| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
and TNF-
and Is Modulated by Metalloproteinase Activity1
Departments of
*
Vascular Biology and
Neuroscience, GlaxoSmithKline, Harlow, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and TNF-
, but not
IL-1
, cooperate synergistically to induce fractalkine mRNA and
protein expression in cultured aortic SMC. We also report the release
of functional, soluble fractalkine from the membranes of stimulated
SMC. This release is inhibited by the zinc metalloproteinase inhibitor
batimastat, resulting in the accumulation of membrane-associated
fractalkine on the SMC surface. Therefore, an SMC-derived
metalloproteinase activity is involved in fractalkine shedding. While
soluble fractalkine present in SMC-conditioned medium is capable of
inducing calcium transients in cells expressing the fractalkine
receptor (CX3CR1), blocking experiments using neutralizing Abs reveal
that it can be inactivated without affecting the chemotactic activity
of SMC-conditioned media on monocytes. However, membrane-bound
fractalkine plays a major role in promoting adhesion of monocytic cells
to activated SMC. This fractalkine-mediated adhesion is further
enhanced in the presence of batimastat, indicating that shedding of
fractalkine from the cell surface down-regulates the adhesive
properties of SMC. Hence, during vascular inflammation, the synergistic
induction of fractalkine by IFN- and TNF- together with its
metalloproteinase-mediated cleavage may finely control the recruitment
of monocytes to SMC within the blood vessel wall. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IFN-, or TNF-
(3, 4, 5, 6, 7). Thus, by secreting chemokines SMC have the
potential to contribute to the recruitment of leukocytes, thereby
influencing the inflammatory reaction in vascular disease.
Among the chemokines, fractalkine (also termed CX3C-chemokine ligand 1)
is unusual because it is encoded as a transmembrane molecule consisting
of a chemokine domain linked to a transmembrane domain by a mucin-rich
stalk (8). The full-length molecule can be cleaved from
the cell membrane to produce a soluble form comprising the chemokine
domain and most of the stalk region (8). Human fractalkine
was originally described as being induced in endothelial cells upon
stimulation with IL-1 or TNF- (8). In addition,
fractalkine was found to be expressed in IL-4-stimulated macrophages
(9), dendritic cells (10, 11), neurons
(12), and epithelial cells (13, 14). Besides
expressing fractalkine on the cell membrane endothelial cells, neurons
and epithelial cells have been reported to release soluble fractalkine
by proteolytic cleavage (8, 13, 14, 15). Although the
responsible protease has yet to be identified, our recent observations
describing inhibition of fractalkine cleavage by batimastat, a broad
spectrum metalloproteinase inhibitor, have shed some light on the
protease involved (15). In addition to the regulation at
the level of protein synthesis, proteolytic cleavage of fractalkine may
further control the biologic activity of the chemokine. Fractalkine is
unique among chemokines because it can mediate two distinct biological
actions. Soluble fractalkine acts as a chemoattractant, whereas the
membrane-bound molecule functions as an adhesion molecule. Chemotaxis
and adhesion are both mediated by a single type of G protein-coupled
receptor termed CX3CR1 (15, 16, 17). CX3CR1 is expressed on a
number of leukocytes, including monocytes, T cell subsets, and NK cells
(16, 18). These cells not only migrate in response to
chemotactic gradients of soluble fractalkine but also adhere to cells
expressing fractalkine on their cell surface (8, 16).
While chemotaxis involves signaling of receptor-coupled pertussis
toxin-sensitive G proteins, this signaling is not required for
adhesion (8, 16, 19, 20). Furthermore, adhesion
mediated by fractalkine and its receptor was shown to be resistant to
physiologic shear flow and to be independent of calcium (16, 19, 20).
Expression of fractalkine in vascular endothelial cells has been
reported. However, the expression of this chemokine in other vessel
cells has not been investigated. In this report we describe the
expression of fractalkine in aortic SMC following stimulation with
inflammatory cytokines. Whereas TNF- and IFN- applied
independently are weak inducers of the chemokine, the cytokines
cooperate synergistically to increase fractalkine message and protein
surface expression dramatically. We show that membrane-bound
fractalkine functions to promote tight adhesion of monocytes to
activated SMC and that fractalkine-mediated adhesion is regulated by a
metalloproteinase converting the membrane-expressed fractalkine into
its soluble form. Our findings suggest that the role of SMC-derived
fractalkine in vascular inflammation is dependent on the presence of
TNF- and IFN- as well as the activity of the fractalkine-cleaving
metalloproteinase.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recombinant extracellular domain fractalkine, chemokine domain
fractalkine, human TNF-, and human IFN- were purchased from
R&D Systems (Oxon, U.K.). Neutralizing Abs to human fractalkine clone
(51637.11) and MCP-1 (clone 24822.111), PE-conjugated mAb to human
fractalkine (clone 51637.11), as well as PE-conjugated and unconjugated
mouse IgG1 isotype control (clone 11711.11) were obtained from R&D
Systems. The antiserum against fractalkine was raised in rabbits and
tested for its specificity to recognize fractalkine in Western blots by
using lysates from fractalkine-transfected and untransfected ECV 304
cells as previously described (21). Hydroxamate-based
metalloproteinase inhibitors were synthesized at GlaxoSmithKline
(Harlow, U.K.) and stored as 20 mM stock solutions in
dimethylsulfoxide. Tissue inhibitors of metalloproteinase type 1 and
type 2 (TIMP1 and TIMP2, respectively) were obtained from R&D Systems.
All inhibitors were controlled for inhibition of gelatinase activity
mediated by matrix metalloproteinase (MMP)2.
