| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
-Dependent CD4 Cell Immunity1
* Department of Pathology, Case Western Reserve University School of Medicine, Cleveland, OH 44106; and
Section of Endocrinology, University Hospitals, Ulm, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
10/106, the
magnitude of this constitutively induced immune response did not
suffice to control the tumor cell growth. In contrast, immunization
with H11.1 peptide, using an immunostimulatory CpG oligonucleotide or
CFA as adjuvant, engaged 25- or 10-fold higher clonal sizes of
type 1 polarized CD4 cells, respectively. Therefore, the CpG
oligonucleotide functioned as a stronger type 1 adjuvant and, unlike
CFA, elicited protective immunity. The protection was IFN-
dependent, as it was not inducible in IFN- knockout mice. Therefore,
CpG adjuvant-guided induction of type 1 immunity against tumor Ags
might be a promising subunit vaccination
approach. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As the success of subunit vaccinations against cancer cells can be
expected to depend on the induction of type 1 immunity against the
tumor Ag/peptide, there is a clear need for an adjuvant capable of
preferentially inducing type 1 immunity that is also suited for use in
humans. Adjuvant effects exerted by immunostimulatory
(ISS)3
oligodeoxynucleotides (ODN) hold promise for this purpose
(5, 6, 7, 8). Using Toll-like receptor-9, cells of the
innate immune system (including dendritic cells (DC), macrophages, and
NK cells) can recognize CpG motifs as a common feature of infectious
non-self, and this triggers production of cytokines (such as IL-1,
IL-6, IL-12, TNF-
) and up-regulation of costimulatory cell surface
molecules (6, 9, 10). Thus, CpG-containing DNA, or
synthetic ODN that contain this motif, are potent inducers of the
second signal link: admixing of CpG ODN into IFA has been shown to
generate a CFA-like adjuvant that can be used to guide the engagement
of Th1-type immune responses (11). ODNs cannot bind to MHC
molecules and are not recognized as Ags by T cells. Therefore,
CpG-based adjuvants do not trigger the severe granulomatous reactions
that are inherently caused by the immunogenic mycobacterial proteins
contained in CFA. These properties make CpG-containing adjuvants prime
candidates for adjuvant-guided type 1 immunity (6, 7, 12).
Therefore, it is of considerable interest to what extent the adjuvant
properties of CpG ODN can be exploited for cancer therapy.
The experiments presented in this work address the question of whether immunization with an MHC class II-restricted tumor peptide with CpG ODN can generate a CD4 cell response in nontransgenic mice potent enough to control tumor cell growth. We selected the C57BL/6-derived class II-negative T cell lymphoma RMA as a model system because it possesses a well-defined I-Ab-restricted determinant (peptide H11.1) (13). Our studies evaluate the in vivo clonal sizes and the cytokine lineage of H11.1 peptide-specific CD4 and CD8 cells induced by vaccination with this peptide using CpG, non-CpG (nCpG), CFA, and IFA as adjuvants, using a single-cell resolution cytokine ELISPOT approach. We further evaluate the clinical effects of such immunizations on the otherwise lethal injection of RMA cells into recipient mice (3).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6, IFN--/-,
IL-2-/-, IL-4-/-,
IL-5-/-, IL-6-/-, and
recombination-activating gene (RAG)-1-/- mice,
all on the C57BL/6 background, were purchased from The Jackson
Laboratory (Bar Harbor, ME) and maintained at the animal facility of
Case Western Reserve University (Cleveland, OH) under specific
pathogen-free conditions. Female mice were used at 6–10 wk of age. The
tumor cell line RMA is a mutagenized derivative of RBL-5, a Rauscher
murine leukemia virus (MuLV)-induced T lymphoma cell line of C57BL/6
origin (14). For RMA tumor challenge 1000 RMA cells were
injected in a volume of 500 µl PBS i.v. into one mouse, a dose that
has been established to invariably cause 100% lethality 21 days
after injection (13).
ODN and peptides
The ODN were purchased from Oligos Etc. (Wilsonville, OR). The sequences of ODN that were phosphorothioate modified throughout (S ODN) are as follows: CpG ODN 1826, TCCATGACGTTCCTGACGTT; nCpG ODN 1745 (control), TCCAATGAGCTTCCTGAGTCT, as they have been previously defined (11). ODN were dissolved in sterile PBS, aliquoted, and then stored at -20°C until used. The peptide H11.1 (SLTPRCNTAWN) is a defined determinant of the envelope protein of Rauscher MuLV that originally caused the transformation of the RMA T cell lymphoma (13). As a control peptide we used OVA323–339 (KISQAVHAAHAEINEAG), which is also an I-Ab-restricted determinant (15). Both were purchased from Princeton Biomolecules (Langhorne, PA). They were dissolved in double-distilled water at a concentration of 2 mM, aliquoted in a volume of 500 µl, and stored at -20°C.
