The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Creus, A.
Right arrow Articles by Leclercq, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Creus, A.
Right arrow Articles by Leclercq, G.
The Journal of Immunology, 2002, 168: 6486-6493.
Copyright © 2002 by The American Association of Immunologists

Developmental and Functional Defects of Thymic and Epidermal V{gamma}3 Cells in IL-15-Deficient and IFN Regulatory Factor-1-Deficient Mice1

An De Creus, Katrien Van Beneden, Frederik Stevenaert, Veronique Debacker, Jean Plum and Georges Leclercq2

Department of Clinical Chemistry, Microbiology, and Immunology, University of Ghent, University Hospital, Ghent, Belgium


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, the role of IL-15 and its regulation by the transcription factor IFN regulatory factor-1 (IRF-1) in murine V{gamma}3 T cell development and activity is assessed. Compared with wild-type (WT) mice, reduced numbers of mature V{gamma}3 cells were found in the fetal thymus of IL-15-/- mice, while IRF-1-/- mice displayed normal frequencies. V{gamma}3+ dendritic epidermal T cells (DETCs) were absent in IL-15-/- mice but present in IRF-1-/- mice. DETCs from IRF-1-/- mice displayed morphologically a less mature phenotype and showed different emergence kinetics during ontogeny. This corresponded with lower IL-15 mRNA levels in the skin epidermis. Comparable levels of IL-7 were found in the skin of WT and IL-15-/- mice. Adoptive transfer experiments of WT fetal thymocytes into IL-15-/- mice did not result in the development of V{gamma}3+ DETCs, confirming the nonredundant role of IL-15 in the skin during DETC development. In vitro, cytolytic activity of IL-15-/- V{gamma}3 cells was normal after stimulation with IL-15 and was further enhanced by addition of IL-12. In contrast, cytolytic activity of IRF-1-/- V{gamma}3 cells remained defective after stimulation with IL-15 in combination with IL-12. These data suggest that IL-15 is redundant for the development and/or survival of mature V{gamma}3 cells in the fetal thymus, whereas it is essential for the localization of V{gamma}3 cells in the skin. Furthermore, a possible role for IRF-1 in inducing morphological maturation of DETCs and cytolytic capacity of V{gamma}3 cells is suggested.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thymocyte development in the murine thymus starts at days 11–12 of fetal development with the influx of precursor cells. The first wave of cells in thymic ontogeny is unique in that they express an invariant {gamma}{delta} TCR characterized by a lack of junctional diversity. V{gamma}3 cells are the first TCR-positive cells that can be found in the fetal thymus around gestation days 14–16 (1, 2, 3). At a later time point, other TCR {gamma}{delta} and TCR {alpha}{beta} thymocytes appear. In adult mice, TCR V{gamma}3 cells are detected only in the epidermis (2). Due to their dendritic morphology, these cells are called dendritic epidermal T cells (DETCs)3 and represent the main T cell population in the epidermis of mice (4). It has been shown that mature fetal V{gamma}3 thymocytes are the precursors of DETCs in the skin (5, 6).

Mice deficient in the common {gamma}-chain ({gamma}c), which is shared by the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors, have a marked impairment of B, T, and NK cell development (7). The defect in T cell development seen in {gamma}c-/- mice mainly reflects the absence of IL-7R signaling, while the defect in NK cell development seen in these mice is due to the absence of IL-15R signaling. IL-7-/- and IL-7R-/- mice have major defects in T cell development, but NK cell development is not compromised (8, 9). IL-7 and IL-7R play a critical role in lymphopoiesis by inducing survival and proliferation of progenitor T lymphocytes (10). Studies in IL-15-/- mice and IL-15R{alpha}-/- mice have confirmed a critical role for IL-15 in regulating the development and/or expansion of NK cells, NK-T cells, and distinct intestinal intraepithelial lymphocyte populations (11, 12). In addition, these studies have revealed a role for IL-15 in the maintenance of the memory CD8+ T cell population in the periphery (11). The finding that IL-15-/- and IL-15R{alpha}-/- mice are lymphopenic suggests that IL-15 may also support adaptive CD4+ and CD8+ T cells. Whether IL-15 regulates adaptive lymphocyte differentiation remains to be elucidated (11, 12).

Some cytokines have also been demonstrated to affect the growth and differentiation of {gamma}{delta} T cells. {gamma}{delta} T cells derived from the fetal thymus and from adult skin, spleen, or peritoneal cavity can proliferate in vitro in response to IL-2, IL-7, or IL-15 (13, 14, 15, 16, 17, 18, 19). {gamma}c-/- mice have confirmed these findings, as these mice have defects in {gamma}{delta} T cell development. {gamma}c-/- mice have severely reduced numbers of immature fetal V{gamma}3 cells and lack mature fetal thymic V{gamma}3 cells. V{gamma}3 DETCs are absent from the skin epidermis of {gamma}c-/- mice (20). In IL-7R-/- and IL-7-/- mice, maturation of V{gamma}3 cells in the fetal thymus is inhibited and no V{gamma}3 DETCs are detected in the skin, showing the importance of IL-7 in the development and/or survival of V{gamma}3 cells or their precursors (8, 21). In addition, several other studies have suggested a role for IL-15 and IL-2 in the development of V{gamma}3 cells (18, 22, 23). Both cytokines interact with receptor complexes that contain the {gamma}c, the IL-2R{beta} chain, and a specific IL-2R or IL-15R {alpha}-chain (22, 23). Mature fetal V{gamma}3 thymocytes and V{gamma}3 DETCs are known to express the IL-2R{beta} chain (14). IL-2R{beta}-deficient mice show a moderate reduction of mature V{gamma}3 cells in the fetal thymus. Small numbers of V{gamma}3 DETCs are detected in the fetal skin, but they are absent in adult mice (17). Because V{gamma}3 cells are present in normal numbers in the fetal thymus and in the adult skin of IL-2-/- mice (24), IL-15 rather than IL-2 signaling through the IL-2R{beta} chain seems to be important for the development and/or the expansion of V{gamma}3 cells and the maintenance of these cells in the skin.

Our aim was to determine whether intrathymic IL-15 is required for the generation of fetal thymic V{gamma}3 cells and whether peripheral expression of IL-15 in the skin is necessary for the development and/or survival of V{gamma}3 DETCs. In addition, we wanted to determine whether the transcription factor IFN regulatory factor-1 (IRF-1) is required for the development of V{gamma}3 cells in the fetal thymus and in the skin epidermis. IRF-1 binds regions within the promoter of type I IFNs and several IFN-inducible genes and is responsible for the induction of IL-15 but not the constitutive expression of this gene. Mice that do not express the transcription factor IRF-1 have been shown to exhibit a severe NK, NK-T, and intestinal intraepithelial lymphocyte deficiency (25). To clarify the role of IL-15 and IRF-1 in V{gamma}3 T cell development, we studied the development and function of these cells in IL-15-/- mice and IRF-1-/- mice. Our results suggest a redundant role for IL-15 expression during V{gamma}3 T cell development in the fetal thymus and a nonredundant function for localization of V{gamma}3 cells in the skin. In addition, we show that the transcription factor IRF-1 is important for the morphological maturation of DETCs, probably by regulating IL-15 expression in the skin epidermis during ontogeny. Furthermore, our data imply an important role for IRF-1 in regulating V{gamma}3 T cell-mediated cytotoxicity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6J wild-type (WT) mice were provided by Proefdierencentrum (Catholic University Leuven, Leuven, Belgium). IRF-1-/- mice (C57BL/6 background) (26) were kindly provided by Dr. P. Matthys (Catholic University Leuven). IL-15-/- mice (C57BL/6 background) were kindly provided by Dr. J. Peschon (Immunex, Seattle, WA) (11). Recombination-activating gene (RAG)-1-/- mice (C57BL/6 background) were purchased from Kankerinstituut (Amsterdam, The Netherlands) and C57BL/6J-Ragtm1/Mom mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were bred in our facility and housed in a specific pathogen-free environment. Mice were treated and used in agreement with institutional guidelines.

