| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Schering-Plough Laboratory for Immunological Research, Dardilly, France;
Institut National de la Santé et de la Recherche Médicale Unité 346, Centre Hospitalier Edouard Herriot, Lyon, France;
Institut National de la Santé et de la Recherche Médicale Unité 491, Faculté de Médecine, Marseille, France;
Centre d’Immunologie, Institut National de la Santé et de la Recherche Médicale-Centre National de la Recherche Scientifique, Marseille, France;
¶ Department of Dermatology, University of Innsbruck, Innsbruck, Austria
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Notably, dendritic cells in thymic medulla are
mLangerin-positive. By contrast, only scattered cells express mLangerin
in lymph nodes and spleen. mLangerin mRNA is also detected in some
nonlymphoid tissues (e.g., lung, liver, and heart). Similarly to
hLangerin, a network of BG form upon transfection of mLangerin cDNA
into fibroblasts. Interestingly, substitution of a conserved residue
(Phe244 to Leu) within the carbohydrate recognition domain
transforms the BG in transfectant cells into structures resembling
cored tubules, previously described in mouse LC. Our findings should
facilitate further characterization of mouse LC, and provide insight
into a plasticity of dendritic cell organelles which may have important
functional consequences. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The DC system is continuously being defined both in human and mouse,
and numerous subsets of DC with distinct phenotype and function have
been described. The finding that murine thymic DC expressing CD8
derive from a CD4low lymphoid progenitor has led
to definition of the lymphoid DC lineage (8). It has
recently been proposed that mouse LC originate from a
lymphoid-committed progenitor on the basis of CD8 expression
(9, 10). However, to date, CD8 has not been observed on
human DC. Furthermore, CD1a, which represents a marker of human LC, is
absent in the mouse. These examples illustrate the difficulties of
translating functional findings between human and mouse DC subsets,
which is key to optimizing preclinical models. In this work, we
describe the identification of mouse (m)Langerin/CD207. The molecule
displays functional features similar to the human counterpart and
should be highly valuable for studying mouse LC. In addition, whereas
wild-type mLangerin induces BG, a single amino acid substitution in the
extracellular carbohydrate recognition domain (CRD) results in
different cytoplasmic structures as observed by electron microscopy.
This finding suggests that different organelles may form in LC
depending on Langerin conformation and ligand interaction with the
sugar-binding region.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mice of inbred strains C57BL/6 and BALB/c were purchased from
Charles River Breeding Laboratories, Iffa-Credo (L’Arbresle, France),
and used at 8–12 wk of age. All experiments involving mice were
conducted according to institutional guidelines and all cell types were
cultured in RPMI 1640 (Life Technologies, Gaithersburg, MD)
supplemented with 10% (v/v) heat-inactivated FBS (Flow Laboratories,
Irvine, U.K.), 2 mM L-glutamine, 5 x
10-5 M 2-ME (Sigma-Aldrich, St. Louis, MO), and
gentamicin (Schering-Plough, Kenilworth, NJ) (hereafter referred to as
complete medium). Culture supernatant of a cell line transfected with
the mouse GM-CSF gene (kind gift of A. Lanzavecchia, Belinzona,
Switzerland) was used as a source for this cytokine (0.5% v/v), and
human TGF-1 (specific activity 1–2 x
107 U/mg) was purchased from Strathmann Biotech
(Hamburg, Germany). Transfections were performed with the murine
fibroblastic COP5 cell line (11) as described
(7).
Identification of mLangerin cDNA and cloning
Bioinformatics searches were performed in GenBank EST databases. Two expressed sequence tags (ESTs) were used for PCR amplification of cDNA from a mouse lung cDNA library (Clontech Laboratories, Palo Alto, CA) using the RACE marathon kit (Clontech Laboratories). Primer sequences were for the 5' RACE (GSP1, TTGGAGCCTCAGGGAGAGAGACAT; and NGSP1, GTTGTTCCCTGCGTTGTTGGGTTC), and for the 3' RACE (GSP2, GGAGAATGTCAACAAGCTGCTCAA; and NGSP2,AAAGCTCACCTGACCTCAGTGTCC). PCR products were cloned in the PCRII TOPO plasmid (Invitrogen, San Diego, CA) and double-stranded plasmid DNA was sequenced on an ABI 373A sequencer (Applied Biosystems, Foster City, CA) using dye terminator technology. Sequencher (Gene Codes, Ann Arbor, MI) and Lasergene (DNAstar, London, U.K.) software was used to analyze sequences. Comparisons against GenBank databases were made using the basic local alignment search tool (BLAST) algorithm. Construction of Langerin-mutated forms was performed with the Gene Editor in vitro Site-Directed Mutagenesis kit (Promega, Madison, WI), according to instruction guidelines and using wild-type Langerin cDNAs as templates and the mutated oligonucleotides 5'-ATCTCCCTCTGGATCCGAGAGCCTCCT (hLangerin WPREPP to WIREPP) and 5'-GAACAAAAGTTACTCTACAAG (mLangerinQKFLYK to QKLLYK).
Northern and Southern analysis
Northern analysis was performed with Multiple Tissue Northern
blots prepared from high-quality poly(A)+ RNA
normalized for a -actin hybridization signal (Clontech Laboratories,
catalog no. 7762-1 and 7763-1), as described (12). For
Southern analysis, DNA (5 µg) from primary amplified cDNA libraries
constructed in our laboratory was digested with NotI and
SalI (Boehringer Mannheim, Indianapolis, IN) to release the
inserts, run on a 1% agarose gel, and transferred to a nylon membrane
(Schleicher and Schuell, Keene, NH). Hybridization was conducted using
a PCR-generated probe labeled with [32P]dCTP
using the High Prime kit (Boehringer Mannheim, Meylan, France).
Unincorporated nucleotides were removed by spin column chromatography
(Chromaspin-100; Clontech Laboratories). Hybridization and washes were
performed in stringent conditions (0.1x SSC/0.1% SDS at 65°C).
Membranes were exposed for 21 days using Biomax MR film (Kodak,
Rochester, NY). Characteristics (number of independent
clones/percentage of clones with inserts) of the cDNA libraries used
were as follows: wild-type thymus, 6.6 x
106/43%; rag-1-/-
thymus, 3.9 x 106/85%; pancreas, 2.2
x 108/97%; skin, 1.4 x
107/90%; spinal cord, 4.4 x
107/95%; spleen, 1.1 x
108/72%; lung, 3.7 x
106/85%; stomach, 4.0 x
106/73%; Peyer’s patch, 8 x
106/72%; mesenteric lymph node, 5.8 x
106/83%; and colon, 5.4 x
106/90%.
Genomic organization and chromosomal localization of Langerin genes
A 900-bp EcoRI fragment of mLangerin cDNA was used as a probe to hybridize a 129/Ola mouse spleen genomic cosmid 121 library (Resource Center/Primary Database, Max Planck Institute for Molecular Genetics, Heidelberg, Germany). Hybridization was performed as described (13), and positive clones were selected and sequenced. Seven overlapping cosmid clones were found to be positive for the Langerin gene, as follows: MPMGc121BO4216Q2, MPMGc 121A22222Q2, MPMGc121F01387Q2, MPMGc121K20580Q2, MPMGc 121D19640Q2, MPMGc121K20694Q2, and MPMGc121HO2719Q2. One cosmid was used for fluorescence in situ hybridization (FISH) mapping of the mouse gene as described (14). The organization of the hLangerin gene was obtained by BLAST nucleotide using the GenBank high throughput genomic database. Chromosomal localization of the hLangerin gene was performed with the Stanford G3 RH medium resolution panel (Research Genetics, Huntsville, AL), using PCR with oligonucleotides that amplify an 850-bp fragment specific for the hLangerin gene (forward, 5'-ACGCCATTCAACAAGGTC; reverse, 5'-CAGCCAAGACAGACGGACTC). The result was scored manually and analysis was performed with the RHmapper program (http://shgc-www.stanford.edu).
Generation of Abs against mLangerin
mAbs were produced by immunizing BALB/c mice with three i.p. injections of lysate of COP5 cells transfected with mLangerin cDNA. Spleens were removed 3 days after a final i.v. injection and splenocytes were fused with SP2/0 cells using polyethylene glycol-1000 and cultured in 96-well plates using standard procedures. Hybridoma supernatants were screened for reactivity against mLangerin transfected vs nontransfected cells. After cloning of selected hybridomas, mAbs were produced as ascites fluids and purified. Data presented were obtained with mAb HD24 (306.G9) of IgG1 isotype. Polyclonal Ab was obtained by immunizing rabbits with mLangerin peptides followed by purification from antiserum using affinity chromatography (CovalAb, Oullins, France).
Biochemistry
COP5 fibroblastic cells transfected with mLangerin cDNA were washed three times with ice-cold PBS, pH 8 and then treated in a lysis buffer containing 50 mM Tris-HCl, pH 8, 1% Nonidet P-40, 150 mM NaCl, and protease inhibitors (Boehringer Mannheim). Lysates were incubated at 4°C for 20 min, and insoluble material was pelleted by centrifugation at 12,000 x g for 10 min at 4°C. Soluble extracts were precleared three times with control mAb and protein G-agarose (Boehringer Mannheim). The extract was then incubated with mAb HD24 for 1 h before adding protein G-agarose for 3 h. Beads were washed three times in lysis buffer, resuspended in SDS-PAGE sample buffer with or without 5% 2-ME, boiled for 3 min, and centrifuged. Immunoprecipitates were separated by SDS-PAGE using 12% polyacrylamide gel and then transferred to a polyvinylidene difluoride membrane (Immobilon P; Millipore, Bedford, MA). Blots were blocked with 1% BSA and 0.1% Tween 20 in PBS, then incubated with HRP-conjugated mAb HD24 for 30 min. Proteins were detected by ECL (Boehringer Mannheim).
Epidermal sheets, epidermal cell suspensions, and bone marrow-derived dendritic cells
Epidermis from ear skin was separated from dermis by means of
ammoniumthiocyanate (15). Resulting sheets were fixed in
acetone for 20 min at room temperature and rinsed in several changes of
PBS and PBS containing 1% BSA. They were then subjected to an
immunolabeling procedure as described (16). Bone
marrow-derived DC were generated essentially as described by Inaba et
al. (17), in the presence of GM-CSF supplemented or not
with TGF-1. Cultures were analyzed on acetone-fixed cytospins on
days 6, 8, 10, 13, and 19 of culture.
Immunohistochemistry and cytofluorometry
For immunohistochemistry of sheets and cytospins, the following mAbs were used: mouse IgG1 anti-mLangerin, clone HD24 (used at final concentrations of 1–2 µg/ml), mouse anti-I-Ek,d (clone 14-4-4S/HB32, mouse IgG2a, American Type Culture Collection, Manassas, VA), anti-I-Adiverse (clone 2G9, fluoresceinated, BD PharMingen, San Diego, CA) and control mouse IgG1 (DAKO, Glostrup, Denmark) used at 5–10 µg/ml. Staining was visualized by immunofluorescence using species-specific biotinylated anti-mouse Ig (Amersham, Little Chalfont, U.K.) followed by streptavidin-FITC (Amersham). For double-labeling, streptavidin-Texas Red (Amersham) was used (instead of streptavidin-FITC), followed by rat Ig (100 µg/ml) for blocking residual binding sites of preceding Abs, and FITC-conjugated anti-MHC class II mAb 2G9. Immunolabeled specimens were mounted in Vectashield (Vector Laboratories, Burlingame, CA) and viewed on a conventional fluorescence microscope (Olympus, Melville, NY).
For immunohistology, microscope slides of acetone-fixed cryocut mouse tissue sections were incubated with polyclonal anti-mLangerin for 60 min, subsequently with biotinylated goat anti-rabbit Ig (Vector Laboratories) for 30 min, and finally with streptavidin coupled to peroxidase (Sigma-Aldrich) for 30 min. Anti-DEC205 mAb (BMA, Bubendorf, Switzerland) was revealed with peroxidase-conjugated affinity purified goat anti-rat IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). Enzyme activity was developed using 3-amino-9 ethylcarbazol high sensitivity (DAKO) and slides were counterstained with Harris hematoxylin (Sigma-Aldrich).
Flow cytometric analysis on COP5 fibroblasts was performed on a FACSCalibur (BD Biosciences, Mountain View, CA), following staining with 10 µg/ml anti-mLangerin mAb HD24 or anti-hLangerin mAb (DCGM4) (18) revealed by PE- or FITC-conjugated F(ab')2 goat anti-mouse Ig (DAKO). Nonspecific staining was determined using isotype-matched control mAb and all procedures were performed in the presence of 0.5 mM EDTA to avoid cell aggregation. Intracytoplasmic staining was performed in saponin (0.1% v/v).
Electron microscopy
Staining was performed as described (18). Briefly, COP5 transfected with mLangerin cDNA were fixed for 18 h with 2% glutaraldehyde in cacodylate buffer, followed by washing for at least 24 h in cacodylate buffer with sucrose. Samples were postfixed for 1 h with 1% osmium in cacodylate buffer with sucrose, dehydrated, and embedded in epoxy resin. Ultrathin sections were poststained with uranyl acetate and lead citrate and examined on a JEOL 1200 EX electron microscope (JEOL, Tokyo, Japan) (7).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Public databases were screened using a translated BLAST nucleotide
algorithm with the amino acid sequence of hLangerin/CD207 as query. Two
mouse EST (AA76540 and AA423304) were identified and this sequence used
in a 3' and 5' RACE PCR on a mouse lung cDNA library. A 1486-bp cDNA
sequence was isolated, containing a 981-bp open reading frame (ORF) but
lacking a start methionine. Using this cDNA as a probe, two cosmid
clones were isolated and sequenced. Upstream of the 5' end of the cDNA
sequence, a potential initiation site (YCANTYY) followed by two
methionines was identified. Thus, we isolated a 1565-bp full-length
cDNA sequence encoding mLangerin/CD207 (accession no. AJ302711). It
contains a 58-bp 5' untranslated region, a 993-bp ORF, a 3'
untranslated region of 514 nt, and an AATAAA polyadenylation signal at
position 1511 bp. The ORF predicts a novel polypeptide of 331 aa (Fig. 1
A), with a molecular mass of
37.5 kDa. As described for hLangerin, the presence of a hydrophobic
signal anchor (residues 47–67) indicates a type-II transmembrane
protein. mLangerin belongs to the Ca2+-dependent
(C-type) lectin family with a single CRD (Fig. 1A) featuring
a glutamate-proline-asparagine motif (residues 288–290), predicting
mannose-type specificity (19). Two potential
N-glycosylation sites are present at positions 90–92 and
116–118 aa. mLangerin contains an intracellular domain of 46 aa with a
proline-rich motif (PREPPP) as potential signal-transduction site
(20, 21). mLangerin displays 66% overall amino acid
sequence identity with its human counterpart (Fig. 1B).
|
).
|
A genomic cosmid library from mouse spleen was hybridized by using
the ESTs of mLangerin cDNA as a probe. Positive clones were propagated,
digested, and hybridized to identify cosmids containing the entire
mLangerin gene. Two cosmid clones of 
40 kbp were used for subcloning
and direct sequencing. The mLangerin gene spans 6.7 kbp and
consists of six exons varying in length between 117 and 624 bp (Fig. 3, A and B)
(accession no. AJ313164) The first exon encodes half of the
intracytoplasmic domain, the second exon encodes the end of the
intracytoplasmic domain and the transmembrane domain, the third exon
encodes the long neck domain, and three exons encode the CRD. Notably,
the proline-rich motif is encoded by two exons. The size of the five
introns is highly variable, ranging from 92 to 1.4 kbp (intron 4).
Using FISH, the mLangerin gene was mapped to chromosome 6D (Fig. 3C).
|
, A and B). For human and mouse
Langerin all introns (except the first one) use consensus
GT-AG type-II splice sites (27, 28), indicating that some
form of transcriptional control may regulate these genes. Computer
analysis of the upstream regions of the human and mouse
Langerin genes revealed that these sequences do not contain
consensus promoter elements. However, regions of homology between the
two genes may delineate binding sites for novel LC-specific
transcription factors and thus explain the extremely restricted
expression of these genes. Finally, by radiation hybrid mapping, the
hLangerin gene was assigned to chromosome 2p13 syntenic to
the localization of the mouse gene (data not shown). Distribution of mLangerin/CD207 mRNA
By Northern blot analysis, a unique band at the expected size of
2.0 kb was observed in spleen, lung, liver, and heart (Fig. 4A). Southern blot analysis of
cDNA libraries from various mouse tissues (Fig. 4B)
indicated the predominant presence of mLangerin mRNA in skin, in
accordance with the previously reported expression of hLangerin
(18). Consistent with Northern blot analysis, a signal was
also detected in spleen and lung. In addition, mLangerin mRNA was found
in mesenteric lymph node and thymus, where it was markedly enhanced in
Rag1-/- mice (Fig. 4B). In contrast
to the above findings, a number of tissues did not reveal mLangerin
mRNA (Fig. 4). These results indicate that mLangerin mRNA is mostly
expressed in skin and hematopoietic tissues but is also detectable in
lung, liver, and heart.
|
By immunization of BALB/c mice with a murine cell line (COP5)
transfected with mLangerin cDNA, we obtained a panel of mAbs against
mLangerin (scoring selectively positive on the mLangerin transfectant
vs mock-transfected cells). One mAb, named HD24 (clone 306G9, IgG1),
was chosen for further studies. Immunoprecipitation revealed that HD24
mAb selectively recognizes a glycoprotein of 48 kDa in
mLangerin-transfected COP5 cells, in accordance with the molecular mass
predicted from the amino-acid sequence (Fig. 5A). Flow cytometric analysis
on transfectants obtained with different constructs of mouse and human
Langerin demonstrated that mAb HD24 cross-reacts with hLangerin and is
directed against an intracellular epitope containing the proline-rich
motif as reactivity is abolished following a site-directed mutation of
WPREPP to WIREPP (Fig. 5B).
|
Because hLangerin is selectively expressed by LC, we first
performed immunohistology on mouse skin sections. Expression of
mLangerin was observed by cells with LC morphology in the epidermis but
not by cells in the dermis (Fig. 6A). As shown in Fig. 6B, bright staining was obtained on ear epidermal sheets of
BALB/c (n > 3), C57BL/6 (n = 2), and
129 (n = 1) mice. Staining was highly specific to the
LC, and keratinocytes were completely negative. Under the
fluorescence microscope, Langerin expression was visible as granules
scattered internally throughout the cell, and no staining was observed
on the cell surface. The granules were found even in the most distant
parts of the dendrites where MHC class II molecules were too sparse to
be visualized (Fig. 6B). Finally, this double-labeling
revealed that virtually all LC (as identified by their MHC class II
expression) were also Langerin positive. Inversely, all
Langerin-positive cells were MHC class II positive, emphasizing the
specificity of the Ab. In corresponding dermal sheets we observed only
very few Langerin-positive cells, presumably LC in transit (data not
shown).
|
, C and E), localized by a serial
staining with DEC205 (Fig. 6D;
DEC205low areas). The
Langerin+ cells in the medulla had a
characteristic dendritic morphology (Fig. 6E). Some
Langerin+ cells, with characteristic dendritic
morphology, were occasionally found in the cortex (Fig. 6F).
In spleen (Fig. 6G) and lymph node (Fig. 6H),
only few Langerin+ cells were observed in
perifollicular areas, expected to be marginal DC or interdigitating
cells, as some of them possess dendrites. We never observed
Langerin+ cells in germinal centers. Taken
together, mLangerin is expressed by LC and a subset of DC in lymphoid
tissues including thymic medulla.
mLangerin/CD207 is expressed in bone marrow cultures
supplemented with TGF-
DC can be obtained from mouse bone marrow progenitor
cells in culture with GM-CSF (17). By FACS analysis of
such permeabilized bone marrow-derived DC, only very weak if any
Langerin staining could be detected. Indeed, inspection of cytospins
from standard cultures in the presence of GM-CSF revealed only a very
small number (1% of all cells) of brightly Langerin-positive
cells (data not shown). TGF- is a cytokine known to promote the
differentiation of LC (29). When TGF- was added to the
cultures (at both 0.5 and 5 ng/ml), the number of Langerin-positive
cells increased up to nearly 10% (Fig. 7). Of note, Langerin-expressing cells
occurred preferably in cell aggregates. No obvious differences in the
percentages of Langerin-positive cells were noted between various time
points (day 6, 8, 10, 13, and 19).
|
and decreased by the LC maturation process. Transfection of mLangerin/CD207 cDNA induces BG, whereas a Phe244 to Leu replacement induces structures resembling cored tubules
Because transfection of hLangerin cDNA induced the formation of BG
in fibroblasts (7), we analyzed by electron microscopy
COP5 mouse fibroblasts transfected with mLangerin cDNA. In a manner
reminiscent of hLangerin, COP5 cells transfected with the murine cDNA
massively accumulated pentalamellar membranes with a central zippering
typical of BG (Fig. 8, Langerin
wild-type). Furthermore, a truncated hLangerin cDNA construct entirely
devoid of the C-type lectin domain (CRD) did not induce BG or any
detectable organelles in COP5 fibroblasts (data not shown). On this
basis, we explored whether modifications within the CRD would have an
impact on BG formation. We isolated a cDNA clone of mLangerin that
displays a leucine at position 244 instead of the phenylalanine that is
conserved in the CRD of type-II lectins (e.g., KCR, ASGPR) (F at
position 48 in the CRDs depicted in Fig. 2). Strikingly, transfection
of the mutated mLangerin cDNA resulted in accumulation of superimposed
and thickened membranes clearly different from typical BG (Fig. 8, Langerin Leu244). Reminiscent structures,
referred to as cored tubules, have been described in mouse LC and
related cells (31). No cytoplasmic structures were
observed in mock-transfected COP5 cells (Fig. 8, control). Our findings
demonstrate that mLangerin/CD207 induces BG formation, and that its
lectin domain is highly plastic relative to the pattern of membrane
superimposed structures that can be created.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The closest related lectin to mLangerin/CD207 is the murine KCR, expressed in the liver and also functioning as an endocytic receptor, although no BG-like structures have been demonstrated in Kupffer cells (32, 33). The phylogenetic tree determined from amino-acid sequences indicates that Langerin and the KCR belong to a subgroup of type-II proteins within the C-type lectin superfamily. This particular relationship is further emphasized by the fact that, as described for the rat KCR (28), the neck domain preceding the CRD of Langerin is encoded by a single exon. However, the KCR possesses an extra exon between the transmembrane and neck domains that can be explained by exon shuffling known to occur in other C-type lectins (34). It remains to be established whether Langerin and the KCR arose from duplication of an ancestral gene, because neither the human KCR nor the chromosomal localization of the mouse KCR is known.
In addition to the mouse and human Langerin and the
KCR genes, the structure of several other genes that encode
type-II C-type lectins has been determined. These include the hepatic
H1 and H2 ASGPR (35), the
low-affinity IgE receptor CD23 (36), and the
HIV-binding lectins dendritic cell-specific ICAM-3-grabbing nonintegrin
(DC-SIGN) and DC-SIGNR (37).
Similarly to Langerin, the CRD of the above genes are
encoded by three exons whose exon-intron boundaries are highly
conserved. In addition, the insertion of a neck domain sequence between
the transmembrane and CRD regions is the hallmark of a subfamily of the
C-type lectins (38). The neck domain of Langerin features
a characteristic heptad repeat producing an -helical coiled-coil
stalk (38). Heptad repeats are important for
dimerization/oligomerization, as illustrated for CD23 (39, 40) and the H1 and H2 subunits of the hepatic ASGPR
(41). This raises the possibility that Langerin occurs as
a dimer/oligomer, although we have no experimental evidence supporting
this hypothesis.
The gene encoding mLangerin maps to chromosome 6D, in a region syntenic to the hLangerin gene on chromosome 2p13. The Langerin genes do not belong to any of the known C-type lectin gene clusters, such as the human DC-SIGN and CD23 genes (chromosome 19p13) (37), the human ASGPR (chromosome 17p11-13) (42), and the human NKR complex (chromosome 12p13-p12) (43). However, due to their particularly close relationship the KCR genes may turn out to cluster with Langerin.
One of the characteristic features of DC is the expression of many C-type lectins. DC express endocytic receptors for capturing exogenous carbohydrate-bearing material for pathogen recognition and Ag routing. Endocytic receptors are exemplified by the type-I lectin DEC205 (44, 45) and the type-II human lectins Langerin (18) and DC-SIGN, which sequesters HIV through binding to gp120 (46). However, a given lectin may have more than one function, as demonstrated for DC-SIGN, which binds ICAM-3 and ICAM-2 and thus has an impact on DC/T cell interactions and DC migration (47, 48). In addition, type-II lectins such as DCIR (49) and dectin-1 (50) contain intracellular immunoreceptor sequences predictive of a role in inhibition or activation of DC function. Consequently, it is an important issue to determine whether multiple function is a general feature of DC lectins and whether lectins on a given DC subset have overlapping functions.
Langerin is abundantly expressed by mouse epidermal LC, both at mRNA
and protein levels. Using mAb HD24, Langerin could not be detected in
other epidermal cells, and could only be detected in scattered DC in
the dermis. Langerin should thus be a highly useful molecular marker
for identification and functional studies of mouse LC. This has been
particularly hampered by paucity of reagents, because the mouse lacks
CD1a, a useful marker of human LC. Mouse LC do express DEC205, but this
molecule is also widely expressed by mature DC in lymphoid tissue
(45). The coexpression of DEC205 and Langerin on mouse LC
raises the possibility of some shared function on this DC subset.
Langerin is down-regulated upon culture of mouse epidermal LC (data not
shown), in line with the notion that it represents a feature of
immature cells. Decreased expression of Langerin agrees with earlier
observations describing the maturation of mouse LC in culture resulting
in disappearance of BG (30). Scattered
Langerin+ cells are observed in lymph nodes and
spleen. Langerin+CD11c+
cells expressing high levels of DEC205 are particularly conspicuous in
skin-draining lymph nodes, where they represent a mature form of LC
immigrated from the epidermis (51).
mLangerin+ cells in spleen have recently been
shown to represent
CD11c+CD8+ DC (K. Inaba,
personal communication). Langerin is also present on DC within the
mouse thymic medulla. This finding warrants several comments and
questions. First, the possibility that Langerin+
thymic DC and LC have a common origin. Mouse thymic DC, which include a
major CD8+ subset (52), are
essentially of lymphoid origin (8). Recently,
lymphoid-committed CD4low precursors were shown
to generate LC upon adoptive transfer (9). Although CD8
is not a marker of lymphoid origin (53), it is striking
that mouse LC can be induced to express this marker (9, 10). Second, the expression of Langerin by thymic DC is
consistent with the description of BG in these cells, in both mouse
(54) and human (55). Third, the presence of
Langerin on thymic DC opens the interesting perspective that Langerin
may play a role in T cell selection, possibly by endocytosis of
self-derived mannosylated Ags. The fact that DEC205 is also expressed
by thymic DC (52) further points to overlapping function
between these two lectins. In addition to skin, mLangerin mRNA is
detected in some nonlymphoid organs. In particular, lung tissue was
positive, similar to the expression of hLangerin in epithelium lining
the human airways (18). The significance of mLangerin mRNA
in liver and heart remains to be explored.
A subset (<10%) of Langerin+ cells was
generated in cultures of mouse bone marrow in the presence of GM-CSF
and TGF-1. The role of TGF- in expanding the
Langerin+ subset is in line with the effects of
this cytokine in up-regulation of hLangerin in human LC cultures
(18) and its critical function in mouse LC development
(29, 56). Langerin should be a highly useful marker to
optimize conditions for in vitro generation of mouse LC that is
currently a limitation to functional studies on this cell
type.
Mouse and human Langerin share the capacity to induce the
formation of pentalamellar membranes typical of BG. This property is
conserved through evolution and emphasizes the potential importance of
the molecule in LC function. Although introduction of Langerin
cDNA does not create "tennis racket" structures sometimes observed
in LC, it should be noted that these particular structures likely
represent only a minority of the BG, probably resulting from fusion
with endocytic vesicles that is not likely to occur in the transfected
fibroblasts because most of the Langerin molecules will superimpose
before reaching the cytomembrane. The prediction of our previous
(7) and present findings is that Langerin plays a
particular role in endocytosis of foreign Ags (e.g., mannosylated
microorganisms) in the periphery, and of self Ags in the thymus.
Routing of Ag into BG could represent the feature of a distinctive DC
sublineage found in epidermis, stratified epithelia, and thymus. It
would be of interest to examine the BG-inducing potential of other
lectins (e.g., CD23, DEC205) expressed by the same cells.
Deletion of the entire lectin domain of Langerin totally
abolished the membrane superimposition effect in transfectants,
emphasizing the role of carbohydrate ligand binding in BG
formation. However, the nature of the physiological ligand(s) of
Langerin remains to be determined. Strikingly, replacement of the
highly conserved F244 by L in the 2 helix of the mLangerin CRD
abrogated formation of the rod-shaped zippered membrane
superimpositions typical of BG. The L244 form of mLangerin gave rise to
structures reminiscent of cored tubules described in mouse LC-type
cells (57, 58). As viewed by electron microscopy, cored
tubules do have an inner central line, but their structure is different
from the disc-shaped BG. Cored tubules have been observed in mouse LC
and related cells (31), although their relationship with
BG is unknown. We propose that the relationship between these different
organelles is determined by the conformation of Langerin. Replacement
of F244 by L, both hydrophobic residues, is not expected to disrupt the
2 helix of the Langerin CRD (59). Rather, a
three-dimensional model using the recently determined crystal structure
of the H1 subunit of the ASGPR (60) indicates that absence
of the aromatic ring of F244 is likely to abolish its interaction with
the parallel and tightly juxtaposed aromatic ring of F205. The
substitution of F244 with L may thus open the hydrophobic pocket in
this region of the CRD, thus contributing to a change in the domain
associated with receptor multimerization or with ligand binding. It has
been suggested that CRD sequences flanking the coiled-coil stalk may
also contribute to C-type lectin subunit assembly (41).
The transition from BG to cored tubules could thus be a consequence of
altered conformation of the receptor-ligand complex. However, it
remains to be determined whether the F244 to L substitution mimics a
conformation change that occurs naturally in Langerin as a result of
interaction with particular types of ligands.
In summary, our present findings identify mouse Langerin/CD207, which should be a useful molecule both as a marker and for functional studies of mouse LC and related cells. In addition, we have demonstrated a plasticity of the types of organelles that can form in DC, and that may have important consequences for the function of these cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sem Saeland, Schering-Plough Laboratory for Immunological Research, 27 chemin des Peupliers, 69571 Dardilly Cedex, France. E-mail address: Sem.Saeland{at}spcorp.com
3 Abbreviations used in this paper: DC, dendritic cell; CRD, carbohydrate recognition domain; BG, Birbeck granule; LC, Langerhans cell; KCR, Kupffer cell receptor; m, mouse; h, human; FISH, fluorescence in situ hybridization; EST, expressed sequence tag; BLAST, basic local alignment search tool; DC-SIGN, dendritic cell-specific ICAM-3-grabbing nonintegrin; ORF, open reading frame; ASGPR, asialoglycoprotein receptor.
Received for publication August 9, 2001. Accepted for publication November 6, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 in Langerhans cell biology: the skin of transforming growth factor 1 null mice is devoid of epidermal Langerhans cells. J. Exp. Med. 184:2417.-Helical coiled-coil stalks in the low-affinity receptor for IgE (Fc
RII/CD23) and related C-type lectins. Proc. Natl. Acad. Sci. USA 89:753.RII/CD23: implications for function. J. Immunol. 150:2372.[Abstract]
RII and its soluble fragments can form oligomers on the cell surface and in solution. Immunology 84:202.[Medline]
-positive dendritic cells from a common myeloid progenitor. Science 290:2152.1 and interleukin 2 synergize to prevent apoptosis and promote effector expansion. J. Exp. Med. 182:699.This article has been cited by other articles:
|
|
 |
|
  B. Z. Igyarto, M. C. Jenison, J. C. Dudda, A. Roers, W. Muller, P. A. Koni, D. J. Campbell, M. J. Shlomchik, and D. H. Kaplan Langerhans Cells Suppress Contact Hypersensitivity Responses Via Cognate CD4 Interaction and Langerhans Cell-Derived IL-10 J. Immunol., October 15, 2009; 183(8): 5085 - 5093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. U. Eriksson and R. R. Singh Cutting Edge: Migration of Langerhans Dendritic Cells Is Impaired in Autoimmune Dermatitis J. Immunol., December 1, 2008; 181(11): 7468 - 7472. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Joachim, B. Handjiski, S. M. Blois, E. Hagen, R. Paus, and P. C. Arck Stress-Induced Neurogenic Inflammation in Murine Skin Skews Dendritic Cells Towards Maturation and Migration: Key Role of Intercellular Adhesion Molecule-1/Leukocyte Function-Associated Antigen Interactions Am. J. Pathol., November 1, 2008; 173(5): 1379 - 1388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Ginhoux, M. P. Collin, M. Bogunovic, M. Abel, M. Leboeuf, J. Helft, J. Ochando, A. Kissenpfennig, B. Malissen, M. Grisotto, et al. Blood-derived dermal langerin+ dendritic cells survey the skin in the steady state J. Exp. Med., December 24, 2007; 204(13): 3133 - 3146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Bennett, M. Noordegraaf, C. A. E. Martina, and B. E. Clausen Langerhans Cells Are Required for Efficient Presentation of Topically Applied Hapten to T Cells J. Immunol., November 15, 2007; 179(10): 6830 - 6835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Iezzi, A. Frohlich, B. Ernst, F. Ampenberger, S. Saeland, N. Glaichenhaus, and M. Kopf Lymph Node Resident Rather Than Skin-Derived Dendritic Cells Initiate Specific T Cell Responses after Leishmania major Infection J. Immunol., July 15, 2006; 177(2): 1250 - 1256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-S. J. Sung, S. M. Fu, C. E. Rose Jr., F. Gaskin, S.-T. Ju, and S. R. Beaty A Major Lung CD103 ({alpha}E)-beta7 Integrin-Positive Epithelial Dendritic Cell Population Expressing Langerin and Tight Junction Proteins J. Immunol., February 15, 2006; 176(4): 2161 - 2172. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Flores-Langarica, S. Meza-Perez, J. Calderon-Amador, T. Estrada-Garcia, G. MacPherson, S. Lebecque, S. Saeland, R. M. Steinman, and L. Flores-Romo Network of dendritic cells within the muscular layer of the mouse intestine PNAS, December 27, 2005; 102(52): 19039 - 19044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Lam, M. K. Mansour, C. A. Specht, and S. M. Levitz A Model Vaccine Exploiting Fungal Mannosylation to Increase Antigen Immunogenicity J. Immunol., December 1, 2005; 175(11): 7496 - 7503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mao, V. Paharkova-Vatchkova, J. Hardy, M. M. Miller, and S. Kovats Estrogen Selectively Promotes the Differentiation of Dendritic Cells with Characteristics of Langerhans Cells J. Immunol., October 15, 2005; 175(8): 5146 - 5151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Czeloth, G. Bernhardt, F. Hofmann, H. Genth, and R. Forster Sphingosine-1-Phosphate Mediates Migration of Mature Dendritic Cells J. Immunol., September 1, 2005; 175(5): 2960 - 2967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sangaletti, L. Gioiosa, C. Guiducci, G. Rotta, M. Rescigno, A. Stoppacciaro, C. Chiodoni, and M. P. Colombo Accelerated dendritic-cell migration and T-cell priming in SPARC-deficient mice J. Cell Sci., August 15, 2005; 118(16): 3685 - 3694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Bennett, E. van Rijn, S. Jung, K. Inaba, R. M. Steinman, M. L. Kapsenberg, and B. E. Clausen Inducible ablation of mouse Langerhans cells diminishes but fails to abrogate contact hypersensitivity J. Cell Biol., May 23, 2005; 169(4): 569 - 576. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Chang-Rodriguez, W. Hoetzenecker, C. Schwarzler, T. Biedermann, S. Saeland, and A. Elbe-Burger Fetal and neonatal murine skin harbors Langerhans cell precursors J. Leukoc. Biol., March 1, 2005; 77(3): 352 - 360. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kissenpfennig, S. Ait-Yahia, V. Clair-Moninot, H. Stossel, E. Badell, Y. Bordat, J. L. Pooley, T. Lang, E. Prina, I. Coste, et al. Disruption of the langerin/CD207 Gene Abolishes Birbeck Granules without a Marked Loss of Langerhans Cell Function Mol. Cell. Biol., January 1, 2005; 25(1): 88 - 99. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Jawdat, E. J. Albert, G. Rowden, I. D. Haidl, and J. S. Marshall IgE-Mediated Mast Cell Activation Induces Langerhans Cell Migration In Vivo J. Immunol., October 15, 2004; 173(8): 5275 - 5282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Takahara, Y. Yashima, Y. Omatsu, H. Yoshida, Y. Kimura, Y.-S. Kang, R. M. Steinman, C. G. Park, and K. Inaba Functional comparison of the mouse DC-SIGN, SIGNR1, SIGNR3 and Langerin, C-type lectins Int. Immunol., June 1, 2004; 16(6): 819 - 829. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Salaun, B. de Saint-Vis, N. Pacheco, Y. Pacheco, A. Riesler, S. Isaac, C. Leroux, V. Clair-Moninot, J.-J. Pin, J. Griffith, et al. CD208/Dendritic Cell-Lysosomal Associated Membrane Protein Is a Marker of Normal and Transformed Type II Pneumocytes Am. J. Pathol., March 1, 2004; 164(3): 861 - 871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bros, X.-L. Ross, A. Pautz, A. B. Reske-Kunz, and R. Ross The Human Fascin Gene Promoter Is Highly Active in Mature Dendritic Cells Due to a Stage-Specific Enhancer J. Immunol., August 15, 2003; 171(4): 1825 - 1834. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Iwasaki The Importance of CD11b+ Dendritic Cells in CD4+ T Cell Activation In Vivo: With Help from Interleukin 1 J. Exp. Med., July 21, 2003; 198(2): 185 - 190. [Full Text] [PDF]
|
|
|
|
 |
|
 N. S. Stambach and M. E. Taylor Characterization of carbohydrate recognition by langerin, a C-type lectin of Langerhans cells Glycobiology, May 1, 2003; 13(5): 401 - 410. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