Cell culture, transfection, and monocyte isolation
Cryopreserved human aortic SMC from three different donors were
obtained from BioWhittaker (Berkshire, U.K.). SMC were cultured
according to the manufacturer’s instructions in SMC basal medium
supplemented with 0.5 ng/ml human epidermal growth factor, 5 µg/ml
insulin, 2 ng/ml human fibroblast growth factor, 50 µg/ml gentamicin,
50 ng/ml amphotericin B, and 5% FCS. The medium was replaced every
2–3 days until confluence was reached, and SMC were subsequently
subcultured after treatment with 0.025% trypsin and 0.01% EDTA
(BioWhittaker). SMC used in these experiments were between passages 4
and 8. Cells were identified as SMC by positive staining with a
specific Ab (HHF35) for SMC -actin and negative staining with a
specific Ab (F8/86) for von Willebrand factor (both from DAKO,
Ely, U.K.). The human monocytic leukemia cell line THP-1 was
cultured in RPMI 1640 medium supplemented with 10% FCS and 2 mM
glutamine (all reagents from Life Technologies, Paisley, U.K.).
CX3CR1-expressing human embryonic kidney cells, HEK 293, were grown in
MEM containing Earle’s salts, 2.2 g/l sodium bicarbonate, 2 mM
L-glutamine, nonessential amino acids, 10% FCS, and 400
µg/ml geneticin (all reagents from Life Technologies). This cell line
had been generated by transfection with the CX3CR1 coding region
amplified with 5' (BamHI) and 3' (EcoRI) primers,
and cloned into BamHI (5') and EcoRI (3') sites
in the polylinker region of the pCDN expression vector (Invitrogen,
Groningen, The Netherlands) using Lipofectamine Plus (Life
Technologies) as transfection reagent. Human monocytes were isolated
from whole blood freshly taken from healthy volunteers. In brief, 90 ml
of blood was collected into 0.9 ml of 50 mM EDTA (pH 7.4) and spun down
at 550 x g for 20 min. Buffy coat (10 ml) was
harvested, mixed with 4 ml of Optiprep (Robbins Scientific, Solihull,
U.K.), and then overlaid by a discontinuous density gradient prepared
by different solutions of Optiprep in PBS with 0.5% BSA. The gradient
consisted of 8 ml of density solution of 1.078 g/ml, followed by 20 ml
of density solution of 1.068 g/ml, finally followed by 0.5 ml of PBS.
After centrifugation at 600 x g for 25 min, the
mononuclear cell layer formed at the top of the gradient was harvested,
and the cells were washed once in PBS. More than 80% of the prepared
cells were monocytes as determined by flow cytometric analysis.
Cytokine stimulation of SMC
Human aortic SMC (70–90% confluence) were grown in serum and
growth factor-free basal medium for 24 h before stimulation with
TNF- and IFN- (20 ng/ml) for various lengths of time, with each
condition represented in triplicate. After 24 h, the conditioned
medium was harvested and concentrated 10-fold using Centriprep-3
filtration units (Millipore, Watford, U.K.). After washing with
10 ml of PBS, cells were harvested in Tri-Reagent (Sigma-Aldrich,
Poole, U.K.) for subsequent isolation of nucleic acids. For analysis of
protein, washed cells were harvested in 10 ml of ice-cold versene (Life
Technologies), spun down, and suspended in 200 µl of lysis buffer
(PBS, 0.1% Triton X-100, and complete protease inhibitors; Roche, East
Sussex, U.K.). After 30 min of incubation on ice under agitation, cell
debris was removed by centrifugation at 12,000 x g for
10 min. To study inhibition of fractalkine cleavage from the cell
surface, cell stimulation was performed in the presence of batimastat,
a potent inhibitor of metalloproteinases (22, 23).
Serum-starved SMC received batimastat (20 µM; GlaxoSmithKline) 2
h before stimulation with proinflammatory cytokines. After 24 h of
incubation, the medium content of cleaved fractalkine as well as
uncleaved fractalkine associated with the cell lysates were determined
by Western blotting.
Relative quantitation of mRNA by real-time quantitative RT-PCR
RNA was isolated from cultured SMC using TRIzol reagent (Life Technologies). Total RNA (1 µg) was treated with DNase (Life Technologies) and reverse transcribed to cDNA using Superscript II (Life Technologies) according to the manufacturer’s instructions. For each sample, a parallel RNA was run with no Superscript II to allow for assessment of genomic DNA contamination. Each cDNA sample was analyzed for expression of fractalkine, MCP-1, GAPDH, and cyclophillin by real-time quantitative RT-PCR using the fluorescent TaqMan 5' nuclease assay. Oligonucleotide primers and probes were designed using Primer Express software version 1.0 (PE Biosystems, Warrington, U.K.) and were synthesized by PE Biosystems. The sequences of forward primer, reverse primer, and probe from 5' to 3' were: fractalkine, ACCTGTAGCTTTGCTCATCCA, CTCCAAGATGATTGCGCGT, and AACAGAACCAGGCATCATGCG; MCP-1, GCCAAGGAGATCTGTGCTGAC, TTGCTTGTCCAGGTGGTCC, and CCAAGCAGAACTGGGTTCAGGATTCCA; and GAPDH, CAGAACATCATCCCTGCCTCTA, CCAGTGAGCTTCCCGTTCA, and CTTGCCCACAGCCTTGGCAGC. The 5' nuclease assay PCRs were performed in a MicroAmp Optical 96-well reaction plate and Optical Caps (PE Biosystems) using the ABI PRISM 7700 Sequence Detection System for thermal cycling and real-time fluorescence measurements (PE Biosystems). Each 25-µl reaction consisted of 1x TaqMan Universal PCR Master Mix (PE Biosystems), 300 nM forward primer, 300 nM reverse primer, 100 nM TaqMan quantification probe, and 5 µl of template. Reaction conditions were as follows: 50°C for 2 min, 95°C for 10 min, then 40 cycles of 95°C for 15 s and 60°C for 1 min. Emitted fluorescence for each reaction well was measured every cycle during both the denaturation and annealing/extension phases, and amplification plots were constructed using ABI PRISM 7700 Sequence Detection System software version 1.6 (PE Biosystems). Levels of fractalkine, MCP-1, and GAPDH mRNA were quantified by comparison of the fluorescence generated by each sample with that of a serial diluted standard of known quantities of human genomic DNA (Promega, Southampton, U.K.).
