data
not shown).
|
and IL-4 production despite the lack of a cell cycle
block, supernatants were collected 24 h after the start of the
secondary stimulation and analyzed for these cytokines. As shown
previously (Fig. 1, B and C),
1,25(OH)2D3 strongly
inhibited both IFN- (Fig. 5D) and IL-4 (Fig. 5E) production from the naive cells. Thus,
1,25(OH)2D3 inhibits
production of the signature Th1 and Th2 cytokines from naive T cells
during their in vitro polarization by a mechanism independent of a cell
cycle block. 1,25(OH)2D3 does not affect the cell cycle in CD62L-CD4+ cells during in vitro Th differentiation
Because 1,25(OH)2D3
retained the capacity to inhibit IFN- production even in
CD62L- T cells (Figs. 2A and
4B), provided the ligand was present from the beginning of
the Th differentiation, we wanted to test whether
1,25(OH)2D3 inhibits the
cell cycle in these cells during the polarization process. Thus,
similar to the experiments described above,
CD62L-CD4+ T cells were
labeled with CFSE (Fig. 6A)
and differentiated in vitro. The number of cell divisions was monitored
every 24 h by FACS. Analogous to the lack of a cell cycle effect
of 1,25(OH)2D3 in naive
cells, this hormone also did not inhibit the cell cycle of
CD62L- cells (compare Fig. 6, B and
C). Once again, the lack of a cell cycle block was
correlated with the previously observed inhibition of IFN- (Fig. 6D) and no effect on IL-4 (Fig. 6E) production in
CD62L- T cells.
1,25(OH)2D3 treatment also
did not affect the viability of the CD62L+ or
CD62L- cells as measured by trypan blue
exclusion (data not shown). Thus, as is the case with naive cells,
1,25(OH)2D3 inhibits
IFN- in CD62L- T cells via a mechanism which
does not involve a cell cycle block.
|
The effects of
1,25(OH)2D3 on in vitro
polarization of CD4+ T cells could conceivably be
mediated through the inhibition of key T cell transcription factors. To
test whether 1,25(OH)2D3
inhibits the Th1 transcription factor T-bet (49) or the
Th2 transcription factors GATA-3 (50) or c-Maf
(51), we isolated total RNA from in vitro activated naive
CD4+ T cells at the end of the polarization
process and performed RT-PCR analysis. Our data show that the hormone
does not alter the levels of GATA-3 (Fig. 7A, compare lanes 5
and 6) in cells polarized toward the Th2 condition. However,
interestingly, 1,25(OH)2D3
does enhance the levels of GATA-3 in nonpolarized cells (Fig. 7A, compare lanes 1 and 2). This
correlates with the enhancement in IL-4 production observed under
nonpolarizing conditions with the ELISA (Fig. 1C).
Similarly, the expression of the other Th2-specific transcription
factor, c-Maf, was not altered by the presence of the hormone (Fig. 7B, compare lanes 5 and 6). Likewise,
1,25(OH)2D3 did not
influence the expression of the Th1-specific transcription factor T-bet
(Fig. 7C, compare lanes 3 and 4). We
have also performed these assays in
CD62L-CD4+ T cells and,
similar to our results in naive cells, we find that there is no effect
of 1,25(OH)2D3 on the
levels of the Th1 and Th2 transcription factors (data not shown). This
correlates with the lack of an effect of this hormone on IFN- and
IL-4 production as measured by ELISA (Fig. 4). To confirm the potency
of our ligand, as well as to test the ability of the hormone to
modulate IL-4 expression at the transcriptional level, we assayed the
mRNA levels of IL-4 in the presence or absence of the ligand.