Immunization and tumor challenge
IFA was purchased from Life Technologies (Grand Island, NY). CFA was prepared by mixing heat-inactivated Mycobacterium tuberculosis H37RA (Difco, Detroit, MI) at 5 mg/ml into IFA. The CpG and nCpG adjuvant were prepared by adding 25 µl of the CpG or nCpG ODN as specified above at 12 µg/µl each to the IFA/peptide solution. One milliliter of each adjuvant was emulsified with 500 µl of either peptide (at 2 mM) and 500 µl of sterile PBS; 200 µl of this emulsion was injected i.p. into female 6- to 10-wk-old C57BL/6 mice (thus, the dose of ODN and H11.1 peptide injected was 30 and 100 µg per mouse, respectively). Three weeks after the immunization the mice were either sacrificed for ELISPOT analysis or challenged with 1000 RMA tumor cells, i.v. injected in 500 µl PBS per animal. The survival of these mice was monitored daily.
Cytotoxicity assay
The assay was performed as previously described (16). Briefly, spleens were removed 12 days after PBS or tumor injection and single-cell suspensions were prepared. Cells from four animals per group were pooled. Splenocytes were restimulated with the Ag in tissue culture as follows. Spleen cells (1 x 107) were coincubated with 5 x 105 irradiated (10,000 rad) RMA cells or RMA cells together with H11.1 peptide (at 70 µg/ml) in complete DMEM in 24-well flat-bottom plates. After 5 days of incubation, the cytotoxicity of the effector cells was assayed on RMA cells that were labeled with Na51CrO4 (Amersham, Arlington Heights, IL). The percentage-specific lysis was calculated as follows: [(experimental 51Cr release - spontaneous 51Cr release)/(maximum 51Cr release - spontaneous 51Cr release)] x 100, where the spontaneous release is the radioactivity of target cells in the absence of effectors (background) and maximum release is the radioactivity released by the targets incubated in 5% Triton X-100 (Fisher Scientific, Fair Lawn, NJ).
Cell separations
Erythrocytes were depleted from spleen cells by Ficoll (Sigma-Aldrich, St. Louis, MO) density gradient separation. CD4+ cells and CD8+ cells were obtained by negative selection, passing erythrocyte-depleted spleen cells through murine CD4+ or CD8+ T cell Enrichment Columns (R&D Systems, Minneapolis, MN). The efficacy of enrichment was controlled by FACS analysis staining with labeled anti-CD4, anti-CD8, and anti-CD3 Abs (all from BD PharMingen, San Diego, CA). More than 95% enrichment for the desired phenotype was obtained. All cell fractions were plated at 2 x 105 cells/well and tested in ELISPOT assays (described below) with 5 x 105 irradiated C57BL/6 APCs or the appropriate cytokine knockout (KO) APCs.
Cytokine ELISPOT assays
These assays were performed as previously described
(3). Briefly, ImmunoSpot M200 plates (Cellular Technology,
Cleveland, OH) were coated overnight at 4°C with the
cytokine-specific capture Abs specified below. The plates were washed
three times with PBS, then blocked with 1% BSA in PBS for 2 h at
room temperature. After washing, freshly isolated splenocytes were
plated at 106 cells/well in serum-free medium,
HL-1 (BioWhittaker, Walkersville, MA), supplemented with
L-glutamine and penicillin/streptomycin, in the presence or
absence of 10,000-rad irradiated RMA tumor cells, H11.1, or OVA peptide
at a final concentration of 70 µg/ml. As a positive control,
anti-CD3 (2C11) at 3 µg/ml was used. After 24 h (for
IFN-, IL-2, IL-6, IL-12, and TNF-
) or 48 h (for IL-4 and
IL-5) of cell culture in the incubator, the cells were removed by
washing three times with PBS and four times with PBS containing 0.05%
Tween (PBST). Then the biotinylated detection Abs were added and
incubated at 4°C overnight. The plates were then washed three times
with PBST and subsequently streptavidin-HRP conjugate (DAKO,
Carpinteria, CA) was added at a 1/2,000 dilution, incubated for 2
h at room temperature, and removed by washing twice with PBST and PBS.