SDS-PAGE and Western blotting
Fractalkine-containing cell lysates and concentrated medium samples were subjected to SDS-PAGE (4–20% precast Tris-glycine gels; Invitrogen, Paisey, U.K.) and transferred onto Immobilon-P membranes (Millipore). Membranes were incubated in blocking buffer (0.05% Tween 20 and 5% milk powder in PBS) at room temperature for 1 h and probed for 1 h with a rabbit antiserum to human fractalkine diluted 1/1000 in blocking buffer. After three washes with PBS/0.05% Tween, membranes were incubated with HRP-linked anti-rabbit Ig (diluted 1/10,000 in PBS/0.05% Tween; Amersham, Little Chalfont, U.K.) for 1 h. After three washes, detection of bound anti-rabbit Ig was conducted using ECL (Amersham) according to the manufacturer’s instructions and was quantified using Chemi-Imager (Flowgen, Lichfield, U.K.).
Flow cytometric analysis
Cultured SMC were detached from culture flasks by treatment with ice-cold versene (Life Technologies) for 10 min and scraping. Cells were fixed in 0.5 ml of 4% paraformaldehyde (Sigma-Aldrich) in PBS for 10 min on ice, washed with PBS, and incubated at 2 x 106 cells/ml with a PE-conjugated mAb to fractalkine or a PE-conjugated IgG1 isotype control (both at 2.5 µg/ml in PBS/0.1% BSA) for 1 h on ice. Following 2-fold washing the fluorescence signal of the labeled cells was analyzed by flow cytometry (EPICS XL-MCL; Coulter, Hialeah, FL) and calculated as the median fluorescence intensity of the gated SMC population.
Measurement of calcium transients
Intracellular calcium transients in CX3CR1-transfected HEK293 cells were assayed using a fluorescence intensity plate reader (Molecular Devices, Menlo Park, CA). CX3CR1-transfected HEK 293 cells were seeded (50,000 cells/well) into poly-D-lysine-coated 96-well, black-wall, clear-bottom microtiter plates (BD Biosciences, Mountain View, CA) 24 h before the assay. Cells were loaded for 1 h with 1 µM fluo-4/AM fluorescent indicator dye (Molecular Probes, Leiden, The Netherlands) in assay buffer (HBSS containing 10 mM HEPES, 200 µM Ca2+, 0.1% BSA, and 2.5 mM probenecid; Molecular Probes), washed twice with 100 µl of assay buffer, and incubated for 10 min in 100 µl of assay buffer before stimulation in the plate reader. For stimulation, cells received either 40 µl of 10-fold concentrated SMC-conditioned medium in 1/2 serial dilutions with assay buffer or defined solutions of recombinant extracellular domain fractalkine in assay buffer. The fluorescence signal was recorded over time, and the maximum change in fluorescence intensity over baseline was calculated to determine the agonist response. Dose response curve data were fitted to a four-parameter logistic equation using GraFit (Erithacus Software, Staines, U.K.).
Monocyte chemotaxis assay
Monocyte chemotaxis assays were performed essentially as previously described (24). As chemotactic stimulus the cells received either 10-fold concentrated SMC-conditioned medium supplemented with 10 mM HEPES in 1/3 serial dilutions with assay buffer (SMC basal medium supplemented with 10 mM HEPES) or defined solutions of recombinant extracellular domain fractalkine or MCP-1 in assay buffer. The number of cells that migrated in response to stimulus solution containing chemoattractant was expressed in relation to that induced by medium only.
Cell adhesion assay
The adhesion of THP-1 cells and monocytes to activated and
nonactivated SMC was determined by seeding 2 x
104 SMC/well into Nunclon 48-well multidishes
(Nunc, Paisley, U.K.). Cells were cultured in full medium until they
reached 90% confluence and subsequently incubated for 24 h in
basal medium without growth factors and serum. Serum-starved cells were
activated with TNF- and IFN- (each 20 ng/ml) in the absence or
the presence of batimastat (20 µM) for 24 h and subsequently
used for adhesion assays with fluorescently labeled THP-1 cells or
human monocytes. For fluorescent labeling cultured THP-1 cells or
freshly prepared monocytes were suspended at 2 x
106 cells/ml in PBS/0.1% BSA and incubated with
10 µM calcein-AM dye (Molecular Probes) for 30 min at 37°C. Excess
dye was removed by centrifugation and resuspension of the cells in
PBS/0.1% BSA. SMC were washed twice with PBS (1 ml/well). THP-1 cells
or monocytes were added to the SMC at 250,000 cells/well and incubated
at 37°C for 30 min. The plate was washed repeatedly by inversion and
by the addition of PBS (1 ml/well), followed by inversion. After each
wash step the fluorescence signal from of the adherent cells was
measured in a Fluorskan plate reader (excitation wavelength, 485 nm;
emission wavelength, 538 nm; Labsystems, Yorkshire, U.K.).
Statistical analysis
Data were statistically analyzed using the paired two-tailed t test. Two populations of data were considered significantly different at p < 0.05, as indicated by an asterisk.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and TNF- cooperate to induce fractalkine mRNA in
isolated SMC
We investigated the basal expression of fractalkine mRNA in SMC
isolated from human aorta. For this purpose SMC were cultured to 70%
confluence before starving the cells of FCS and growth factors for
24 h to induce quiescence. As quantified by real-time PCR, these
cells expressed negligible message encoding fractalkine (Fig. 1
A). To examine whether SMC
could be induced to express fractalkine mRNA, serum-starved SMC were
stimulated for 16 h with increasing concentrations of IL-1,
TNF-, or IFN-. While IL-1 had no effect, TNF- and IFN-
induced detectable levels of mRNA encoding fractalkine (Fig. 1B). Increasing the concentration of these cytokines above
20 ng/ml again decreased mRNA expression. However, when IFN- and
TNF- (each 20 ng/ml) were applied in combination, fractalkine
message was dramatically up-regulated. In the presence of both stimuli
fractalkine expression was 45- and 8-fold higher than that induced by
TNF- or IFN- alone, clearly showing synergy between the two
cytokines. IL-1, which did not stimulate fractalkine mRNA expression
itself, also failed to induce fractalkine expression in combination
with IFN- or TNF-.
|
, TNF-, and
IFN- to induce MCP-1 mRNA in SMC. Interestingly, addition of IL-1
resulted in a large increase in MCP-1 message levels. TNF- also
induced a remarkable increase in MCP-1 mRNA, while IFN- had
comparatively negligible effects. Challenge of SMC with a combination
of cytokines resulted in further MCP-1 expression. However, in this
study costimulation produced only additive effects. Thus, although
IFN- and TNF- were capable of inducing both MCP-1 and
fractalkine, synergistic cooperation of the stimuli was seen only with
fractalkine.