1,25(OH)2D3 caused a
significant down-regulation of IL-4 mRNA levels in polarized cells
(Fig. 7D, compare lanes 5 and 6),
suggesting that this hormone inhibits IL-4 production via
transcriptional repression.
|
Previous studies from our laboratory have shown that
1,25(OH)2D3 inhibits IL-2
and GM-CSF transcription through a mechanism involving interference or
competition of VDR with NFAT/AP-1 DNA binding (29, 35, 38). Because both IL-4 protein and mRNA levels were inhibited in
the presence of 1,25(OH)2D3
(Figs. 1C and 7D), and because the murine IL-4
promoter contains five NFAT binding sites within the proximal 300 bp
(reviewed in Refs. 52 and 53), we
hypothesized that
1,25(OH)2D3 may directly
modulate the activity of this locus at the transcriptional level. To
test this possibility, Jurkat cells were cotransfected by
electroporation with a VDR producer plasmid (CMV-VDR), an IL-4 reporter
plasmid containing 800 bp of the proximal murine promoter
(54), and an internal control plasmid
(CMV-
-galactosidase). The cells were treated with activating agents,
PHA and PMA, in the presence (filled bars) or absence (shaded bars) of
1,25(OH)2D3. In addition,
ethanol (open bars) and
1,25(OH)2D3 (hatched bars)
treatment controls were included. Eight hours postactivation, the cells
were harvested and luciferase levels were measured and normalized for
protein concentration and -galactosidase activity. In the absence of
VDR, 1,25(OH)2D3 treatment
did not affect IL-4 promoter activity (Fig. 8, compare lanes 3 and
4). Overexpression of VDR resulted in a dose-dependent
repression of activated transcription in the presence of
10-9–10-6 M
1,25(OH)2D3 (Fig. 8, compare lanes 8, 10, 12, and
14 to lane 6). Thus, inhibition of IL-4
transcription by ligand-bound VDR appears to be one mode by which
1,25(OH)2D3 suppresses IL-4
production.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
but also IL-4 production in naive cells differentiated toward the Th1
or Th2 subset, respectively.
1,25(OH)2D3 maintained its
ability to suppress IFN- synthesis even in
CD62L- cells but was unable to attenuate IL-4
expression in these cells. Our experiments further revealed that
1,25(OH)2D3 was needed
during the early stages of the differentiation process to exert its
inhibitory effect on IL-4 and IFN- production. If the cells were
allowed to differentiate under strong polarizing conditions in the
absence of this ligand for as few as 4 days,
1,25(OH)2D3 was ineffective
in suppressing either of the two cytokines.
As presented here, it is clear that
1,25(OH)2D3 does not alter
cell cycle progression in naive or in vivo activated
CD4+ cells differentiated into either subset in
vitro. 1,25(OH)2D3 also did
not alter the levels of Th1/Th2 transcription factors, suggesting that
the inhibition of IFN- and IL-4 is not secondary to the inhibition
of these key transcription factors. We also found that
1,25(OH)2D3 does not alter
the levels of the IL-4 receptor (data not shown). Instead, our
preliminary data show that VDR can directly down-regulate IL-4
transcription (Figs. 7D and 8), suggesting that this may be
the basis for the diminished IL-4 levels in the presence of this
liganded receptor. It is interesting to note the lack of an effect of
1,25(OH)2D3 on IL-4
production from memory/activated (CD62L-)
CD4+ T cells despite the fact that this hormone
most likely inhibits IL-4 transcription. We believe that chromatin
remodeling, which occurs during Th differentiation at the IL-4 locus,
may prevent VDR from binding to cognate response elements, thus
eliminating suppression of IL-4 production in memory/activated
cells.
While our data clearly demonstrate a role for
1,25(OH)2D3 in modulating
the levels of the key Th1 and Th2 cytokines during in vitro
polarization of naive CD4+ T cells, the question
still remains as to whether this hormone inhibits Th differentiation
per se or whether it simply inhibits cytokine production from
differentiating or already differentiated cells. The lack of an effect
of 1,25(OH)2D3 on both the
cell cycle and the key Th1/Th2 transcription factors during the
polarization of CD4+ T cells would argue against
a general block on Th differentiation by this ligand. Instead, our data
are more consistent with a model in which
1,25(OH)2D3 inhibits
cytokine production during CD4+ T cell
differentiation via transcriptional repression of IL-4 in the case of
Th2-polarized cells. Similarly, Cippitelli and Santoni
(36) have demonstrated the down-modulation of IFN-
transcription by
1,25(OH)2D3. Thus, a common
strategy in which
1,25(OH)2D3 may hamper the
function of Th1 and Th2 cells is through the transcriptional
down-regulation of central cytokines such as IFN- and IL-4.
To the best of our knowledge, this is the first study describing the
effects of 1,25(OH)2D3 on
purified naive or
CD62L-CD4+ T cells during
their in vitro polarization. Lemire and colleagues (40)
used human rye grass allergen-specific T cell clones, isolated from
atopic patients and classified into Th0, Th1, or Th2 subsets based on
their cytokine secretion profile, and activated them in vitro with
HLA-matched APCs in the presence or absence of
1,25(OH)2D3. Forty-eight to
72 h postactivation, the supernatants revealed decreased levels of
IFN- but unaltered levels of IL-4 (40). These data are
in accord with our observations on the effect of
1,25(OH)2D3 on
CD62L- murine CD4+ T
cells, where this hormone also inhibits IFN- production (Fig. 2A) but does not affect IL-4 production (Fig. 2B).
Earlier studies by Lemire and Archer (55) showed that 1,25(OH)2D3 prolonged the survival of mice immunized with "encephalitogenic doses of central nervous tissue"; in other words, 1,25(OH)2D3 suppressed murine experimental autoimmune encephalomyelitis (EAE). In addition, they also demonstrated that this hormone suppressed anti-MBP Ab production. Based on their results, they suggested that the hormone may inhibit in vivo T cells central to the development of EAE. They also argued that the significant recovery detected in 1,25(OH)2D3-treated mice despite severe clinical disease may be due to the inability of the mice to develop an Ab response. The fact that 1,25(OH)2D3 was able to inhibit Ab production in this model coupled to the well-established role of IL-4 in aiding Ab production by B cells lends indirect support to our findings of suppression of IL-4 by this hormone.
Following the initial demonstration of the beneficial effects of
1,25(OH)2D3 on EAE,
Cantorna and colleagues (56) extended those findings by
reporting that this hormone reversibly blocks the progression of EAE
while vitamin D3 deficiency accelerates the onset
of the disease. A subsequent study by the same group argued that
1,25(OH)2D3 treatment of
mice with EAE caused an increase in IL-4 and TGF-1 mRNA levels in
the lymph nodes, spinal cord, and brain (57). Based on
these observations, they suggested that
1,25(OH)2D3 is a positive
regulator of these two cytokines and that this may account for
the ability of this hormone to block encephalomyelitis
(57). Our results demonstrating that
1,25(OH)2D3 diminishes IL-4
production from naive CD4+ T cells challenge
these observations. However, several important differences exist
between the experimental systems used in the two studies, which may
perhaps explain the disparity in results, including the strains of
mice, the time course of the experiments, the purity of the cell
populations, and the difference in the type of activation stimuli
used.
The exact role of
1,25(OH)2D3 on Th2
differentiation remains unclear. Our results may suggest an inhibitory
role for this hormone on Th2 function and perhaps differentiation while
an earlier report suggests only minimal effects on Th2 development
(58). Recently, an enhanced Th2 differentiation by
1,25(OH)2D3 was suggested
(59). While we have concentrated our studies on the
inhibitory effects of
1,25(OH)2D3 on IFN- and
IL-4 during in vitro polarization of CD4+ T
cells, it should be noted that under nonskewing conditions (i.e., the
Th0 condition) we see a modest enhancement of IL-4 production (Fig. 1C) as well as an increase in the Th2 transcription factor
GATA-3 (Fig. 7A, lanes 1 and 2). This
is in accord with the recent report by Boonstra and colleagues
(59), who show that
1,25(OH)2D3 enhances IL-4
production and GATA-3 levels following in vitro activation of
CD4+ T cells under nonskewing conditions.
However, unlike the reported increase in c-Maf mRNA (59),
we do not detect any appreciable levels of this transcription factor in
our nonpolarized cultures. The ability of
1,25(OH)2D3 to inhibit IL-4
levels under polarizing conditions but to enhance levels of this
cytokine under nonpolarizing conditions suggests a differential
regulation of IL-4 by this hormone. This modulation may be dependent on
the cytokine environment.
The data presented in this study establish the autonomous effects of
1,25(OH)2D3 on the
functional potential of Th cells. We have demonstrated the importance
of the presence of this hormone during the early stages of the
differentiation process to ensure its effectiveness in suppressing both
IFN- and IL-4 synthesis in naive cells polarized toward the Th1 or
Th2 condition, respectively. There are two possible implications of
this effect of 1,25(OH)2D3
on Th differentiation. On one hand, the requirement for an early
involvement of this hormone in the Th polarization process may suggest
that 1,25(OH)2D3 interferes
with the establishment of the Th1/Th2 subsets. However, the lack of an
effect of 1,25(OH)2D3 on
the cell cycle and the Th1/Th2 transcription factors argues against
that possibility. Instead, the fact that
1,25(OH)2D3 suppresses
IFN- and IL-4 production may suggest that the ligand plays a role in
the maintenance of the Th subsets. This notion may also be supported by
the absence of a complete block in Th differentiation by
1,25(OH)2D3. Additional
experiments will be needed to discern whether
1,25(OH)2D3 interferes with
the establishment or the maintenance of the Th1 and Th2 subsets. At
present, the ability of
1,25(OH)2D3 to inhibit key
Th cytokines during in vitro differentiation suggests that this hormone
may likely hinder the function of differentiating Th cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Leonard P. Freedman, Cell Biology Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. E-mail address: l-freedman{at}ski.mskcc.org
3 Abbreviations used in this paper: 1,25(OH)2D3, 1,25-dihydroxyvitamin D3; VDR, vitamin D receptor; RXR, retinoid X receptor; EAE, experimental autoimmune encephalomyelitis; CD62L, CD62 ligand.
Received for publication August 2, 2001. Accepted for publication November 29, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-2, but not IL-4 and IL-5. J. Immunol. 155:4604.[Abstract]
,25-dihydroxyvitamin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation. J. Immunol. 164:2405.,25 dihydroxyvitamin D3 and its analogs: a vitamin D receptor-dependent pathway that promotes a persistent state of immaturity in vitro and in vivo. Proc. Natl. Acad. Sci. USA 98:6800.,25-Dihydroxyvitamin D3 inhibits -interferon synthesis by normal human peripheral blood lymphocytes. Proc. Natl. Acad. Sci. USA 84:3385. gene. Eur. J. Immunol. 28:3017.[Medline]
B downregulation in transcriptional repression of the p40 gene. J. Clin. Invest. 101:252.[Medline]
,25-dihydroxyvitamin D3-mediated effects. J. Immunol. 160:209.,25-dihydroxyvitamin D3 (calcitriol) induces apoptosis in stimulated T cells through an IL-2 dependent mechanism. Cytokine 8:342.[Medline]
1 and IL-4. J. Immunol. 160:5314.,25-Dihydroxyvitamin D3 has a direct effect on naive CD4+ T cells to enhance the development of Th2 cells. J. Immunol. 167:4974.This article has been cited by other articles:
|
|
 |
|
  C.-C. Szeto and P. K.-T. Li The use of vitamin D analogues in chronic kidney diseases: possible mechanisms beyond bone and mineral metabolism NDT Plus, June 1, 2009; 2(3): 205 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Tang, R. Zhou, D. Luger, W. Zhu, P. B. Silver, R. S. Grajewski, S.-B. Su, C.-C. Chan, L. Adorini, and R. R. Caspi Calcitriol Suppresses Antiretinal Autoimmunity through Inhibitory Effects on the Th17 Effector Response J. Immunol., April 15, 2009; 182(8): 4624 - 4632. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Bouillon, G. Carmeliet, L. Verlinden, E. van Etten, A. Verstuyf, H. F. Luderer, L. Lieben, C. Mathieu, and M. Demay Vitamin D and Human Health: Lessons from Vitamin D Receptor Null Mice Endocr. Rev., October 1, 2008; 29(6): 726 - 776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. P. Kovesdy, S. Ahmadzadeh, J. E. Anderson, and K. Kalantar-Zadeh Association of Activated Vitamin D Treatment and Mortality in Chronic Kidney Disease Arch Intern Med, February 25, 2008; 168(4): 397 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cutolo and K. Otsa Review: Vitamin D, immunity and lupus Lupus, January 1, 2008; 17(1): 6 - 10. [Abstract] [PDF]
|
|
|
|
 |
|
 Y. Arnson, H. Amital, and Y. Shoenfeld Vitamin D and autoimmunity: new aetiological and therapeutic considerations Ann Rheum Dis, September 1, 2007; 66(9): 1137 - 1142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Baroni, M. Biffi, F. Benigni, A. Monno, D. Carlucci, G. Carmeliet, R. Bouillon, and D. D'Ambrosio VDR-dependent regulation of mast cell maturation mediated by 1,25-dihydroxyvitamin D3 J. Leukoc. Biol., January 1, 2007; 81(1): 250 - 262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Daniel, H. H. Radeke, N. A. Sartory, N. Zahn, U. Zuegel, A. Steinmeyer, and J. Stein The New Low Calcemic Vitamin D Analog 22-Ene-25-Oxa-Vitamin D Prominently Ameliorates T Helper Cell Type 1-Mediated Colitis in Mice J. Pharmacol. Exp. Ther., November 1, 2006; 319(2): 622 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Fretz, L. A. Zella, S. Kim, N. K. Shevde, and J. W. Pike 1,25-Dihydroxyvitamin D3 Regulates the Expression of Low-Density Lipoprotein Receptor-Related Protein 5 via Deoxyribonucleic Acid Sequence Elements Located Downstream of the Start Site of Transcription Mol. Endocrinol., September 1, 2006; 20(9): 2215 - 2230. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chen, M. T. Cencioni, D. F. Angelini, G. Borsellino, L. Battistini, and C. F. Brosnan Transcriptional Profiling of {gamma}{delta} T Cells Identifies a Role for Vitamin D in the Immunoregulation of the V{gamma}9V{delta}2 Response to Phosphate-Containing Ligands J. Immunol., May 15, 2005; 174(10): 6144 - 6152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Murase, K. K. Chan, T. J. Garite, D. M. Cooper, and G. D. Weinstein Hormonal Effect on Psoriasis in Pregnancy and Post Partum Arch Dermatol, May 1, 2005; 141(5): 601 - 606. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Cantorna and B. D. Mahon Mounting Evidence for Vitamin D as an Environmental Factor Affecting Autoimmune Disease Prevalence Experimental Biology and Medicine, December 1, 2004; 229(11): 1136 - 1142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Rhodes, L. A. Terry, J. Hope, R. G. Hewinson, and H. M. Vordermeier 1,25-Dihydroxyvitamin D3 and Development of Tuberculosis in Cattle Clin. Vaccine Immunol., November 1, 2003; 10(6): 1129 - 1135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gurlek, M. R. Pittelkow, and R. Kumar Modulation of Growth Factor/Cytokine Synthesis and Signaling by 1{alpha},25-Dihydroxyvitamin D3: Implications in Cell Growth and Differentiation Endocr. Rev., December 1, 2002; 23(6): 763 - 786. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