The spots were visualized by adding HRP substrate
3-amino-9-ethylcarbozole (Pierce, Rockford, IL). The plates were then
washed with distilled water, air dried, and analyzed the next day with
the Series 1 ImmunoSpot Analyzer (Cellular Technology) customized for
analyzing ELISPOTs to meet objective criteria for size, chromatic
density, shape, and color. We used the following combinations of
capture mAbs for the cytokines tested: IFN- (R46A2, 4 µg/ml), IL-2
(JES6-1A12, 4 µg/ml), IL-4 (11B11, 4 µg/ml), IL-5 (TRFK5, 2.5
µg/ml), IL-6 (MP5-20F3, 4 µg/ml), IL-12 (9A5, 2.5 µg/ml), and
TNF- (G281-2626, 4 µg/ml). For their detection the mAbs IFN-
(XMG1.1-biotin, 0.25 µg/ml), IL-2 (JES6-5H4-biotin, 2 µg/ml), IL-4
(BVD6-24G2-biotin, 4 µg/ml), IL-5 (TRFK4-biotin, 4 µg/ml), IL-6
(MP5-32C11-biotin, 2 µg/ml), IL-12 (C17.8-biotin, 2 µg/ml), and
TNF- (MP6-XT3-biotin, 1 µg/ml) were used in these assays.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-2 is
<1/106
Taking advantage of the high resolution of ELISPOT analysis
(detection limit, 1/106), we first addressed the
question of the RMA-specific preimmune repertoire. We tested spleen
cells of naive C57BL/6 mice for RMA-induced cytokine production (Fig. 1
, open bars). The tumor cells triggered
the spleen cells to secrete IL-4, IL-6, IL-12, and TNF-, in the
absence of detectable IFN- and IL-2. The number of spot-forming
units was 15/106 for IL-4 (medium control,
3/106), 197/106 for IL-6
(medium control, 92/106),
13/106 for IL-12 (medium control,
5/106), and 159/106 for
TNF- (medium control, 69/106). This IL-4,
IL-6, IL-12, and TNF- was produced by cells of the innate immune
system; spleen cells of RAG-1 KO mice responded with a similar cytokine
secretion profile when exposed to RMA cells (Fig. 1, filled bars). As
expected, the frequencies of cells producing these cytokines in the
RAG-1 KO mice were higher than that found in the wild type (WT; only
10% of the spleen cells in a WT mouse are members of the innate
immune system). The RMA cells themselves did not produce any of these
cytokines (data not shown). The data show, first, that RMA cells
activate cells of the innate immune system and, second, that the
frequency of RMA- or H11.1-specific T lymphocytes in the preimmune
repertoire is <1/106.
|
First, we studied the clonal size and the cytokine signature of
RMA-specific T cells under these conditions of apparently uncontrolled,
fulminant tumor growth. Twelve days after i.v. injection of 1000 RMA
cells, the recipient mice were sacrificed and their spleen cells were
tested directly ex vivo for reactivity to either the RMA tumor itself
or the H11.1 peptide (Fig. 2). IFN-
and IL-2 were induced by either stimulus at a frequency of
10/106 over a background of
<1/106 in the medium control wells. The spleen
cells from PBS-injected control mice (Fig. 2) behaved as did the spleen
cells of uninjected mice described above (Fig. 1
), showing no tumor
Ag-triggered IFN- and IL-2 production
(<1/106). Also, vigorous production of IL-4 and
IL-6 was seen that occurred over an elevated medium background (Fig. 2, C and D). IL-3 and IL-5 production was not
induced over medium background (both <1/106,
data not shown). Cytokine-producing cells of similar frequencies and
cytokine signatures were detected on days 5 and 9 (data not shown).
Based on experience gained in allogenic models (16), we
tested for cytolytic activity on day 12. Neither RMA- nor
H11.1-specific cytotoxicity was detected in standard chromium release
assays (Fig. 2F).
|
10-fold higher than those producing IFN- and IL-2, these
data obtained by testing bulk spleen cell populations seemed to suggest
that the immunity that RMA cells elicit is type 2 biased. Cells from
the innate immune system, in addition to T cells, could contribute to
this cytokine signature; however, it was critical to define the cell
population that actually produces the measured cytokine. Obtaining this
information was also critical because only T cells are clonally
expandable effector cells with long-term cytokine commitment and are
therefore of primary relevance for vaccination purposes. RMA-induced T cells produce type 1 cytokines
We purified CD4 and CD8 cell subsets from spleens of
RMA-injected mice and tested these on splenic APCs of
congenic naive mice that were gene-disrupted for the cytokine in
question. In this setting, all cytokine produced is T cell derived and
bystander reactions by APC can be excluded. In response to RMA cells
and H11.1 peptide, the CD4 cells from such tumor-experienced mice
produced IFN- and IL-2 (Fig. 3). This
recall response by CD4 cells required the presence of the splenic APCs
(data not shown), consistent with indirect pathway recognition of the
(MHC class II-negative) RMA tumor. The CD8 cells from the RMA-injected
mice also produced IFN- and IL-2 in response to the RMA cells (Fig. 3), while CD4 or CD8 cells from PBS-injected mice did not show this
cytokine response (<1/106, data not shown).