Having found that transcriptional control of fractalkine and MCP-1 is
distinct, we next investigated the expression of both chemokines in SMC
in response to costimulation with IFN- and TNF- (20 ng/ml each)
over different periods of time. As shown in Fig. 1
B, the
early kinetics of fractalkine and MCP-1 expression were divergent. At
2 h poststimulation mRNA encoding fractalkine reached almost
maximal levels, while that of MCP-1 was still relatively low. Maximal
levels of both chemokines were reached 8 h poststimulation and
maintained for the duration of the experiment.
IFN- and TNF- synergistically stimulate SMC to express
fractalkine on the cell surface
The cooperative effect of IFN- and TNF- on induction of
fractalkine was further examined by investigating cell surface
expression of the protein. Analysis was performed by flow cytometry
using a PE-conjugated mAb to fractalkine. Compared with the
fluorescence signal obtained with resting cells, a weak shift to higher
fluorescence intensity was observed when SMC were stimulated with
either TNF- (20 ng/ml) or IFN- (20 ng/ml) alone for 8 h
(Fig. 2A). The rather small
increase in median fluorescence indicated that both stimuli per se are
only weak inducers of fractalkine surface expression. However, in the
presence of both stimuli together (20 ng/ml each) the signal was
increased dramatically (Fig. 2A), demonstrating that the
synergism between IFN- and TNF- seen at the level of mRNA is also
expressed in terms of cell surface-associated fractalkine protein. As
indicated by a time course of stimulation with IFN- and TNF-
(both 20 ng/ml), fractalkine expression on the surface of SMC reached a
maximum value after 24 h and was not further increased during
longer stimulation periods (Fig. 2B). For all subsequent
functional studies (see below) SMC were stimulated with IFN- and
TNF- for 24 h.
|
- and
TNF--stimulated SMC
We next investigated whether SMC are capable of cleaving
membrane-bound fractalkine. For this purpose SMC were stimulated with
IFN- and TNF- for 24 h, and subsequently conditioned media
were analyzed for the presence of soluble fractalkine by Western
blotting using a previously characterized antiserum raised against the
chemokine domain of fractalkine (21). As shown in Fig. 3A, media of unstimulated SMC
contained no detectable fractalkine. Stimulation of SMC with either
IFN- or TNF- did induce small amounts of soluble fractalkine, as
indicated by a single faint protein band with an apparent size of 80
kDa. However, the intensity of this band was dramatically increased
upon costimulation of SMC with IFN- and TNF-, suggesting that
stimulated SMC are capable of releasing considerable amounts of soluble
fractalkine during a stimulation period of 24 h. Interestingly, no
soluble fractalkine was detected when the cells were costimulated with
IFN and TNF for 8 h only (data not shown). While the expression of
membrane-associated fractalkine reaches a considerable level after
8 h of stimulation (compare to Fig. 2B), 24 h of
stimulation are required for soluble fractalkine to accumulate in
detectable quantities in the medium.
|
In the next set of experiments we examined the ability of
metalloproteinase inhibitors to affect cleavage of the chemokine in
SMC. The hydroxamate inhibitor, batimastat, inhibits a broad spectrum
of zinc-dependent proteinases (22) and has been previously
found to prevent fractalkine cleavage in endothelial cells
(15). To test the effect of this inhibitor on SMC-mediated
fractalkine cleavage, SMC were stimulated in the presence and the
absence of the inhibitor (20 µM), and subsequently cell lysates as
well as conditioned media were analyzed for the presence of
cell-associated and soluble fractalkine, respectively. As shown in Fig. 3B, neither lysate nor conditioned medium of unstimulated
SMC contained detectable levels of fractalkine. Following cell
stimulation with IFN- and TNF-, cell-associated fractalkine in
the lysate and soluble fractalkine in the medium were detected as a
single protein bands with apparent sizes of approximately 95 and 80
kDa, respectively. However, when cell stimulation with IFN- and
TNF- was performed in the presence of batimastat (20 µM), soluble
chemokine could no longer be detected in the conditioned medium, and
membrane-bound fractalkine accumulated in the cell lysates (Fig. 3A). This was confirmed by flow cytometric detection of
surface-expressed fractalkine. As expected, the surface staining for
fractalkine was increased 2-fold when stimulation of SMC was conducted
in the presence of batimastat, giving further evidence that inhibition
of fractalkine cleavage by batimastat leads to the accumulation of
membrane-bound molecule on the cell surface (Fig. 3B). In a
more detailed experiment employing different concentrations of
batimastat (0.5, 1, 2, 5, 10, and 20 µM), the compound was found to
induce half-maximal inhibition of fractalkine cleavage at a dosage of 1
µM, while inhibition was maximal at 10 µM (data not shown). In
addition to batimastat, a second broad-spectrum metalloproteinase
inhibitor based on hydroxamic acid (25) was tested and
found to prevent fractalkine cleavage at a concentration of 7 µM. In
an attempt to further delineate the protease(s) responsible for
fractalkine cleavage by SMC, we investigated the involvement of MMP2
and MMP9. These proteases appeared to be reasonable candidates, as
they are known to be up-regulated in SMC under inflammatory conditions
in vitro and in vivo (26, 27). However, potent synthetic
inhibitors blocking MMP2 and MMP9, but not MMP1 and MMP3, in nanomolar
concentrations did not affect fractalkine cleavage by SMC (each
inhibitor tested at concentrations up to 20 µM; data not shown),
indicating that the metalloproteinase mediating fractalkine cleavage is
not MMP2 or MMP9. Likewise, TIMP1 and TIMP2 that show a broader
activity profile against various metalloproteinases of the MMP class
failed to block fractalkine cleavage in SMC (each inhibitor tested at
concentrations of 0.1 and 1 µg/ml; data not shown). Thus, for the
time being we cannot provide any data on the inhibition of fractalkine
cleavage by more specific inhibitors than by the two broad-spectrum
hydroxamate-based inhibitors.
