| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
v
3 and v5 Integrins Are Not Essential for MHC Class I Cross-Presentation of Cell-Associated Antigen by CD8+ Murine Dendritic Cells1
* Immunobiology Laboratory,
Lymphocyte Molecular Biology Laboratory, and
Cell Adhesion and Disease Laboratory, Cancer Research UK, London Research Institute, London, United Kingdom; and
Division of Hematology and Medical Oncology, Department of Medicine, Weill Medical College of Cornell University, New York, NY 10021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
v
3 and/or
v5 in this process. In the mouse,
cross-presentation was recently shown to be a function of
CD8+ DC. Here we report that CD36 is expressed on
CD8+, but not on CD8-, DC. To address
the role of CD36 in cross-presentation we compared
CD36-/- and CD36+/+ H-2b DC for
their ability to stimulate naive OT-1 T cells specific for OVA plus
H-2Kb in the presence of OVA-loaded MHC-mismatched
splenocytes as a source of cell-associated Ag for cross-presentation.
Surprisingly, no difference was seen between CD36-/- and
CD36+/+ CD8+ DC in their ability to
cross-present cell-associated OVA or to capture OVA-bearing cells.
Furthermore, the proliferation of CFSE-labeled OT-1 cells in response
to OVA cross-presentation in vivo was normal in CD36-/-
bone marrow chimeras, also arguing against a necessary role for CD36 in
cross-presentation by DC or other APC. DC doubly deficient for
3 and 5 integrins were similarly
unimpaired in their ability to cross-present OVA-bearing cells in
vitro. These data demonstrate that in the mouse, receptors other than
CD36 or 3 and 5 integrins can support the
specialized cross-presenting function of CD8+
DC. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The existence of a specialized cross-presenting APC was postulated in
1987 (7), but its identity remained elusive until recently
despite many attempts to reconstitute cross-presentation in vitro.
Several reports suggested that both macrophages
(M
)3 and B cells
could present soluble exogenous Ags on MHC class I, but this was only
seen in situations in which very large amounts of Ag were delivered to
the cells or taken up via specific Ig, implying that they were unlikely
to constitute an efficient cross-presenting APC in vivo
(8, 9, 10, 11, 12, 13). In contrast to M and B cells, dendritic cells
(DC) were shown to be able to efficiently present soluble exogenous Ags
on MHC class I, particularly upon macropinocytic uptake or after
targeting to Fc receptors (14, 15, 16), and efficient MHC
class I cross-presentation of cell-associated Ags was reconstituted in
vitro using human DC that had been fed influenza-infected monocytes
(17). DC can also cross-present cellular Ags on MHC class
II (18) and are sufficient for the induction of
CD8+ T cell cross-tolerance in vivo
(19). Recently, Den Haan and Bevan (20)
identified CD8+ DC as the major APC type in
mouse spleen able to cross-present to CD8+ T
cells OVA derived from a cell-based inoculum. The same DC subset also
excels in presenting soluble OVA protein on MHC class I
(21). Together, these observations suggest that DC might
constitute the primary cross-presenting APC in vivo.
Nevertheless, the mechanisms underlying cross-presentation by DC remain
poorly understood. Since most instances of cross-presentation involve
cell-based inocula, one hypothesis is that DC phagocytose apoptotic
cells in the inoculum and re-present the acquired cellular Ags on MHC
class I and MHC class II. Support for this idea comes from work showing
that immature human DC capable of phagocytosing apoptotic cells are
better at cross-presenting cell-associated Ags than mature cells that
have lost phagocytic ability (22). Much interest has
therefore focused on which receptors mediate the uptake of apoptotic
cells by DC. Albert et al. (22) used blocking Abs to show
that two of these receptors in human DC are CD36 and
v5. An alternative
integrin, v3, has
also been implicated in apoptotic cell uptake by human DC
(23). In contrast, M do not appear to use
v5, leading to the
suggestion that the receptors used by different phagocytes for uptake
of apoptotic cells are somehow responsible for the difference in the
fate of the internalized Ag: cross-presentation in DC vs degradation in
M (22). However, the direct involvement of CD36,
v3, and
v5 in
cross-presentation has never been tested. Here we show that CD36 is
selectively expressed in murine CD8+ DC.
However, using cells from genetically deficient mice, we demonstrate
that neither CD36 nor the
v3 and
v5 integrins are
responsible for the superior cross-presenting ability of
CD8+ DC. Our results suggest that the
receptors critical for cross-presentation in the mouse remain to be
identified.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female C57BL/6 and BALB/c mice were purchased from Charles River
(Margate, U.K.). OT-1 mice (24) on a
recombinase-activating gene 1 (RAG-1)-/-
background (gift from Dr. D. Kioussis, National Institute for Medical
Research, Mill Hill, U.K.), CD45.1+ B6.SJL mice
(gift from F. Powrie, University of Oxford, Oxford, U.K.) and
3/5 doubly deficient mice
(25) were bred at the animal facility of the London
Research Institute (South Mimms, U.K.) under specific pathogen-free
conditions. CD36-/- mice (26)
backcrossed at least six times onto a C57BL/6 background were housed at
Weill Medical College of Cornell University in a fully accredited
Association of Laboratory Animal Care facility. All mice were
used at 6–10 wk of age. To analyze DC genetically deficient for CD36,
bone marrow chimeras were made by reconstituting irradiated CD45.1
B6.SJL mice with 2 x 106 congenic bone
marrow cells from either CD45.2+
CD36-/- mice or CD45.2+
CD36+/+ littermate controls. The dose of x-ray
radiation given to recipient mice was chosen according to the aim of
the experiment: sublethal irradiation (400 rad, twice) was used to make
mixed bone marrow chimeras to compare donor and recipient DC ex vivo;
lethal irradiation (600 rad, twice) was used to analyze
cross-presentation in wild-type (WT) vs CD36-/-
full bone marrow chimeras in vivo. All chimeras were left for at least
5 wk before use to allow turnover of the splenic DC compartment
(27).
Reagents
The OVA peptide 257–264 (OVA peptide; SIINFEKL) was made by the CRUC peptide synthesis service. OVA protein and polyethylene glycol 1000 were obtained from Calbiochem-Novabiochem (Nottingham, U.K.). PE-conjugated H-2Kb/SIINFEKL tetramer (28) was a gift from the MHC tetramer core facility of the National Institute of Allergy and Infectious Diseases (Atlanta, GA).
The mAbs used were HL3, a hamster IgG mAb against CD11c; 53-6.7, RM4-5,
and RA3-6B2, rat IgG2a mAbs against CD8, CD4, and B220,
respectively; A20, a mouse IgG2a mAb against CD45.1; and 2.4G2 and
RB6-8C5, rat IgG2b mAbs against Fc
R III/II and Gr-1, respectively.
All mAbs were obtained from BD Pharmingen (BD Bioscience, Oxford,
U.K.), unless otherwise indicated.
Cells
Spleen cell suspensions were prepared as previously described
(29) using Liberase CI (Roche Diagnostics, Lewes, U.K.).
Splenic DC subsets were isolated in two steps. First, DC-enriched
splenocytes were prepared by magnetic selection using anti-CD11c
MACS beads (Miltenyi Biotec, Bisley, U.K.) and positive selection
columns as recommended by the manufacturer. CD11c-enriched cells were
then stained with PE-labeled anti-CD11c, FITC-labeled
anti-CD8, and CyChrome-labeled anti-CD4 and sorted into
subsets on a MoFlo cytometer (Cytomation, Fort Collins, CO).
CD11c-enriched cells from CD45.2/CD45.1 mixed bone marrow chimeras were
stained with FITC-labeled anti-CD45.1, PE-labeled anti-CD11c,
TriColor-labeled anti-CD8 (Caltag Laboratories, San Francisco,
CA), and allophycocyanin-labeled anti-CD4. Events were sorted based
on a set of hierarchical gates: a scatter gate around live cells, a
histogram gate on CD11cbright cells, followed by
gates on three distinct DC subsets defined using a CD4 vs CD8 dot plot.
CD4, CD8, and double-negative (DN) DC populations from CD45.2/CD45.1
mixed bone marrow chimeras were further split into recipient-derived
(CD36+) and donor-derived
(CD36-) subsets by gating on
CD45.1+ and CD45.1-
populations on a CD45.1 histogram.
OT-1 T cells were isolated from lymph nodes of OT-1 x
RAG-1-/- mice and depleted of APC by negative
selection using magnetic beads. Briefly, cells were stained with a
mixture of biotinylated mAbs including anti-FcR, anti-CD4,
anti-CD11c, anti-Gr-1, and anti-B220, washed, and incubated
with streptavidin beads (Miltenyi Biotec, Bisley, U.K.). Labeled cells
were removed on a MACS depletion column, and the flow-through fraction
was collected, representing unlabeled, APC-depleted OT-1 T cells.
Ab staining and flow cytometry
For flow cytometry, cell suspensions were washed in PBS/5 mM
EDTA and stained in PBS/EDTA containing 1% FCS and 0.02% sodium azide
(FACS buffer). CD36 expression was determined on CD11c-enriched
splenocytes using a four-color staining protocol. Briefly, cells were
stained with anti-murine CD36 (mouse IgA) (30) in the
presence of anti-FcR, followed by biotinylated anti-mouse
IgA, followed by an mAb cocktail, including FITC-conjugated
anti-CD8, PE-conjugated anti-CD11c, TriColor-conjugated
streptavidin (Caltag Laboratories), and allophycocyanin-conjugated
anti-CD4. Parallel samples were stained with an irrelevant
isotype-matched control Ab to validate the specificity of the CD36
staining. Events were collected on a FACSCalibur cytometer (BD
Bioscience, Mountain View, CA) and analyzed using FlowJo software
(Treestar, San Carlos, CA).
In vitro cross-presentation assay
BALB/c splenocytes were loaded with OVA protein using osmotic shock treatment as previously described (20, 31, 32) and were subsequently irradiated using an x-ray source (1350 rad). Control cells were treated identically, except for the omission of OVA. OVA-loaded or control splenocytes (5 x 105 cells) were then cocultured with sorted DC subsets (1–2 x 105 cells) and APC-depleted OT-1 T cells (105 cells) in 96-well flat-bottom culture plates. As a positive control, the same DC subsets were cultured at 2–4 x 104 with OT-I T cells (105 cells) in the presence of subsaturating amounts of OVA peptide, chosen so as to reveal any putative differences in the stimulatory capacity of DC subsets. Cultures were incubated in RPMI 1640 medium supplemented with 10% FCS, penicillin (100 U/ml), streptomycin (100 µg/ml), glutamine (2 mM), and 2-ME (5 x 10-5 M). Two days after culture initiation 25 µl supernatant was harvested and tested for IL-2 production by sandwich ELISA using JES6-1A12 as the capture and JES6-5H4-B (biotinylated) as the detection Ab. The cultures were then pulsed overnight with [3H]thymidine (1 µCi/well; Amersham, Little Chalfont, U.K.), and [3H]thymidine incorporation was measured in a beta plate counter (Wallac, Newbury, U.K.).
In vivo cross-presentation assay
Lymph node and spleen cells from OT-1 x
RAG-1-/- mice were pooled, labeled with CFSE (2
µM, 15 min, 37°C; Molecular Probes, Eugene, OR), and injected via
the tail vein (5 x 106/mouse) into chimeric
CD45.1 B6.SJL mice that had been lethally irradiated and reconstituted
with bone marrow from either WT or CD36-/-
mice. Next day mice were immunized by i.v. injection of PBS (vehicle
control), OVA peptide (2.5 µg/mouse), or OVA- or mock-loaded BALB/c
splenocytes (20–30 x 106/mouse). Three
days later spleens were collected, and cell suspensions were stained
with PE-conjugated H-2Kb/SIINFEKL tetramer and
TriColor-conjugated anti-CD8 (Caltag Laboratories) and analyzed
by flow cytometry.
Cell uptake assay
CD11c-enriched cells (C57BL/6; 106/well)
were prestained with FITC-conjugated anti-CD11c and subsequently
cocultured with BALB/c-derived splenocytes (5 x
106 cells/well), which had been labeled with the
lipophilic, fluorescent dye PKH26 (4 µM, 10 min, room temperature;
Sigma, Dorset, U.K.) as recommended by the manufacturer, followed by
further treatment as described for in vitro cross-presentation (see
above). Cells were harvested 4 h later in FACS buffer and analyzed
by FACS. To compare WT vs CD36-/- DC,
CD11c-enriched cells from CD45.1/CD45.2 mixed bone marrow chimeras were
prestained with FITC-conjugated anti-CD45.1 and TC-conjugated
anti-CD8 before adding them to PKH26-labeled splenocytes. To
exclude dead cells from the analysis, the DNA binding dye TOPRO-3 was
added before sample acquisition.
Semiquantitative RT-PCR
Total RNA was isolated from sorted DC subset samples using the
RNeasy mini kit (Qiagen, Crawley, U.K.) combined with a DNA digestion
step (DNase set, Qiagen). Single-stranded cDNA was synthesized using
the SuperScript preamplification system (Life Technologies, Paisley,
U.K.), and PCR was conducted according to standard protocols on a
PTC-100 thermal cycler (MJ Research, Watertown, MA). PCR products were
electrophoresed on 1.5% agarose gels and visualized by ethidium
bromide staining. The following primer pairs were used: -actin
(forward, GTTTGAGACCTTCAACACCCC; reverse,
GTGGCCATCTCCTGCTCGAAGTC; product size, 320 bp), CD36 (forward,
CCATTCCTCAGTTTGGTTCC; reverse, TGCATTTGCCAATGTCTAGC; product size,
450 bp).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In an effort to molecularly characterize murine DC subsets,
we conducted representational difference analysis (33)
between freshly isolated CD8+ and
CD8- splenic DC (D. J. Pennington, O.
Schulz, and C. Reis e Sousa, unpublished observations). Cloning and
sequencing of one of the bands from the sample containing
CD8+ DC-specific cDNA revealed that it
corresponded to nt 127–294 of murine CD36 (data not shown). RT-PCR
analysis conducted on fresh samples of RNA purified from splenic DC
subsets confirmed that CD36 was primarily expressed in
CD8+ DC (Fig. 1
A).
CD4+ DC were negative for CD36 expression, while
CD8- CD4- (DN) DC
expressed CD36 mRNA at lower levels than CD8+
DC (Fig. 1A). Staining with an Ab specific for murine CD36
demonstrated that CD8+ DC, but not
CD4+ DC, express CD36 at the cell surface (Fig. 1B). Staining was unimodal revealing that essentially all
CD8+ DC express CD36 (Fig. 1B).
Consistent with the RT-PCR data, expression of CD36 was also seen in a
small fraction of DN DC (Fig. 1B). However, this appeared to
be due to contamination of the DN fraction with
CD8+ DC that were not completely excluded by
electronic gating because backgating on CD36+ DN
DC revealed that they expressed higher levels of CD8 than the bulk
of DN DC (not shown). We conclude that CD36 expression in murine spleen
DC is primarily restricted to the CD8+ DC
subset.
|
+ DC selectively cross-present cell associated Ag
in vitro to CD8+ T cells
Den Haan and Bevan (20) have shown that all DC
subsets can capture cell-associated Ags in vivo, but that only
CD8+ DC are able to cross-present them to
CD8+ T cells ex vivo. To establish whether
selective cross-presentation by CD8+ DC is
also seen in vitro, we used a protocol based on the one used by those
authors. Sorted DC subsets from C57BL/6 (H-2b)
mice were incubated with irradiated allogeneic splenocytes
osmotically loaded with OVA protein (OVA cells) (20, 31, 32), and the response of OT-I T cells was used to measure the
display of processed
OVA257–264/Kb complexes
by DC. As shown in Fig. 2, OT-I did
not mount an allogeneic response to the inoculum, as they did not
proliferate or produce IL-2 in the absence of added syngeneic DC. Using
proliferation of OT-I cells as a readout, CD8+
DC were markedly more potent than other DC subsets at presenting OVA
cells (Fig. 2A). This was OVA specific, as no proliferation
was seen when DC were pulsed with control allogeneic cells loaded in
the absence of OVA (mock cells; Fig. 2A). DN DC also
cross-presented OVA cells to OT-I T cells, but were near 50-fold less
potent than CD8+ DC, raising the possibility
that their activity might be due to residual
CD8+ DC contamination (Fig. 2A). In
contrast, there was practically no proliferation in response to
CD4+ DC pulsed with OVA-cells (Fig. 2A). Similar results were obtained when IL-2 secretion was
measured as an indicator of OT-I activation instead of proliferation
(Fig. 2B). IL-2 was not made by T cells in the splenocyte
inoculum responding to allogeneic DC, as there was no cytokine
accumulation in the cultures in the absence of OT-I (Fig. 2B). The differential behavior of DC subsets in the assay
was not due to intrinsic differences in their ability to stimulate T
cells, because all subsets stimulated OT-I proliferation equally well
when offered preprocessed OVA peptide (data not shown; see Figs. 3 and 6) as previously reported
(21, 34). We conclude that, as reported in vivo
(20), CD8+ DC are the major DC
subtype involved in cross-presentation of cell-associated Ags in
vitro.
|
|
|
+ DC show no impairment in
cross-presentation in vitro
CD36 can act as a receptor for cellular uptake by phagocytes
(35) and has been postulated to be involved in
cross-presentation by human DC (22). The selective
expression of CD36 in CD8+ DC raised the
question of whether this receptor was responsible for their selective
ability to cross-present cell-associated OVA. To address this question,
we compared the cross-presenting ability of
CD36-/- and WT CD8+ DC
(Fig. 3
A). To ensure that any putative differences between
CD36+/+ and CD36-/- DC
were intrinsic to the cells rather than the environment in which they
developed, bone marrow chimeric mice were constructed so as to contain
both cell types (see Materials and Methods).
CD36-/- and CD36+/+ DC in
the spleens of chimeric mice were identified by the expression of the
CD45.1 allelic marker in the latter, but not the former, cell type
(Fig. 3B). CD45.1-
CD8+ and CD8- DC
were present in the expected ratio, demonstrating that CD36 deficiency
does not affect CD8+ DC development (Fig. 3B). The two types of CD8+ DC as
well as control CD36+/+
CD8- DC were then purified by cell sorting,
verified for the expected CD36 expression pattern (Fig. 3B),
and used as APC for OT-I in vitro. The ability of
CD36-/- CD8+ DC to
stimulate OT-I T cells was comparable to that of all other
CD36-sufficient DC subsets, as all APC populations induced similar
levels of OT-I proliferation in response to a subsaturating dose of
preprocessed OVA peptide (Fig. 3C). When assessed for the
ability to cross-present cell-associated OVA,
CD8+ DC were markedly superior to
CD8- cells, as before (Fig. 3C).
Interestingly, this was not altered by the absence of CD36, as
CD36-/-cells were comparable to
CD36+/+ control CD8+ DC
in their ability to cross-present OVA-cells (Fig. 3C).
Titration experiments using wild-type DC demonstrated that the in vitro
cross-presentation assay was not saturated by the number of APC added
to the wells; even a 5-fold decrease in CD8+
DC was sufficient to completely abrogate OT-I proliferation in response
to OVA cells, but not to OVA peptide (data not shown). Thus, the
stimulation of OT-I cells by CD36-/-
CD45.2+ DC could not be accounted for by the
small fraction (<1%) of CD36+/+
CD45.1+ contaminants in the sorted fraction. We
conclude that CD36 is not essential for cross-presentation by
CD8+ DC in vitro.
CD36 expression by APC is not necessary for cross-presentation in vivo
Primary DC isolated from lymphoid tissues undergo a process of
spontaneous maturation in vitro that results in a marked alteration in
phenotype and functional properties (36). To confirm that
the lack of CD36 dependence was not an artifact of the in vitro assay,
we set up a test for cross-presentation in vivo. OT-I cells labeled
with the cell division marker CFSE were transferred adoptively into
unirradiated C57BL/6 mice, which were then immunized with OVA cells.
OT-I cells were identified in the spleens of the recipients 3 days
after immunization by double staining with OVA/Kb
tetramers and anti-CD8 (Fig. 4A, arrows). These cells were
analyzed for CFSE content. As shown in Fig. 4B, control mice
immunized with PBS or with mock cells contained only
CFSEbright OT-I cells that had not divided. In
contrast, multiple peaks of CFSElow
OT-I cells were obvious in mice receiving OVA cells or OVA peptide, the
latter was used as a positive control (Fig. 4B). As
expected, those mice containing CFSElow cells
also showed an increase in the frequency of OT-I cell in the spleen
(Fig. 4A). Thus, this assay accurately reflects
cross-presentation of cell-associated OVA to OT-I in vivo.
|
B). We
conclude that CD36 is not required for cross-presentation in
vivo.
CD36 is not required for cellular uptake by CD8+ DC
The failure to identify a role for CD36 in cross-presentation
suggested that it might not be required for cell uptake by murine
CD8+ DC. Therefore, we prepared mock-loaded
irradiated allogeneic splenocytes as described for the
cross-presentation experiments, labeled them with a fluorescent
membrane dye (PKH26), and incubated them with anti-CD11c prelabeled
DC to examine the extent of association of the inoculum and the APC. As
shown in Fig. 5A (upper
panels), CD11c+ DC were clearly associated
with the labeled inoculum after 4 h coculture. A large fraction of
the labeled material appeared to have been internalized by the cells as
determined by microscopic analysis (not shown). There were also many
CD11c-labeled cells, corresponding to free cells in the inoculum or
cells taken up by non-DC (Fig. 5A, upper
panels). To determine the contribution of CD36 in this
assay, DC fractions were prepared from the spleens of chimeras made by
sublethal irradiation, in which both CD36+/+
(CD45.1-) and CD36-/-
(CD45.1+) cells were clearly distinguishable from
one another using the CD45.1 allelic marker (Fig. 5A,
lower panels). These DC were labeled with anti-CD45.1
and anti-CD8 and were mixed with labeled cells. When the DC were
analyzed on the basis of CD8 expression, a remarkable 75% of
CD8+ DC were associated with labeled
allogeneic cells in multiple experiments (Fig. 5B). However,
this proportion was unchanged between CD36-/-
and CD36+/+ cells (Fig. 5B)
demonstrating that CD36 is not required for cellular uptake in this
model.
|
v3 and
v5 integrins are not essential for
cross-presentation by CD8+ DC
v3 and
v5 integrins in
association with CD36 appear to be required for cellular uptake by
human DC and are thought to be involved in cross-presentation by those
cells (22, 23). Since CD36 did not appear to be required
for mouse CD8+ DC to bind and internalize
cellular material, we asked whether the 3 and
5 integrins played any role in
cross-presentation in the mouse system. Despite the fact that
v expression on splenic DC is low to
undetectable (data not shown), DC were purified from
3-5-
doubly deficient mice or from WT littermate controls and assayed for
the ability to cross-present OVA cells to OT-I T cells in vitro. As
shown in Fig. 6, both
CD8+ and CD4+ DC types
presented OVA peptide equally well to OT-I independently of
v3 and
v5. As before,
CD8+ DC and not CD4+ DC
were the main DC subtype responsible for OT-I activation after pulsing
with cell-associated OVA. This cross-presentation was not altered when
3-5-
doubly deficient DC were used. We conclude that
v3 and
v5 are not essential
for cross-presentation by CD8+ DC.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
v3, and/or
v5 (22, 23). Here,
using an in vitro cross-presentation assay, we confirm the observation
first made in vivo by Den Haan and Bevan (20) that
CD8+ DC are the primary APC involved in the
cross-presentation of cell-associated Ags in mice. We show that
CD8+ DC selectively express CD36, but that
CD36 is not necessary for cross-presentation of cell-associated Ag in
vitro or in vivo or for uptake of cell-based Ag in vitro. We further
demonstrate that v3
and v5 are also
dispensable for cross-presentation by CD8+ DC.
Our data suggest that mouse DC use receptors for cell uptake and
cross-presentation that differ from those used by human DC or that
mouse DC use a redundant set of receptors such that elimination of CD36
or both 3 and 5
integrins does not prevent function. Similar results have been obtained
by Belz et al. (61), who also find CD36-independent cross-presentation
in both cross-priming and cross-tolerance models.
Despite much speculation about their function, little is known about
the molecular characteristics of murine DC subsets. Quantitative
differences in CD11b, CD24a, and F4/80 expression levels all can be
used to discriminate between resting CD8+ and
CD8- DC. However, relatively few
subset-restricted markers have been described other than DEC-205 in
CD8+ DC (37, 38). Here, we
suggest that CD36 can be used as an additional marker to discriminate
among DC subsets. Indeed, we found that CD36 is expressed on the cell
surface by virtually all CD8+ DC, but not by
most CD8- DC, although we cannot entirely
exclude that it may be expressed in a small number of DN DC (Fig. 1).
Interestingly, CD36 expression has not been previously described in
murine DC, although it has been found in human monocyte-derived DC
(22, 39) and in human dermal DC (40).
The idea that cross-presentation by DC is linked to the uptake of
apoptotic cells is an appealing hypothesis that is supported by the
finding that apoptotic monocytes can donate Ags for cross-presentation
by DC in vitro and that cross-presentation in vivo increases after
CTL-mediated apoptotic killing of Ag-bearing cells (22, 41). CD36 is prominent among the receptors involved in apoptotic
cells uptake by phagocytes (35). CD36 recognizes
thrombospondin, a soluble molecule that binds to an unknown ligand
exposed on the surface of apoptotic cells and bridges the latter to the
phagocyte (42).
v3 is thought to
associate with CD36 to mediate the internalization of apoptotic cells
by macrophages and monocytes (42, 43). CD36 can also
cooperate with v5 in
apoptotic cell internalization, and this integrin, rather than
v3, may be the
primary CD36 partner in human DC (22), although
v3 may be required
for DC phagocytosis of late apoptotic bodies (23). Abs
against either CD36 or
v3 are sufficient to
partially block apoptotic cell phagocytosis by human M
(42, 43, 44), whereas anti-CD36 and
anti-v5, but not
anti-v3, is
sufficient to partially block apoptotic cell uptake by human DC
(22). Similarly, apoptotic cell clearance is impaired in
Drosophila croquemort mutants lacking CD36
(45). These studies demonstrate that CD36 and
3/5 integrins play an essential and
nonredundant role in efficient apoptotic cell uptake across several
species. The selective expression of CD36 by
CD8+ DC led us, therefore, to ask whether CD36
was responsible for the cross-presenting potency of that DC subset.
However, our results clearly indicate that CD36 and, likewise,
v3 and
v5 are not essential
for cross-presentation by DC in vitro and that
CD36-/- APC are competent to carry out
cross-presentation in vivo. These results suggest that CD36 or
v3 and
v5 play only a minor
role in cross-presentation by mouse DC. Other receptors for apoptotic
cell uptake have been described, including the phosphatidylserine (PS)
receptor, class A scavenger receptor and CD14 (46, 47, 48). It
is possible that these are more critical than CD36 or
3/5 integrins for apoptotic cell
uptake by murine DC. This would be consistent with the fact that the
prevalent receptor used for ingestion of apoptotic cells can vary from
one cell type to another or even change upon cell activation. For
example, apoptotic cell phagocytosis by unstimulated human
monocyte-derived M depends primarily on the
v3/CD36 mechanism,
whereas after glucan stimulation of the same cells the process becomes
dependent on PS receptor/CD36 (49). Even blocking CD36 and
v5 together does not
completely abrogate apoptotic cell uptake by human DC, again suggesting
the involvement of additional receptors (22). Further
characterization of apoptotic cell receptors on mouse DC will be
necessary to address these questions. Nevertheless, our data do not
completely exclude a role for CD36 and
3/5 integrins in
cross-presentation. It is conceivable that these receptors operate with
an unexpected degree of redundancy in mouse DC such that an effect will
be apparent only if all three have been eliminated. Experiments to
address this question are in progress, but have been hampered by the
lack of blocking Abs in the mouse system. It also remains to be
confirmed whether the lack of CD36 or
v3/v5
dependence seen here for cross-presentation of injected cells would
apply in more physiological circumstances such as, for example, after
certain viral infections (50).
One clear difference between our experiments and others cited above is
that we used a live spleen cell-based inoculum that was not
deliberately made apoptotic. This form of Ag has traditionally been
used for induction of cross-priming in vivo (2, 32). Ex
vivo culture and irradiation inevitably render some cells in the
inoculum apoptotic (O. Schulz and C. Reis e Sousa, unpublished
observations), and it may be that only those cells act as the source of
Ag by becoming targets for DC phagocytosis. Experiments are under way
to determine whether DC cross-presentation of a homogeneous inoculum of
apoptotic cells is also independent of CD36 and
3/5 integrins. Nevertheless, it
remains possible that cross-presentation need not necessarily involve
apoptotic cell uptake. Although it can decrease human DC uptake of
apoptotic cells by up to 60% (22), the effect of CD36 and
v5 blockade on
cross-presentation has not been reported. Uptake of necrotic cells can
lead to cross-presentation in some systems (51, 52), and
these necrotic cells could be ingested via receptors other than those
typically associated with phagocytosis of apoptotic cells. Furthermore,
cell uptake may even be dispensable for cross-presentation. Soluble
heat shock proteins can be released by necrotic cells (53, 54) and carry donor Ags for MHC class I presentation by APC
(55). One of the APC receptors involved in heat shock
protein cross-presentation is CD91 (56), and it remains to
be tested whether CD91 deficiency decreases cross-presentation of
cell-based inocula, although, interestingly, CD91 can also be involved
in the uptake of apoptotic cells (57). Exosomes produced
by the donor cells could also be involved in cross-presentation
(58). However, preliminary evidence from Trans-Well
experiments suggests that contact between the donor cells and DC is
required for cross-presentation, arguing against a role for exosomes or
soluble mediators of cross-presentation in our experiments (O. Schulz
and C. Reis e Sousa, unpublished observations).
If CD36 is not involved in cross-presentation, what other function
might it have on CD8+ DC? Interestingly,
cross-linking of CD36 or v has been shown to
dominantly suppress human DC activation by LPS and CD40 ligand
(39). These receptors may also mediate the
immunosuppressive effects of apoptotic cells on monocytes and DC
(39, 59). Therefore, it is possible that engagement of
CD36 on CD8+ acts to counteract DC activation.
This could contribute to preventing immune responses to peripheral Ags
during normal tissue turnover and might be exploited by some pathogens
to escape immune responses (60).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Caetano Reis e Sousa, Immunobiology Laboratory, Cancer Research UK, London Research Institute, Lincoln’s Inn Fields Laboratories, 44 Lincoln’s Inn Fields, London, U.K. WC2A 3PX. E-mail address: caetano{at}cancer.org.uk
3 Abbreviations used in this paper: M, macrophage; DC, dendritic cell; DN, double negative; PS, phosphatidylserine; RAG, recombinase-activating gene.
Received for publication January 22, 2002. Accepted for publication March 21, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J. Exp. Med. 189:371.v5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359.v3 integrin and requires intracellular and extracellular calcium. Eur. J. Immunol. 27:1893.[Medline]
3-integrin or 3- and 5-integrins. Nat. Med 8:27.[Medline]
v5 integrin in photoreceptor phagocytosis by the retinal pigment epithelium. J. Exp. Med. 194:1289.- and CD8+ subclasses of dendritic cells undergo phenotypic and functional maturation in vitro and in vivo. J. Leukocyte Biol. 69:951.v3). J. Immunol. 161:6250.
B pathway. Int. Immunol. 12:1539.This article has been cited by other articles:
|
|
 |
|
  M. Nakayama, H. Akiba, K. Takeda, Y. Kojima, M. Hashiguchi, M. Azuma, H. Yagita, and K. Okumura Tim-3 mediates phagocytosis of apoptotic cells and cross-presentation Blood, April 16, 2009; 113(16): 3821 - 3830. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hemmi, J. Idoyaga, K. Suda, N. Suda, K. Kennedy, M. Noda, A. Aderem, and R. M. Steinman A New Triggering Receptor Expressed on Myeloid Cells (Trem) Family Member, Trem-Like 4, Binds to Dead Cells and Is a DNAX Activation Protein 12-Linked Marker for Subsets of Mouse Macrophages and Dendritic Cells J. Immunol., February 1, 2009; 182(3): 1278 - 1286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Tagliani, P. Guermonprez, J. Sepulveda, M. Lopez-Bravo, C. Ardavin, S. Amigorena, F. Benvenuti, and O. R. Burrone Selection of an Antibody Library Identifies a Pathway to Induce Immunity by Targeting CD36 on Steady-State CD8{alpha}+ Dendritic Cells J. Immunol., March 1, 2008; 180(5): 3201 - 3209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Segura, C. Guerin, N. Hogg, S. Amigorena, and C. Thery CD8+ Dendritic Cells Use LFA-1 to Capture MHC-Peptide Complexes from Exosomes In Vivo J. Immunol., August 1, 2007; 179(3): 1489 - 1496. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Behrens, U. Sriram, D. K. Shivers, M. Gallucci, Z. Ma, T. H. Finkel, and S. Gallucci Complement Receptor 3 Ligation of Dendritic Cells Suppresses Their Stimulatory Capacity J. Immunol., May 15, 2007; 178(10): 6268 - 6279. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Puig-Kroger, A. Dominguez-Soto, L. Martinez-Munoz, D. Serrano-Gomez, M. Lopez-Bravo, E. Sierra-Filardi, E. Fernandez-Ruiz, N. Ruiz-Velasco, C. Ardavin, Y. Groner, et al. RUNX3 Negatively Regulates CD36 Expression in Myeloid Cell Lines J. Immunol., August 15, 2006; 177(4): 2107 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Skoberne, S. Somersan, W. Almodovar, T. Truong, K. Petrova, P. M. Henson, and N. Bhardwaj The apoptotic-cell receptor CR3, but not {alpha}vbeta5, is a regulator of human dendritic-cell immunostimulatory function Blood, August 1, 2006; 108(3): 947 - 955. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Harui, M. D. Roth, D. Vira, M. Sanghvi, H. Mizuguchi, and S. K. Basak Adenoviral-encoded antigens are presented efficiently by a subset of dendritic cells expressing high levels of {alpha}v{beta}3 integrins J. Leukoc. Biol., June 1, 2006; 79(6): 1271 - 1278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ostrowski, M. Vermeulen, O. Zabal, J. R. Geffner, A. M. Sadir, and O. J. Lopez Impairment of Thymus-Dependent Responses by Murine Dendritic Cells Infected with Foot-and-Mouth Disease Virus J. Immunol., September 15, 2005; 175(6): 3971 - 3979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Kerksiek, F. Niedergang, P. Chavrier, D. H. Busch, and T. Brocker Selective Rac1 inhibition in dendritic cells diminishes apoptotic cell uptake and cross-presentation in vivo Blood, January 15, 2005; 105(2): 742 - 749. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Edwards, D. Chaussabel, S. Tomlinson, O. Schulz, A. Sher, and C. Reis e Sousa Relationships Among Murine CD11chigh Dendritic Cell Subsets as Revealed by Baseline Gene Expression Patterns J. Immunol., July 1, 2003; 171(1): 47 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Harshyne, M. I. Zimmer, S. C. Watkins, and S. M. Barratt-Boyes A Role for Class A Scavenger Receptor in Dendritic Cell Nibbling from Live Cells J. Immunol., March 1, 2003; 170(5): 2302 - 2309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Edwards, S. P. Manickasingham, R. Sporri, S. S. Diebold, O. Schulz, A. Sher, T. Kaisho, S. Akira, and C. Reis e Sousa Microbial Recognition Via Toll-Like Receptor-Dependent and -Independent Pathways Determines the Cytokine Response of Murine Dendritic Cell Subsets to CD40 Triggering J. Immunol., October 1, 2002; 169(7): 3652 - 3660. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or WT littermate controls (
) mice were cultured
in the presence of APC-depleted OT-1 T cells and either OVA cells
(left) or OVA peptide (200 pM; right).
Results represent [3H]thymidine uptake on day 3 of
culture. Data are the mean of triplicate wells. All error bars are
shown and represent 1 SD from the mean. Similar data were obtained in a
separate experiment comparing total DC from WT and