Apparently contradicting the measurements done on unseparated spleen
cells (Fig. 2), neither the CD4 nor the CD8 cells from the RMA-primed
mice produced IL-4 or IL-6 over background when tested on IL-4 or IL-6
KO APC, respectively (data not shown). Because we had no access to
TNF- KO APC we could not more closely define the contribution of
T cells to this cytokine recall response, which we measured in the bulk
spleen cells.
|
We hypothesized that the lack of IL-4 and IL-6 production by the
purified T cells on the respective cytokine KO APC suggests that the
Ag-stimulated T cells may trigger an IL-4 and IL-6 bystander response
in the splenic APC (17). To test this hypothesis, we
purified CD4 or CD8 cells from primed mice and cultured them with and
without the H11.1 peptide on naive spleen cells. Twenty-four hours
later, the culture supernatants were collected and added to spleen
cells of naive mice for 48 h, after which the ELISPOT assays were
developed. While no IFN- and IL-2 spots were induced, the
supernatants of the Ag-stimulated cultures triggered 3- to 5-fold
elevated numbers of IL-4, IL-6, and TNF- spots over the medium
background (Fig. 4, B–D). The peptide alone did not induce the
production of any of these cytokines over medium background in RAG-1 KO
or naive WT spleen cells (data not shown; see also Figs. 1 and 2).
Therefore, secretory products released by activated T cells induced
this Ag-specific IL-4, IL-6, and TNF- bystander reaction in cells
of the innate immune system. This bystander reaction might also occur
in vivo, as signified by the up to 17-fold elevated IL-4, IL-6, and
TNF- medium background of tumor-bearing mice (Fig. 2), and
positively or negatively affect immune surveillance of the tumor.
However, the T cells that fail to mediate the immune surveillance under
these conditions of fulminant tumor growth are essentially of a pure
type 1.
|
When H11.1 peptide was injected without adjuvant, in PBS, and the
spleen cells of the mice were tested for peptide-induced recall
response 21 days later, no significant induction of cytokine production
was seen over PBS-injected control mice (Table I). The injection of H11.1 peptide in PBS
was apparently not immunogenic. An adjuvant seemed to be required for
effective subunit vaccination with this peptide. We injected groups of
mice with peptide H11.1 mixed in four different adjuvants. In
particular, we selected IFA, because it was found to favor the
induction of type 2 immunity (4), CFA, and ISS CpG ODN
because the latter two have been implicated in adjuvant-guided type 1
immunity. All three adjuvants had the same mineral oil as the carrier
(IFA is the oil alone, CFA contains admixed mycobacteria, and the CpG
adjuvant contained the specified ODN emulsified in IFA). To control for
the ISS CpG effect, we used as nCpG adjuvant an ODN that lacks the CpG
motif (specified in Materials and Methods) and its
pronounced stimulatory activity (11). As a specificity
control, we also injected OVA peptide 323–339, which, like H11.1, is
also restricted by the I-Ab molecule
(15) in the four adjuvants. Three weeks after the peptide
injection, the mice were sacrificed and their spleen cells
were tested for cytokine recall responses in the ELISPOT assays.
The data are summarized in Table I. The 2- to 3-fold higher frequencies
of CpG-induced T cells vs CFA-induced T cells was also seen on day 12
after immunization (data not shown).
|
recall response to the H11.1 peptide
(125/106 over a background of
1/106). This induction of IFN- production was
specific because it was not elicited by H11.1 peptide in CpG OVA
peptide-immunized mice (Table I, on the right). IL-2, IL-4, IL-5, IL-6,
and TNF- were also specifically induced with stimulation indices
of 36, 12, 5.8, 2, and 2.6, respectively. The CFA-guided response to
H11.1 peptide was of a similar cytokine profile, albeit the specific
peptide-induced frequencies of IFN--producing cells were 50%
lower in all three independent experiments performed. Even lower
frequencies of IFN--producing cells were engaged following
immunization with the nCpG adjuvant (24/106).
Immunizations with IFA did not induce IFN-- and TNF--producing
cells over background but triggered the production of IL-2, IL-4, IL-5,
and IL-6 with stimulation indices of 10, 9.7, 15, and 3.6,
respectively.
H11.1:CpG engages higher clonal sizes of IFN--producing CD4
cells than immunizations with CFA, nCpG, and IFA
To directly measure the frequency of the specific T cells engaged
and their cytokine lineage (3), we isolated CD4 and CD8
cells from the spleens of H11.1:adjuvant-injected mice and tested them
on the respective cytokine gene KO APC. While unstimulated CD4 cells
did not secrete any of the cytokines tested
(<1/106 T cells), they did produce IFN-
and/or IL-2 upon tumor Ag stimulation (Fig. 5). We found no evidence for the
induction of IL-4- and IL-6-producing CD4 cells after H11.1 peptide
injection with either of the adjuvants (data not shown). The frequency
of IFN--secreting, H11.1 peptide-specific CD4 cells was by far the
highest in the CpG-immunized mice, at 250/106.
This CD4 cell fraction was also activated in the presence of the RMA
tumor with a frequency of 30/106. CD4 cells
from nCpG- and CFA-immunized mice each responded with a frequency of
90/106 to the H11.1 peptide and with 10 and 20
to the RMA tumor, respectively. No specific IFN- was detected in the
IFA-immunized mice, whereas their CD4 cells produced IL-5 in a
frequency of 13 SFU/106 in response to the
peptide (data not shown). CpG also induced the highest frequency of
IL-2-secreting, peptide-specific CD4 cells
(80/106), when compared with the immunizations
with nCpG, CFA, and IFA (frequencies of 55/106,
35/106, and 20/106,
respectively). The data demonstrate that immunizations with CpG, CFA,
and nCpG induced highly type 1-polarized CD4 cell immunity to H11.1
peptide with clonal sizes highest in CpG-injected mice, followed by CFA
and nCpG. This hierarchy in magnitudes of frequencies was observed in
five independent experiments. The administration of the H11.1 peptide
in IFA was also immunogenic, inducing CD4 memory cells that produced
IL-2 and IL-5 but not IFN-, IL-4, and IL-6.
|
, the recall response in the bulk spleen cells from
the immunized mice in all groups had a type 2 (IL-4, IL-6) component
that was not detected when purified CD4 (or CD8) cells were tested on
IL-4 and IL-6 KO APC. Analogous to the data shown for the tumor-primed
mice (Fig. 4), we found that the apparently Ag-specific production of
IL-4 and IL-6 seen in unseparated spleen cells (Table I) resulted
entirely from a bystander reaction by cells of the innate immune system
that could be elicited by the supernatants of peptide-activated T cells
(data not shown). We also tested on cytokine KO APC the purified CD8
cell fractions of the mice that were immunized with the H11.1 peptide
in the four adjuvants and did not detect IFN-, IL-2, IL-4, or IL-6
spot formation exceeding 3/106 CD8 cells in any
of them (data not shown). Therefore, the H11.1 peptide-induced
cytokine-producing T cells were, with all four adjuvants, CD4
cells. Injection of H11.1 with CpG, but not with the other adjuvants, induces protective immunity
To assess the efficacy of the induced immune responses, we
immunized C57BL/6 mice with H11.1 (or the OVA control) peptide in the
four adjuvants, as above, followed 3 wk later by injection of 1000 RMA
tumor cells. Control mice injected with the OVA peptide showed the same
rate of survival as did the untreated or PBS-injected mice (Fig. 6A). These data demonstrate
that the adjuvants themselves had no protective effects. Of the
H11.1-injected mice, only immunization with the CpG adjuvant had an
impact on survival. Thirty-three percent of the CpG:H11.1-vaccinated
mice survived >120 days, whereas 100% of the mice in all the other
groups died by day 28 (Fig. 6B). Survival was prolonged even
in those CpG:H11.1-vaccinated mice that eventually died when compared
with controls (33 ± 6 days for CpG H11.1 vs 23 ± 2 days for
the control groups, p = 0.010).
|
dependent
The observation that immunizations with CpG induced protective
immunity, while those with CFA (or the other adjuvants) did not, seemed
to suggest that the magnitude of the IFN- response by CD4 cells
might explain the difference in the survival. To test this hypothesis,
we immunized IFN- KO mice and WT C57BL/6 mice with CpG H11.1 (and
nCpG:H11.1 as the control) and challenged them with 1000 RMA tumor
cells 3 wk later. The IFN- KO mice immunized with CpG:H11.1 died at
a comparable rate (23 ± 1 days) to the control mice injected with
nCpG:H11.1 or PBS (23 ± 1 and 22 ± 1 days), whereas the WT
C57BL/6 mice that were preinjected with CpG:H11.1 reproduced the
aforementioned level of protection (33 ± 5 days) of mean
survival. The data demonstrate the IFN- dependence of the
CpG:H11.1-induced protective immunity.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-producing, tumor-specific CD4 and CD8 cells were detected in
tumor-injected mice (Fig. 3A). These cytokine-producing T
cells qualified as in vivo primed memory cells for two reasons. First,
they were not detected in naive mice or in mice injected with unrelated
tumors. Second, while memory cells can produce these cytokines within
24 h after Ag exposure, it takes naive T cells >3 days to
differentiate into producing IFN--secreting memory cells
(3). The tumor-specific production of IL-2 was also
indicative of in vivo clonal expansion/T cell memory, because no
tumor-specific, IL-2-producing cells were detected in naive spleen
cells or purified T cells. The 24-h duration of the assay precluded in
vitro proliferation affecting the frequencies measured. Clearly, the
RMA tumor itself induced a specific T cell response, albeit of low
frequency.
Our next set of experiments showed that cells of the innate immune
system become activated by the RMA tumor as required for eliciting the
second signal. When we exposed spleen cells from RAG-1 KO mice (which
lack T cells, B cells, and NK1.1 cells but contain abundant numbers of
macrophages, NK cells, and DC) with RMA tumor cells, cytokine
production was induced in short-term assays. In particular, IL-4, IL-6,
IL-12, and TNF were elicited (Fig. 1). Notably, these cytokines
produced by APC are critical for guiding T cell differentiation along
the type 1 (IL-12, TNF) and type 2 (IL-4) pathway. Although we did not
further narrow down the cell type that produced them, macrophages, NK
cells, and DCs have pattern recognition capabilities and can be induced
to express these cytokines (18). The RMA tumor originated
by transformation with Rauscher MuLV, and it is possible that viral
proteins render this tumor stimulatory (infectious non-self).
Alternatively, it is also possible that the lowered level of MHC class
I molecule expression on the tumor cells is recognized by NK cells
(18) or that the altered glycosylation of cell surface
molecules (19) is recognized by pattern recognition
receptors (20). We favor the notion that the cytokine
response induced in the innate immune system is not solely a
consequence of the viral origins of the RMA tumor, because other tumors
(P815 mastocytoma, L5178Y-R T cell lymphoma, M3 melanoma) that are of
nonviral origin also triggered similar responses of the innate immune
system and were also immunogenic (M. Tary-Lehmann, unpublished
observation).
Immunization with a tumor peptide is a promising approach for the
induction of protective antitumor immunity. However, injection of a
soluble peptide in saline is generally not immunogenic
(1). To the contrary, soluble peptides frequently induce
immune tolerance because they provide signal 1 (Ag recognition by the
specific T cells) in the absence of signal 2. Consistent with this, we
did not find peptide H11.1 to be immunogenic when injected in PBS.
H11.1-injected mice did not display significantly elevated frequencies
of peptide-specific, cytokine-producing memory cells (Table I) and were
not protected when challenged with the RMA tumor (Fig. 6B).
In contrast, the injection of peptides mixed with an adjuvant reliably
guided the engagement of immunity and of the effector class. We have
previously demonstrated that peptide immunizations performed using
either CFA (4) or CpG as adjuvants (11)
induced type 1 immune responses. This occurred overriding genetic type
1 or type 2 biases of the murine hosts (4), a property
that would also be required for a reliable vaccination strategy in the
outbred human population. In this report we showed that injection of
H11.1 peptide both in CFA and in CpG induced IFN--producing memory
cells at frequencies of 100/106 and
250/106 CD4 cells, respectively. These clonal
sizes were 10–25 times higher after immunization than following tumor
injection alone. The cytokine profile of the primed T cell response was
purely type 1, in that purified CD4 cells specifically produced IFN-
and IL-2, but no IL-4 or IL-6, when tested on cytokine KO APC.
Therefore, both adjuvants seemed to be equally suited for the type 1
polarization of the H11.1 peptide-specific immune response, but
immunization with CpG induced a 2.5-fold higher frequency of H11.1
peptide-specific memory cells than did the injection of the peptide in
CFA (Table I).
Unlike the immune response induced by the other adjuvants, injection of H11.1 peptide in CpG induced protective immunity against the RMA tumor. In five repeat experiments, 20–30% of the vaccinated mice survived, and those that succumbed to the tumor showed a prolonged survival rate. This protection was quite striking, because injection of RMA cells led to 100% mortality in all 100 mice that either were untreated or were vaccinated differently.
The superior protective effect of CpG over the other adjuvants may be
due to its ability to engage an average 3-fold increase in clonal sizes
of H11.1-specific type 1 CD4 cells. It has been well established in
autoimmune disease models and graft-vs-host disease that as little as
2-fold differences in the specific T effector cell mass can determine
whether or not the animal will develop disease (21), thus
providing a precedent for this hypothesis. Accordingly, it is possible
that the interindividual variation in clonal sizes of H11.1-specific
CD4 cells engaged by CpG immunization accounts for the spectrum of
complete protection seen in 30% of the mice to partial protection
observed in others. If this hypothesis is correct, then further
modifications of the CpG motif constellation, and/or repeated
injections of the adjuvant, may promote an even stronger clonal
expansion and result in a fully protective immunization regimen.
The protection afforded by the H11.1 peptide-specific, CpG-induced CD4
cells was IFN- dependent, as no protection could be induced in
IFN- KO mice. IFN- is a key effector molecule of type 1 CD4
cells. Its secretion by such T cells at the site of Ag recognition
elicits the activation of macrophages and of NK cells at that site;
these locally stimulated cells of the innate immune system are thought
to be the actual effector cells of CD4-mediated type 1 immunity. This
indirect mechanism of T cell-derived IFN- action implies that there
may be no advantage if the cytokine-producing T cell directly
recognizes the tumor vs when the T cell secretes IFN- in close
vicinity of the tumor, following indirect recognition. Additionally,
the local release of IFN- has been shown to interfere with tumor
growth by inhibiting the vascularization of the tumor
(22), which also represents an "indirect pathway"
effector mechanism (23). Furthermore, IFN- is required
for the induction of the "determinant spreading" reaction
(24), which also contributes to antitumor immunity. It is
conceivable that the higher frequency of H11.1-specific CD4 effector
cells induced by CpG immunization provides a stronger trigger for the
elicitation of the second wave response to the tumor, providing an
additional explanation for why the immunization with CpG was more
protective than, for example, H11.1 injection with CFA.
In summary, we showed that RMA tumor activates cells of the innate
immune system and induces, on its own, a weak type 1 CD4 and CD8
response that apparently is of insufficient magnitude to control the
tumor. Immunization with the class II-restricted tumor peptide H11.1 in
CpG, in contrast, induces protective immunity that is CD4 cell mediated
and operates via IFN--dependent indirect pathway mechanisms.
Therefore, CpG adjuvant-guided induction of type 1 immunity against
tumor Ags might be a promising subunit vaccination approach.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Magdalena Tary-Lehmann, Department of Pathology, Case Western Reserve University, Biomedical Research Building, Room 928, 10900 Euclid Avenue, Cleveland, OH 44106. E-mail address: mxt27{at}po.cwru.edu
3 Abbreviations used in this paper: ISS, immunostimulatory; MuLV, murine leukemia virus; RAG, recombination-activating gene; KO, knockout; ODN, oligodeoxynucleotide; DC, dendritic cell; nCpG, non-CpG; WT, wild type.
Received for publication August 8, 2001. Accepted for publication April 5, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor expression by nonhematopoietic cells. Immunity 12:677.[Medline]
This article has been cited by other articles:
|
|
 |
|
  B. Vasir, Z. Wu, K. Crawford, J. Rosenblatt, C. Zarwan, A. Bissonnette, D. Kufe, and D. Avigan Fusions of Dendritic Cells with Breast Carcinoma Stimulate the Expansion of Regulatory T Cells while Concomitant Exposure to IL-12, CpG Oligodeoxynucleotides, and Anti-CD3/CD28 Promotes the Expansion of Activated Tumor Reactive Cells J. Immunol., July 1, 2008; 181(1): 808 - 821. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Atanackovic, N. K. Altorki, Y. Cao, E. Ritter, C. A. Ferrara, G. Ritter, E. W. Hoffman, C. Bokemeyer, L. J. Old, and S. Gnjatic Booster vaccination of cancer patients with MAGE-A3 protein reveals long-term immunological memory or tolerance depending on priming PNAS, February 5, 2008; 105(5): 1650 - 1655. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Fujii, J. D. Trudeau, D. T. Teachey, J. D. Fish, S. A. Grupp, K. R. Schultz, and G. S. D. Reid In vivo control of acute lymphoblastic leukemia by immunostimulatory CpG oligonucleotides Blood, March 1, 2007; 109(5): 2008 - 2013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. F. Eisenbeis, G. B. Lesinski, M. Anghelina, R. Parihar, D. Valentino, J. Liu, P. Nadella, P. Sundaram, D. C. Young, M. Sznol, et al. Phase I Study of the Sequential Combination of Interleukin-12 and Interferon Alfa-2b in Advanced Cancer: Evidence for Modulation of Interferon Signaling Pathways by Interleukin-12 J. Clin. Oncol., December 1, 2005; 23(34): 8835 - 8844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gregoire, A. S. Bergot, C. Feraudet, C. Carnaud, P. Aucouturier, and M. B. Rosset The Murine B Cell Repertoire Is Severely Selected against Endogenous Cellular Prion Protein J. Immunol., November 15, 2005; 175(10): 6443 - 6449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Weihrauch, S. Ansen, E. Jurkiewicz, C. Geisen, Z. Xia, K. S. Anderson, E. Gracien, M. Schmidt, B. Wittig, V. Diehl, et al. Phase I/II Combined Chemoimmunotherapy with Carcinoembryonic Antigen-Derived HLA-A2-Restricted CAP-1 Peptide and Irinotecan, 5-Fluorouracil, and Leucovorin in Patients with Primary Metastatic Colorectal Cancer Clin. Cancer Res., August 15, 2005; 11(16): 5993 - 6001. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Oumouna, J. W. Mapletoft, B. C. Karvonen, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Formulation with CpG Oligodeoxynucleotides Prevents Induction of Pulmonary Immunopathology following Priming with Formalin-Inactivated or Commercial Killed Bovine Respiratory Syncytial Virus Vaccine J. Virol., February 15, 2005; 79(4): 2024 - 2032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Kemp, J. M. Moore, and T. S. Griffith Human B Cells Express Functional TRAIL/Apo-2 Ligand after CpG-Containing Oligodeoxynucleotide Stimulation J. Immunol., July 15, 2004; 173(2): 892 - 899. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Switaj, A. Jalili, A. B. Jakubowska, N. Drela, M. Stoksik, D. Nowis, G. Basak, J. Golab, P. J. Wysocki, A. Mackiewicz, et al. CpG Immunostimulatory Oligodeoxynucleotide 1826 Enhances Antitumor Effect of Interleukin 12 Gene-Modified Tumor Vaccine in a Melanoma Model in Mice Clin. Cancer Res., June 15, 2004; 10(12): 4165 - 4175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Rosset, C. Ballerini, S. Gregoire, P. Metharom, C. Carnaud, and P. Aucouturier Breaking Immune Tolerance to the Prion Protein Using Prion Protein Peptides Plus Oligodeoxynucleotide-CpG in Mice J. Immunol., May 1, 2004; 172(9): 5168 - 5174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Atanackovic, N. K. Altorki, E. Stockert, B. Williamson, A. A. Jungbluth, E. Ritter, D. Santiago, C. A. Ferrara, M. Matsuo, A. Selvakumar, et al. Vaccine-Induced CD4+ T Cell Responses to MAGE-3 Protein in Lung Cancer Patients J. Immunol., March 1, 2004; 172(5): 3289 - 3296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-F. Chen, C.-W. Lin, Y.-P. Tsao, and S.-L. Chen Cytotoxic-T-Lymphocyte Human Papillomavirus Type 16 E5 Peptide with CpG-Oligodeoxynucleotide Can Eliminate Tumor Growth in C57BL/6 Mice J. Virol., February 1, 2004; 78(3): 1333 - 1343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Lonsdorf, H. Kuekrek, B. V. Stern, B. O. Boehm, P. V. Lehmann, and M. Tary-Lehmann Intratumor CpG-Oligodeoxynucleotide Injection Induces Protective Antitumor T Cell Immunity J. Immunol., October 15, 2003; 171(8): 3941 - 3946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Flynn and B. Stockinger Tumor and CD4 T-cell interactions: tumor escape as result of reciprocal inactivation Blood, June 1, 2003; 101(11): 4472 - 4478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Woodberry, J. Gardner, S. L. Elliott, S. Leyrer, D. M. Purdie, P. Chaplin, and A. Suhrbier Prime Boost Vaccination Strategies: CD8 T Cell Numbers, Protection, and Th1 Bias J. Immunol., March 1, 2003; 170(5): 2599 - 2604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Addo, X. G. Yu, A. Rathod, D. Cohen, R. L. Eldridge, D. Strick, M. N. Johnston, C. Corcoran, A. G. Wurcel, C. A. Fitzpatrick, et al. Comprehensive Epitope Analysis of Human Immunodeficiency Virus Type 1 (HIV-1)-Specific T-Cell Responses Directed against the Entire Expressed HIV-1 Genome Demonstrate Broadly Directed Responses, but No Correlation to Viral Load J. Virol., February 1, 2003; 77(3): 2081 - 2092. [Abstract] [Full Text] [PDF]
|
|
| ||||||