Antibodies

Monoclonal Abs used for staining were anti-Fc{gamma}RII/III (unconjugated, rat IgG2b; kindly provided by Dr. J. Unkeless, Mount Sinai School of Medicine, New York, NY), anti-heat-stable Ag (HSA; biotin-conjugated, rat IgG2b; BD PharMingen, San Diego, CA), anti-NK1.1 (PE-conjugated, mouse IgG2a; BD PharMingen), anti-Thy1.2 (PE- and FITC-conjugated, rat IgG2b; BD PharMingen), anti-IL-2R{beta} (FITC-conjugated, rat IgG2b; kindly provided by Dr. T. Tanaka, Tokyo, Japan), and anti-TCR V{gamma}3 (FITC-conjugated, hamster hybridoma F536 (kindly provided by Dr. J. P. Allison, University of California, Berkeley, CA) and PE-conjugated (BD PharMingen)).

Epidermal sheets

Epidermal sheets were prepared as described previously (27). Epidermal sheets were labeled with FITC-conjugated anti-Thy1.2 mAb or with FITC-conjugated anti-V{gamma}3 mAb at 4°C for 18 h. DETCs were counted with a fluorescence microscope in a field that equaled 0.2 mm2. Ten mice were used for each strain and for each specimen five random fields were counted. Data are expressed as the mean (± SD) number of positive cells per square millimeter.

Preparation of cell suspensions

Epidermal cell (EC) suspension. Skin samples were freed of fatty tissue and were floated dermal side down in a petri dish containing 0.3% trypsin-PBS solution (Difco, Detroit, MI) at 4°C for 18 h. Epidermal sheets were peeled from the underlying dermis. Epidermal skin samples were then pooled in DMEM (Life Technologies, Paisley, U.K.) containing 0.25% DNase (Boehringer Mannheim, Mannheim, Germany). Single cell suspensions were prepared as described before (27). Cells were counted with trypan blue to exclude dead cells.

Thymic cell suspension from fetal day (FD)17 mice. Mice were mated overnight. Thymuses from FD17 (plug date = day 0) WT IRF-1-/- mice and IL-15-/- mice were removed and disrupted using a small potter homogenizer. Cells were counted with trypan blue to exclude dead cells. Thymocytes were suspended in RPMI 1640 medium supplemented with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 0.03% glutamine, and 5 x 10-5 M 2-ME (all from Life Technologies). This medium will be further referred to as RPMI 1640 medium.

Semiquantitative RT-PCR for IL-12R and real-time PCR for IL-15 and IL-7

TRIzol LS Reagent (Life Technologies) was added to the sorted cells or total cell suspensions and RNA was extracted according to the manufacturer’s instructions. Before reverse transcription, digestion of DNA was performed with DNase I (Life Technologies). cDNA was synthesized with oligo(dT) as primer using the Superscript kit (Life Technologies). Primers used for RT-PCR for murine hypoxanthine phosphoribosyltransferase (HPRT), a housekeeping gene, were GTAATGATCAGTCAACGGGGGAC (sense) and CCAGCAAGCTTGCAACCTTAACCA (antisense). For IL-12R{beta}2, primers used were AAAGCCAACTGGAAAGCATTCG (sense) and AGTTTTGAGTCAGGGTCTCTGC (antisense). Semiquantitative RT-PCR amplification was performed using a PTC-200 Peltier Thermal Cycler (MJ Research, Biozym, Landgraaf, The Netherlands) for 35 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min (HPRT) or with 35 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min (IL-12R). For semiquantitative RT-PCR, three 3-fold dilutions of each cDNA were amplified. H2O and genomic DNA were used as negative controls (data not shown).

Amplification reactions for IL-15, IL-7, and HPRT mRNA were performed with the SYBR Green assay which contained 1x SYBR PCR buffer, 3 mM MgCl2, 0.2 mM dATP, 0.2 mM dCTP, 0.4 mM dUTP, 1.25 U AmpliTaq Gold, and 0.5 U AmpErase UNG (all from PE Applied Biosystems, Foster City, CA). Primers for murine IL-15 (AAAGCTTTATACGCATTGTCCAAA T (sense) and CATGCAGTCAGGACGTGTTGAT (antisense)), murine IL-7 (GGAATTCCTCCACTGATCCTTG (sense) and TTCCTGTCATTTTGTCCAATTCA (antisense)), and HPRT (AATACGAGGAGTCCTGTTGATGTTG (sense) and CATTCATAGAAGGTTCATGCAAAAAG (antisense)) were designed with Primer Express 1.0 software (PE Applied Biosystems) and used at 50 nM (IL-15) and 200 nM (IL-7, HPRT) concentrations. The PCR conditions were 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Melting curves were generated after amplification. Amplification reactions for GAPDH, a housekeeping gene, were performed with the TaqMan assay kit for GAPDH amplification from PE Applied Biosystems. Amplification was performed in 1x TaqMan Universal PCR Master Mix (PE Applied Biosystems), using 100 nM of each primer and 200 nM probe for rodent GAPDH. Data were collected using the 5700 SDS thermal cycler (PE Applied Biosystems). Each sample was tested in triplicate and all PCR runs were performed three times.

Cytokine culture

FD17 thymic cell suspensions were prepared and cultured in 24-well plates (Falcon; BD Biosciences, Mountain View, CA) at 2 x 106 cells/well in 2 ml RPMI 1640 medium with a final concentration of 50 ng/ml recombinant human (rhu)IL-15 (R&D Systems, Abingdon, U.K.). After culture for 4 days in 5% CO2 at 37°C, cells were harvested, washed, and counted with trypan blue. Cells were sorted into V{gamma}3+ and NK1.1+V{gamma}3- populations. Sorted cells were cultured in 96-well plates (Falcon; BD Biosciences) at 1 x 105 cells/well in 200 µl RPMI 1640 medium for an additional 2 days, with a final concentration of 50 ng/ml rhuIL-15 with or without 2 ng/ml rIL-12 (PeproTech, Rocky Hill, NJ). After these additional 2 days of culture, the purity of the V{gamma}3 and NK cells was >99%.

FCA and sorting

To avoid aspecific binding, the Fc{gamma}R was blocked by preincubating the cells with saturating amounts of anti-Fc{gamma}RII/III mAb. Freshly isolated FD17 thymocytes were incubated with anti-HSA (biotin-conjugated), anti-V{gamma}3 (PE-conjugated), and anti-IL2R{beta} (FITC-conjugated) at 4°C for 45 min. After washing, cells were incubated with streptavidin-allophycocyanin (BD Biosciences) at 4°C for 20 min. ECs were incubated with anti-Thy1.2 (PE-conjugated) mAb at 4°C for 45 min. Cells were analyzed for fluorescence using a FACSCalibur (BD Biosciences) equipped with an argon (488 nm) and helium (325 nm) laser with the CellQuest software program (BD Biosciences) for data acquisition and analysis. Propidium iodide was added to the cells (2 µg/ml) just before flow cytometric analysis (FCA). Gating was done on propidium iodide-negative cells to exclude dead cells.

FD17 thymocytes from WT mice and IRF-1-/- mice cultured for 4 days in the presence of rhuIL-15 were incubated with anti-NK1.1 (PE-conjugated) and anti-V{gamma}3 (FITC-conjugated) mAbs at 4°C for 45 min. V{gamma}3+ cells and V{gamma}3-NK1.1+ cells were sorted to a purity of >99% using a FACSVantage flow cytometer (BD Biosciences) equipped with an argon laser.

In vivo injection of FD18 thymocytes

Freshly isolated FD18 thymocytes (107) from WT and IL-15-/- mice were i.v. injected into syngeneic RAG-1-/- and/or IL-15-/- mice. Six weeks after injection, mice were analyzed for the presence of V{gamma}3+ DETCs by immunolabeling of epidermal sheets. Experiments were repeated three times with three mice of each genotype per experiment.

Cytotoxic assay

The tumor target used was the YAC-1 cell line (kindly provided by Dr. M. Joniau, K. V. Leuven, Kortrijk, Belgium). Target cells (106) were labeled with 100 µCi 51Cr (Amersham International, Little Chalfont, U.K.) for 60 min at 37°C. Cells were washed three times. Effector cells used were sorted FD17 thymic V{gamma}3+ cells or NK cells derived from WT, IL-15-/-, or IRF-1-/- mice, cultured in the presence of IL-15 with or without IL-12. Graded effector cell numbers were cocultured in triplicate with 103 51Cr-labeled YAC-1 cells in a total volume of 100 µl RPMI 1640 medium in 96-well V-bottom plates (Nunc, Roskilde, Denmark). Alternatively, to determine the spontaneous and maximal 51Cr release, medium and 1% Triton X-100 solution, respectively, was added to the target cells instead of effector cells. After incubation for 6 h at 37°C, 70 µl supernatant was removed from each well. Then, 225 µl Optiphase Supermix (Wallac, Turku, Finland) was added to the supernatants, and radioactivity was measured using a 96-well scintillation counter (Microbeta; Wallac). Data are expressed as the mean percentage of specific 51Cr release. Percentage of specific release was calculated as follows: 100 x ((experimental - spontaneous release)/(maximal - spontaneous release)).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cell number of mature V{gamma}3 cells in the fetal thymus is reduced in IL-15-/- mice, whereas it is normal in IRF-1-/- mice

To examine the role of IL-15 in fetal V{gamma}3 T cell development, we analyzed FD17 thymocytes from IL-15-/- mice. Fetal V{gamma}3 thymocytes consist of immature HSAhigh and mature HSAlow cells (28). Maturation of V{gamma}3 thymocytes is also associated with the expression of the IL-2/IL-15R{beta} chain (14). The total cell number of the fetal thymus of WT and IL-15-/- mice was comparable (data not shown). As shown in Fig. 1Go, a selective reduction of mature HSAlow V{gamma}3+ thymocytes in FD17 IL-15-/- mice could be observed, but all mature HSAlowV{gamma}3+ thymocytes from IL-15-/- mice expressed the IL-2R{beta} chain at normal levels. To examine whether regulation of IL-15 expression determines fetal V{gamma}3 T cell development, we examined FD17 thymocytes from IRF-1-/- mice. Others have shown that mice deficient for IRF-1 fail to up-regulate IL-15 expression after stimulation, but low basal amounts of IL-15 can be detected (25). We found no reduction of mature V{gamma}3+ thymocytes in the fetal thymus of IRF-1-/- mice (Fig. 1Go). The total cell number of the fetal thymus of WT and IRF-1-/- mice was comparable (data not shown).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. IL-15-/- mice have moderate reduced numbers of mature fetal V{gamma}3 thymocytes, whereas IRF-1-/- mice have normal numbers. Thymocyte cell suspensions were freshly prepared from FD17 fetuses. Cells were labeled with FITC-conjugated anti-IL-2R{beta} mAb, PE-conjugated anti-V{gamma}3 mAb, and biotinylated anti-HSA mAb (second-step streptavidin-allophycocyanin). Propidium iodide was added just before FCA. Gating was done on propidium iodide-negative cells (dot plots) or on propidium iodide-negative, V{gamma}3+HSAlow cells (histograms). The open histograms represent background staining; the filled histograms represent staining by the indicated mAb. Results are representative of more than three experiments.

 
V{gamma}3+ DETCs are absent in IL-15-/- mice but present in IRF-1-/- mice

V{gamma}3 thymocytes migrate from the fetal thymus to the skin (5, 6). After birth, V{gamma}3 cells can only be detected in the epidermis (2). IL-2R{beta}-/- mice have no V{gamma}3 cells in the skin epidermis (17), whereas IL-2-/- mice have normal DETC numbers (24). To determine whether the absence of epidermal V{gamma}3 cells in IL-2R{beta}-/- mice is due to the lack of IL-15 signaling, epidermal sheets from IL-15-/- mice were examined. No V{gamma}3+ DETCs could be detected in the skin of adult (12 wk) IL-15-/- mice by in situ immunofluorescent staining of epidermal sheets (Fig. 2GoB). To determine whether the transcription factor IRF-1 is important during development of V{gamma}3+ DETCs, we also examined epidermal sheets of IRF-1-/- mice. First, we determined whether IL-15 mRNA was expressed in ECs of IRF-1-/- mice. As expected, unstimulated ECs expressed mRNA for IL-15 but, compared with WT mice, no up-regulation was found after stimulation with LPS and IFN-{gamma} (data not shown). In contrast to IL-15-/- mice, V{gamma}3 cells could be detected in normal numbers in epidermal sheets of adult IRF-1-/- mice (Fig. 2GoC). However, IRF-1-/- V{gamma}3 DETCs differed from WT cells in their morphology, as V{gamma}3+ DETCs from IRF-1-/- mice had less extensive dendrites (Fig. 2Go).



View larger version (110K):
[in this window]
[in a new window]
 
FIGURE 2. V{gamma}3+ DETCs are absent in the skin of IL-15-/- mice but present in the skin of IRF-1-/- mice. Epidermal V{gamma}3+ DETCs from 12-wk-old WT (A), IL-15-/- (B), and IRF-1-/- (C) mice were visualized by immunolabeling of epidermal sheets using FITC-conjugated anti-V{gamma}3 mAb. Results are representative of at least eight mice of each genotype.

 
Kinetics in the appearance of V{gamma}3+ and Thy1+ cells in the skin are affected in IL-15-/- and IRF-1-/- mice

Because no V{gamma}3+ DETCs could be detected in the skin of adult IL-15-/- mice and DETCs of adult IRF-1-/- mice had a less mature dendritic morphology, we studied the role of IL-15 for the emergence kinetics of V{gamma}3+ and Thy-1+ DETCs. Epidermal sheets from WT, IL-15-/-, and IRF-1-/- mice were examined at different time points after birth. Epidermal sheets 2 days after birth contained round-shaped Thy1+ ECs and V{gamma}3+ ECs in both WT and IRF-1-/- mice, although lower numbers were detected in IRF-1-/- compared with WT mice (Figs. 3Go and 4Go). During the next few days, WT mice showed a gradual increase of V{gamma}3+ DETCs with peak numbers 2 wk after birth (Fig. 4Go). After 2 wk of age, WT V{gamma}3+ DETC numbers decreased until steady cell numbers were reached. At 12 wk after birth, all WT V{gamma}3+ DETCs had a dendritic morphology (Fig. 3GoA). In IRF-1-/- mice we also found an increase of V{gamma}3+ DETCs until 2 wk after birth, but cell numbers at 1 and 2 wk were significantly lower compared with WT mice. No decrease was observed at later time points. The end result was that at 12 wk there was no difference in the cell number of V{gamma}3+ DETCs in IRF-1-/- vs WT mice. In contrast, higher numbers of Thy1+ DETCs were reached in IRF-1-/- mice compared with WT mice at 2 and 4 wk of age; at 12 wk there was again no difference detectable (Fig. 4Go). DETCs from IRF-1-/- mice had fewer dendrites at all time points examined (Fig. 3Go). No V{gamma}3+ DETCs could be detected at any time point after birth in the epidermis of IL-15-/- mice, and only marginal numbers of Thy1+ cells were present (Figs. 3Go and 4Go). FCA of EC suspensions showed that these Thy1+ cells stained positive for CD3, although expression levels were lower compared with WT Thy1+ cells (data not shown). To exclude the possibility that we could not detect very small numbers of V{gamma}3+ DETCs in the epidermis of IL-15-/- mice by immunolabeling in situ, we prepared EC suspensions at different time points after birth, cultured them with IL-15 for 24 h, and examined them by flow cytometry for the presence of V{gamma}3+ DETCs and/or other Thy1+ cells. Compared with adult WT mice, only small numbers of Thy1+ cells were present in EC suspensions of IL-15-/- mice, but no V{gamma}3 cells could be detected (data not shown).



View larger version (127K):
[in this window]
[in a new window]
 
FIGURE 3. Comparison of morphological features of V{gamma}3+ and Thy-1+ DETCs in WT, IL-15-/-, and IRF-1-/- mice during ontogeny. V{gamma}3+ DETCs (A) and Thy-1+ DETCs (B) from WT, IL-15-/-, and IRF-1-/- mice were visualized by immunolabeling of epidermal sheets using FITC-conjugated anti-V{gamma}3 mAb or FITC-conjugated anti-Thy-1 mAb. Results are representative of at least eight mice of each genotype.

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Emergence kinetics of V{gamma}3+ DETCs and Thy-1+ DETCs in WT vs IRF-1-/- mice. Epidermal sheets from WT, IL-15-/-, or IRF-1-/- mice at the indicated ages were stained with FITC-conjugated anti-V{gamma}3 mAb (A) or FITC-conjugated anti-Thy-1 mAb (B). Data are expressed as the number of cells per square millimeter ± SD for at least eight mice of each genotype. A, *, p = 0.0001; **, p = 0.0075; ***, p = 0.04 (unpaired t test). B, *, p = 0.04; **, p < 0.0001 (unpaired t test).

 
IRF-1-/- mice express lower levels of IL-15 in the skin during ontogeny

Because IL-15 seems to be essential for the proliferation and/or survival of V{gamma}3+ DETCs, we determined whether the difference observed in emergence kinetics and dendritic morphology between WT V{gamma}3+ DETCs and IRF-1-/- V{gamma}3+ DETCs correlated with a different IL-15 mRNA expression in the skin during ontogeny. We prepared EC suspensions at different time points after birth. Real-time PCR for IL-15 showed lower mRNA levels in the skin of IRF-1-/- mice compared with WT mice at all time points examined (Fig. 5Go).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 5. Lower expression of IL-15 mRNA in the skin of IRF-1-/- mice. EC suspensions were prepared from WT and IRF-1-/- mice at the indicated ages. cDNA was prepared and real-time PCR for IL-15 and GAPDH was performed. Results represent the relative expression of IL-15 mRNA after normalization to GAPDH mRNA (mean ± SD) in ECs from WT or IRF-1-/- mice.

 
No V{gamma}3+ DETCs are present after adoptive transfer of WT FD18 thymocytes into IL-15-/- mice and mRNA levels for IL-7 are similar in the skin of WT and IL-15-/- mice

Previously it has been shown that circulating CD3+TCR V{gamma}3+ fetal murine thymocytes home to the skin and give rise to proliferating DETCs (5, 6). In addition, an important role for IL-7 during the survival and/or proliferation of V{gamma}3+ DETCs in vitro has been suggested (15). To determine further the role of IL-15 and IL-7 during V{gamma}3 cell development in the skin, we injected WT FD18 thymocytes i.v. into syngeneic IL-15-/- mice. We also injected WT FD18 thymocytes i.v. into RAG-1-/- mice as a positive control, and IL-15-/- FD18 thymocytes were adoptively transferred into RAG-1-/- mice to see whether IL-15-/- fetal V{gamma}3 T cells developed normally within the thymus. Six weeks after injection, epidermal sheets were prepared and V{gamma}3+ DETCs were detected by in situ immunofluorescent staining. V{gamma}3+ DETCs could be detected in the skin of RAG-/- mice after adoptive transfer of WT and IL-15-/- FD18 thymocytes. In contrast, V{gamma}3+ DETCs could not be detected in the skin of IL-15-/- mice after adoptive transfer of WT FD18 thymocytes (Fig. 6Go). We compared the expression of IL-7 mRNA by real-time PCR in the skin of WT and IL-15-/- mice. Levels of mRNA for IL-7 in the skin were comparable between WT and IL-15-/- mice (Fig. 7Go).



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 6. Adoptive transfer of WT and IL-15-/- fetal thymocytes into RAG-1-/- mice gives rise to V{gamma}3+ DETCs, whereas adoptive transfer of WT fetal thymocytes into IL-15-/- mice does not. WT FD18 thymocytes were i.v. injected into RAG-1-/- (A) and IL-15-/- (B) mice. IL-15-/- FD18 thymocytes were i.v. injected into RAG-1-/- mice (C). Six weeks later, V{gamma}3+ DETCs were visualized by immunolabeling of epidermal sheets with FITC-conjugated anti-V{gamma}3 mAb.

 


View larger version (9K):
[in this window]
[in a new window]
 
FIGURE 7. Comparable expression of IL-7 mRNA in the skin of IL-15-/- and WT mice. EC suspensions were prepared from adult WT and IL-15-/- mice. cDNA was prepared and real-time PCR for IL-7 and HPRT was performed. Results represent the quantitative expression of IL-7 after normalization to HPRT (mean ± SD) in ECs from WT or IL-15-/- mice.

 
IL-15-/- V{gamma}3 cells cultured in the presence of IL-15 and IL-12 are cytotoxic, whereas IRF-1-/- V{gamma}3 cells are not

To determine whether V{gamma}3 cells from IL-15-/- mice and IRF-1-/- mice are functional we tested their cytolytic activity against YAC-1 cells. FD17 thymocytes from WT mice and from both knockout mice were cultured in the presence of IL-15. After 4 days, V{gamma}3 cells and NK cells, as a control, were sorted and cultured for an additional 2 days in the presence of IL-15 to remove the anti-V{gamma}3 and anti-NK1.1 mAbs from the cell surface. Compared with WT V{gamma}3 cells, V{gamma}3 cells from IL-15-/- mice exhibited reduced killing activity, but cytotoxicity could clearly be detected. The same results were found for IL-15-/- NK cells (Fig. 8Go). In contrast, IRF-1-/- V{gamma}3 cells exhibited very low killing activity, while IRF-1-/- NK cells cultured in the presence of IL-15 exhibited killing activity, but weaker when compared with WT NK cells (Fig. 8Go).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 8. Normal and aberrant cytotoxic capacity of IL-15-/- and IRF-1-/- V{gamma}3 cells, respectively, after culture in IL-15 with or without IL-12. FD17 thymocytes were cultured in the presence of 50 ng/ml rIL-15 for 4 days. V{gamma}3 cells and NK cells were sorted and cultured for an additional 2 days in the presence of 50 ng/ml rIL-15 with or without 2 ng/ml IL-12. The cytotoxicity of V{gamma}3 cells (upper panel) and NK cells (lower panel) was analyzed in a 51Cr release assay against YAC-1 target cells. Experiments were performed four times in triplicate. Results are expressed as the mean ± SD.

 
Because the addition of IL-12 augments the killing capacity of NK cells, NK-T cells, and human {gamma}{delta} T cells (29, 30, 31, 32, 33, 34), we determined whether addition of IL-12 could restore the killing activity of IRF-1-/- V{gamma}3 cells. IL-15-cultured V{gamma}3 cells from IRF-1-/- mice were sorted and cultured for an additional 2 days in the presence of IL-15 plus IL-12. IL-12 did not increase the killing activity of IRF-1-/- V{gamma}3 cells, while the killing activity of WT V{gamma}3 cells and IL-15-/- V{gamma}3 cells was significantly enhanced (Fig. 8Go). Next, we determined whether the lack of cytolytic activity seen in V{gamma}3 cells from IRF-1-/- mice upon IL-12 triggering was due to a diminished IL-12R expression. RT-PCR confirmed the presence of mRNA of IL-12R{beta}2 chain in V{gamma}3 cells from IRF-1-/- mice cultured in the presence of IL-15, and no difference was found as compared with WT V{gamma}3 cells (Fig. 9Go).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 9. Comparable expression levels of IL-12R mRNA in WT and IRF-1-/- V{gamma}3 cells. FD17 thymocytes were cultured in the presence of 50 ng/ml rIL-15 for 4 days. V{gamma}3 cells were sorted to a purity of >=99.7%. cDNA was prepared and semiquantitative RT-PCR for HPRT and IL-12R{beta}2 was performed.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we determined the role of IL-15 in the development and maturation of V{gamma}3 cells. We demonstrate that IL-15, but not the transcription factor IRF-1, is important for the phenotypic maturation of V{gamma}3 thymocytes within the fetal thymus and is essential for the presence of V{gamma}3+ DETCs in the epidermis of adult mice. The results found in IRF-1-/- mice suggest that the level of IL-15 expression during ontogeny might determine the normal morphologic maturation of V{gamma}3+ DETCs within the epidermis. The in vivo experiments of adoptive transfer of fetal thymocytes and the data obtained by real-time PCR for IL-7 confirmed the nonredundant role of IL-15 during V{gamma}3 T cell development in the skin. Our data also indicate that IRF-1 is essential for the induction of V{gamma}3 T cell-mediated cytotoxicity.

Our results show that mature V{gamma}3 thymocytes were decreased but not completely eliminated in IL-15-/- mice, whereas normal numbers were found in IRF-1-/- mice. These observations indicate that 1) other cytokines can support the development and/or survival of mature fetal V{gamma}3 thymocytes, and 2) minimal concentrations of IL-15 are sufficient to support the normal survival and/or differentiation of mature fetal V{gamma}3 thymocytes. In this context, it has been reported that IL-7 is involved in the maturation of V{gamma}3 cells in the fetal thymus (14, 35). IL-7 signaling is important during thymic differentiation of V{gamma}3 cells, because maturation of fetal V{gamma}3 thymocytes is almost completely blocked in IL-7-/- and IL-7R{alpha}-/- mice (8, 9). In addition, IL-7R signaling induces germline transcription in the TCR {gamma} locus and supports the proliferation and survival of lymphocyte precursors (10, 36). The absence of mature V{gamma}3 cells in IL-7-/- mice shows that IL-15 alone is not sufficient for maturation of V{gamma}3 thymocytes to occur.

{gamma}c-/- mice have severely reduced numbers of immature fetal V{gamma}3 thymocytes, no mature V{gamma}3 thymocytes, and an absence of epidermal V{gamma}3+ DETCs (20). IL-7 and IL-15 are known to share the {gamma}c. V{gamma}3+ DETCs are absent in IL-7-/- and IL-7R{alpha}-/- mice, indicating a role for IL-7 in V{gamma}3+ DETC development (8, 9, 21). However, our data also show that IL-15 is nonredundant for the development and/or survival of V{gamma}3+ DETCs in vivo, because these cells were completely absent in the epidermis of IL-15-/- mice. Adoptive transfer of WT FD18 thymocytes into IL-15-/- mice clearly indicated that IL-15 plays a nonredundant role in V{gamma}3+ DETC development. In addition, we found comparable levels of IL-7 mRNA in the skin of IL-15-/- and WT mice, suggesting that although IL-7 is present in the skin of IL-15-/- mice it is not sufficient to support the development of V{gamma}3+ DETCs. These data indicate that, whereas other cytokines like IL-7 can promote the development of fetal V{gamma}3 thymocytes and support the proliferation and survival of DETCs in vitro (8, 9, 15), they cannot compensate for IL-15 during development of V{gamma}3+ DETCs in the epidermis. Results obtained by others have already shown a reduction of mature fetal V{gamma}3 thymocytes and the absence of DETCs in IL-2R{beta}-/- mice. Furthermore, in contrast to the IL-7R, an essential role for the IL-2R{beta} chain in the proliferation and survival of DETCs in the skin has been shown (37). Our data are in agreement with these results and, in addition, confirm the previous assumption that signaling through the IL-2R{beta} chain by the cytokine IL-15, rather than IL-2, is a key factor in DETC development.

The kinetic studies we performed ( Figs. 3–5GoGoGo) support the assumption that IL-15 is a key factor for normal development of V{gamma}3 cells in the skin. Newly arriving DETC precursors in the skin, derived from fetal V{gamma}3+ thymocytes (5, 38), are known to undergo proliferation in the epidermis (6, 39, 40). Colonization of the epidermis occurs in the perinatal period. The results we found for the kinetics in appearance of mature Thy+ and V{gamma}3+ DETCs in the epidermis of WT mice are in agreement with previously reported data (39). Different kinetics in appearance of Thy1+ and V{gamma}3+ DETCs were found in IRF-1-/- mice. In addition, morphologically, most Thy1+ and V{gamma}3+ DETCs from IRF-1-/- mice had less extensive dendrites compared with WT DETCs at each time point investigated. No V{gamma}3+ DETCs could be found at any time point after birth in the skin of IL-15-/- mice. Because the transcription factor IRF-1 regulates IL-15 expression (25), we postulate that the amount of IL-15 expression during ontogeny could determine the maturation of DETC precursors in the epidermis. IL-15 mRNA levels in the epidermis of WT mice were indeed higher compared with the levels found in IRF-1-/- mice at each time point examined. Although this might indicate that also higher levels of IL-15 protein are present, one has to keep in mind that IL-15 synthesis and secretion can be negatively regulated at multiple levels, i.e., at the levels of transcription, translation, and intracellular trafficking (41, 42). We were not able to measure IL-15 protein levels, as no reliable IL-15 ELISA method is available at the moment. It has already been postulated that skin epithelium has the capacity to induce DETC maturation (40) and that cytokines expressed in the epidermis might determine the localization and maturation of V{gamma}3+ DETCs in the epidermis (8, 17, 18, 43, 44). Our results obtained in IL-15-/- and IRF-1-/- mice suggest that the presence of threshold amounts of IL-15 in the skin epithelium is essential during the development and maturation of DETCs in the epidermis.

V{gamma}3 cells, cultured in the presence of IL-2 or IL-15, proliferate and acquire lymphokine-activated killing capacities (45). IL-15-/- V{gamma}3 cells, cultured in the presence of IL-15, acquired reduced but significant killing capacity when compared with WT V{gamma}3 cells, whereas IRF-1-/- V{gamma}3 cells exhibited a drastically decreased killing activity. In contrast, and in agreement with published data (25), IRF-1-/- NK cells acquired significant killing activity in response to IL-15, but it was still somewhat lower when compared with WT NK cells. Our in vitro studies on V{gamma}3 and NK killing capacity from IL-15-/- mice and IRF-1-/- mice, and previous data showing the importance of IL-15 in the development of functional cytotoxic cells (11), suggest that IRF-1 controls the expression of other, non-IL-15, target gene(s) that contributes to the acquisition of cytotoxicity in V{gamma}3 cells. In this context, IL-12 has been shown to enhance {gamma}{delta} T cell cytotoxicity activity (29, 33). Because IRF-1 is known to regulate IL-12 expression (46), IL-12 could be the missing factor to induce lytic activity in IRF-1-/- V{gamma}3 cells. But, in contrast to WT V{gamma}3 cells and IL-15-/- V{gamma}3 cells, addition of IL-12 did not enhance the killing capacity of IRF-1-/- V{gamma}3 cells. As this might be due to inadequate expression of the IL-12R, we measured IL-12R mRNA levels by semiquantitative RT-PCR. However, V{gamma}3 cells from IRF-1-/- mice expressed the same levels of mRNA for IL-12R as compared with WT V{gamma}3+ thymocytes. This is in contrast with a previous report which shows a reduced expression of IL-12R mRNA in IRF-1-/- mice. But mRNA levels were determined only for hepatic and pulmonary tissues and macrophages, not for {gamma}{delta} T cells (47). IL-12 induces cytotoxicity, presumably through the induction of genes involved in target cell lysis, such as perforin or granzyme B (48, 49). The induction of lytic granules containing perforin and granzymes might be defective in IRF-1-/- mice, explaining the lack of lytic activity. But V{gamma}3 cells from IRF-1-/- mice showed normal expression of perforin and contained lytic granules (data not shown). Because the presence of perforin is sufficient for the lysis of YAC-1 target cells (50), we did not examine whether granzymes were present. Furthermore, IRF-1-/- V{gamma}3 cells showed normal adhesion to the target cells and expressed normal levels of the 2B4 NK receptor (data not shown), which has been shown to augment the killing capacity of V{gamma}3 cells (51, 52).

The difference observed in V{gamma}3 T cell morphology and function between IRF-1-/- and WT mice can be due to differences in basal and inducible expression levels, respectively, of IL-15 (25). In addition, because IRF-1 is known to regulate several other genes in addition to IL-12, such as type I IFNs, IL-18, inducible NO synthase, and Fas ligand (25, 46, 53, 54, 55, 56, 57, 58), and is located downstream from IFN-{gamma}, IFN-{alpha}{beta}, IL-6, IL-1, and TNF (59, 60, 61, 62), we cannot rule out the possibility that one of these factors is involved in the morphological maturation and function of V{gamma}3 T cells.

IL-15-/- mice specifically lack NK cells, NK-T cells, intestinal intraepithelial lymphocytes, and memory CD8+ T cells (11). The loss of these cells demonstrates that IL-15 is mainly critical for the development and/or maintenance of lymphoid cells of the innate immune system. V{gamma}3 cells share common features with both NK and NK-T innate immune cells, as V{gamma}3 cells also express NK cell markers including 2B4 (52), IL-2R{beta}/IL-15R{beta} (30), Ly49E, and CD94/NKG2 (63), and as they express a canonical TCR V{gamma}3/V{delta}1 (14, 52, 64). IL-7 is necessary for normal development of lymphoid cells of the adaptive immune system (10). Others have shown that IL-7 is also essential for thymic differentiation of V{gamma}3 cells (9, 21). These data, in combination with our finding that V{gamma}3 cell development is impaired in the skin IL-15-/- mice, indicate that the cytokine requirements during fetal thymic differentiation of V{gamma}3 cells are characteristic of adaptive immune cells, whereas cytokine requirements for peripheral survival are characteristic of innate immune cells. This resemblance of V{gamma}3 cells with both cells from the innate immune system and the adaptive immune system confirms the assumption that V{gamma}3 cells are at the transition between these two systems.


    Acknowledgments
 
We thank Dr. J. Peschon and Dr. P. Matthys for providing us with IL-15-/- and IRF-1-/- mice, respectively. We also thank M. De Smedt for purification of Abs and C. Collier and G. De Smet for animal care. We thank T. Van Belle for optimizing and performing the real-time PCR for IL-15 and T. Taghon and T. Kerre for excellent discussions.


    Footnotes
 
1 This work was supported by grants from the research fund of the University of Ghent and the Fund for Scientific Research of Flanders (Belgium). Back

2 Address correspondence and reprint requests to Dr. Georges Leclercq, Department of Clinical Chemistry, Microbiology, and Immunology, University of Ghent, University Hospital, B-9000 Ghent, Belgium. E-mail address: Georges.leclercq{at}rug.ac.be Back

3 Abbreviations used in this paper: DETC, dendritic epidermal T cell; {gamma}c, common {gamma}-chain; HPRT, hypoxanthine phosphoribosyltransferase; EC, epidermal cell; FCA, flow cytometric analysis; RAG, recombination-activating gene; FD, fetal day; HSA, heat-stable Ag; IRF-1, IFN regulatory factor-1; rhu, recombinant human; WT, wild type. Back

Received for publication December 7, 2001. Accepted for publication April 12, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ito, K., M. Bonneville, Y. Takagaki, N. Nakanishi, O. Kanagawa, E. G. Krecko, S. Tonegawa. 1989. Different {gamma}{delta} T cell receptors are expressed on thymocytes at different stages of development. Proc. Natl. Acad. Sci. USA 86:631.[Abstract/Free Full Text]
  2. Havran, W. L., J. P. Allison. 1988. Developmentally ordered appearance of thymocytes expressing different T-cell antigen receptors. Nature 335:443.[Medline]
  3. Lafaille, J. J., A. DeCloux, M. Bonneville, Y. Takagaki, S. Tonegawa. 1989. Junctional sequences of T cell receptor {gamma}{delta} genes: implications for {gamma}{delta} T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59:859.[Medline]
  4. Tigelaar, R. E., J. M. Lewis, P. R. Bergstresser. 1990. TCR {gamma}/{delta}+ dendritic epidermal T cells as constituents of skin-associated lymphoid tissue. J. Invest. Dermatol. 94:58.[Medline]
  5. Havran, W. L., J. P. Allison. 1990. Origin of Thy-1+ dendritic epidermal cells of adult mice from fetal thymic precursors. Nature 344:68.[Medline]
  6. Payer, E., A. Elbe, G. Stingl. 1991. Circulating CD3+/T cell receptor V{gamma}3+ fetal murine thymocytes home to the skin and give rise to proliferating dendritic epidermal T cells. J. Immunol. 146:2536.[Abstract]
  7. DiSanto, J. P., D. Guy Grand, A. Fisher, A. Tarakhovsky. 1996. Critical role for the common cytokine receptor {gamma} chain in intrathymic and peripheral T cell selection. J. Exp. Med. 183:1111.[Abstract/Free Full Text]
  8. Maki, K., S. Sunaga, Y. Komagata, Y. Kodaira, A. Mabuchi, H. Karasuyama, K. Yokomuro, J. I. Miyazaki, K. Ikuta. 1996. Interleukin 7 receptor-deficient mice lack {gamma}{delta} T cells. Proc. Natl. Acad. Sci. USA 93:7172.[Abstract/Free Full Text]
  9. Moore, T. A., U. von Freeden Jeffry, R. Murray, A. Zlotnik. 1996. Inhibition of {gamma}{delta} T cell development and early thymocyte maturation in IL-7-/- mice. J. Immunol. 157:2366.[Abstract]
  10. Peschon, J. J., P. J. Morrissey, K. H. Grabstein, F. J. Ramsdell, E. Maraskovsky, B. C. Gliniak, L. S. Park, S. F. Ziegler, D. E. Williams, C. B. Ware, et al 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J. Exp. Med. 180:1955.[Abstract/Free Full Text]
  11. Kennedy, M. K., M. Glaccum, S. N. Brown, E. A. Butz, J. L. Viney, M. Embers, N. Matsuki, K. Charrier, L. Sedger, C. R. Willis, et al 2000. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J. Exp. Med. 191:771.[Abstract/Free Full Text]
  12. Lodolce, J. P., D. L. Boone, S. Chai, R. E. Swain, T. Dassopoulos, S. Trettin, A. Ma. 1998. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity 9:669.[Medline]
  13. Leclercq, G., M. De Smedt, B. Tison, J. Plum. 1990. Preferential proliferation of T cell receptor V{gamma}3-positive cells in IL-2-stimulated fetal thymocytes. J. Immunol. 145:3992.[Abstract]
  14. Leclercq, G., M. De Smedt, J. Plum. 1995. Cytokine dependence of V{gamma}3 thymocytes: mature but not immature V{gamma}3 cells require endogenous IL-2 and IL-7 to survive: evidence for cytokine redundancy. Int. Immunol. 7:843.[Abstract/Free Full Text]
  15. Matsue, H., P. R. Bergstresser, A. Takashima. 1993. Keratinocyte-derived IL-7 serves as a growth factor for dendritic epidermal T cells in mice. J. Immunol. 151:6012.[Abstract]
  16. Nishimura, H., K. Hiromatsu, N. Kobayashi, K. H. Grabstein, R. Paxton, K. Sugamura, J. A. Bluestone, Y. Yoshikai. 1996. IL-15 is a novel growth factor for murine {gamma}{delta} T cells induced by Salmonella infection. J. Immunol. 156:663.[Abstract]
  17. Kawai, K., H. Suzuki, K. Tomiyama, M. Minagawa, T. W. Mak, P. S. Ohashi. 1998. Requirement of the IL-2 receptor {beta} chain for the development of V{gamma}3 dendritic epidermal T cells. J. Invest. Dermatol. 110:961.[Medline]
  18. Tanaka, T., Y. Takeuchi, T. Shiohara, F. Kitamura, Y. Nagasaka, K. Hamamura, H. Yagita, M. Miyasaka. 1992. In utero treatment with monoclonal antibody to IL-2 receptor {beta}-chain completely abrogates development of Thy-1+ dendritic epidermal cells. Int. Immunol. 4:487.[Abstract/Free Full Text]
  19. Watanabe, Y., T. Sudo, N. Minato, A. Ohnishi, Y. Katsura. 1991. Interleukin 7 preferentially supports the growth of {gamma}{delta} T cell receptor-bearing T cells from fetal thymocytes in vitro. Int. Immunol. 3:1067.[Abstract/Free Full Text]
  20. Malissen, M., P. Pereira, D. J. Gerber, B. Malissen, J. P. DiSanto. 1997. The common cytokine receptor {gamma} chain controls survival of {gamma}/{delta} T cells. J. Exp. Med. 186:1277.[Abstract/Free Full Text]
  21. Laky, K., L. Lefrancois, U. von Freeden Jeffry, R. Murray, L. Puddington. 1998. The role of IL-7 in thymic and extrathymic development of TCR {gamma}{delta} cells. J. Immunol. 161:707.[Abstract/Free Full Text]
  22. Giri, J. G., M. Ahdieh, J. Eisenman, K. Shanebeck, K. Grabstein, S. Kumaki, A. Namen, L. S. Park, D. Cosman, D. Anderson. 1994. Utilization of the {beta} and {gamma} chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 13:2822.[Medline]
  23. de Jong, J. L. O., N. L. Farner, M. B. Widmer, J. G. Giri, P. M. Sondel. 1996. Interaction of IL-15 with the shared IL-2 receptor {beta} and common {gamma} subunits: the IL-15/{beta}/common {gamma} receptor-ligand complex is less stable than the IL-2/{beta}/common {gamma} receptor-ligand complex. J. Immunol. 156:1339.[Abstract]
  24. Schimpl, A., T. Hünig, A. Elbe, I. Berberich, S. Krämer, H. Merz, A. C. Feller, B. Sadlack, H. Schorle, I. Horak. 1994. Development and function of the immune system in mice with targeted disruption of the interleukin-2 gene. H. Bleuthmann, and P. S. Ohashi, eds. Transgenesis and Targeted Mutagenesis in Immunology 191. Academic, San Diego.
  25. Ohteki, T., H. Yoshida, T. Matsuyama, G. S. Duncan, T. W. Mak, P. S. Ohashi. 1998. The transcription factor interferon regulatory factor 1 (IRF-1) is important during the maturation of natural killer 1.1+ T cell receptor-{alpha}/{beta}+ (NK1+ T) cells, natural killer cells, and intestinal intraepithelial T cells. J. Exp. Med. 187:967.[Abstract/Free Full Text]
  26. Kimura, T., K. Nakayama, J. Penninger, M. Kitagawa, H. Harada, T. Matsuyama, N. Tanaka, R. Kamijo, J. Vilcek, T. W. Mak, et al 1994. Involvement of the IRF-1 transcription factor in antiviral responses to interferons. Science 264:1921.[Abstract/Free Full Text]
  27. De Creus, A., K. Van Beneden, T. Taghon, V. Debacker, J. Plum, G. Leclercq. 2000. Langerhans cells that have matured in vivo in the absence of T cells are fully capable of inducing a helper CD4 as well as a cytotoxic CD8 response. J. Immunol. 165:645.[Abstract/Free Full Text]
  28. Leclercq, G., J. Plum, D. Nandi, M. De Smedt, J. P. Allison. 1993. Intrathymic differentiation of V{gamma}3 T cells. J. Exp. Med. 178:309.[Abstract/Free Full Text]
  29. Cesano, A., S. Visonneau, S. C. Clark, D. Santoli. 1993. Cellular and molecular mechanisms of activation of MHC nonrestricted cytotoxic cells by IL-12. J. Immunol. 151:2943.[Abstract]
  30. Chehimi, J., S. E. Starr, I. Frank, M. Rengaraju, S. J. Jackson, C. Llanes, M. Kobayashi, B. Perussia, D. Young, E. Nickbarg, et al 1992. Natural killer (NK) cell stimulatory factor increases the cytotoxic activity of NK cells from both healthy donors and human immunodeficiency virus-infected patients. J. Exp. Med. 175:789.[Abstract/Free Full Text]
  31. Fujimiya, Y., Y. Suzuki, R. Katakura, T. Miyagi, T. Yamaguchi, T. Yoshimoto, T. Ebina. 1997. In vitro interleukin 12 activation of peripheral blood CD3+CD56+ and CD3+CD56- {gamma}{delta} T cells from glioblastoma patients. Clin. Cancer Res. 3:633.[Abstract]
  32. Hashimoto, W., K. Takeda, R. Anzai, K. Ogasawara, H. Sakihara, K. Sugiura, S. Seki, K. Kumagai. 1995. Cytotoxic NK1.1 Ag+ {alpha}{beta} T cells with intermediate TCR induced in the liver of mice by IL-12. J. Immunol. 154:4333.[Abstract]
  33. Klein, J. L., H. Fickenscher, J. E. Holliday, B. Biesinger, B. Fleckenstein. 1996. Herpesvirus saimiri immortalized {gamma}{delta} T cell line activated by IL-12. J. Immunol. 156:2754.[Abstract]
  34. Satoh, M., S. Seki, W. Hashimoto, K. Ogasawara, T. Kobayashi, K. Kumagai, S. Matsuno, K. Takeda. 1996. Cytotoxic {gamma}{delta} or {alpha}{beta} T cells with a natural killer cell marker, CD56, induced from human peripheral blood lymphocytes by a combination of IL-12 and IL-2. J. Immunol. 157:3886.[Abstract]
  35. Leclercq, G., V. Debacker, M. De Smedt, J. Plum. 1996. Differential effects of interleukin-15 and interleukin-2 on differentiation of bipotential T/natural killer progenitor cells. J. Exp. Med. 184:325.[Abstract/Free Full Text]
  36. Maki, K., S. Sunaga, K. Ikuta. 1996. The V-J recombination of T cell receptor-{gamma} genes is blocked in interleukin-7 receptor-deficient mice. J. Exp. Med. 184:2423.[Abstract/Free Full Text]
  37. Ye, S., K. Maki, H. Lee, A. Ito, K. Kawai, H. Suzuki, T. Mak, Y. Chien, T. Honjo, K. Ikuta. 2001. Differential roles of cytokine receptors in the development of {gamma}{delta} T cells. J. Immunol. 167:1929.[Abstract/Free Full Text]
  38. Allison, J. P., D. M. Asarnow, M. Bonyhadi, A. Carbone, W. L. Havran, D. Nandi, J. Noble. 1991. {gamma}{delta} T cells in murine epithelia: origin, repertoire, and function. Adv. Exp. Med. Biol. 292:63.[Medline]
  39. Elbe, A., E. Tschachler, G. Steiner, A. Binder, K. Wolff, G. Stingl. 1989. Maturational steps of bone marrow-derived dendritic murine epidermal cells: phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period. J. Immunol. 143:2431.[Abstract]
  40. Elbe, A., O. Kilgus, R. Strohal, E. Payer, S. Schreiber, G. Stingl. 1992. Fetal skin: a site of dendritic epidermal T cell development. J. Immunol. 149:1694.[Abstract]
  41. Kurys, G., Y. Tagaya, R. Bamford, J. A. Hanover, T. A. Waldmann. 2000. The long signal peptide isoform and its alternative processing direct the intracellular trafficking of interleukin-15. J. Biol. Chem. 275:30653.[Abstract/Free Full Text]
  42. Bamford, R. N., A. P. DeFilippis, N. Azimi, G. Kurys, T. A. Waldmann. 1998. The 5' untranslated region, signal peptide, and the coding sequence of the carboxyl terminus of IL-15 participate in its multifaceted translational control. J. Immunol. 160:4418.[Abstract/Free Full Text]
  43. Takashima, A., H. Matsue, P. R. Bergstresser, K. Ariizumi. 1995. Interleukin-7-dependent interaction of dendritic epidermal T cells with keratinocytes. J. Invest. Dermatol. 105:50.
  44. Stingl, G., A. Elbe, E. Paer, O. Kilgus, R. Strohal, S. Schreiber. 1991. The role of fetal epithelial tissues in the maturation/differentiation of bone marrow-derived precursors into dendritic epidermal T cells (DETC) of the mouse. Curr. Top. Microbiol. Immunol. 173:269.[Medline]
  45. Leclercq, G., M. De Smedt, J. Plum. 1991. Interleukin-2 stimulated T cell receptor V{gamma}3 positive thymocytes do not migrate to the skin. Immunol. Lett. 28:135.[Medline]
  46. Salkowski, C. A., K. Kopydlowski, J. Blanco, M. J. Cody, R. McNally, S. N. Vogel. 1999. IL-12 is dysregulated in macrophages from IRF-1 and IRF-2 knockout mice. J. Immunol. 163:1529.[Abstract/Free Full Text]
  47. Salkowski, C. A., K. E. Thomas, M. J. Cody, S. N. Vogel. 2000. Impaired IFN-{gamma} production in IFN regulatory factor-1 knockout mice during endotoxemia is secondary to a loss of both IL-12 and IL-12 receptor expression. J. Immunol. 165:3970.[Abstract/Free Full Text]
  48. DeBlaker Hohe, D. F., A. Yamauchi, C. R. Yu, J. A. Horvath Arcidiacono, E. T. Bloom. 1995. IL-12 synergizes with IL-2 to induce lymphokine-activated cytotoxicity and perforin and granzyme gene expression in fresh human NK cells. Cell. Immunol. 165:33.[Medline]
  49. Salcedo, T. W., L. Azzoni, S. F. Wolf, B. Perussia. 1993. Modulation of perforin and granzyme messenger RNA expression in human natural killer cells. J. Immunol. 151:2511.[Abstract]
  50. Davis, J. E., M. J. Smyth, J. A. Trapani. 2001. Granzyme A and B-deficient killer lymphocytes are defective in eliciting DNA fragmentation but retain potent in vivo anti-tumor capacity. Eur. J. Immunol. 31:39.[Medline]
  51. Schuhmachers, G., K. Ariizumi, P. A. Mathew, M. Bennett, V. Kumar, A. Takashima. 1995. Activation of murine epidermal {gamma}{delta} T cells through surface 2B4. Eur. J. Immunol. 25:1117.[Medline]
  52. Schuhmachers, G., K. Ariizumi, P. A. Mathew, M. Bennett, V. Kumar, A. Takashima. 1995. 2B4, a new member of the immunoglobulin gene superfamily, is expressed on murine dendritic epidermal T cells and plays a functional role in their killing of skin tumors. J. Invest. Der