The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Staeva-Vieira, T. P.
Right arrow Articles by Freedman, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Staeva-Vieira, T. P.
Right arrow Articles by Freedman, L. P.
The Journal of Immunology, 2002, 168: 1181-1189.
Copyright © 2002 by The American Association of Immunologists

1,25-Dihydroxyvitamin D3 Inhibits IFN-{gamma} and IL-4 Levels During In Vitro Polarization of Primary Murine CD4+ T Cells1

Teodora P. Staeva-Vieira* and Leonard P. Freedman2,{dagger}

* Immunology and {dagger} Cell Biology Programs, Memorial Sloan-Kettering Cancer Center, Sloan-Kettering Division, Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Following their activation, naive CD4+ T cells can differentiate into one of two effector cell subsets, Th1 and Th2. These two subsets have different cytokine secretion patterns and thus mediate separate arms of the immune response. It has been established that the fat-soluble vitamin D3 metabolite 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) and its nuclear receptor, the vitamin D receptor, play an important role in the immune system primarily through the transcriptional inhibition of cytokine genes that either are required for Th1 differentiation or are products of differentiated Th1 cells. Therefore, we wanted to test directly the ability of 1,25(OH)2D3 to alter the Th differentiation process. Our results indicate that 1,25(OH)2D3 inhibits not only the Th1 cytokine IFN-{gamma} but also the Th2 cytokine IL-4 in naive CD62 ligand+CD4+ T cells during their in vitro polarization. This effect is most dramatic when the ligand is present from the onset of the differentiation process. If the ligand is added after the polarization has ensued, the inhibition is significantly diminished. In activated (CD62 ligand-CD4+) T cells, 1,25(OH)2D3 is still able to inhibit IFN-{gamma} but has no effect on IL-4 production. Our results also indicate that inhibition of these two cytokines in naive cells by vitamin D receptor and its ligand is neither a result of a cell cycle block nor an inhibition of Th1 or Th2 transcription factor expression but, rather, at least in the case of Th2 differentiation, an attenuation of IL-4 transcription by the receptor.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Upon Ag stimulation, naive CD4+ Th cells differentiate into two distinct effector populations, Th1 and Th2, based on their cytokine secretion patterns (1). One of the most crucial factors in the polarization process is the cytokine environment. Thus, in vitro, Th1 and Th2 subsets can be generated by activating naive CD4+ T cells in the presence of IL-12 or IL-4, respectively. IL-12 activates the Stat4 signaling pathway to induce IFN-{gamma} transcription and initiate Th1 differentiation, while IL-4 triggers the Stat6 signaling pathway, resulting in IL-4 transcription and Th2 differentiation (2). Once established, the two subsets have distinct cytokine secretion profiles that not only serve to define them (with IFN-{gamma} being the Th1 signature cytokine while IL-4 is the defining Th2 cytokine) but also endow them with different functional properties. Th1 cells secrete IL-2, IFN-{gamma}, and lymphotoxin and direct cell-mediated immune responses, while Th2 cells secrete IL-4, IL-5, IL-6, and IL-13 and mediate humoral responses. In addition to the cytokine environment, many other factors have been shown to play an important role in the differentiation process. Some of these include the Th1- and Th2-specific transcription factors, the strength of TCR signaling, the Ag dose, costimulatory signals, and the influence of the APCs (3, 4, 5, 6, 7). Furthermore, some less conventional factors, such as PGE2 (8, 9) and the steroids progesterone (10) and dexamethasone (reviewed in Ref. 11), have also been implicated in influencing the differentiation process. Our studies focus on the role of another secosteroid, vitamin D3, in Th differentiation.

1,25-Dihydroxyvitamin D3 (1,25(OH)2D3),3 the active metabolite of vitamin D3, is a lipophilic molecule which exerts its actions through a nuclear receptor, the vitamin D receptor (VDR) (reviewed in Refs. 12 and 13). VDR is a member of the steroid-nuclear receptor superfamily, whose members include receptors that bind glucocorticoids, retinoids, thyroid hormones, sex steroids, fatty acids, and eicosanoids (14). In the presence of its ligand, VDR, together with its heterodimeric partner the retinoid X receptor (RXR), can activate or repress target genes by binding to vitamin D response elements on DNA (15, 16). Although traditionally 1,25(OH)2D3 has been associated with regulating calcium homeostasis, the discovery of VDR expression in lymphocytes and monocytes (17, 18, 19) suggested a role for this hormone in the immune system as well. Indeed, a number of studies have now demonstrated the ability of this receptor-ligand pair to act as a strong immunosuppressor (reviewed in Refs. 20 and 21). In promonocytes, 1,25(OH)2D3 has been shown to exert strong antiproliferative and prodifferentiation properties (reviewed in Ref. 22). In contrast, in dendritic cells this hormone inhibits differentiation, maturation, and activation in both human and mouse cells (23, 24, 25). In T lymphocytes, 1,25(OH)2D3 also diminishes proliferation (26, 27, 28), most likely by virtue of its ability to inhibit IL-2 transcription (29). Thus far, 1,25(OH)2D3 and its receptor have been shown to down-modulate the production of other key cytokines, such as IFN-{gamma} (30, 31, 32), IL-12 (33), and GM-CSF (34, 35).

The effects of 1,25(OH)2D3 on the immune system are often inhibitory and frequently result from binding of VDR to nonconsensus vitamin D response elements (29, 35, 36). Furthermore, the mechanisms of the repression on all of the above mentioned gene promoters caused by 1,25(OH)2D3 have been described (36, 37, 38). Our laboratory first demonstrated what now appears to be a common repressive mechanism of VDR and its ligand in the immune system (29, 39). Specifically, VDR interferes with binding of NFAT/AP-1 to key regulatory sites in the promoters of many of the cytokine genes, resulting in a repression of activated transcription of such genes (29, 36, 38).

From the above mentioned studies, it is apparent that 1,25(OH)2D3 inhibits cytokines which either are required for Th1 differentiation, such as IL-12, or are products of differentiated Th1 cells (IL-2 and IFN-{gamma}), suggesting that one of the functions of 1,25(OH)2D3 in the immune system is to inhibit Th1 differentiation (33, 40). Before initiating our studies, a considerable body of evidence existed for the inhibitory effects of 1,25(OH)2D3 on Th1 differentiation. However, not much was known about the possible role this hormone may play in Th2 polarization. Given the established role of 1,25(OH)2D3 as an immunoregulator, we decided to study the possible effect VDR may have during Th differentiation. Our studies indicate that 1,25(OH)2D3 inhibits not only Th1 but also Th2 differentiation during in vitro polarization of naive CD4+ T cells. This inhibition is dependent on the presence of the hormone during the initial stages of Th differentiation and seems to be mediated most likely via a mechanism of transcriptional repression by VDR of the key Th1 and Th2 cytokines IFN-{gamma} and IL-4, respectively. Our results suggest that 1,25(OH)2D3 acts as another influence on the differentiation of the Th1 and Th2 subsets. Thus, levels of 1,25(OH)2D3 at sites of inflammation may have a significant effect on the initiation of the immune response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice, cytokines, and Abs

BALB/c mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and the National Cancer Institute (Frederick, MD). IL-2 was purchased from BioSource International (Camarillo, CA), IL-4 was purchased from Endogen (Woburn, MA), IL-12 was purchased from R&D Systems (Minneapolis, MN), and anti-IL-4, anti-IL-12, anti-CD3, anti-CD28, anti-CD62 ligand (CD62L)-PE, and all other fluorochrome-conjugated Abs were purchased from BD PharMingen (San Diego, CA). All ELISA and ELISPOT Abs were purchased from Endogen.

Preparation of CD4+ T cells

Splenocytes from 6- to 8-wk-old BALB/c mice were purified by RBC lysis. CD4+ T cells were isolated by positive selection using CD4 Dynabeads followed by detachment with DETACHaBEAD (Dynal Biotech, Oslo, Norway). The purified CD4+ T cells were labeled with R-PE-conjugated anti-CD62L Ab and sorted into CD62L+ and CD62L- using a MoFlo (Cytomation, Fort Collins, CO) cell sorter. The sorted cells were pelleted at 1200 rpm at 4°C, resuspended in complete medium, and used in in vitro differentiation experiments. The complete medium consisted of RPMI supplemented with 10% FBS plus penicillin-streptomycin, sodium pyruvate, and glutamine to a final concentration of 100 µg/ml. In addition, 2-ME (Sigma-Aldrich, St. Louis, MO) was added to final concentration of 50 µM and gentamicin (Life Technologies, Grand Island, NY) to 50 ng/ml.

In vitro differentiation of CD4+ T cells

CD62L+ or CD62L- cells (at 0.5–1 x 106 cells/ml) were stimulated in vitro with plate-bound anti-CD3 mAb (2C11) at 3 µg/ml and anti-CD28 mAb (37.51) at 1 µg/ml plus IL-2 at 25 U/ml (nonskewing condition). In addition, cells were incubated with IL-12 at 5 ng/ml and anti-IL-4 mAb (11B11) at 3 µg/ml (Th1-skewing condition) or IL-4 at 500 U/ml and anti-IL-12 (C17.8) at 6 µg/ml (Th2-skewing condition). Differentiation proceeded in the presence of 2.4 x 10-8 M 1,25(OH)2D3 (a kind gift of M. Uskokovic, Hoffmann-LaRoche, Nutley, NJ) diluted in ethanol or in the presence of an equal volume of ethanol only. Four days poststimulation, the cultures were expanded 4-fold with fresh medium, cytokines, and Abs. Three days later, the cells were harvested, washed five times with RPMI 1640 and counted, and equal number of cells were restimulated with plate-bound anti-CD3 at 1 µg/ml. Twenty-four hours postrestimulation, supernatants were collected and cytokine levels were measured by ELISA.

FACS analysis

Cell staining for CD3, CD4, and CD8 was performed by incubating 50 µl of cell suspension (~1 x 106 cells) with 0.2 µg of the appropriate Ab (anti-CD3 CyChrome, anti-CD4 FITC, anti-CD8 PE) for 30 min on ice. The cells were washed, resuspended in PBS, and analyzed using a FACSCalibur.

IL-4 and IFN-{gamma} ELISA

Ninety-six-well Nunc ELISA MaxiSorp flat-bottom plates (Fisher Scientific, Pittsburgh, PA) were coated overnight at room temperature with 1 µg/ml IL-4 coating mAb in PBS (pH 7.4) or with 0.5 µg/ml coating IFN-{gamma} mAb in coating buffer B (0.03 M sodium carbonate, 0.068 M sodium bicarbonate). The primary mAbs were discarded and the plates were blocked with 200 µl/well assay buffer (4% BSA in PBS (pH7.4)) for 1 h at room temperature. The plates were washed three times with wash buffer (50 mM Tris (pH 8), 0.2% Tween 20) and blotted on paper towel, and 50 µl/well of the standards or samples were added in duplicates. Some samples required prior dilution in complete medium to fall within the standard curve range. Following a 1-h incubation at room temperature, 50 µl/well of the detecting mAb was added: 100 ng/ml anti IL-4 secondary Ab or 250 ng/ml anti IFN-{gamma} Ab. The plates were incubated for 1 h at room temperature and washed three times with wash buffer, and 100 µl/well HRP-conjugated streptavidin was added at 1/32,000 dilution for IL-4 or 1/8,000 dilution for IFN-{gamma} in assay buffer. After a 30-min incubation at room temperature, the plates were washed as before and 100 µl/well tetramethylbenzidine substrate solution was added. The color was allowed to develop for 30 min in the dark before the reaction was quenched with 100 µl/well stop solution (0.18 M H2SO4). The plates were read at 450–550 nm and the sample concentrations were determined with the help of the standard curve. All reagents for the ELISAs were purchased from Endogen.

CFSE labeling and analysis

Murine CD4+ T cells, isolated as described above, were further purified into CD62L+ and CD62L- by positive isolation with detachment using a biotin-conjugated anti-CD62L mAb (BD PharMingen) and a CELLection Biotin Binder kit (Dynal Biotech). The purity of the isolated cells was confirmed by FACS using a PE-conjugated anti-CD62L mAb (BD PharMingen). The cells were subsequently resuspended in 1 ml of HBSS (at <= 2 x 107 cells/ml) and labeled with 5 µM CFSE (Molecular Probes, Eugene, OR) at room temperature for 8 min. The reaction was quenched with 1 ml of FBS and the cells were washed four times with complete medium. After the final wash, the cells were allowed to rest overnight in complete medium at 37°C and 5% CO2. A small aliquot of the labeled cells was analyzed by FACS for CFSE incorporation. The rest of the cells were pelleted, resuspended in 1 ml of complete medium, counted, diluted to 0.5–1 x 106 cells/ml, and activated on Ab-coated plates in the presence of the appropriate skewing cytokines and Abs as described above.

Cell culture and transfection

Jurkat, a human T cell lymphoma, was maintained in RPMI 1640 supplemented with 10% FBS plus penicillin-streptomycin, sodium pyruvate, and glutamine to a final concentration of 100 µg/ml. The cells were transfected by electroporation as previously described (38).

RT-PCR

Total RNA was isolated, according to the manufacturer’s instructions, using TRIzol reagent (Life Technologies) from in vitro activated CD4+ T cells. RNA (1.5 µg) was used in the reverse transcription reaction with Superscript II RNase H- (Invitrogen, San Diego, CA) following the manufacturer’s instructions. The cDNA was diluted 5-fold in water and 5 µl were amplified 25 cycles in PTC-200 Peltier Thermal Cycler (MJ Research, Cambridge, MA) in a reaction containing 5 µl of 10x PCR buffer with 15 mM MgCl2, 1 µl of 20 mM sense and antisense primers, 1 µl of 10 mM dNTPs, 36.5 µl of water, and 0.5 µl of Taq. The cycling conditions were 94°C for 2 min followed by 25 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1.5 min, and a final extension at 72°C for 5 min. The following primers were used: GATA-3 sense, GAAGGCATCCAGACCCGAAAC, and antisense, ACCCATGGCGGTGACCATGC; c-Maf sense, CCCAGTCCTGCCGCTTCAAGAGGG, and antisense, CATTGAACATTGTGCAAGTCC; T-bet sense, TGCCTGCAGTGCTTCTAACA, and antisense, TGCCCCGCTTCCTCTCCAACCAA, as published in Ref. 41 ; IL-4 sense, CATCGGCATTTTGAACGAGGTCA, and antisense, CTTATCGATGAATCCAGGCATCG; and HPRT sense, GTTGGAGACAGGCCAGACTTTGTTG, and antisense, GAGGGTAGGCTGGCCTATAGGCT. The IL-4 and HPRT primer sequences were as published in Ref. 42 .


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1,25(OH)2D3 inhibits IFN-{gamma} and IL-4 production during Th differentiation of naive CD62L+CD4+ T cells

To test directly whether 1,25(OH)2D3 can affect the Th polarization process, we conducted in vitro Th differentiation experiments. Briefly, naive (CD62+) CD4+ T cells (Fig. 1GoA) were isolated from spleens of BALB/c mice and were activated in culture under nonskewing, Th1-skewing, or Th2-skewing conditions in the absence (shaded bars) or presence (filled bars) of 1,25(OH)2D3. After 7 days, the cells were washed and restimulated for 24 h in the absence of exogenous cytokines and Abs. Supernatants were collected and levels of secreted IFN-{gamma} and IL-4 were determined using an ELISA. As expected, we observed that 1,25(OH)2D3 inhibited IFN-{gamma} production in naive T cells by at least 50% (Fig. 1GoB). Likewise, 1,25(OH)2D3 also inhibited IL-4 production, but only in cultures polarized toward the Th2 condition (Fig. 1GoC). Under nonpolarizing conditions, 1,25(OH)2D3 did not have an inhibitory effect on IL-4 production. In fact, the presence of the hormone enhanced IL-4 levels, 1.4 ng/ml with ligand as compared with 0.3 ng/ml for the vehicle control (Fig. 1GoC). Similar results were obtained using an ELISPOT assay (data not shown). Thus, 1,25(OH)2D3 appears to inhibit not only IFN-{gamma} but also IL-4 production during the in vitro differentiation of naive CD4+ T cells toward the Th1 and Th2 subsets, respectively.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. 1,25(OH)2D3 inhibits both Th1 and Th2 differentiation of naive primary murine CD4+ T cells. A, Phenotype analysis of purified CD4+CD62L+ and CD62L- T cells. B and C, Naive (CD62L+) CD4+ T cells were activated in vitro under either nonpolarizing, Th1-polarizing, or Th2-polarizing conditions in the presence (filled bars) or absence (shaded bars) of 2.4 x 10-8 M 1,25(OH)2D3. Cytokine production was measured by ELISA 7 days after the start of differentiation. A total of nine experiments were conducted yielding similar results. One representative experiment is shown.

 
1,25(OH)2D3 inhibits IFN-{gamma} but not IL-4 production during Th differentiation in activated CD62L-CD4+ T cells

In addition to testing the effects of 1,25(OH)2D3 on naive CD4+ T cells, we also wondered how this hormone would affect the in vitro Th differentiation of activated CD4+ T cells. To test this, we set up the Th differentiation experiments previously described but using CD62L- T cells (Fig. 1GoA). Similar to its effects on naive cells, 1,25(OH)2D3 inhibited IFN-{gamma} production in the CD62L- T cells (Fig. 2GoA). However, unlike its effect on naive cells, the hormone did not alter IL-4 production in this cell population (Fig. 2GoB). Similar results were obtained using the ELISPOT assay (data not shown). It should be noted that the unskewed population (Fig. 2GoB) produced as much IL-4 as the Th2-polarized cells. We believe this is due to the genetic background of the mice used, BALB/c, which develop preferentially a Th2 response. Our results suggest that in previously activated CD4+ T cells, 1,25(OH)2D3 inhibits only IFN-{gamma} production but is ineffective in altering IL-4 levels during the in vitro differentiation of these cells.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Effect of 1,25(OH)2D3 on Th differentiation of activated CD62L-CD4+ T cells. CD62L-CD4+ T cells were stimulated in vitro under nonpolarizing, Th1-polarizing, or Th2-polarizing conditions in the presence (filled bars) or absence (shaded bars) of 2.4 x 10-8 M 1,25(OH)2D3. Cytokine production was measured by ELISA 7 days after the start of differentiation. A representative experiment of 10 independent experiments with similar results is shown.

 
Temporal effects of 1,25(OH)2D3 on naive CD4+ T cells

Because 1,25(OH)2D3 was able to inhibit IL-4 production in naive cells but was ineffective in suppressing this cytokine in previously activated T cells, we wondered at what time point after the Th differentiation process has begun can the ligand be first added and still be able to inhibit IL-4 production. Thus, we established the following experimental system (Fig. 3GoA): naive CD4+ T cells were differentiated under polarizing or nonpolarizing conditions, as previously described, and 1,25(OH)2D3 was added at the beginning of the differentiation process (treatment 1), halfway through the differentiation (treatment 2), or at the end of the skewing process (treatment 3). In all three cases, the ligand was maintained in the cultures for a total of 7 days following its addition. The strongest inhibitory effects of 1,25(OH)2D3 on both IFN-{gamma} and IL-4 production were observed when the hormone was present at the onset as well as throughout the differentiation process (Fig. 3Go, B and E). However, if polarization was allowed to proceed in the absence of the ligand for as little as 4 days, the subsequent addition and maintenance of 1,25(OH)2D3 in the cultures for 7 days was ineffective in diminishing the production of these two cytokines (Fig. 3Go, C and F). Similarly, addition of the hormone at the end of the differentiation process did not decrease the amount of secreted IFN-{gamma} and IL-4 (Fig. 3Go, D and G). Thus, 1,25(OH)2D3 is able to inhibit IFN-{gamma} and IL-4 production in naive cells skewed toward the Th1 or Th2 subsets, respectively, only if present during the early stages of the polarization process.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 3. Inhibition of Th1 and Th2 differentiation of naive CD4+ T cells by 1,25(OH)2D3 is dependent upon the presence of this ligand during the early stages of the polarization process. A, Schematic representation of the experimental setup. Naive (CD62L+) CD4+ cells were stimulated with immobilized anti-CD3 and anti-CD28 Abs under Th1- or Th2-polarizing conditions for 7 days and were assayed for cytokine production following a 24-h stimulation with anti-CD3. 1,25(OH)2D3 was added at the beginning of differentiation (day 0, B and E), 4 days following the start of differentiation (day 4, C and F), or at the end of the primary culture (day 7, D and G). It should be noted that regardless of when the hormone was first added to the primary cultures, 1,25(OH)2D3 was subsequently maintained with the cells for a total of 7 days before the cultures were restimulated. The level of secreted murine IFN-{gamma} (BD) or murine IL-4 (EG) was measured by ELISA. The nanogram per milliliter levels vary from graph to graph due to the different numbers of cells used during the secondary stimulation in each experiment. However, an equal number of cells were used per condition within each experiment.

 
Temporal effects of 1,25(OH)2D3 on CD62L-CD4+ T cells

Akin to the experiments just described, CD62L- T cells were differentiated in vitro in the presence of 1,25(OH)2D3 added at the start of the polarization (treatment 1); halfway through the differentiation (treatment 2), or at the end of the skewing process (treatment 3) (Fig. 4GoA). In all three cases, the hormone was maintained in the cultures for a total of 7 days before the cells were washed and restimulated. As was the case with the naive cells, 1,25(OH)2D3 suppressed IFN-{gamma} production only when the hormone was provided at the onset of the differentiation process (Fig. 4GoB). Once the cells had been activated in vitro under strong skewing conditions for 4 days, the ligand was much less effective in inhibiting IFN-{gamma} synthesis (Fig. 4GoC). If 1,25(OH)2D3 was first added to the cells 7 days after the start of the in vitro differentiation, the ligand no longer inhibited (Fig. 4GoD). 1,25(OH)2D3 had no effect on IL-4 production from CD62L- T cells during their in vitro differentiation (Fig. 4Go, EG). The inhibitory effect of 1,25(OH)2D3 on CD62L- T cells during their in vitro Th differentiation seems to be confined to IFN-{gamma} only. Furthermore, this suppression is dependent on the presence of the ligand during the early stages of the polarization process.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 4. 1,25(OH)2D3 inhibits Th1 but not Th2 differentiation in CD62L-CD4+ T cells. A, CD62L-CD4+ cells were stimulated with anti-CD3 and anti-CD28 under Th1- or Th2-polarizing conditions for 7 days and were assayed for cytokine production following a 24-h stimulation with anti-CD3. 1,25(OH)2D3 was added at the start of differentiation (day 0, B and E), 4 days following the start of differentiation (day 4, C and F), or at the end of the primary culture (day 7, D and G). It should be noted that regardless of when the hormone was first added to the primary cultures, 1,25(OH)2D3 was subsequently maintained with the cells, under the skewing conditions, for a total of 7 days before the cultures were restimulated. The level of secreted murine IFN-{gamma} (BD) or murine IL-4 (EG) was measured by ELISA. The nanogram per milliliter levels vary from graph to graph due to the different numbers of cells used during the secondary stimulation in each experiment. However, an equal number of cells were used per condition within each experiment.

 
1,25(OH)2D3 inhibits IFN-{gamma} and IL-4 production from naive CD4+ T cells in the absence of a cell cycle block

Having observed that 1,25(OH)2D3 inhibits both IFN-{gamma} and IL-4 production from naive CD4+ T cells as well as IFN-{gamma} synthesis from CD62L-CD4+ T cells during their in vitro polarization, we wanted to determine the mechanism of this repression. There are at least three possible ways that may account for inhibition of IFN-{gamma} and IL-4 caused by 1,25(OH)2D3 during the differentiation process: 1) a block in the cell cycle of the differentiating cells, 2) an inhibition of the expression of the Th1 and Th2 transcription factors, and 3) a transcriptional repression of the IFN-{gamma} and IL-4 loci.

We were especially intrigued by the possibility that 1,25(OH)2D3 may inhibit the cell cycle in differentiating Th cells, as previous work from our laboratory has shown that 1,25(OH)2D3 inhibits the cell cycle by up-regulating p21 and p27 in the myelomonocytic cell line U937 (43). Furthermore, Rigby and colleagues (44) have shown that 1,25(OH)2D3 blocks the cell cycle in human T cells. Considering that cell cycle progression provides an important level of regulation governing Th differentiation (45), we wondered whether 1,25(OH)2D3 may be able to inhibit the key Th1 and Th2 cytokines, namely IFN-{gamma} and IL-4, in naive cells by virtue of its ability to inhibit the cell cycle. To address this question, naive T cells were labeled with CFSE (Fig. 5GoA) and subsequently activated in vitro and differentiated as described for the experiments in Fig. 1Go. The cell division status of the cells was followed every 24 h by FACS. CFSE labels cells by spontaneously and irreversibly coupling to cellular proteins. In addition, it is distributed equally between daughter cells; thus, the CFSE intensity is halved with each cell division cycle (46). Importantly, CFSE does not interfere with the proliferative and differentiative capacity of the cells (45, 47). Treatment of naive T cells with 1,25(OH)2D3 did not inhibit the cell cycle in any of the Th differentiation conditions (compare Fig. 5Go, B and C). Although only the day 3 data are shown, similar results were obtained at all other days tested (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 5. 1,25(OH)2D3 inhibits the differentiation of naive CD4+ T cells in the absence of a cell cycle block. A, Naive CD4+ T cells were labeled with CFSE and differentiated in vitro as previously described. B and C, The cell division status of the differentiating cells was assayed by FACS every 24 h following activation. A representative time point, day 3, is shown. D and E, ELISAs on the culture supernatants at the end of the differentiation process confirmed the presence of Th1 and Th2 inhibition by liganded VDR despite the lack of a cell cycle block.

 
It has been shown that IL-2 can reverse the cell cycle block of 1,25(OH)2D3 on human PBMC (48). Because our experiments were done in the presence of exogenous IL-2, it is formally possible that the inability to detect any changes in cell cycle progression could be due to the addition of IL-2 to the cultures. Thus, we have also performed the cell cycle analysis experiments in the absence of exogenous IL-2 and, as we observed with IL-2, we do not see any significant differences in the CFSE profiles of the 1,25(OH)2D3-treated vs the untreated cells (data not shown). To confirm that 1,25(OH)2D3 was able to inhibit IFN-{gamma} and IL-4 production despite the lack of a cell cycle block, supernatants were collected 24 h after the start of the secondary stimulation and analyzed for these cytokines. As shown previously (Fig. 1Go, B and C), 1,25(OH)2D3 strongly inhibited both IFN-{gamma} (Fig. 5GoD) and IL-4 (Fig. 5GoE) production from the naive cells. Thus, 1,25(OH)2D3 inhibits production of the signature Th1 and Th2 cytokines from naive T cells during their in vitro polarization by a mechanism independent of a cell cycle block.

1,25(OH)2D3 does not affect the cell cycle in CD62L-CD4+ cells during in vitro Th differentiation

Because 1,25(OH)2D3 retained the capacity to inhibit IFN-{gamma} production even in CD62L- T cells (Figs. 2GoA and 4B), provided the ligand was present from the beginning of the Th differentiation, we wanted to test whether 1,25(OH)2D3 inhibits the cell cycle in these cells during the polarization process. Thus, similar to the experiments described above, CD62L-CD4+ T cells were labeled with CFSE (Fig. 6GoA) and differentiated in vitro. The number of cell divisions was monitored every 24 h by FACS. Analogous to the lack of a cell cycle effect of 1,25(OH)2D3 in naive cells, this hormone also did not inhibit the cell cycle of CD62L- cells (compare Fig. 6Go, B and C). Once again, the lack of a cell cycle block was correlated with the previously observed inhibition of IFN-{gamma} (Fig. 6GoD) and no effect on IL-4 (Fig. 6GoE) production in CD62L- T cells. 1,25(OH)2D3 treatment also did not affect the viability of the CD62L+ or CD62L- cells as measured by trypan blue exclusion (data not shown). Thus, as is the case with naive cells, 1,25(OH)2D3 inhibits IFN-{gamma} in CD62L- T cells via a mechanism which does not involve a cell cycle block.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 6. 1,25(OH)2D3 does not affect the cell cycle in differentiating CD62L-CD4+ cells. A, CD62L-CD4+ cells were labeled with CFSE and differentiated in vitro. B and C, The cell division status of the differentiating cells grown in the presence (filled histograms) or absence (shaded histograms) was assayed by FACS. A representative time point, day 4, is shown. D and E, ELISAs on the culture supernatants from the secondary stimulation.

 
VDR does not alter the levels of the Th1 and Th2 transcription factors during the in vitro polarization of CD4+T cells

The effects of 1,25(OH)2D3 on in vitro polarization of CD4+ T cells could conceivably be mediated through the inhibition of key T cell transcription factors. To test whether 1,25(OH)2D3 inhibits the Th1 transcription factor T-bet (49) or the Th2 transcription factors GATA-3 (50) or c-Maf (51), we isolated total RNA from in vitro activated naive CD4+ T cells at the end of the polarization process and performed RT-PCR analysis. Our data show that the hormone does not alter the levels of GATA-3 (Fig. 7GoA, compare lanes 5 and 6) in cells polarized toward the Th2 condition. However, interestingly, 1,25(OH)2D3 does enhance the levels of GATA-3 in nonpolarized cells (Fig. 7GoA, compare lanes 1 and 2). This correlates with the enhancement in IL-4 production observed under nonpolarizing conditions with the ELISA (Fig. 1GoC). Similarly, the expression of the other Th2-specific transcription factor, c-Maf, was not altered by the presence of the hormone (Fig. 7GoB, compare lanes 5 and 6). Likewise, 1,25(OH)2D3 did not influence the expression of the Th1-specific transcription factor T-bet (Fig. 7GoC, compare lanes 3 and 4). We have also performed these assays in CD62L-CD4+ T cells and, similar to our results in naive cells, we find that there is no effect of 1,25(OH)2D3 on the levels of the Th1 and Th2 transcription factors (data not shown). This correlates with the lack of an effect of this hormone on IFN-{gamma} and IL-4 production as measured by ELISA (Fig. 4Go). To confirm the potency of our ligand, as well as to test the ability of the hormone to modulate IL-4 expression at the transcriptional level, we assayed the mRNA levels of IL-4 in the presence or absence of the ligand. 1,25(OH)2D3 caused a significant down-regulation of IL-4 mRNA levels in polarized cells (Fig. 7GoD, compare lanes 5 and 6), suggesting that this hormone inhibits IL-4 production via transcriptional repression.



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 7. Effect of 1,25(OH)2D3 on the Th1 and Th2 transcription factors and IL-4 mRNA levels. Total RNA obtained from activated and nonpolarized or polarized naive CD4+ T cells was analyzed by RT-PCR for levels of the Th2 transcription factors GATA-3 (A) and c-Maf (B) as well as the Th1 transcription factor T-bet (C) and the Th2 cytokine IL-4 (D).

 
VDR inhibits transcription of the murine IL-4 promoter in a ligand dose-dependent manner

Previous studies from our laboratory have shown that 1,25(OH)2D3 inhibits IL-2 and GM-CSF transcription through a mechanism involving interference or competition of VDR with NFAT/AP-1 DNA binding (29, 35, 38). Because both IL-4 protein and mRNA levels were inhibited in the presence of 1,25(OH)2D3 (Figs. 1GoC and 7D), and because the murine IL-4 promoter contains five NFAT binding sites within the proximal 300 bp (reviewed in Refs. 52 and 53), we hypothesized that 1,25(OH)2D3 may directly modulate the activity of this locus at the transcriptional level. To test this possibility, Jurkat cells were cotransfected by electroporation with a VDR producer plasmid (CMV-VDR), an IL-4 reporter plasmid containing 800 bp of the proximal murine promoter (54), and an internal control plasmid (CMV-{beta}-galactosidase). The cells were treated with activating agents, PHA and PMA, in the presence (filled bars) or absence (shaded bars) of 1,25(OH)2D3. In addition, ethanol (open bars) and 1,25(OH)2D3 (hatched bars) treatment controls were included. Eight hours postactivation, the cells were harvested and luciferase levels were measured and normalized for protein concentration and {beta}-galactosidase activity. In the absence of VDR, 1,25(OH)2D3 treatment did not affect IL-4 promoter activity (Fig. 8Go, compare lanes 3 and 4). Overexpression of VDR resulted in a dose-dependent repression of activated transcription in the presence of 10-9–10-6 M 1,25(OH)2D3 (Fig. 8Go, compare lanes 8, 10, 12, and 14 to lane 6). Thus, inhibition of IL-4 transcription by ligand-bound VDR appears to be one mode by which 1,25(OH)2D3 suppresses IL-4 production.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 8. VDR inhibits activated transcription of the murine IL-4 promoter in the presence of 1,25(OH)2D3. Jurkat T cells were transfected with an 800-bp IL-4 promoter reporter construct (54 ) as well as 375 ng of CMV-VDR DNA. Cells were treated for 8 h with the activating agents PHA and PMA (shaded bars) and/or increasing concentrations of 1,25(OH)2D3 (filled bars). Luciferase activity was normalized to total protein as well as {beta}-galactosidase activity produced off the internal control plasmid CMV-{beta}-gal that was included in each transfection.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have examined the effect of 1,25(OH)2D3 on the Th differentiation process in naive (CD62L+) as well as activated (CD62L-) CD4+ T cells. Our results show that this hormone inhibits not only IFN-{gamma} but also IL-4 production in naive cells differentiated toward the Th1 or Th2 subset, respectively. 1,25(OH)2D3 maintained its ability to suppress IFN-{gamma} synthesis even in CD62L- cells but was unable to attenuate IL-4 expression in these cells. Our experiments further revealed that 1,25(OH)2D3 was needed during the early stages of the differentiation process to exert its inhibitory effect on IL-4 and IFN-{gamma} production. If the cells were allowed to differentiate under strong polarizing conditions in the absence of this ligand for as few as 4 days, 1,25(OH)2D3 was ineffective in suppressing either of the two cytokines.

As presented here, it is clear that 1,25(OH)2D3 does not alter cell cycle progression in naive or in vivo activated CD4+ cells differentiated into either subset in vitro. 1,25(OH)2D3 also did not alter the levels of Th1/Th2 transcription factors, suggesting that the inhibition of IFN-{gamma} and IL-4 is not secondary to the inhibition of these key transcription factors. We also found that 1,25(OH)2D3 does not alter the levels of the IL-4 receptor (data not shown). Instead, our preliminary data show that VDR can directly down-regulate IL-4 transcription (Figs. 7GoD and 8), suggesting that this may be the basis for the diminished IL-4 levels in the presence of this liganded receptor. It is interesting to note the lack of an effect of 1,25(OH)2D3 on IL-4 production from memory/activated (CD62L-) CD4+ T cells despite the fact that this hormone most likely inhibits IL-4 transcription. We believe that chromatin remodeling, which occurs during Th differentiation at the IL-4 locus, may prevent VDR from binding to cognate response elements, thus eliminating suppression of IL-4 production in memory/activated cells.

While our data clearly demonstrate a role for 1,25(OH)2D3 in modulating the levels of the key Th1 and Th2 cytokines during in vitro polarization of naive CD4+ T cells, the question still remains as to whether this hormone inhibits Th differentiation per se or whether it simply inhibits cytokine production from differentiating or already differentiated cells. The lack of an effect of 1,25(OH)2D3 on both the cell cycle and the key Th1/Th2 transcription factors during the polarization of CD4+ T cells would argue against a general block on Th differentiation by this ligand. Instead, our data are more consistent with a model in which 1,25(OH)2D3 inhibits cytokine production during CD4+ T cell differentiation via transcriptional repression of IL-4 in the case of Th2-polarized cells. Similarly, Cippitelli and Santoni (36) have demonstrated the down-modulation of IFN-{gamma} transcription by 1,25(OH)2D3. Thus, a common strategy in which 1,25(OH)2D3 may hamper the function of Th1 and Th2 cells is through the transcriptional down-regulation of central cytokines such as IFN-{gamma} and IL-4.

To the best of our knowledge, this is the first study describing the effects of 1,25(OH)2D3 on purified naive or CD62L-CD4+ T cells during their in vitro polarization. Lemire and colleagues (40) used human rye grass allergen-specific T cell clones, isolated from atopic patients and classified into Th0, Th1, or Th2 subsets based on their cytokine secretion profile, and activated them in vitro with HLA-matched APCs in the presence or absence of 1,25(OH)2D3. Forty-eight to 72 h postactivation, the supernatants revealed decreased levels of IFN-{gamma} but unaltered levels of IL-4 (40). These data are in accord with our observations on the effect of 1,25(OH)2D3 on CD62L- murine CD4+ T cells, where this hormone also inhibits IFN-{gamma} production (Fig. 2GoA) but does not affect IL-4 production (Fig. 2GoB).

Earlier studies by Lemire and Archer (55) showed that 1,25(OH)2D3 prolonged the survival of mice immunized with "encephalitogenic doses of central nervous tissue"; in other words, 1,25(OH)2D3 suppressed murine experimental autoimmune encephalomyelitis (EAE). In addition, they also demonstrated that this hormone suppressed anti-MBP Ab production. Based on their results, they suggested that the hormone may inhibit in vivo T cells central to the development of EAE. They also argued that the significant recovery detected in 1,25(OH)2D3-treated mice despite severe clinical disease may be due to the inability of the mice to develop an Ab response. The fact that 1,25(OH)2D3 was able to inhibit Ab production in this model coupled to the well-established role of IL-4 in aiding Ab production by B cells lends indirect support to our findings of suppression of IL-4 by this hormone.

Following the initial demonstration of the beneficial effects of 1,25(OH)2D3 on EAE, Cantorna and colleagues (56) extended those findings by reporting that this hormone reversibly blocks the progression of EAE while vitamin D3 deficiency accelerates the onset of the disease. A subsequent study by the same group argued that 1,25(OH)2D3 treatment of mice with EAE caused an increase in IL-4 and TGF-{beta}1 mRNA levels in the lymph nodes, spinal cord, and brain (57). Based on these observations, they suggested that 1,25(OH)2D3 is a positive regulator of these two cytokines and that this may account for the ability of this hormone to block encephalomyelitis (57). Our results demonstrating that 1,25(OH)2D3 diminishes IL-4 production from naive CD4+ T cells challenge these observations. However, several important differences exist between the experimental systems used in the two studies, which may perhaps explain the disparity in results, including the strains of mice, the time course of the experiments, the purity of the cell populations, and the difference in the type of activation stimuli used.

The exact role of 1,25(OH)2D3 on Th2 differentiation remains unclear. Our results may suggest an inhibitory role for this hormone on Th2 function and perhaps differentiation while an earlier report suggests only minimal effects on Th2 development (58). Recently, an enhanced Th2 differentiation by 1,25(OH)2D3 was suggested (59). While we have concentrated our studies on the inhibitory effects of 1,25(OH)2D3 on IFN-{gamma} and IL-4 during in vitro polarization of CD4+ T cells, it should be noted that under nonskewing conditions (i.e., the Th0 condition) we see a modest enhancement of IL-4 production (Fig. 1GoC) as well as an increase in the Th2 transcription factor GATA-3 (Fig. 7GoA, lanes 1 and 2). This is in accord with the recent report by Boonstra and colleagues (59), who show that 1,25(OH)2D3 enhances IL-4 production and GATA-3 levels following in vitro activation of CD4+ T cells under nonskewing conditions. However, unlike the reported increase in c-Maf mRNA (59), we do not detect any appreciable levels of this transcription factor in our nonpolarized cultures. The ability of 1,25(OH)2D3 to inhibit IL-4 levels under polarizing conditions but to enhance levels of this cytokine under nonpolarizing conditions suggests a differential regulation of IL-4 by this hormone. This modulation may be dependent on the cytokine environment.

The data presented in this study establish the autonomous effects of 1,25(OH)2D3 on the functional potential of Th cells. We have demonstrated the importance of the presence of this hormone during the early stages of the differentiation process to ensure its effectiveness in suppressing both IFN-{gamma} and IL-4 synthesis in naive cells polarized toward the Th1 or Th2 condition, respectively. There are two possible implications of this effect of 1,25(OH)2D3 on Th differentiation. On one hand, the requirement for an early involvement of this hormone in the Th polarization process may suggest that 1,25(OH)2D3 interferes with the establishment of the Th1/Th2 subsets. However, the lack of an effect of 1,25(OH)2D3 on the cell cycle and the Th1/Th2 transcription factors argues against that possibility. Instead, the fact that 1,25(OH)2D3 suppresses IFN-{gamma} and IL-4 production may suggest that the ligand plays a role in the maintenance of the Th subsets. This notion may also be supported by the absence of a complete block in Th differentiation by 1,25(OH)2D3. Additional experiments will be needed to discern whether 1,25(OH)2D3 interferes with the establishment or the maintenance of the Th1 and Th2 subsets. At present, the ability of 1,25(OH)2D3 to inhibit key Th cytokines during in vitro differentiation suggests that this hormone may likely hinder the function of differentiating Th cells.


    Acknowledgments
 
We are grateful to Drs. Janko Nikolich-Zugich and Lionel Ivashkiv for many helpful discussions and for critically reviewing the manuscript. We also thank Dr. Kenneth Murphy for plasmids, Dr. M. Uskokovic for 1,25(OH)2D3, and T. Delohery and P. Anderson for assistance with FACS sorting.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant DK45460 (to L.P.F.) and a predoctoral Cancer Research Institute grant (to T.P.S.-V.). Back

2 Address correspondence and reprint requests to Dr. Leonard P. Freedman, Cell Biology Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. E-mail address: l-freedman{at}ski.mskcc.org Back

3 Abbreviations used in this paper: 1,25(OH)2D3, 1,25-dihydroxyvitamin D3; VDR, vitamin D receptor; RXR, retinoid X receptor; EAE, experimental autoimmune encephalomyelitis; CD62L, CD62 ligand. Back

Received for publication August 2, 2001. Accepted for publication November 29, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mosmann, T. R., R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.[Medline]
  2. Wurster, A. L., T. Tanaka, M. J. Grusby. 2000. The biology of Stat4 and Stat6. Oncogene 19:2577.[Medline]
  3. Constant, S. L., K. Bottomly. 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15:297.[Medline]
  4. O’Garra, A.. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8:275.[Medline]
  5. Murphy, K. M., W. Ouyang, J. D. Farrar, J. Yang, S. Ranganath, H. Asnagli, M. Afkarian, T. L. Murphy. 2000. Signaling and transcription in T helper development. Annu. Rev. Immunol. 18:451.[Medline]
  6. Glimcher, L. H., K. M. Murphy. 2000. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14:1693.[Free Full Text]
  7. Moser, M., K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. 1:199.[Medline]
  8. Katamura, K., N. Shintaku, Y. Yamauchi, T. Fukui, Y. Ohshima, M. Mayumi, K. Furusho. 1995. Prostaglandin E2 at priming of naive CD4+ T cells inhibits acquisition of ability to produce IFN-{gamma} and IL-2, but not IL-4 and IL-5. J. Immunol. 155:4604.[Abstract]
  9. Demeure, C. E., L. P. Yang, C. Desjardins, P. Raynauld, G. Delespesse. 1997. Prostaglandin E2 primes naive T cells for the production of anti-inflammatory cytokines. Eur. J. Immunol. 27:3526.[Medline]
  10. Piccinni, M. P., M. G. Giudizi, R. Biagiotti, L. Beloni, L. Giannarini, S. Sampognaro, P. Parronchi, R. Manetti, F. Annunziato, C. Livi, et al 1995. Progesterone favors the development of human Th cells producing Th2-type cytokines and promotes both IL-4 production and membrane CD30 expression in established Th1 cell clones. J. Immunol. 155:128.[Abstract]
  11. Elenkov, I. J., G. P. Chrousos. 1999. Stress hormones, Th1/Th2 patterns, pro/anti-inflammatory cytokines and susceptibility to disease. Trends Endocrinol. Metab. 10:359.[Medline]
  12. Lemon, B. D., J. D. Fondell, L. P. Freedman. 1997. Retinoid X receptor:vitamin D3 receptor heterodimers promote stable preinitiation complex formation and direct 1,25-dihydroxyvitamin D3-dependent cell-free transcription. Mol. Cell. Biol. 17:1923.[Abstract]
  13. Lowe, K. E., A. C. Maiyar, A. W. Norman. 1992. Vitamin D-mediated gene expression. Crit. Rev. Eukaryotic Gene Expression 2:65.[Medline]
  14. Freedman, L. P.. 1997. Molecular Biology of Steroid and Nuclear Hormone Receptors Birkhouser, Boston.
  15. Kliewer, S. A., K. Umesono, D. J. Mangelsdorf, R. M. Evans. 1992. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355:446.[Medline]
  16. Lemon, B. D., L. P. Freedman. 1996. Selective effects of ligands on vitamin D3 receptor- and retinoid X receptor-mediated gene activation in vivo. Mol. Cell. Biol. 16:1006.[Abstract]
  17. Provvedini, D. M., C. D. Tsoukas, L. J. Deftos, S. C. Manolagas. 1983. 1,25-dihydroxyvitamin D3 receptors in human leukocytes. Science 221:1181.[Abstract/Free Full Text]
  18. Yu, X. P., H. Mocharla, F. G. Hustmyer, S. C. Manolagas. 1991. Vitamin D receptor expression in human lymphocytes: signal requirements and characterization by Western blots and DNA sequencing. J. Biol. Chem. 266:7588.[Abstract/Free Full Text]
  19. Veldman, C. M., M. T. Cantorna, H. F. DeLuca. 2000. Expression of 1,25-dihydroxyvitamin D3 receptor in the immune system. Arch. Biochem. Biophys. 374:334.[Medline]
  20. Lemire, J.. 1997. The role of vitamin D3 in immunosuppression: lessons from autoimmunity and transplantation. D. Feldman, and F. H. Glorieux, and J. W. Pike, eds. Vitamin D 1167. Academic, San Diego.
  21. O’Riordan, M. H. A. J.. 1997. Immunomodulatory and cell differentiation effects of vitamin D. D. Feldman, and F. H. Glorieux, and J. W. Pike, eds. Vitamin D 447. Academic, San Diego.
  22. Bromleigh, V. C., J. Ward, L. P. Freedman. 2001. Transcriptional targets of the vitamin D3 receptor during myeloid differentiation. K. Ravid, and J. R. Licht, eds. Transcription Factors: Normal and Malignant Development of Blood Cells 163. Wiley-Liss, New York.
  23. Penna, G., L. Adorini. 2000. 1{alpha},25-dihydroxyvitamin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation. J. Immunol. 164:2405.[Abstract/Free Full Text]
  24. Piemonti, L., P. Monti, M. Sironi, P. Fraticelli, B. E. Leone, E. Dal Cin, P. Allavena, V. Di Carlo. 2000. Vitamin D3 affects differentiation, maturation, and function of human monocyte-derived dendritic cells. J. Immunol. 164:4443.[Abstract/Free Full Text]
  25. Griffin, M. D., W. Lutz, V. A. Phan, L. A. Bachman, D. J. McKean, R. Kumar. 2001. Dendritic cell modulation by 1{alpha},25 dihydroxyvitamin D3 and its analogs: a vitamin D receptor-dependent pathway that promotes a persistent state of immaturity in vitro and in vivo. Proc. Natl. Acad. Sci. USA 98:6800.[Abstract/Free Full Text]
  26. Bhalla, A. K., E. P. Amento, B. Serog, L. H. Glimcher. 1984. 1,25-Dihydroxyvitamin D3 inhibits antigen-induced T cell activation. J. Immunol. 133:1748.[Abstract]
  27. Tsoukas, C. D., D. M. Provvedini, S. C. Manolagas. 1984. 1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone. Science 224:1438.[Abstract/Free Full Text]
  28. Rigby, W. F., T. Stacy, M. W. Fanger. 1984. Inhibition of T lymphocyte mitogenesis by 1,25-dihydroxyvitamin D3 (calcitriol). J. Clin. Invest. 74:1451.
  29. Alroy, I., T. L. Towers, L. P. Freedman. 1995. Transcriptional repression of the interleukin-2 gene by vitamin D3: direct inhibition of NFATp/AP-1 complex formation by a nuclear hormone receptor. Mol. Cell. Biol. 15:5789.[Abstract]
  30. Matsui, T., R. Takahashi, Y. Nakao, T. Koizumi, Y. Katakami, K. Mihara, T. Sugiyama, T. Fujita. 1986. 1,25-Dihydroxyvitamin D3-regulated expression of genes involved in human T-lymphocyte proliferation and differentiation. Cancer Res. 46:5827.[Abstract/Free Full Text]
  31. Rigby, W. F., S. Denome, M. W. Fanger. 1987. Regulation of lymphokine production and human T lymphocyte activation by 1,25-dihydroxyvitamin D3: specific inhibition at the level of messenger RNA. J. Clin. Invest. 79:1659.
  32. Reichel, H., H. P. Koeffler, A. Tobler, A. W. Norman. 1987. 1{alpha},25-Dihydroxyvitamin D3 inhibits {gamma}-interferon synthesis by normal human peripheral blood lymphocytes. Proc. Natl. Acad. Sci. USA 84:3385.[Abstract/Free Full Text]
  33. Lemire, J. M.. 1995. Immunomodulatory actions of 1,25-dihydroxyvitamin D3. J. Steroid Biochem. Mol. Biol. 53:599.[Medline]
  34. Tobler, A., J. Gasson, H. Reichel, A. W. Norman, H. P. Koeffler. 1987. Granulocyte-macrophage colony-stimulating factor: sensitive and receptor-mediated regulation by 1,25-dihydroxyvitamin D3 in normal human peripheral blood lymphocytes. J. Clin. Invest. 79:1700.
  35. Towers, T. L., L. P. Freedman. 1998. Granulocyte-macrophage colony-stimulating factor gene transcription is directly repressed by the vitamin D3 receptor: implications for allosteric influences on nuclear receptor structure and function by a DNA element. J. Biol. Chem. 273:10338.[Abstract/Free Full Text]
  36. Cippitelli, M., A. Santoni. 1998. Vitamin D3: a transcriptional modulator of the interferon-{gamma} gene. Eur. J. Immunol. 28:3017.[Medline]
  37. D’Ambrosio, D., M. Cippitelli, M. G. Cocciolo, D. Mazzeo, P. Di Lucia, R. Lang, F. Sinigaglia, P. Panina-Bordignon. 1998. Inhibition of IL-12 production by 1,25-dihydroxyvitamin D3: involvement of NF-{kappa}B downregulation in transcriptional repression of the p40 gene. J. Clin. Invest. 101:252.[Medline]
  38. Towers, T. L., T. P. Staeva, L. P. Freedman. 1999. A two-hit mechanism for vitamin D3-mediated transcriptional repression of the granulocyte-macrophage colony-stimulating factor gene: vitamin D receptor competes for DNA binding with NFAT1 and stabilizes c-Jun. Mol. Cell. Biol. 19:4191.[Abstract/Free Full Text]
  39. Takeuchi, A., G. S. Reddy, T. Kobayashi, T. Okano, J. Park, S. Sharma. 1998. NFAT as a molecular target for 1{alpha},25-dihydroxyvitamin D3-mediated effects. J. Immunol. 160:209.[Abstract/Free Full Text]
  40. Lemire, J. M., D. C. Archer, L. Beck, H. L. Spiegelberg. 1995. Immunosuppressive actions of 1,25-dihydroxyvitamin D3: preferential inhibition of Th1 functions. J. Nutr. 125:1704S.
  41. Mullen, A. C., F. A. High, A. S. Hutchins, H. W. Lee, A. V. Villarino, D. M. Livingston, A. L. Kung, N. Cereb, T. P. Yao, S. Y. Yang, S. L. Reiner. 2001. Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science 292:1907.[Abstract/Free Full Text]
  42. Reiner, S. L., S. Zheng, D. B. Corry, R. M. Locksley. 1993. Constructing polycompetitor cDNAs for quantitative PCR. [Published errata appear in 1994 J. Immunol. Methods 173:133 and 1994 J. Immunol. Methods 175:275.]. J. Immunol. Methods 165:37.[Medline]
  43. Liu, M., M. H. Lee, M. Cohen, M. Bommakanti, L. P. Freedman. 1996. Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937. Genes Dev. 10:142.[Abstract/Free Full Text]
  44. Rigby, W. F., R. J. Noelle, K. Krause, M. W. Fanger. 1985. The effects of 1,25-dihydroxyvitamin D3 on human T lymphocyte activation and proliferation: a cell cycle analysis. J. Immunol. 135:2279.[Abstract]
  45. Bird, J. J., D. R. Brown, A. C. Mullen, N. H. Moskowitz, M. A. Mahowald, J. R. Sider, T. F. Gajewski, C. R. Wang, S. L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229.[Medline]
  46. Lyons, A. B., C. R. Parish. 1994. Determination of lymphocyte division by flow cytometry. J. Immunol. Methods 171:131.[Medline]
  47. Wells, A. D., H. Gudmundsdottir, L. A. Turka. 1997. Following the fate of individual T cells throughout activation and clonal expansion: signals from T cell receptor and CD28 differentially regulate the induction and duration of a proliferative response. J. Clin. Invest. 100:3173.[Medline]
  48. Pintado, C. O., J. Carracedo, M. Rodriguez, R. Perez-Calderon, R. Ramirez. 1996. 1{alpha},25-dihydroxyvitamin D3 (calcitriol) induces apoptosis in stimulated T cells through an IL-2 dependent mechanism. Cytokine 8:342.[Medline]
  49. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[Medline]
  50. Zheng, W., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587.[Medline]
  51. Ho, I. C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  52. Rengarajan, J., S. J. Szabo, L. H. Glimcher. 2000. Transcriptional regulation of Th1/Th2 polarization. Immunol. Today 21:479.[Medline]
  53. Asnagli, H., K. M. Murphy. 2001. Stability and commitment in T helper cell development. Curr. Opin. Immunol. 13:242.[Medline]
  54. Szabo, S. J., J. S. Gold, T. L. Murphy, K. M. Murphy. 1993. Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc. Mol. Cell. Biol. 13:4793.[Abstract/Free Full Text]
  55. Lemire, J. M., D. C. Archer. 1991. 1,25-dihydroxyvitamin D3 prevents the in vivo induction of murine experimental autoimmune encephalomyelitis. J. Clin. Invest. 87:1103.
  56. Cantorna, M. T., C. E. Hayes, H. F. DeLuca. 1996. 1,25-Dihydroxyvitamin D3 reversibly blocks the progression of relapsing encephalomyelitis, a model of multiple sclerosis. Proc. Natl. Acad. Sci. USA 93:7861.[Abstract/Free Full Text]
  57. Cantorna, M. T., W. D. Woodward, C. E. Hayes, H. F. DeLuca. 1998. 1,25-dihydroxyvitamin D3 is a positive regulator for the two anti-encephalitogenic cytokines TGF-{beta}1 and IL-4. J. Immunol. 160:5314.[Abstract/Free Full Text]
  58. Mattner, F., S. Smiroldo, F. Galbiati, M. Muller, P. Di Lucia, P. L. Poliani, G. Martino, P. Panina-Bordignon, L. Adorini. 2000. Inhibition of Th1 development and treatment of chronic-relapsing experimental allergic encephalomyelitis by a non-hypercalcemic analogue of 1,25-dihydroxyvitamin D3. Eur. J. Immunol. 30:498.[Medline]
  59. Boonstra, A., F. J. Barrat, C. Crain, V. L. Heath, H. F. J. Savelkoul, A. O’Garra. 2001. 1{alpha},25-Dihydroxyvitamin D3 has a direct effect on naive CD4+ T cells to enhance the development of Th2 cells. J. Immunol. 167:4974.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
NDT PlusHome page
C.-C. Szeto and P. K.-T. Li
The use of vitamin D analogues in chronic kidney diseases: possible mechanisms beyond bone and mineral metabolism
NDT Plus, June 1, 2009; 2(3): 205 - 212.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Tang, R. Zhou, D. Luger, W. Zhu, P. B. Silver, R. S. Grajewski, S.-B. Su, C.-C. Chan, L. Adorini, and R. R. Caspi
Calcitriol Suppresses Antiretinal Autoimmunity through Inhibitory Effects on the Th17 Effector Response
J. Immunol., April 15, 2009; 182(8): 4624 - 4632.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
R. Bouillon, G. Carmeliet, L. Verlinden, E. van Etten, A. Verstuyf, H. F. Luderer, L. Lieben, C. Mathieu, and M. Demay
Vitamin D and Human Health: Lessons from Vitamin D Receptor Null Mice
Endocr. Rev., October 1, 2008; 29(6): 726 - 776.
[Abstract] [Full Text] [PDF]


Home page
Arch Intern MedHome page
C. P. Kovesdy, S. Ahmadzadeh, J. E. Anderson, and K. Kalantar-Zadeh
Association of Activated Vitamin D Treatment and Mortality in Chronic Kidney Disease
Arch Intern Med, February 25, 2008; 168(4): 397 - 403.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
M. Cutolo and K. Otsa
Review: Vitamin D, immunity and lupus
Lupus, January 1, 2008; 17(1): 6 - 10.
[Abstract] [PDF]


Home page
Ann Rheum DisHome page
Y. Arnson, H. Amital, and Y. Shoenfeld
Vitamin D and autoimmunity: new aetiological and therapeutic considerations
Ann Rheum Dis, September 1, 2007; 66(9): 1137 - 1142.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. Baroni, M. Biffi, F. Benigni, A. Monno, D. Carlucci, G. Carmeliet, R. Bouillon, and D. D'Ambrosio
VDR-dependent regulation of mast cell maturation mediated by 1,25-dihydroxyvitamin D3
J. Leukoc. Biol., January 1, 2007; 81(1): 250 - 262.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Daniel, H. H. Radeke, N. A. Sartory, N. Zahn, U. Zuegel, A. Steinmeyer, and J. Stein
The New Low Calcemic Vitamin D Analog 22-Ene-25-Oxa-Vitamin D Prominently Ameliorates T Helper Cell Type 1-Mediated Colitis in Mice
J. Pharmacol. Exp. Ther., November 1, 2006; 319(2): 622 - 631.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. A. Fretz, L. A. Zella, S. Kim, N. K. Shevde, and J. W. Pike
1,25-Dihydroxyvitamin D3 Regulates the Expression of Low-Density Lipoprotein Receptor-Related Protein 5 via Deoxyribonucleic Acid Sequence Elements Located Downstream of the Start Site of Transcription
Mol. Endocrinol., September 1, 2006; 20(9): 2215 - 2230.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Chen, M. T. Cencioni, D. F. Angelini, G. Borsellino, L. Battistini, and C. F. Brosnan
Transcriptional Profiling of {gamma}{delta} T Cells Identifies a Role for Vitamin D in the Immunoregulation of the V{gamma}9V{delta}2 Response to Phosphate-Containing Ligands
J. Immunol., May 15, 2005; 174(10): 6144 - 6152.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
J. E. Murase, K. K. Chan, T. J. Garite, D. M. Cooper, and G. D. Weinstein
Hormonal Effect on Psoriasis in Pregnancy and Post Partum
Arch Dermatol, May 1, 2005; 141(5): 601 - 606.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. T. Cantorna and B. D. Mahon
Mounting Evidence for Vitamin D as an Environmental Factor Affecting Autoimmune Disease Prevalence
Experimental Biology and Medicine, December 1, 2004; 229(11): 1136 - 1142.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
S. G. Rhodes, L. A. Terry, J. Hope, R. G. Hewinson, and H. M. Vordermeier
1,25-Dihydroxyvitamin D3 and Development of Tuberculosis in Cattle
Clin. Vaccine Immunol., November 1, 2003; 10(6): 1129 - 1135.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Gurlek, M. R. Pittelkow, and R. Kumar
Modulation of Growth Factor/Cytokine Synthesis and Signaling by 1{alpha},25-Dihydroxyvitamin D3: Implications in Cell Growth and Differentiation
Endocr. Rev., December 1, 2002; 23(6): 763 - 786.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Staeva-Vieira, T. P.
Right arrow Articles by Freedman, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Staeva-Vieira, T. P.
Right arrow Articles by Freedman, L. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS