The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ludwig, A.
Right arrow Articles by Chapman, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ludwig, A.
Right arrow Articles by Chapman, G.
The Journal of Immunology, 2002, 168: 604-612.
Copyright © 2002 by The American Association of Immunologists

Fractalkine Is Expressed by Smooth Muscle Cells in Response to IFN-{gamma} and TNF-{alpha} and Is Modulated by Metalloproteinase Activity1

Andreas Ludwig2,*, Theo Berkhout*, Kitty Moores*, Pieter Groot* and Gayle Chapman{dagger}

Departments of * Vascular Biology and {dagger} Neuroscience, GlaxoSmithKline, Harlow, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fractalkine/CX3C-chemokine ligand 1 is expressed as a membrane-spanning adhesion molecule that can be cleaved from the cell surface to produce a soluble chemoattractant. Within the vasculature, fractalkine is known to be generated by endothelial cells, but to date there are no reports describing its expression by smooth muscle cells (SMC). In this study we demonstrate that IFN-{gamma} and TNF-{alpha}, but not IL-1{beta}, cooperate synergistically to induce fractalkine mRNA and protein expression in cultured aortic SMC. We also report the release of functional, soluble fractalkine from the membranes of stimulated SMC. This release is inhibited by the zinc metalloproteinase inhibitor batimastat, resulting in the accumulation of membrane-associated fractalkine on the SMC surface. Therefore, an SMC-derived metalloproteinase activity is involved in fractalkine shedding. While soluble fractalkine present in SMC-conditioned medium is capable of inducing calcium transients in cells expressing the fractalkine receptor (CX3CR1), blocking experiments using neutralizing Abs reveal that it can be inactivated without affecting the chemotactic activity of SMC-conditioned media on monocytes. However, membrane-bound fractalkine plays a major role in promoting adhesion of monocytic cells to activated SMC. This fractalkine-mediated adhesion is further enhanced in the presence of batimastat, indicating that shedding of fractalkine from the cell surface down-regulates the adhesive properties of SMC. Hence, during vascular inflammation, the synergistic induction of fractalkine by IFN-{gamma} and TNF-{alpha} together with its metalloproteinase-mediated cleavage may finely control the recruitment of monocytes to SMC within the blood vessel wall.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Smooth muscle cells (SMC)3 in the arterial wall respond to inflammatory processes in the vasculature by changes in their morphology and protein expression pattern. This modulation includes the up-regulation of adhesion molecules and the release of proinflammatory mediators from SMC, such as growth factors, cytokines, and chemokines. In general, chemokines are a family of small, soluble polypeptides secreted by various cell types upon inflammatory insult and capable of creating a chemoattractive concentration gradient for receptive inflammatory cells (1). In vitro and in vivo work has shown that chemokines are relevant for the attraction of different leukocyte populations to sites of vascular inflammation (2). Within the chemokine family monocyte chemoattractant protein-1 (MCP-1)/CCL2, IL-8/CXCL8, stromal cell-derived factor 1/CXCL12, EBI1-ligand chemokine/CCL19, and eotaxin/CCL11 have been found to be secreted by SMC upon stimulation with inflammatory mediators such as LPS, IL-1{beta}, IFN-{gamma}, or TNF-{alpha} (3, 4, 5, 6, 7). Thus, by secreting chemokines SMC have the potential to contribute to the recruitment of leukocytes, thereby influencing the inflammatory reaction in vascular disease.

Among the chemokines, fractalkine (also termed CX3C-chemokine ligand 1) is unusual because it is encoded as a transmembrane molecule consisting of a chemokine domain linked to a transmembrane domain by a mucin-rich stalk (8). The full-length molecule can be cleaved from the cell membrane to produce a soluble form comprising the chemokine domain and most of the stalk region (8). Human fractalkine was originally described as being induced in endothelial cells upon stimulation with IL-1{beta} or TNF-{alpha} (8). In addition, fractalkine was found to be expressed in IL-4-stimulated macrophages (9), dendritic cells (10, 11), neurons (12), and epithelial cells (13, 14). Besides expressing fractalkine on the cell membrane endothelial cells, neurons and epithelial cells have been reported to release soluble fractalkine by proteolytic cleavage (8, 13, 14, 15). Although the responsible protease has yet to be identified, our recent observations describing inhibition of fractalkine cleavage by batimastat, a broad spectrum metalloproteinase inhibitor, have shed some light on the protease involved (15). In addition to the regulation at the level of protein synthesis, proteolytic cleavage of fractalkine may further control the biologic activity of the chemokine. Fractalkine is unique among chemokines because it can mediate two distinct biological actions. Soluble fractalkine acts as a chemoattractant, whereas the membrane-bound molecule functions as an adhesion molecule. Chemotaxis and adhesion are both mediated by a single type of G protein-coupled receptor termed CX3CR1 (15, 16, 17). CX3CR1 is expressed on a number of leukocytes, including monocytes, T cell subsets, and NK cells (16, 18). These cells not only migrate in response to chemotactic gradients of soluble fractalkine but also adhere to cells expressing fractalkine on their cell surface (8, 16). While chemotaxis involves signaling of receptor-coupled pertussis toxin-sensitive G proteins, this signaling is not required for adhesion (8, 16, 19, 20). Furthermore, adhesion mediated by fractalkine and its receptor was shown to be resistant to physiologic shear flow and to be independent of calcium (16, 19, 20).

Expression of fractalkine in vascular endothelial cells has been reported. However, the expression of this chemokine in other vessel cells has not been investigated. In this report we describe the expression of fractalkine in aortic SMC following stimulation with inflammatory cytokines. Whereas TNF-{alpha} and IFN-{gamma} applied independently are weak inducers of the chemokine, the cytokines cooperate synergistically to increase fractalkine message and protein surface expression dramatically. We show that membrane-bound fractalkine functions to promote tight adhesion of monocytes to activated SMC and that fractalkine-mediated adhesion is regulated by a metalloproteinase converting the membrane-expressed fractalkine into its soluble form. Our findings suggest that the role of SMC-derived fractalkine in vascular inflammation is dependent on the presence of TNF-{alpha} and IFN-{gamma} as well as the activity of the fractalkine-cleaving metalloproteinase.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokines, Abs, and inhibitors

Recombinant extracellular domain fractalkine, chemokine domain fractalkine, human TNF-{alpha}, and human IFN-{gamma} were purchased from R&D Systems (Oxon, U.K.). Neutralizing Abs to human fractalkine clone (51637.11) and MCP-1 (clone 24822.111), PE-conjugated mAb to human fractalkine (clone 51637.11), as well as PE-conjugated and unconjugated mouse IgG1 isotype control (clone 11711.11) were obtained from R&D Systems. The antiserum against fractalkine was raised in rabbits and tested for its specificity to recognize fractalkine in Western blots by using lysates from fractalkine-transfected and untransfected ECV 304 cells as previously described (21). Hydroxamate-based metalloproteinase inhibitors were synthesized at GlaxoSmithKline (Harlow, U.K.) and stored as 20 mM stock solutions in dimethylsulfoxide. Tissue inhibitors of metalloproteinase type 1 and type 2 (TIMP1 and TIMP2, respectively) were obtained from R&D Systems. All inhibitors were controlled for inhibition of gelatinase activity mediated by matrix metalloproteinase (MMP)2.

Cell culture, transfection, and monocyte isolation

Cryopreserved human aortic SMC from three different donors were obtained from BioWhittaker (Berkshire, U.K.). SMC were cultured according to the manufacturer’s instructions in SMC basal medium supplemented with 0.5 ng/ml human epidermal growth factor, 5 µg/ml insulin, 2 ng/ml human fibroblast growth factor, 50 µg/ml gentamicin, 50 ng/ml amphotericin B, and 5% FCS. The medium was replaced every 2–3 days until confluence was reached, and SMC were subsequently subcultured after treatment with 0.025% trypsin and 0.01% EDTA (BioWhittaker). SMC used in these experiments were between passages 4 and 8. Cells were identified as SMC by positive staining with a specific Ab (HHF35) for SMC {alpha}-actin and negative staining with a specific Ab (F8/86) for von Willebrand factor (both from DAKO, Ely, U.K.). The human monocytic leukemia cell line THP-1 was cultured in RPMI 1640 medium supplemented with 10% FCS and 2 mM glutamine (all reagents from Life Technologies, Paisley, U.K.). CX3CR1-expressing human embryonic kidney cells, HEK 293, were grown in MEM containing Earle’s salts, 2.2 g/l sodium bicarbonate, 2 mM L-glutamine, nonessential amino acids, 10% FCS, and 400 µg/ml geneticin (all reagents from Life Technologies). This cell line had been generated by transfection with the CX3CR1 coding region amplified with 5' (BamHI) and 3' (EcoRI) primers, and cloned into BamHI (5') and EcoRI (3') sites in the polylinker region of the pCDN expression vector (Invitrogen, Groningen, The Netherlands) using Lipofectamine Plus (Life Technologies) as transfection reagent. Human monocytes were isolated from whole blood freshly taken from healthy volunteers. In brief, 90 ml of blood was collected into 0.9 ml of 50 mM EDTA (pH 7.4) and spun down at 550 x g for 20 min. Buffy coat (10 ml) was harvested, mixed with 4 ml of Optiprep (Robbins Scientific, Solihull, U.K.), and then overlaid by a discontinuous density gradient prepared by different solutions of Optiprep in PBS with 0.5% BSA. The gradient consisted of 8 ml of density solution of 1.078 g/ml, followed by 20 ml of density solution of 1.068 g/ml, finally followed by 0.5 ml of PBS. After centrifugation at 600 x g for 25 min, the mononuclear cell layer formed at the top of the gradient was harvested, and the cells were washed once in PBS. More than 80% of the prepared cells were monocytes as determined by flow cytometric analysis.

Cytokine stimulation of SMC

Human aortic SMC (70–90% confluence) were grown in serum and growth factor-free basal medium for 24 h before stimulation with TNF-{alpha} and IFN-{gamma} (20 ng/ml) for various lengths of time, with each condition represented in triplicate. After 24 h, the conditioned medium was harvested and concentrated 10-fold using Centriprep-3 filtration units (Millipore, Watford, U.K.). After washing with 10 ml of PBS, cells were harvested in Tri-Reagent (Sigma-Aldrich, Poole, U.K.) for subsequent isolation of nucleic acids. For analysis of protein, washed cells were harvested in 10 ml of ice-cold versene (Life Technologies), spun down, and suspended in 200 µl of lysis buffer (PBS, 0.1% Triton X-100, and complete protease inhibitors; Roche, East Sussex, U.K.). After 30 min of incubation on ice under agitation, cell debris was removed by centrifugation at 12,000 x g for 10 min. To study inhibition of fractalkine cleavage from the cell surface, cell stimulation was performed in the presence of batimastat, a potent inhibitor of metalloproteinases (22, 23). Serum-starved SMC received batimastat (20 µM; GlaxoSmithKline) 2 h before stimulation with proinflammatory cytokines. After 24 h of incubation, the medium content of cleaved fractalkine as well as uncleaved fractalkine associated with the cell lysates were determined by Western blotting.

Relative quantitation of mRNA by real-time quantitative RT-PCR

RNA was isolated from cultured SMC using TRIzol reagent (Life Technologies). Total RNA (1 µg) was treated with DNase (Life Technologies) and reverse transcribed to cDNA using Superscript II (Life Technologies) according to the manufacturer’s instructions. For each sample, a parallel RNA was run with no Superscript II to allow for assessment of genomic DNA contamination. Each cDNA sample was analyzed for expression of fractalkine, MCP-1, GAPDH, and cyclophillin by real-time quantitative RT-PCR using the fluorescent TaqMan 5' nuclease assay. Oligonucleotide primers and probes were designed using Primer Express software version 1.0 (PE Biosystems, Warrington, U.K.) and were synthesized by PE Biosystems. The sequences of forward primer, reverse primer, and probe from 5' to 3' were: fractalkine, ACCTGTAGCTTTGCTCATCCA, CTCCAAGATGATTGCGCGT, and AACAGAACCAGGCATCATGCG; MCP-1, GCCAAGGAGATCTGTGCTGAC, TTGCTTGTCCAGGTGGTCC, and CCAAGCAGAACTGGGTTCAGGATTCCA; and GAPDH, CAGAACATCATCCCTGCCTCTA, CCAGTGAGCTTCCCGTTCA, and CTTGCCCACAGCCTTGGCAGC. The 5' nuclease assay PCRs were performed in a MicroAmp Optical 96-well reaction plate and Optical Caps (PE Biosystems) using the ABI PRISM 7700 Sequence Detection System for thermal cycling and real-time fluorescence measurements (PE Biosystems). Each 25-µl reaction consisted of 1x TaqMan Universal PCR Master Mix (PE Biosystems), 300 nM forward primer, 300 nM reverse primer, 100 nM TaqMan quantification probe, and 5 µl of template. Reaction conditions were as follows: 50°C for 2 min, 95°C for 10 min, then 40 cycles of 95°C for 15 s and 60°C for 1 min. Emitted fluorescence for each reaction well was measured every cycle during both the denaturation and annealing/extension phases, and amplification plots were constructed using ABI PRISM 7700 Sequence Detection System software version 1.6 (PE Biosystems). Levels of fractalkine, MCP-1, and GAPDH mRNA were quantified by comparison of the fluorescence generated by each sample with that of a serial diluted standard of known quantities of human genomic DNA (Promega, Southampton, U.K.).

SDS-PAGE and Western blotting

Fractalkine-containing cell lysates and concentrated medium samples were subjected to SDS-PAGE (4–20% precast Tris-glycine gels; Invitrogen, Paisey, U.K.) and transferred onto Immobilon-P membranes (Millipore). Membranes were incubated in blocking buffer (0.05% Tween 20 and 5% milk powder in PBS) at room temperature for 1 h and probed for 1 h with a rabbit antiserum to human fractalkine diluted 1/1000 in blocking buffer. After three washes with PBS/0.05% Tween, membranes were incubated with HRP-linked anti-rabbit Ig (diluted 1/10,000 in PBS/0.05% Tween; Amersham, Little Chalfont, U.K.) for 1 h. After three washes, detection of bound anti-rabbit Ig was conducted using ECL (Amersham) according to the manufacturer’s instructions and was quantified using Chemi-Imager (Flowgen, Lichfield, U.K.).

Flow cytometric analysis

Cultured SMC were detached from culture flasks by treatment with ice-cold versene (Life Technologies) for 10 min and scraping. Cells were fixed in 0.5 ml of 4% paraformaldehyde (Sigma-Aldrich) in PBS for 10 min on ice, washed with PBS, and incubated at 2 x 106 cells/ml with a PE-conjugated mAb to fractalkine or a PE-conjugated IgG1 isotype control (both at 2.5 µg/ml in PBS/0.1% BSA) for 1 h on ice. Following 2-fold washing the fluorescence signal of the labeled cells was analyzed by flow cytometry (EPICS XL-MCL; Coulter, Hialeah, FL) and calculated as the median fluorescence intensity of the gated SMC population.

Measurement of calcium transients

Intracellular calcium transients in CX3CR1-transfected HEK293 cells were assayed using a fluorescence intensity plate reader (Molecular Devices, Menlo Park, CA). CX3CR1-transfected HEK 293 cells were seeded (50,000 cells/well) into poly-D-lysine-coated 96-well, black-wall, clear-bottom microtiter plates (BD Biosciences, Mountain View, CA) 24 h before the assay. Cells were loaded for 1 h with 1 µM fluo-4/AM fluorescent indicator dye (Molecular Probes, Leiden, The Netherlands) in assay buffer (HBSS containing 10 mM HEPES, 200 µM Ca2+, 0.1% BSA, and 2.5 mM probenecid; Molecular Probes), washed twice with 100 µl of assay buffer, and incubated for 10 min in 100 µl of assay buffer before stimulation in the plate reader. For stimulation, cells received either 40 µl of 10-fold concentrated SMC-conditioned medium in 1/2 serial dilutions with assay buffer or defined solutions of recombinant extracellular domain fractalkine in assay buffer. The fluorescence signal was recorded over time, and the maximum change in fluorescence intensity over baseline was calculated to determine the agonist response. Dose response curve data were fitted to a four-parameter logistic equation using GraFit (Erithacus Software, Staines, U.K.).

Monocyte chemotaxis assay

Monocyte chemotaxis assays were performed essentially as previously described (24). As chemotactic stimulus the cells received either 10-fold concentrated SMC-conditioned medium supplemented with 10 mM HEPES in 1/3 serial dilutions with assay buffer (SMC basal medium supplemented with 10 mM HEPES) or defined solutions of recombinant extracellular domain fractalkine or MCP-1 in assay buffer. The number of cells that migrated in response to stimulus solution containing chemoattractant was expressed in relation to that induced by medium only.

Cell adhesion assay

The adhesion of THP-1 cells and monocytes to activated and nonactivated SMC was determined by seeding 2 x 104 SMC/well into Nunclon 48-well multidishes (Nunc, Paisley, U.K.). Cells were cultured in full medium until they reached 90% confluence and subsequently incubated for 24 h in basal medium without growth factors and serum. Serum-starved cells were activated with TNF-{alpha} and IFN-{gamma} (each 20 ng/ml) in the absence or the presence of batimastat (20 µM) for 24 h and subsequently used for adhesion assays with fluorescently labeled THP-1 cells or human monocytes. For fluorescent labeling cultured THP-1 cells or freshly prepared monocytes were suspended at 2 x 106 cells/ml in PBS/0.1% BSA and incubated with 10 µM calcein-AM dye (Molecular Probes) for 30 min at 37°C. Excess dye was removed by centrifugation and resuspension of the cells in PBS/0.1% BSA. SMC were washed twice with PBS (1 ml/well). THP-1 cells or monocytes were added to the SMC at 250,000 cells/well and incubated at 37°C for 30 min. The plate was washed repeatedly by inversion and by the addition of PBS (1 ml/well), followed by inversion. After each wash step the fluorescence signal from of the adherent cells was measured in a Fluorskan plate reader (excitation wavelength, 485 nm; emission wavelength, 538 nm; Labsystems, Yorkshire, U.K.).

Statistical analysis

Data were statistically analyzed using the paired two-tailed t test. Two populations of data were considered significantly different at p < 0.05, as indicated by an asterisk.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{gamma} and TNF-{alpha} cooperate to induce fractalkine mRNA in isolated SMC

We investigated the basal expression of fractalkine mRNA in SMC isolated from human aorta. For this purpose SMC were cultured to 70% confluence before starving the cells of FCS and growth factors for 24 h to induce quiescence. As quantified by real-time PCR, these cells expressed negligible message encoding fractalkine (Fig. 1GoA). To examine whether SMC could be induced to express fractalkine mRNA, serum-starved SMC were stimulated for 16 h with increasing concentrations of IL-1{beta}, TNF-{alpha}, or IFN-{gamma}. While IL-1{beta} had no effect, TNF-{alpha} and IFN-{gamma} induced detectable levels of mRNA encoding fractalkine (Fig. 1GoB). Increasing the concentration of these cytokines above 20 ng/ml again decreased mRNA expression. However, when IFN-{gamma} and TNF-{alpha} (each 20 ng/ml) were applied in combination, fractalkine message was dramatically up-regulated. In the presence of both stimuli fractalkine expression was 45- and 8-fold higher than that induced by TNF-{alpha} or IFN-{gamma} alone, clearly showing synergy between the two cytokines. IL-1{beta}, which did not stimulate fractalkine mRNA expression itself, also failed to induce fractalkine expression in combination with IFN-{gamma} or TNF-{alpha}.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. RT-PCR analysis of human fractalkine and MCP-1 expression in SMC from human aorta. A, Serum-starved SMC were stimulated with increasing concentrations of IFN-{gamma} (•), TNF-{alpha} ({circ}), or IL-1{beta} () and subsequently analyzed for the expression of mRNA encoding fractalkine. B, Serum-starved SMC were stimulated with IFN-{gamma}, TNF-{alpha}, IL-1{beta}, or combinations of these cytokines (each 20 ng/ml) for 16 h, and mRNA encoding fractalkine ({blacksquare}) or MCP-1 ({square}) was quantified. C, Induction of fractalkine (•) and MCP-1 ({circ}) was studied over time by stimulating serum-starved SMC with a combination of IFN-{gamma} and TNF-{alpha} for 0, 2, 8, 16, and 24 h. Fractalkine (FKN) and MCP-1 mRNA levels were quantified by real-time RT-PCR and expressed as a percentage of that determined for GAPDH. Data are given as the mean and SD (n = 3) and were reproduced twice in separate experiments with SMC from different donors.

 
For comparison we examined the potential of IL-1{beta}, TNF-{alpha}, and IFN-{gamma} to induce MCP-1 mRNA in SMC. Interestingly, addition of IL-1{beta} resulted in a large increase in MCP-1 message levels. TNF-{alpha} also induced a remarkable increase in MCP-1 mRNA, while IFN-{gamma} had comparatively negligible effects. Challenge of SMC with a combination of cytokines resulted in further MCP-1 expression. However, in this study costimulation produced only additive effects. Thus, although IFN-{gamma} and TNF-{alpha} were capable of inducing both MCP-1 and fractalkine, synergistic cooperation of the stimuli was seen only with fractalkine.

Having found that transcriptional control of fractalkine and MCP-1 is distinct, we next investigated the expression of both chemokines in SMC in response to costimulation with IFN-{gamma} and TNF-{alpha} (20 ng/ml each) over different periods of time. As shown in Fig. 1GoB, the early kinetics of fractalkine and MCP-1 expression were divergent. At 2 h poststimulation mRNA encoding fractalkine reached almost maximal levels, while that of MCP-1 was still relatively low. Maximal levels of both chemokines were reached 8 h poststimulation and maintained for the duration of the experiment.

IFN-{gamma} and TNF-{alpha} synergistically stimulate SMC to express fractalkine on the cell surface

The cooperative effect of IFN-{gamma} and TNF-{alpha} on induction of fractalkine was further examined by investigating cell surface expression of the protein. Analysis was performed by flow cytometry using a PE-conjugated mAb to fractalkine. Compared with the fluorescence signal obtained with resting cells, a weak shift to higher fluorescence intensity was observed when SMC were stimulated with either TNF-{alpha} (20 ng/ml) or IFN-{gamma} (20 ng/ml) alone for 8 h (Fig. 2GoA). The rather small increase in median fluorescence indicated that both stimuli per se are only weak inducers of fractalkine surface expression. However, in the presence of both stimuli together (20 ng/ml each) the signal was increased dramatically (Fig. 2GoA), demonstrating that the synergism between IFN-{gamma} and TNF-{alpha} seen at the level of mRNA is also expressed in terms of cell surface-associated fractalkine protein. As indicated by a time course of stimulation with IFN-{gamma} and TNF-{alpha} (both 20 ng/ml), fractalkine expression on the surface of SMC reached a maximum value after 24 h and was not further increased during longer stimulation periods (Fig. 2GoB). For all subsequent functional studies (see below) SMC were stimulated with IFN-{gamma} and TNF-{alpha} for 24 h.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. Flow cytometric analysis of fractalkine surface expression on SMC. A, Serum-starved SMC were left unstimulated (dotted line) or were stimulated with 20 ng/ml IFN-{gamma} (solid line), TNF-{alpha} (gray line), or a combination of both cytokines (filled histogram) for 8 h and subsequently analyzed for expression of fractalkine on the cell surface by flow cytometry using a PE-conjugated mAb to fractalkine. Histograms shown were obtained in one representative of three experiments. B, Serum-starved SMC were stimulated with a combination of IFN-{gamma} and TNF-{alpha} for 0, 2, 8, 16, and 24 h and subsequently stained with a PE-conjugated mAb to fractalkine (•) or an isotype control ({circ}). Results are shown as the median fluorescence intensity of labeled cells and represent the mean and SD (n = 3).

 
Release of soluble fractalkine by IFN-{gamma}- and TNF-{alpha}-stimulated SMC

We next investigated whether SMC are capable of cleaving membrane-bound fractalkine. For this purpose SMC were stimulated with IFN-{gamma} and TNF-{alpha} for 24 h, and subsequently conditioned media were analyzed for the presence of soluble fractalkine by Western blotting using a previously characterized antiserum raised against the chemokine domain of fractalkine (21). As shown in Fig. 3GoA, media of unstimulated SMC contained no detectable fractalkine. Stimulation of SMC with either IFN-{gamma} or TNF-{alpha} did induce small amounts of soluble fractalkine, as indicated by a single faint protein band with an apparent size of 80 kDa. However, the intensity of this band was dramatically increased upon costimulation of SMC with IFN-{gamma} and TNF-{alpha}, suggesting that stimulated SMC are capable of releasing considerable amounts of soluble fractalkine during a stimulation period of 24 h. Interestingly, no soluble fractalkine was detected when the cells were costimulated with IFN and TNF for 8 h only (data not shown). While the expression of membrane-associated fractalkine reaches a considerable level after 8 h of stimulation (compare to Fig. 2GoB), 24 h of stimulation are required for soluble fractalkine to accumulate in detectable quantities in the medium.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. Western blot and flow cytometric analysis of fractalkine cleavage by SMC. A, Serum-starved SMC received no stimulus, IFN-{gamma} or TNF-{alpha} alone, or a combination of both cytokines (20 ng/ml each). After 24 h of incubation conditioned media were harvested, concentrated 10-fold, and analyzed for the presence of soluble fractalkine by Western blotting using an antiserum to the chemokine. B, Serum-starved SMC received no stimulus or a combination of IFN-{gamma} and TNF-{alpha} (20 ng/ml each) and were incubated in the presence or the absence of the protease inhibitor batimastat (20 µM). After 24 h of incubation conditioned media and cells were harvested separately and analyzed for the presence of the membrane-bound and soluble fractalkine by Western blotting. Shown is one representative experiment of three. C, Cells were stimulated as described in B, fixed, and stained for surface-expressed fractalkine with a PE-conjugated mAb to fractalkine ({blacksquare}) or probed with an IgG1 isotype control ({square}). The median fluorescence intensity of labeled cells was recorded by flow cytometry. Data are given as the mean and SD (n = 3).