Fractalkine-mediated biological activity of SMC-conditioned media
To assess the functional activity of SMC-derived soluble
fractalkine, we investigated the potential of concentrated culture
media from IFN--/TNF--stimulated SMC to induce calcium transients
in CX3CR1-transfected HEK 293 cells. As shown in Fig. 4A, these cells responded to
the recombinant extracellular domain of human fractalkine (5 nM) by a
robust calcium transient. Conditioned medium of resting SMC had no
effect on this cell line, consistent with the absence of fractalkine.
However, a clear response was obtained when the cells were challenged
with conditioned medium from IFN--/TNF--stimulated SMC. This
activity was completely abrogated when the conditioned medium was
treated with a neutralizing Ab to fractalkine. Thus, SMC-derived
soluble fractalkine was indeed responsible for activation of the
receptor-bearing cells.
|
B). As anticipated,
medium from IFN-- and TNF--stimulated SMC induced a calcium
response in a concentration-dependent manner, with the unconcentrated
medium leading to about half-maximal activation. In contrast, medium
from cells stimulated in the presence of batimastat did not induce a
response even at the highest concentration tested (3-fold concentrated
sample). This confirmed that a batimastat-sensitive protease was
responsible for fractalkine cleavage leading to the generation of a
functionally active soluble chemokine.
Having demonstrated the presence of functional fractalkine in
SMC-conditioned media, we next determined the relative contribution of
this chemokine to the chemoattraction of human monocytes. As shown in
Fig. 5A, concentrated medium
from resting SMC did not stimulate the directed migration of monocytes
even at the highest concentration tested (10-fold concentrated sample),
while medium from IFN--/TNF--activated SMC was found to induce a
dose-dependent chemotactic response (Fig. 5A). This response
was characterized by a bell-shaped curve, reaching a maximum at a final
3-fold concentration before declining at a higher concentration
(10-fold). This chemotactic activity was not significantly decreased in
the presence of a mAb raised to fractalkine that had proved sufficient
to neutralize the activity of recombinant fractalkine tested in
parallel (Fig. 5B). In contrast, neutralization of MCP-1
with a blocking Ab resulted in a significant reduction of the
chemotactic response. Taken together, these findings indicate that
IFN--/TNF--stimulated SMC produce functionally active fractalkine
as well as MCP-1, but that the latter chemokine dominates in its
effects on monocyte chemotaxis.
|
As fractalkine does not play a major role as a monocyte
chemoattractant in SMC-conditioned media, we examined whether the
chemokine could function as an adhesion molecule on the cell surface of
SMC. In a first approach, SMC were investigated for their potential to
bind fluorescently labeled THP-1 cells that had been previously
demonstrated to express CX3CR1 (28). The adhesion assay
was conducted in the absence of Ca2+ and
Mg2+ to minimize cell adhesion mediated by
calcium- or magnesium-dependent adhesion molecules. After coincubation
of THP-1 cells with SMC for 30 min, nonadherent THP-1 cells were washed
away, and remaining THP-1 cells were detected by means of their
fluorescence signal (Fig. 6A).
Compared with the signal obtained with resting SMC, stimulation of the
cells with IFN- and TNF- resulted in a 22-fold increase in the
fluorescence intensity, indicating that activated SMC are indeed a good
substrate for THP-1 adhesion.
|
A). This effect was specific for
fractalkine and not due to the general activation of the cells, because
similar treatment with MCP-1 (50 nM for 10 min) did not significantly
affect cell adhesion. Although adhesion was only partly inhibited by
blocking fractalkine receptors, this observation gave the first
indication that surface-expressed fractalkine is responsible for more
than half the adhesive interaction between THP-1 cells and stimulated
SMC in this model. As expected, neither fractalkine nor MCP-1 treatment
had an effect on the adhesion of THP-1 cells to unstimulated
SMC.
We next examined whether stimulation of SMC in the presence of
batimastat would improve the adhesive properties of SMC for THP-1
cells. Indeed, THP-1 adhesion was increased 2-fold when stimulation of
SMC was performed in the presence of the protease inhibitor (Fig. 6B). More importantly, the fractalkine-dependent adhesion
(which was blocked by preincubation of cells with recombinant
fractalkine) was up to 3-fold increased. Thus, batimastat improved the
fractalkine-dependent adhesion between SMC and THP-1 cells.
In a final set of adhesion experiments we examined the role of
fractalkine in the adhesion of freshly prepared monocytes to stimulated
SMC. In these experiments we exploited a neutralizing mAb to
fractalkine that is able to recognize surface-expressed fractalkine
as demonstrated above. Stimulated SMC were preincubated with increasing
concentrations of a fractalkine-neutralizing Ab for 10 min before the
addition of human monocytes. Quantification of the adherent monocytes
after the first wash step revealed that monocyte adhesion was inhibited
by 50% by the neutralizing Ab at the highest concentration used (50
µg/ml; Fig. 7). Furthermore, after a
second and a third wash step, inhibition was increased to 75 and 85%,
respectively. This finding indicated that the fractalkine-dependent
fraction of cellular adhesion is resistant to repeated washing.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and TNF- synergistically induce
surface expression of fractalkine in human aortic SMC, thereby
increasing the adhesive properties of SMC for monocytes. In turn,
fractalkine-mediated adhesion of monocytes to cytokine-stimulated SMC
is counter-regulated by metalloproteinase-mediated shedding of the
transmembrane chemokine. This study suggests that SMC-derived
fractalkine plays a role in vascular inflammation, where its expression
and function may be under the control of multiple cytokines and the
metalloproteinase activity responsible for fractalkine cleavage.
To our knowledge this report is the first to demonstrate functional
expression of fractalkine in cytokine-stimulated SMC. We found that
both IFN- and TNF- are required to induce optimal expression of
fractalkine in SMC. IL-1 was found to have no effect, either alone
or in the presence of IFN- or TNF-. This pattern of gene
induction for fractalkine is different from that seen for MCP-1
expression. Unlike fractalkine, MCP-1 is induced to a high level in the
presence of IL-1 or TNF- alone, and combinations of these
cytokines do not show synergistic cooperation in enhancing MCP-1
expression. This suggests that optimal expression of fractalkine in SMC
is restricted to inflammatory conditions where IFN- and TNF- are
both present, whereas conditions for induction of MCP-1 are less
limited. Very recently, IFN- and TNF- were also found to
cooperate in the induction of fractalkine in endothelial cells and
astrocytes (29, 30). Interestingly, in endothelial cells
we have found that IL-1 could replace TNF- as a cooperative
stimulus to IFN- (A. Ludwig and R. Joshi, unpublished observations),
whereas in SMC IL-1 was neither able to induce fractalkine by itself
nor act as a costimulus. Taken together, IFN- and TNF- regulate
fractalkine expression in endothelial and SMC in a similar fashion,
whereas the effect of IL-1 in these cells is different. These
findings indicate that in smooth muscle as well as endothelial cells
expression of fractalkine is under tight control of several, but not
necessarily the same, cytokines and that multiple stimuli have to be
present to obtain optimal induction of the chemokine.
We demonstrate here that cytokine-stimulated SMC express fractalkine on the cell surface and are capable of cleaving the molecule from the cell surface to produce a soluble chemokine. We have shown here that soluble fractalkine derived from SMC cultures is biologically active, as it was found to be responsible for the induction of calcium transients in CX3CR1-expressing cells by SMC-conditioned medium. Of course, besides fractalkine, cytokine-stimulated SMC also release other potent chemoattractants such as MCP-1, as shown here and by others (3, 4, 6). Like fractalkine, MCP-1 is known to activate monocytes (31) via its specific receptor (CCR2) expressed on these cells. In fact, selective neutralization of MCP-1 and fractalkine with mAbs revealed that of the two chemokines, MCP-1 dominates in its contribution to the monocyte chemotactic activity of SMC-conditioned medium. Thus, in this model among the various chemoattractants released by cytokine-stimulated SMC, fractalkine does not play a major role as chemotactic mediator for monocytes. Instead, SMC-expressed fractalkine functions as a membrane-anchored molecule, promoting adhesive properties for monocytes. This was demonstrated by blocking fractalkine and MCP-1 receptors on monocytes with soluble chemokines, a procedure previously used as a tool to evaluate the role of fractalkine in monocyte endothelial interaction (16, 21). Using this method we show that the adhesion of THP-1 cells to cytokine-stimulated SMC is largely dependent on fractalkine, but not on MCP-1. This finding was further supported by neutralizing SMC-expressed fractalkine with a mAb, resulting in >80% inhibition of monocyte adhesion. Taken together, these data strongly suggest that the interaction of membrane-expressed fractalkine on activated SMC with CXC3R1 on monocytes is responsible for a considerable fraction of the adhesion between the two cell types.
We also provide evidence that an SMC-derived zinc-dependent protease is
involved in fractalkine cleavage. Two different hydroxamate inhibitors
that chelate the zinc atom at the active site of metalloproteinases
(22, 23) completely block cleavage of fractalkine and
its release into the supernatant of SMC. In the presence of the
inhibitors, fractalkine was found to accumulate as a membrane-bound
molecule on the cell surface, which consequently increased the
fractalkine-dependent fraction of adhesion between monocytes and SMC.
These findings indicate that a metalloproteinase activity is regulating
the adhesive properties of SMC, and this is at least partially due to
inhibition of fractalkine cleavage. Interestingly, several cell types,
including endothelial cells and macrophages, that can be stimulated to
express fractalkine have been shown to possess endogenous cleavage
activity for the chemokine (8, 13). In fact, in a previous
study we found that batimastat is also capable of blocking fractalkine
cleavage in endothelial cells (15), suggesting that the
same class of protease is responsible for cleavage of the chemokine in
these different cell types. In an attempt to characterize the
protease(s) involved we have tested selective inhibitors for MMP2 and
MMP9. However, as these potent inhibitors were unable to block the
generation of soluble fractalkine in SMC, we can exclude a role for the
latter proteases in fractalkine cleavage. Very recently it was
demonstrated that the TNF--converting enzyme of the disintegrin- and
metalloproteinase-like protein family is involved in the
phorbol-myristate acetate-inducible cleavage of transfected fractalkine
in ECV 304 cells, but not in the constitutive cleavage
(32). As soon as well-characterized inhibitors for
TNF--converting enzyme are available it will be intriguing to
elucidate the role of this protease in the cleavage of endogenous
fractalkine from SMC.
The expression of fractalkine in endothelial cells (8) and
macrophages (9) suggests a role for the molecule in the
vascular inflammation. Our data further extend this idea by
demonstrating for the first time that vascular SMC may constitute
another potent source of fractalkine in the vasculature. According to
our in vitro data, fractalkine will be up-regulated in SMC exposed to
the inflammatory cytokines IFN- and TNF-. Such a situation may be
envisaged in acute as well as chronic inflammatory reactions, such as
bacterial infection, transplant rejection, vasculitis, and
atherosclerosis, where inflammatory cytokines, including IFN- and
TNF-, are very likely to be present. However, evidence for a role of
fractalkine in animal models of these diseases is still rare and
controversial. Mice lacking fractalkine or CX3CR1 have been generated
by targeted gene disruption and investigated in various inflammatory
models, but to date no abnormalities have been reported (33, 34). More positive results have been obtained by blocking CX3CR1
in rats with a neutralizing Ab, resulting in a prolonged survival of
cardiac allografts (35) and prevention of experimentally
induced crescentic glomerulonephritis in the animals (36).
Furthermore, a recently published study has described a genetic
polymorphism found in the gene encoding the fractalkine human receptor,
resulting in a valine to isoleucine shift at position 249. This
polymorphism is reported to decrease the number of fractalkine binding
sites on PBMC and has been associated with a reduced risk for
atherosclerosis in heterozygote individuals (37) as well
as increased vascular endothelial dysfunction (38).
Studies on whether fractalkine or CX3CR1 deletion in mice would affect
atherosclerosis have not yet been published and are eagerly awaited.
Furthermore, a histological analysis of inflamed vascular tissue that
would allow delineation of fractalkine expression in smooth muscle
under disease conditions has not yet been reported. Addressing this
issue, we recently obtained preliminary evidence that fractalkine
protein is localized to the medial smooth muscle layer in
atherosclerotic plaques (A. Ludwig and T. Reape, unpublished
observations). This observation supports our hypothesis that
SMC-derived fractalkine contributes to the development of this disease.
The early induction of fractalkine by SMC following an inflammatory
insult could be important in establishing a tight adhesion between SMC
and inflammatory cells, such as monocytes, infiltrating the lesion.
However, any extended role in the process must also depend on the
activity of the fractalkine-cleaving protease. Interestingly, within
the atherosclerotic lesions several types of metalloproteinases of the
MMP class (27, 39) and TNF--converting enzyme of the
disintegrin- and metalloproteinase-like protein family
(40) are reportedly up-regulated. Increased cleavage of
membrane-expressed fractalkine could be envisaged to have several
consequences on monocyte recruitment within the lesion. On the one
hand, enhanced generation of soluble fractalkine would lead to the
production of a local chemoattractive concentration gradient within the
vascular wall, resulting ultimately in the attraction of further
monocytes to the SMC. On the other hand, due to the lack of
transmembrane, fractalkine SMC would not establish a tight cellular
contact to the recruited inflammatory cells. It may be imagined that
increased monocyte infiltration in parallel with the reduced tissue
cohesion via fractalkine constitute critical regulatory factors
contributing to the destabilization of the atherosclerotic plaque.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Andreas Ludwig, Department of Vascular Biology, GlaxoSmithKline, Cold Harbor Road, Harlow, Essex, U.K. CM19 5AW. E-mail address: andreas_2_ludwig@sbphrd.com or aludwig{at}web.de
3 Abbreviations used in this paper: SMC, smooth muscle cell; MCP-1, monocyte chemoattractant protein-1; MMP, matrix metalloproteinase; TIMP, tissue inhibitor of metalloproteinase.
Received for publication August 10, 2001. Accepted for publication November 2, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, MIP-3 and fractalkine induce the locomotion and the mobilization of intracellular calcium, and activate the heterotrimeric G proteins in human natural killer cells. Immunology 95:618.[Medline]
and interferon-, of fractalkine expression in human astrocytes. Neurosci. Lett. 303:132.[Medline]
-converting enzyme (ADAM17) mediates the cleavage and shedding of fractalkine (CX3CL1). J. Biol. Chem. 276:37993.This article has been cited by other articles:
|
|
 |
|
  L. Landsman, L. Bar-On, A. Zernecke, K.-W. Kim, R. Krauthgamer, E. Shagdarsuren, S. A. Lira, I. L. Weissman, C. Weber, and S. Jung CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival Blood, January 22, 2009; 113(4): 963 - 972. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Truman, C. A. Ford, M. Pasikowska, J. D. Pound, S. J. Wilkinson, I. E. Dumitriu, L. Melville, L. A. Melrose, C. A. Ogden, R. Nibbs, et al. CX3CL1/fractalkine is released from apoptotic lymphocytes to stimulate macrophage chemotaxis Blood, December 15, 2008; 112(13): 5026 - 5036. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Hermand, F. Pincet, S. Carvalho, H. Ansanay, E. Trinquet, M. Daoudi, C. Combadiere, and P. Deterre Functional Adhesiveness of the CX3CL1 Chemokine Requires Its Aggregation: ROLE OF THE TRANSMEMBRANE DOMAIN J. Biol. Chem., October 31, 2008; 283(44): 30225 - 30234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Cardona, M. Li, L. Liu, C. Savarin, and R. M. Ransohoff Chemokines in and out of the central nervous system: much more than chemotaxis and inflammation J. Leukoc. Biol., September 1, 2008; 84(3): 587 - 594. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. P. Luttrell, M. Swee, B. Starcher, W. C. Parks, and K. Chitaley Erectile dysfunction in the type II diabetic db/db mouse: impaired venoocclusion with altered cavernosal vasoreactivity and matrix Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2204 - H2211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ryu, C.-W. Lee, K.-H. Hong, J.-A. Shin, S.-H. Lim, C.-S. Park, J. Shim, K. B. Nam, K.-J. Choi, Y.-H. Kim, et al. Activation of fractalkine/CX3CR1 by vascular endothelial cells induces angiogenesis through VEGF-A/KDR and reverses hindlimb ischaemia Cardiovasc Res, May 1, 2008; 78(2): 333 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Loppnow, K. Werdan, and M. Buerke Invited review: Vascular cells contribute to atherosclerosis by cytokine- and innate-immunity-related inflammatory mechanisms Innate Immunity, April 1, 2008; 14(2): 63 - 87. [Abstract] [PDF]
|
|
|
|
 |
|
 L. G. Spagnoli, E. Bonanno, G. Sangiorgi, and A. Mauriello Role of Inflammation in Atherosclerosis J. Nucl. Med., November 1, 2007; 48(11): 1800 - 1815. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Barlic, Y. Zhang, and P. M. Murphy Atherogenic Lipids Induce Adhesion of Human Coronary Artery Smooth Muscle Cells to Macrophages by Up-regulating Chemokine CX3CL1 on Smooth Muscle Cells in a TNF{alpha}-NF{kappa}B-dependent Manner J. Biol. Chem., June 29, 2007; 282(26): 19167 - 19176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hundhausen, A. Schulte, B. Schulz, M. G. Andrzejewski, N. Schwarz, P. von Hundelshausen, U. Winter, K. Paliga, K. Reiss, P. Saftig, et al. Regulated Shedding of Transmembrane Chemokines by the Disintegrin and Metalloproteinase 10 Facilitates Detachment of Adherent Leukocytes J. Immunol., June 15, 2007; 178(12): 8064 - 8072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Barlic, Y. Zhang, J. F. Foley, and P. M. Murphy Oxidized Lipid-Driven Chemokine Receptor Switch, CCR2 to CX3CR1, Mediates Adhesion of Human Macrophages to Coronary Artery Smooth Muscle Cells Through a Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Pathway Circulation, August 22, 2006; 114(8): 807 - 819. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Green, K. H. Han, Y. Chen, F. Almazan, I. F. Charo, Y. I. Miller, and O. Quehenberger The CC Chemokine MCP-1 Stimulates Surface Expression of CX3CR1 and Enhances the Adhesion of Monocytes to Fractalkine/CX3CL1 via p38 MAPK. J. Immunol., June 15, 2006; 176(12): 7412 - 7420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chabot, J. S. Wagner, S. Farrant, and M. R. Neutra TLRs Regulate the Gatekeeping Functions of the Intestinal Follicle-Associated Epithelium J. Immunol., April 1, 2006; 176(7): 4275 - 4283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Honczarenko, Y. Le, M. Swierkowski, I. Ghiran, A. M. Glodek, and L. E. Silberstein Human Bone Marrow Stromal Cells Express a Distinct Set of Biologically Functional Chemokine Receptors Stem Cells, April 1, 2006; 24(4): 1030 - 1041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Obreja, W. Biasio, M. Andratsch, K. S. Lips, P. K. Rathee, A. Ludwig, S. Rose-John, and M. Kress Fast modulation of heat-activated ionic current by proinflammatory interleukin 6 in rat sensory neurons Brain, July 1, 2005; 128(7): 1634 - 1641. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G.-Y. Liu, V. Kulasingam, R. T. Alexander, N. Touret, A. M. Fong, D. D. Patel, and L. A. Robinson Recycling of the Membrane-anchored Chemokine, CX3CL1 J. Biol. Chem., May 20, 2005; 280(20): 19858 - 19866. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Hannan, R. L. Jones, H. O. D. Critchley, G. J. Kovacs, P. A. W. Rogers, B. Affandi, and L. A. Salamonsen Coexpression of Fractalkine and Its Receptor in Normal Human Endometrium and in Endometrium from Users of Progestin-Only Contraception Supports a Role for Fractalkine in Leukocyte Recruitment and Endometrial Remodeling J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 6119 - 6129. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Sukkar, R. Issa, S. Xie, U. Oltmanns, R. Newton, and K. F. Chung Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-{gamma} and TNF-{alpha} and regulation by TGF-{beta} and corticosteroids Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1230 - L1240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Abel, C. Hundhausen, R. Mentlein, A. Schulte, T. A. Berkhout, N. Broadway, D. Hartmann, R. Sedlacek, S. Dietrich, B. Muetze, et al. The Transmembrane CXC-Chemokine Ligand 16 Is Induced by IFN-{gamma} and TNF-{alpha} and Shed by the Activity of the Disintegrin-Like Metalloproteinase ADAM10 J. Immunol., May 15, 2004; 172(10): 6362 - 6372. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Daoudi, E. Lavergne, A. Garin, N. Tarantino, P. Debre, F. Pincet, C. Combadiere, and P. Deterre Enhanced Adhesive Capacities of the Naturally Occurring Ile249-Met280 Variant of the Chemokine Receptor CX3CR1 J. Biol. Chem., May 7, 2004; 279(19): 19649 - 19657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-M. Chen, M.-I Hu-Tsai, S.-L. Lin, T.-J. Tsai, and B.-S. Hsieh Expression of CX3CL1/fractalkine by mesangial cells in vitro and in acute anti-Thy1 glomerulonephritis in rats Nephrol. Dial. Transplant., December 1, 2003; 18(12): 2505 - 2514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Lucas, C. Bursill, T. J. Guzik, J. Sadowski, K. M. Channon, and D. R. Greaves Smooth Muscle Cells in Human Atherosclerotic Plaques Express the Fractalkine Receptor CX3CR1 and Undergo Chemotaxis to the CX3C Chemokine Fractalkine (CX3CL1) Circulation, November 18, 2003; 108(20): 2498 - 2504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Lavergne, B. Combadiere, O. Bonduelle, M. Iga, J.-L. Gao, M. Maho, A. Boissonnas, P. M. Murphy, P. Debre, and C. Combadiere Fractalkine Mediates Natural Killer-Dependent Antitumor Responses in Vivo Cancer Res., November 1, 2003; 63(21): 7468 - 7474. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Haynes, L. P. Jones, A. Barskey, L. J. Anderson, and R. A. Tripp Enhanced Disease and Pulmonary Eosinophilia Associated with Formalin-Inactivated Respiratory Syncytial Virus Vaccination Are Linked to G Glycoprotein CX3C-CX3CR1 Interaction and Expression of Substance P J. Virol., September 15, 2003; 77(18): 9831 - 9844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Hundhausen, D. Misztela, T. A. Berkhout, N. Broadway, P. Saftig, K. Reiss, D. Hartmann, F. Fahrenholz, R. Postina, V. Matthews, et al. The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion Blood, August 15, 2003; 102(4): 1186 - 1195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Martinez-Pomares, D. M. Reid, G. D. Brown, P. R. Taylor, R. J. Stillion, S. A. Linehan, S. Zamze, S. Gordon, and S. Y. C. Wong Analysis of mannose receptor regulation by IL-4, IL-10, and proteolytic processing using novel monoclonal antibodies J. Leukoc. Biol., May 1, 2003; 73(5): 604 - 613. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Silverman, D. O. Zamora, Y. Pan, P. V. Texeira, S.-H. Baek, S. R. Planck, and J. T. Rosenbaum Constitutive and Inflammatory Mediator-Regulated Fractalkine Expression in Human Ocular Tissues and Cultured Cells Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1608 - 1615. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), or
IL-1
) and subsequently analyzed for the expression of mRNA
encoding fractalkine. B, Serum-starved SMC were
stimulated with IFN-
) or MCP-1 (
) was quantified. C, Induction of
fractalkine (•) and MCP-1 (
and 
) or
leaving cells unexposed (