 
Cleavage of fractalkine by an SMC-derived metalloproteinase

In the next set of experiments we examined the ability of metalloproteinase inhibitors to affect cleavage of the chemokine in SMC. The hydroxamate inhibitor, batimastat, inhibits a broad spectrum of zinc-dependent proteinases (22) and has been previously found to prevent fractalkine cleavage in endothelial cells (15). To test the effect of this inhibitor on SMC-mediated fractalkine cleavage, SMC were stimulated in the presence and the absence of the inhibitor (20 µM), and subsequently cell lysates as well as conditioned media were analyzed for the presence of cell-associated and soluble fractalkine, respectively. As shown in Fig. 3GoB, neither lysate nor conditioned medium of unstimulated SMC contained detectable levels of fractalkine. Following cell stimulation with IFN-{gamma} and TNF-{alpha}, cell-associated fractalkine in the lysate and soluble fractalkine in the medium were detected as a single protein bands with apparent sizes of approximately 95 and 80 kDa, respectively. However, when cell stimulation with IFN-{gamma} and TNF-{alpha} was performed in the presence of batimastat (20 µM), soluble chemokine could no longer be detected in the conditioned medium, and membrane-bound fractalkine accumulated in the cell lysates (Fig. 3GoA). This was confirmed by flow cytometric detection of surface-expressed fractalkine. As expected, the surface staining for fractalkine was increased 2-fold when stimulation of SMC was conducted in the presence of batimastat, giving further evidence that inhibition of fractalkine cleavage by batimastat leads to the accumulation of membrane-bound molecule on the cell surface (Fig. 3GoB). In a more detailed experiment employing different concentrations of batimastat (0.5, 1, 2, 5, 10, and 20 µM), the compound was found to induce half-maximal inhibition of fractalkine cleavage at a dosage of 1 µM, while inhibition was maximal at 10 µM (data not shown). In addition to batimastat, a second broad-spectrum metalloproteinase inhibitor based on hydroxamic acid (25) was tested and found to prevent fractalkine cleavage at a concentration of 7 µM. In an attempt to further delineate the protease(s) responsible for fractalkine cleavage by SMC, we investigated the involvement of MMP2 and MMP9. These proteases appeared to be reasonable candidates, as they are known to be up-regulated in SMC under inflammatory conditions in vitro and in vivo (26, 27). However, potent synthetic inhibitors blocking MMP2 and MMP9, but not MMP1 and MMP3, in nanomolar concentrations did not affect fractalkine cleavage by SMC (each inhibitor tested at concentrations up to 20 µM; data not shown), indicating that the metalloproteinase mediating fractalkine cleavage is not MMP2 or MMP9. Likewise, TIMP1 and TIMP2 that show a broader activity profile against various metalloproteinases of the MMP class failed to block fractalkine cleavage in SMC (each inhibitor tested at concentrations of 0.1 and 1 µg/ml; data not shown). Thus, for the time being we cannot provide any data on the inhibition of fractalkine cleavage by more specific inhibitors than by the two broad-spectrum hydroxamate-based inhibitors.

Fractalkine-mediated biological activity of SMC-conditioned media

To assess the functional activity of SMC-derived soluble fractalkine, we investigated the potential of concentrated culture media from IFN-{gamma}-/TNF-{alpha}-stimulated SMC to induce calcium transients in CX3CR1-transfected HEK 293 cells. As shown in Fig. 4GoA, these cells responded to the recombinant extracellular domain of human fractalkine (5 nM) by a robust calcium transient. Conditioned medium of resting SMC had no effect on this cell line, consistent with the absence of fractalkine. However, a clear response was obtained when the cells were challenged with conditioned medium from IFN-{gamma}-/TNF-{alpha}-stimulated SMC. This activity was completely abrogated when the conditioned medium was treated with a neutralizing Ab to fractalkine. Thus, SMC-derived soluble fractalkine was indeed responsible for activation of the receptor-bearing cells.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. Induction of intracellular calcium transients in CX3CR1-transfected HEK 293 cells by SMC-conditioned media. A, CX3CR1-transfected HEK 293 cells were challenged with 3-fold concentrated conditioned media (CM) from serum-starved SMC that were left unstimulated or were costimulated with IFN-{gamma} and TNF-{alpha} (20 ng/ml each, for 24 h). The role of soluble fractalkine was investigated by treating the media with a fractalkine-neutralizing mAb (50 µg/ml) 30 min before the assay. As a control, cells were stimulated with recombinant full-length soluble fractalkine (5 nM) in parallel. Data represent the calcium responses over time obtained in one representative of three experiments. B, Conditioned media were harvested from serum-starved SMC that were left unstimulated or were stimulated by a combination of IFN-{gamma} and TNF-{alpha} (20 ng/ml each) and incubated for 24 h in the absence or the presence of 20 µM batimastat. CX3CR1-transfected HEK 293 cells were challenged with serial dilutions of the 10-fold concentrated supernatants. The cellular response was calculated as the maximum change in fluorescence intensity over baseline. Results are shown as the mean and SD (n = 3).

 
We next investigated whether inhibition of fractalkine cleavage would abrogate the activity of SMC-conditioned and concentrated media on CX3CR1-transfected HEK 293 cells (Fig. 4GoB). As anticipated, medium from IFN-{gamma}- and TNF-{alpha}-stimulated SMC induced a calcium response in a concentration-dependent manner, with the unconcentrated medium leading to about half-maximal activation. In contrast, medium from cells stimulated in the presence of batimastat did not induce a response even at the highest concentration tested (3-fold concentrated sample). This confirmed that a batimastat-sensitive protease was responsible for fractalkine cleavage leading to the generation of a functionally active soluble chemokine.

Having demonstrated the presence of functional fractalkine in SMC-conditioned media, we next determined the relative contribution of this chemokine to the chemoattraction of human monocytes. As shown in Fig. 5GoA, concentrated medium from resting SMC did not stimulate the directed migration of monocytes even at the highest concentration tested (10-fold concentrated sample), while medium from IFN-{gamma}-/TNF-{alpha}-activated SMC was found to induce a dose-dependent chemotactic response (Fig. 5GoA). This response was characterized by a bell-shaped curve, reaching a maximum at a final 3-fold concentration before declining at a higher concentration (10-fold). This chemotactic activity was not significantly decreased in the presence of a mAb raised to fractalkine that had proved sufficient to neutralize the activity of recombinant fractalkine tested in parallel (Fig. 5GoB). In contrast, neutralization of MCP-1 with a blocking Ab resulted in a significant reduction of the chemotactic response. Taken together, these findings indicate that IFN-{gamma}-/TNF-{alpha}-stimulated SMC produce functionally active fractalkine as well as MCP-1, but that the latter chemokine dominates in its effects on monocyte chemotaxis.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 5. Monocyte chemotactic activity of SMC-conditioned media. A, Media were harvested from cultures of SMC that were left unstimulated ({circ}) or were costimulated (•) with IFN-{gamma} and TNF-{alpha} (both 20 ng/ml) for 24 h. Conditioned media (CM) were concentrated 10-fold and subsequently assayed in various dilutions for chemotactic activity on human monocytes. B, Conditioned media of unstimulated or IFN-{gamma}-/TNF-{alpha}-stimulated SMC were pretreated with 20 µg/ml blocking mAb to MCP-1 () or fractalkine ({blacksquare}) or were left untreated ({square}) for 30 min before monocyte chemotaxis assays. The neutralizing effects of both Abs (both of IgG1 isotype) on the chemotactic activity of recombinant MCP-1 (0.3 nM) or fractalkine (3 nM), respectively, were controlled in parallel. Data are shown as the mean and SD (n = 3). Values that are statistically different from each other are indicated by an asterisk (p < 0.05).

 
Surface-expressed fractalkine promotes tight adhesion of monocytic cells to SMC

As fractalkine does not play a major role as a monocyte chemoattractant in SMC-conditioned media, we examined whether the chemokine could function as an adhesion molecule on the cell surface of SMC. In a first approach, SMC were investigated for their potential to bind fluorescently labeled THP-1 cells that had been previously demonstrated to express CX3CR1 (28). The adhesion assay was conducted in the absence of Ca2+ and Mg2+ to minimize cell adhesion mediated by calcium- or magnesium-dependent adhesion molecules. After coincubation of THP-1 cells with SMC for 30 min, nonadherent THP-1 cells were washed away, and remaining THP-1 cells were detected by means of their fluorescence signal (Fig. 6GoA). Compared with the signal obtained with resting SMC, stimulation of the cells with IFN-{gamma} and TNF-{alpha} resulted in a 22-fold increase in the fluorescence intensity, indicating that activated SMC are indeed a good substrate for THP-1 adhesion.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 6. Adhesion of THP-1 cells to SMC. Fluorescently labeled THP-1 cells were assayed for the adhesion to a confluent monolayer of SMC. A, SMC were left unstimulated or were costimulated with IFN-{gamma} and TNF-{alpha} (both 20 ng/ml) for 24 h. B, Stimulation of SMC with IFN-{gamma} and TNF-{alpha} was performed in the presence or the absence of 20 µM batimastat. As a control unstimulated SMC were incubated in parallel with or without the inhibitor. The fraction of fractalkine-dependent cell adhesion was evaluated by exposing THP-1 cells to either 50 nM soluble fractalkine ({blacksquare}) or 50 nM MCP-1 (A, ) or by leaving cells unexposed ({square}) for 10 min before the adhesion assay. After 2-fold washing, the fluorescence signal from the adherent THP-1 cells was recorded as relative fluorescent units (RLU) and calculated as the mean and SD (n = 4). Adhesion values that are statistically different from each other are indicated by an asterisk (p < 0.05).

 
The contribution of fractalkine to the adhesive properties of SMC was further examined by blocking CX3CR1 on THP-1 cells. This blocking was achieved by preincubating the THP-1 cells with soluble fractalkine (50 nM for 10 min), thus occupying the receptor with soluble ligand. Cells were subsequently analyzed for adhesion to stimulated SMC. Adhesion was reduced by 50% when the cells were preincubated with recombinant fractalkine (Fig. 6GoA). This effect was specific for fractalkine and not due to the general activation of the cells, because similar treatment with MCP-1 (50 nM for 10 min) did not significantly affect cell adhesion. Although adhesion was only partly inhibited by blocking fractalkine receptors, this observation gave the first indication that surface-expressed fractalkine is responsible for more than half the adhesive interaction between THP-1 cells and stimulated SMC in this model. As expected, neither fractalkine nor MCP-1 treatment had an effect on the adhesion of THP-1 cells to unstimulated SMC.

We next examined whether stimulation of SMC in the presence of batimastat would improve the adhesive properties of SMC for THP-1 cells. Indeed, THP-1 adhesion was increased 2-fold when stimulation of SMC was performed in the presence of the protease inhibitor (Fig. 6GoB). More importantly, the fractalkine-dependent adhesion (which was blocked by preincubation of cells with recombinant fractalkine) was up to 3-fold increased. Thus, batimastat improved the fractalkine-dependent adhesion between SMC and THP-1 cells.

In a final set of adhesion experiments we examined the role of fractalkine in the adhesion of freshly prepared monocytes to stimulated SMC. In these experiments we exploited a neutralizing mAb to fractalkine that is able to recognize surface-expressed fractalkine as demonstrated above. Stimulated SMC were preincubated with increasing concentrations of a fractalkine-neutralizing Ab for 10 min before the addition of human monocytes. Quantification of the adherent monocytes after the first wash step revealed that monocyte adhesion was inhibited by 50% by the neutralizing Ab at the highest concentration used (50 µg/ml; Fig. 7Go). Furthermore, after a second and a third wash step, inhibition was increased to 75 and 85%, respectively. This finding indicated that the fractalkine-dependent fraction of cellular adhesion is resistant to repeated washing.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 7. Inhibition of monocyte adhesion to SMC by a neutralizing Ab to fractalkine. Fluorescently labeled monocytes were assayed for the adhesion to SMC stimulated with IFN-{gamma} and TNF-{alpha} (both 20 ng/ml) for 24 h. The role of SMC-expressed fractalkine was examined by exposing SMC to a fractalkine-neutralizing mAb (10 and 50 µg/ml; {blacksquare} and , respectively) or an IgG1 isotype control ( and ) or leaving cells unexposed ({square}) 10 min before the addition of monocytes. Nonadherent cells were removed by 3-fold washing. After each wash step, the fluorescence signal from the adherent monocytes was recorded as relative fluorescent units (RLU) and calculated as the mean and SD (n = 4).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During vascular inflammation SMC are thought to contribute to the recruitment of leukocytes by secreting chemoattractant mediators and by up-regulating adhesion molecules. In this study we demonstrated that the inflammatory cytokines IFN-{gamma} and TNF-{alpha} synergistically induce surface expression of fractalkine in human aortic SMC, thereby increasing the adhesive properties of SMC for monocytes. In turn, fractalkine-mediated adhesion of monocytes to cytokine-stimulated SMC is counter-regulated by metalloproteinase-mediated shedding of the transmembrane chemokine. This study suggests that SMC-derived fractalkine plays a role in vascular inflammation, where its expression and function may be under the control of multiple cytokines and the metalloproteinase activity responsible for fractalkine cleavage.

To our knowledge this report is the first to demonstrate functional expression of fractalkine in cytokine-stimulated SMC. We found that both IFN-{gamma} and TNF-{alpha} are required to induce optimal expression of fractalkine in SMC. IL-1{beta} was found to have no effect, either alone or in the presence of IFN-{gamma} or TNF-{alpha}. This pattern of gene induction for fractalkine is different from that seen for MCP-1 expression. Unlike fractalkine, MCP-1 is induced to a high level in the presence of IL-1{beta} or TNF-{alpha} alone, and combinations of these cytokines do not show synergistic cooperation in enhancing MCP-1 expression. This suggests that optimal expression of fractalkine in SMC is restricted to inflammatory conditions where IFN-{gamma} and TNF-{alpha} are both present, whereas conditions for induction of MCP-1 are less limited. Very recently, IFN-{gamma} and TNF-{alpha} were also found to cooperate in the induction of fractalkine in endothelial cells and astrocytes (29, 30). Interestingly, in endothelial cells we have found that IL-1{beta} could replace TNF-{alpha} as a cooperative stimulus to IFN-{gamma} (A. Ludwig and R. Joshi, unpublished observations), whereas in SMC IL-1{beta} was neither able to induce fractalkine by itself nor act as a costimulus. Taken together, IFN-{gamma} and TNF-{alpha} regulate fractalkine expression in endothelial and SMC in a similar fashion, whereas the effect of IL-1{beta} in these cells is different. These findings indicate that in smooth muscle as well as endothelial cells expression of fractalkine is under tight control of several, but not necessarily the same, cytokines and that multiple stimuli have to be present to obtain optimal induction of the chemokine.

We demonstrate here that cytokine-stimulated SMC express fractalkine on the cell surface and are capable of cleaving the molecule from the cell surface to produce a soluble chemokine. We have shown here that soluble fractalkine derived from SMC cultures is biologically active, as it was found to be responsible for the induction of calcium transients in CX3CR1-expressing cells by SMC-conditioned medium. Of course, besides fractalkine, cytokine-stimulated SMC also release other potent chemoattractants such as MCP-1, as shown here and by others (3, 4, 6). Like fractalkine, MCP-1 is known to activate monocytes (31) via its specific receptor (CCR2) expressed on these cells. In fact, selective neutralization of MCP-1 and fractalkine with mAbs revealed that of the two chemokines, MCP-1 dominates in its contribution to the monocyte chemotactic activity of SMC-conditioned medium. Thus, in this model among the various chemoattractants released by cytokine-stimulated SMC, fractalkine does not play a major role as chemotactic mediator for monocytes. Instead, SMC-expressed fractalkine functions as a membrane-anchored molecule, promoting adhesive properties for monocytes. This was demonstrated by blocking fractalkine and MCP-1 receptors on monocytes with soluble chemokines, a procedure previously used as a tool to evaluate the role of fractalkine in monocyte endothelial interaction (16, 21). Using this method we show that the adhesion of THP-1 cells to cytokine-stimulated SMC is largely dependent on fractalkine, but not on MCP-1. This finding was further supported by neutralizing SMC-expressed fractalkine with a mAb, resulting in >80% inhibition of monocyte adhesion. Taken together, these data strongly suggest that the interaction of membrane-expressed fractalkine on activated SMC with CXC3R1 on monocytes is responsible for a considerable fraction of the adhesion between the two cell types.

We also provide evidence that an SMC-derived zinc-dependent protease is involved in fractalkine cleavage. Two different hydroxamate inhibitors that chelate the zinc atom at the active site of metalloproteinases (22, 23) completely block cleavage of fractalkine and its release into the supernatant of SMC. In the presence of the inhibitors, fractalkine was found to accumulate as a membrane-bound molecule on the cell surface, which consequently increased the fractalkine-dependent fraction of adhesion between monocytes and SMC. These findings indicate that a metalloproteinase activity is regulating the adhesive properties of SMC, and this is at least partially due to inhibition of fractalkine cleavage. Interestingly, several cell types, including endothelial cells and macrophages, that can be stimulated to express fractalkine have been shown to possess endogenous cleavage activity for the chemokine (8, 13). In fact, in a previous study we found that batimastat is also capable of blocking fractalkine cleavage in endothelial cells (15), suggesting that the same class of protease is responsible for cleavage of the chemokine in these different cell types. In an attempt to characterize the protease(s) involved we have tested selective inhibitors for MMP2 and MMP9. However, as these potent inhibitors were unable to block the generation of soluble fractalkine in SMC, we can exclude a role for the latter proteases in fractalkine cleavage. Very recently it was demonstrated that the TNF-{alpha}-converting enzyme of the disintegrin- and metalloproteinase-like protein family is involved in the phorbol-myristate acetate-inducible cleavage of transfected fractalkine in ECV 304 cells, but not in the constitutive cleavage (32). As soon as well-characterized inhibitors for TNF-{alpha}-converting enzyme are available it will be intriguing to elucidate the role of this protease in the cleavage of endogenous fractalkine from SMC.

The expression of fractalkine in endothelial cells (8) and macrophages (9) suggests a role for the molecule in the vascular inflammation. Our data further extend this idea by demonstrating for the first time that vascular SMC may constitute another potent source of fractalkine in the vasculature. According to our in vitro data, fractalkine will be up-regulated in SMC exposed to the inflammatory cytokines IFN-{gamma} and TNF-{alpha}. Such a situation may be envisaged in acute as well as chronic inflammatory reactions, such as bacterial infection, transplant rejection, vasculitis, and atherosclerosis, where inflammatory cytokines, including IFN-{gamma} and TNF-{alpha}, are very likely to be present. However, evidence for a role of fractalkine in animal models of these diseases is still rare and controversial. Mice lacking fractalkine or CX3CR1 have been generated by targeted gene disruption and investigated in various inflammatory models, but to date no abnormalities have been reported (33, 34). More positive results have been obtained by blocking CX3CR1 in rats with a neutralizing Ab, resulting in a prolonged survival of cardiac allografts (35) and prevention of experimentally induced crescentic glomerulonephritis in the animals (36). Furthermore, a recently published study has described a genetic polymorphism found in the gene encoding the fractalkine human receptor, resulting in a valine to isoleucine shift at position 249. This polymorphism is reported to decrease the number of fractalkine binding sites on PBMC and has been associated with a reduced risk for atherosclerosis in heterozygote individuals (37) as well as increased vascular endothelial dysfunction (38). Studies on whether fractalkine or CX3CR1 deletion in mice would affect atherosclerosis have not yet been published and are eagerly awaited. Furthermore, a histological analysis of inflamed vascular tissue that would allow delineation of fractalkine expression in smooth muscle under disease conditions has not yet been reported. Addressing this issue, we recently obtained preliminary evidence that fractalkine protein is localized to the medial smooth muscle layer in atherosclerotic plaques (A. Ludwig and T. Reape, unpublished observations). This observation supports our hypothesis that SMC-derived fractalkine contributes to the development of this disease. The early induction of fractalkine by SMC following an inflammatory insult could be important in establishing a tight adhesion between SMC and inflammatory cells, such as monocytes, infiltrating the lesion. However, any extended role in the process must also depend on the activity of the fractalkine-cleaving protease. Interestingly, within the atherosclerotic lesions several types of metalloproteinases of the MMP class (27, 39) and TNF-{alpha}-converting enzyme of the disintegrin- and metalloproteinase-like protein family (40) are reportedly up-regulated. Increased cleavage of membrane-expressed fractalkine could be envisaged to have several consequences on monocyte recruitment within the lesion. On the one hand, enhanced generation of soluble fractalkine would lead to the production of a local chemoattractive concentration gradient within the vascular wall, resulting ultimately in the attraction of further monocytes to the SMC. On the other hand, due to the lack of transmembrane, fractalkine SMC would not establish a tight cellular contact to the recruited inflammatory cells. It may be imagined that increased monocyte infiltration in parallel with the reduced tissue cohesion via fractalkine constitute critical regulatory factors contributing to the destabilization of the atherosclerotic plaque.


    Acknowledgments
 
We thank David Greaves and Andrew Lucas (Sir William Dun School of Pathology, University of Oxford, Oxford, U.K.) as well as Greg Murphy and Martin Benson (GlaxoSmithKline) for helpful discussions and critical review of the manuscript.


    Footnotes
 
1 This work was supported by the European Commission, Marie Curie Industry Host Fellowship, HPMI-CT-1999-0007. Back

2 Address correspondence and reprint requests to Dr. Andreas Ludwig, Department of Vascular Biology, GlaxoSmithKline, Cold Harbor Road, Harlow, Essex, U.K. CM19 5AW. E-mail address: andreas_2_ludwig@sbphrd.com or aludwig{at}web.de Back

3 Abbreviations used in this paper: SMC, smooth muscle cell; MCP-1, monocyte chemoattractant protein-1; MMP, matrix metalloproteinase; TIMP, tissue inhibitor of metalloproteinase. Back

Received for publication August 10, 2001. Accepted for publication November 2, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mackay, C. R.. 2001. Chemokines: immunology’s high impact factors. Nat. Immunol 2:95.[Medline]
  2. Gerard, C., B. J. Rollins. 2001. Chemokines and disease. Nat. Immunol 2:108.[Medline]
  3. Denger, S., L. Jahn, P. Wende, L. Watson, S. H. Gerber, W. Kubler, J. Kreuzer. 1999. Expression of monocyte chemoattractant protein-1 cDNA in vascular smooth muscle cells: induction of the synthetic phenotype: a possible clue to SMC differentiation in the process of atherogenesis. Atherosclerosis 144:15.[Medline]
  4. Wang, J. M., A. Sica, G. Peri, S. Walter, I. M. Padura, P. Libby, M. Ceska, I. Lindley, F. Colotta, A. Mantovani. 1991. Expression of monocyte chemotactic protein and interleukin-8 by cytokine-activated human vascular smooth muscle cells. Arterioscler. Thromb. 11:1166.[Abstract/Free Full Text]
  5. Reape, T. J., K. Rayner, C. D. Manning, A. N. Gee, M. S. Barnette, K. G. Burnand, P. H. Groot. 1999. Expression and cellular localization of the CC chemokines PARC and ELC in human atherosclerotic plaques. Am. J. Pathol. 154:365.[Abstract/Free Full Text]
  6. Abi-Younes, S., A. Sauty, F. Mach, G. K. Sukhova, P. Libby, A. D. Luster. 2000. The stromal cell-derived factor-1 chemokine is a potent platelet agonist highly expressed in atherosclerotic plaques. Circ. Res. 86:131.[Abstract/Free Full Text]
  7. Haley, K. J., C. M. Lilly, J. H. Yang, Y. Feng, S. P. Kennedy, T. G. Turi, J. F. Thompson, G. H. Sukhova, P. Libby, R. T. Lee. 2000. Overexpression of eotaxin and the CCR3 receptor in human atherosclerosis: using genomic technology to identify a potential novel pathway of vascular inflammation. Circulation 102:2185.[Abstract/Free Full Text]
  8. Bazan, J. F., K. B. Bacon, G. Hardiman, W. Wang, K. Soo, D. Rossi, D. R. Greaves, A. Zlotnik, T. J. Schall. 1997. A new class of membrane-bound chemokine with a CX3C motif. Nature 385:640.[Medline]
  9. Greaves, D. R., T. Hakkinen, A. D. Lucas, K. Liddiard, E. Jones, C. M. Quinn, J. Senaratne, F. R. Green, K. Tyson, J. Boyle, et al 2001. Linked chromosome 16q13 chemokines, macrophage-derived chemokine, fractalkine, and thymus- and activation-regulated chemokine, are expressed in human atherosclerotic lesions. Arterioscler. Thromb. Vasc. Biol. 21:923.[Abstract/Free Full Text]
  10. Kanazawa, N., T. Nakamura, K. Tashiro, M. Muramatsu, K. Morita, K. Yoneda, K. Inaba, S. Imamura, T. Honjo. 1999. Fractalkine and macrophage-derived chemokine: T cell-attracting chemokines expressed in T cell area dendritic cells. Eur. J. Immunol. 29:1925.[Medline]
  11. Papadopoulos, E. J., C. Sassetti, H. Saeki, N. Yamada, T. Kawamura, D. J. Fitzhugh, M. A. Saraf, T. Schall, A. Blauvelt, S. D. Rosen, et al 1999. Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur. J. Immunol. 29:2551.[Medline]
  12. Harrison, J. K., Y. Jiang, S. Chen, Y. Xia, D. Maciejewski, R. K. McNamara, W. J. Streit, M. N. Salafranca, S. Adhikari, D. A. Thompson, et al 1998. Role for neuronally derived fractalkine in mediating interactions between neurons and CX3CR1-expressing microglia. Proc. Natl. Acad. Sci. USA 95:10896.[Abstract/Free Full Text]
  13. Lucas, A. D., N. Chadwick, B. F. Warren, D. P. Jewell, S. Gordon, F. Powrie, D. R. Greaves. 2001. The transmembrane form of the CX3CL1 chemokine fractalkine is expressed predominantly by epithelial cells in vivo. Am. J. Pathol. 158:855.[Abstract/Free Full Text]
  14. Muehlhoefer, A., L. J. Saubermann, X. Gu, K. Luedtke-Heckenkamp, R. Xavier, R. S. Blumberg, D. K. Podolsky, R. P. MacDermott, H. C. Reinecker. 2000. Fractalkine is an epithelial and endothelial cell-derived chemoattractant for intraepithelial lymphocytes in the small intestinal mucosa. J. Immunol. 164:3368.[Abstract/Free Full Text]
  15. Chapman, G. A., K. Moores, D. Harrison, C. A. Campbell, B. R. Stewart, P. J. Strijbos. 2000. Fractalkine cleavage from neuronal membranes represents an acute event in the inflammatory response to excitotoxic brain damage. J. Neurosci. 20:RC87.
  16. Imai, T., K. Hieshima, C. Haskell, M. Baba, M. Nagira, M. Nishimura, M. Kakizaki, S. Takagi, H. Nomiyama, T. J. Schall, et al 1997. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91:521.[Medline]
  17. Combadiere, C., K. Salzwedel, E. D. Smith, H. L. Tiffany, E. A. Berger, P. M. Murphy. 1998. Identification of CX3CR1: a chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV-1. J. Biol. Chem. 273:23799.[Abstract/Free Full Text]
  18. Al Aoukaty, A., B. Rolstad, A. Giaid, A. A. Maghazachi. 1998. MIP-3{alpha}, MIP-3{beta} and fractalkine induce the locomotion and the mobilization of intracellular calcium, and activate the heterotrimeric G proteins in human natural killer cells. Immunology 95:618.[Medline]
  19. Haskell, C. A., M. D. Cleary, I. F. Charo. 1999. Molecular uncoupling of fractalkine-mediated cell adhesion and signal transduction: rapid flow arrest of CX3CR1-expressing cells is independent of G-protein activation. J. Biol. Chem. 274:10053.[Abstract/Free Full Text]
  20. Fong, A. M., L. A. Robinson, D. A. Steeber, T. F. Tedder, O. Yoshie, T. Imai, D. D. Patel. 1998. Fractalkine and CX3CR1 mediate a novel mechanism of leukocyte capture, firm adhesion, and activation under physiologic flow. J. Exp. Med. 188:1413.[Abstract/Free Full Text]
  21. Chapman, G. A., K. E. Moores, J. Gohil, T. A. Berkhout, L. Patel, P. Green, C. H. Macphee, B. R. Stewart. 2000. The role of fractalkine in the recruitment of monocytes to the endothelium. Eur. J. Pharmacol. 392:189.[Medline]
  22. Grams, F., M. Crimmin, L. Hinnes, P. Huxley, M. Pieper, H. Tschesche, W. Bode. 1995. Structure determination and analysis of human neutrophil collagenase complexed with a hydroxamate inhibitor. Biochemistry 34:14012.[Medline]
  23. Botos, I., L. Scapozza, D. Zhang, L. A. Liotta, E. F. Meyer. 1996. Batimastat, a potent matrix metalloproteinase inhibitor, exhibits an unexpected mode of binding. Proc. Natl. Acad. Sci. USA 93:2749.[Abstract/Free Full Text]
  24. Berkhout, T. A., H. M. Sarau, K. Moores, J. R. White, N. Elshourbagy, E. Appelbaum, R. J. Reape, M. Brawner, J. Makwana, J. J. Foley, et al 1997. Cloning, in vitro expression, and functional characterization of a novel human CC chemokine of the monocyte chemotactic protein (MCP) family (MCP-4) that binds and signals through the CC chemokine receptor 2B. J. Biol. Chem. 272:16404.[Abstract/Free Full Text]
  25. Gonnella, N. C., R. Bohacek, X. Zhang, I. Kolossvary, C. G. Paris, R. Melton, C. Winter, S. I. Hu, V. Ganu. 1995. Bioactive conformation of stromelysin inhibitors determined by transferred nuclear Overhauser effects. Proc. Natl. Acad. Sci. USA 92:462.[Abstract/Free Full Text]
  26. Galis, Z. S., M. Muszynski, G. K. Sukhova, E. Simon-Morrissey, P. Libby. 1995. Enhanced expression of vascular matrix metalloproteinases induced in vitro by cytokines and in regions of human atherosclerotic lesions. Ann. NY Acad. Sci. 748:501.[Medline]
  27. Galis, Z. S., G. K. Sukhova, M. W. Lark, P. Libby. 1994. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J. Clin. Invest. 94:2493.
  28. Goda, S., T. Imai, O. Yoshie, O. Yoneda, H. Inoue, Y. Nagano, T. Okazaki, H. Imai, E. T. Bloom, N. Domae, et al 2000. CX3C-chemokine, fractalkine-enhanced adhesion of THP-1 cells to endothelial cells through integrin-dependent and -independent mechanisms. J. Immunol. 164:4313.[Abstract/Free Full Text]
  29. Fraticelli, P., M. Sironi, G. Bianchi, D. D’Ambrosio, C. Albanesi, A. Stoppacciaro, M. Chieppa, P. Allavena, L. Ruco, G. Girolomoni, et al 2001. Fractalkine (CX3CL1) as an amplification circuit of polarized Th1 responses. J. Clin. Invest. 107:1173.[Medline]
  30. Yoshida, H., T. Imaizumi, K. Fujimoto, N. Matsuo, K. Kimura, X. Cui, T. Matsumiya, K. Tanji, T. Shibata, W. Tamo, et al 2001. Synergistic stimulation, by tumor necrosis factor-{alpha} and interferon-{gamma}, of fractalkine expression in human astrocytes. Neurosci. Lett. 303:132.[Medline]
  31. Rollins, B. J., A. Walz, M. Baggiolini. 1991. Recombinant human MCP-1/JE induces chemotaxis, calcium flux, and the respiratory burst in human monocytes. Blood 78:1112.[Abstract/Free Full Text]
  32. Garton, K. J., P. J. Gough, C. P. Blobel, G. Murphy, D. R. Greaves, P. J. Dempsey, E. W. Raines. 2001. Tumor necrosis factor-{alpha}-converting enzyme (ADAM17) mediates the cleavage and shedding of fractalkine (CX3CL1). J. Biol. Chem. 276:37993.[Abstract/Free Full Text]
  33. Cook, D. N., S. C. Chen, L. M. Sullivan, D. J. Manfra, M. T. Wiekowski, D. M. Prosser, G. Vassileva, S. A. Lira. 2001. Generation and analysis of mice lacking the chemokine fractalkine. Mol. Cell. Biol. 21:3159.[Abstract/Free Full Text]
  34. Jung, S., J. Aliberti, P. Graemmel, M. J. Sunshine, G. W. Kreutzberg, A. Sher, D. R. Littman. 2000. Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol. Cell. Biol. 20:4106.[Abstract/Free Full Text]
  35. Robinson, L. A., C. Nataraj, D. W. Thomas, D. N. Howell, R. Griffiths, V. Bautch, D. D. Patel, L. Feng, T. M. Coffman. 2000. A role for fractalkine and its receptor (CX3CR1) in cardiac allograft rejection. J. Immunol. 165:6067.[Abstract/Free Full Text]
  36. Feng, L., S. Chen, G. E. Garcia, Y. Xia, M. A. Siani, P. Botti, C. B. Wilson, J. K. Harrison, K. B. Bacon. 1999. Prevention of crescentic glomerulonephritis by immunoneutralization of the fractalkine receptor CX3CR1 rapid communication. Kidney Int. 56:612.[Medline]
  37. Moatti, D., S. Faure, F. Fumeron, M. Amara, P. Seknadji, D. H. McDermott, P. Debre, M. C. Aumont, P. M. Murphy, D. de Prost, et al 2001. Polymorphism in the fractalkine receptor CX3CR1 as a genetic risk factor for coronary artery disease. Blood 97:1925.[Abstract/Free Full Text]
  38. McDermott, D. H., J. P. Halcox, W. H. Schenke, M. A. Waclawiw, M. N. Merrell, N. Epstein, A. A. Quyyumi, P. M. Murphy. 2001. Association between polymorphism in the chemokine receptor CX3CR1 and coronary vascular endothelial dysfunction and atherosclerosis. Circ. Res. 89:401.[Abstract/Free Full Text]
  39. Knox, J. B., G. K. Sukhova, A. D. Whittemore, P. Libby. 1997. Evidence for altered balance between matrix metalloproteinases and their inhibitors in human aortic diseases. Circulation 95:205.[Abstract/Free Full Text]
  40. Herren, B., E. W. Raines, R. Ross. 1997. Expression of a disintegrin-like protein in cultured human vascular cells and in vivo. FASEB J. 11:173.[Abstract]



This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
M. J. Koziolek, G.-A. Muller, A. Zapf, D. Patschan, H. Schmid, C. D. Cohen, S. Koschnick, R. Vasko, C. Bramlage, and F. Strutz
Role of CX3C-chemokine CX3C-L/fractalkine expression in a model of slowly progressive renal failure
Nephrol. Dial. Transplant., November 24, 2009; (2009) gfp602v1.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. E. White, T. C.C. Tan, A. E. John, C. Whatling, W. L. McPheat, and D. R. Greaves
Fractalkine has anti-apoptotic and proliferative effects on human vascular smooth muscle cells via epidermal growth factor receptor signalling
Cardiovasc Res, November 12, 2009; (2009) cvp341v2.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-W. Huang, P. Su, G. Y. Liu, M. R. Crow, D. Chaukos, H. Yan, and L. A. Robinson
Constitutive Endocytosis of the Chemokine CX3CL1 Prevents Its Degradation by Cell Surface Metalloproteases
J. Biol. Chem., October 23, 2009; 284(43): 29644 - 29653.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H.-J. Kim, E.-K. Yoo, J.-Y. Kim, Y.-K. Choi, H.-J. Lee, J.-K. Kim, N. H. Jeoung, K.-U. Lee, I.-S. Park, B.-H. Min, et al.
Protective Role of Clusterin/Apolipoprotein J Against Neointimal Hyperplasia via Antiproliferative Effect on Vascular Smooth Muscle Cells and Cytoprotective Effect on Endothelial Cells
Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1558 - 1564.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Landsman, L. Bar-On, A. Zernecke, K.-W. Kim, R. Krauthgamer, E. Shagdarsuren, S. A. Lira, I. L. Weissman, C. Weber, and S. Jung
CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival
Blood, January 22, 2009; 113(4): 963 - 972.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. A. Truman, C. A. Ford, M. Pasikowska, J. D. Pound, S. J. Wilkinson, I. E. Dumitriu, L. Melville, L. A. Melrose, C. A. Ogden, R. Nibbs, et al.
CX3CL1/fractalkine is released from apoptotic lymphocytes to stimulate macrophage chemotaxis
Blood, December 15, 2008; 112(13): 5026 - 5036.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Hermand, F. Pincet, S. Carvalho, H. Ansanay, E. Trinquet, M. Daoudi, C. Combadiere, and P. Deterre
Functional Adhesiveness of the CX3CL1 Chemokine Requires Its Aggregation: ROLE OF THE TRANSMEMBRANE DOMAIN
J. Biol. Chem., October 31, 2008; 283(44): 30225 - 30234.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. E. Cardona, M. Li, L. Liu, C. Savarin, and R. M. Ransohoff
Chemokines in and out of the central nervous system: much more than chemotaxis and inflammation
J. Leukoc. Biol., September 1, 2008; 84(3): 587 - 594.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
I. P. Luttrell, M. Swee, B. Starcher, W. C. Parks, and K. Chitaley
Erectile dysfunction in the type II diabetic db/db mouse: impaired venoocclusion with altered cavernosal vasoreactivity and matrix
Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2204 - H2211.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. Ryu, C.-W. Lee, K.-H. Hong, J.-A. Shin, S.-H. Lim, C.-S. Park, J. Shim, K. B. Nam, K.-J. Choi, Y.-H. Kim, et al.
Activation of fractalkine/CX3CR1 by vascular endothelial cells induces angiogenesis through VEGF-A/KDR and reverses hindlimb ischaemia
Cardiovasc Res, May 1, 2008; 78(2): 333 - 340.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
H. Loppnow, K. Werdan, and M. Buerke
Invited review: Vascular cells contribute to atherosclerosis by cytokine- and innate-immunity-related inflammatory mechanisms
Innate Immunity, April 1, 2008; 14(2): 63 - 87.
[Abstract] [PDF]


Home page
JNMHome page
L. G. Spagnoli, E. Bonanno, G. Sangiorgi, and A. Mauriello
Role of Inflammation in Atherosclerosis
J. Nucl. Med., November 1, 2007; 48(11): 1800 - 1815.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Barlic, Y. Zhang, and P. M. Murphy
Atherogenic Lipids Induce Adhesion of Human Coronary Artery Smooth Muscle Cells to Macrophages by Up-regulating Chemokine CX3CL1 on Smooth Muscle Cells in a TNF{alpha}-NF{kappa}B-dependent Manner
J. Biol. Chem., June 29, 2007; 282(26): 19167 - 19176.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Hundhausen, A. Schulte, B. Schulz, M. G. Andrzejewski, N. Schwarz, P. von Hundelshausen, U. Winter, K. Paliga, K. Reiss, P. Saftig, et al.
Regulated Shedding of Transmembrane Chemokines by the Disintegrin and Metalloproteinase 10 Facilitates Detachment of Adherent Leukocytes
J. Immunol., June 15, 2007; 178(12): 8064 - 8072.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. Barlic, Y. Zhang, J. F. Foley, and P. M. Murphy
Oxidized Lipid-Driven Chemokine Receptor Switch, CCR2 to CX3CR1, Mediates Adhesion of Human Macrophages to Coronary Artery Smooth Muscle Cells Through a Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Pathway
Circulation, August 22, 2006; 114(8): 807 - 819.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Green, K. H. Han, Y. Chen, F. Almazan, I. F. Charo, Y. I. Miller, and O. Quehenberger
The CC Chemokine MCP-1 Stimulates Surface Expression of CX3CR1 and Enhances the Adhesion of Monocytes to Fractalkine/CX3CL1 via p38 MAPK.
J. Immunol., June 15, 2006; 176(12): 7412 - 7420.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Chabot, J. S. Wagner, S. Farrant, and M. R. Neutra
TLRs Regulate the Gatekeeping Functions of the Intestinal Follicle-Associated Epithelium
J. Immunol., April 1, 2006; 176(7): 4275 - 4283.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
O. Obreja, W. Biasio, M. Andratsch, K. S. Lips, P. K. Rathee, A. Ludwig, S. Rose-John, and M. Kress
Fast modulation of heat-activated ionic current by proinflammatory interleukin 6 in rat sensory neurons
Brain, July 1, 2005; 128(7): 1634 - 1641.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G.-Y. Liu, V. Kulasingam, R. T. Alexander, N. Touret, A. M. Fong, D. D. Patel, and L. A. Robinson
Recycling of the Membrane-anchored Chemokine, CX3CL1
J. Biol. Chem., May 20, 2005; 280(20): 19858 - 19866.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. J. Hannan, R. L. Jones, H. O. D. Critchley, G. J. Kovacs, P. A. W. Rogers, B. Affandi, and L. A. Salamonsen
Coexpression of Fractalkine and Its Receptor in Normal Human Endometrium and in Endometrium from Users of Progestin-Only Contraception Supports a Role for Fractalkine in Leukocyte Recruitment and Endometrial Remodeling
J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 6119 - 6129.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. B. Sukkar, R. Issa, S. Xie, U. Oltmanns, R. Newton, and K. F. Chung
Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-{gamma} and TNF-{alpha} and regulation by TGF-{beta} and corticosteroids
Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1230 - L1240.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Abel, C. Hundhausen, R. Mentlein, A. Schulte, T. A. Berkhout, N. Broadway, D. Hartmann, R. Sedlacek, S. Dietrich, B. Muetze, et al.
The Transmembrane CXC-Chemokine Ligand 16 Is Induced by IFN-{gamma} and TNF-{alpha} and Shed by the Activity of the Disintegrin-Like Metalloproteinase ADAM10
J. Immunol., May 15, 2004; 172(10): 6362 - 6372.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Daoudi, E. Lavergne, A. Garin, N. Tarantino, P. Debre, F. Pincet, C. Combadiere, and P. Deterre
Enhanced Adhesive Capacities of the Naturally Occurring Ile249-Met280 Variant of the Chemokine Receptor CX3CR1
J. Biol. Chem., May 7, 2004; 279(19): 19649 - 19657.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
Y.-M. Chen, M.-I Hu-Tsai, S.-L. Lin, T.-J. Tsai, and B.-S. Hsieh
Expression of CX3CL1/fractalkine by mesangial cells in vitro and in acute anti-Thy1 glomerulonephritis in rats
Nephrol. Dial. Transplant., December 1, 2003; 18(12): 2505 - 2514.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. D. Lucas, C. Bursill, T. J. Guzik, J. Sadowski, K. M. Channon, and D. R. Greaves
Smooth Muscle Cells in Human Atherosclerotic Plaques Express the Fractalkine Receptor CX3CR1 and Undergo Chemotaxis to the CX3C Chemokine Fractalkine (CX3CL1)
Circulation, November 18, 2003; 108(20): 2498 - 2504.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Lavergne, B. Combadiere, O. Bonduelle, M. Iga, J.-L. Gao, M. Maho, A. Boissonnas, P. M. Murphy, P. Debre, and C. Combadiere
Fractalkine Mediates Natural Killer-Dependent Antitumor Responses in Vivo
Cancer Res., November 1, 2003; 63(21): 7468 - 7474.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. M. Haynes, L. P. Jones, A. Barskey, L. J. Anderson, and R. A. Tripp
Enhanced Disease and Pulmonary Eosinophilia Associated with Formalin-Inactivated Respiratory Syncytial Virus Vaccination Are Linked to G Glycoprotein CX3C-CX3CR1 Interaction and Expression of Substance P
J. Virol., September 15, 2003; 77(18): 9831 - 9844.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Hundhausen, D. Misztela, T. A. Berkhout, N. Broadway, P. Saftig, K. Reiss, D. Hartmann, F. Fahrenholz, R. Postina, V. Matthews, et al.
The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion
Blood, August 15, 2003; 102(4): 1186 - 1195.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Martinez-Pomares, D. M. Reid, G. D. Brown, P. R. Taylor, R. J. Stillion, S. A. Linehan, S. Zamze, S. Gordon, and S. Y. C. Wong
Analysis of mannose receptor regulation by IL-4, IL-10, and proteolytic processing using novel monoclonal antibodies
J. Leukoc. Biol., May 1, 2003; 73(5): 604 - 613.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. D. Silverman, D. O. Zamora, Y. Pan, P. V. Texeira, S.-H. Baek, S. R. Planck, and J. T. Rosenbaum
Constitutive and Inflammatory Mediator-Regulated Fractalkine Expression in Human Ocular Tissues and Cultured Cells
Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1608 - 1615.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ludwig, A.
Right arrow Articles by Chapman, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ludwig, A.
Right arrow Articles by Chapman, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS