|
|
||||||||
1 and a Novel Cytokine Receptor Subunit, IL-23R1











Departments of
* Immunology,
Molecular Biology, and
Molecular Pathology, DNAX Research, Palo Alto, CA 94304
| Abstract |
|---|
|
|
|---|
1. However, it does not use
IL-12R
2. In this study, we identify a novel member of the
hemopoietin receptor family as a subunit of the receptor for IL-23,
"IL-23R." IL-23R pairs with IL-12R
1 to confer IL-23
responsiveness on cells expressing both subunits. Human IL-23, but not
IL-12, exhibits detectable affinity for human IL-23R. Anti-IL-12R
1
and anti-IL-23R Abs block IL-23 responses of an NK cell line and
Ba/F3 cells expressing the two receptor chains. IL-23 activates the
same Jak-stat signaling molecules as IL-12: Jak2, Tyk2, and stat1, -3,
-4, and -5, but stat4 activation is substantially weaker and different
DNA-binding stat complexes form in response to IL-23 compared with
IL-12. IL-23R associates constitutively with Jak2 and in a
ligand-dependent manner with stat3. The ability of cells to respond to
IL-23 or IL-12 correlates with expression of IL-23R or IL-12R
2,
respectively. The human IL-23R gene is on human chromosome 1 within 150
kb of IL-12R
2. | Introduction |
|---|
|
|
|---|
-helical bundle structure and
collectively play important and varied roles in immune regulation.
IL-23 is a covalently linked heterodimeric hemopoietic cytokine that
shares the p40 (soluble cytokine receptor-like) subunit of IL-12 but is
distinguished from the latter by its cytokine subunit, p19
(1). IL-23-like IL-12 induces proliferation and IFN-
production by human T cells. In contrast to IL-12, IL-23 preferentially
stimulates memory as opposed to naive T cell populations in both human
and mouse (1). Transgenic mice ubiquitously expressing the
p19 subunit of IL-23 develop a severe multiorgan inflammatory syndrome
with elevated expression levels of TNF and IL-1 (2),
suggesting direct or indirect effects on myeloid cells as well as NK
and T cells. This pathology can be transferred with transgenic bone
marrow, suggesting that the principal source of the proinflammatory
mediator (IL-23) is hemapoietic cells (2).
Consistent with the structural and biological similarities of IL-12 and
IL-23, the IL-23R complex shares a subunit with that of IL-12
(IL-12R
1); however, it does not use or detectably bind to IL-12R
2
(1). To facilitate a more detailed understanding of
IL-23s function, we have identified and characterized an
additional subunit of the IL-23R complex, termed "IL-23R." In this
study, we show that IL-23R is a novel member of the hemopoietin
receptor superfamily encoded by a gene that maps within 150 kb of the
gene for IL-12R
2 on human chromosome 1. IL-23 uses the same Jak-stat
signaling molecules as IL-12, and IL-23R associates with Jak2 and
stat3. The ability of cells to respond to either IL-12 or IL-23 is
determined by expression of IL-12R
2 or IL-23R, respectively.
| Materials and Methods |
|---|
|
|
|---|
Human (h)6 IL-12 and mouse (m)IL-12 were purchased from R&D Systems (Minneapolis, MN). rhIL-23 and rmIL-23 were covalently linked fusion proteins (3) containing FLAG epitope tags as described (1).
Antibodies
Goat anti-hIL-12R
1 was from R&D Systems. Anti-FLAG
epitope Abs were from Sigma-Aldrich (St. Louis, MO). Rabbit
anti-hIL-23R anti-serum was prepared by immunizing rabbits
(Josman LLC, Napa, CA) with rIL-23R extracellular domain containing
C-terminal V5 (Invitrogen, Carlsbad, CA) and His6 epitope tags (soluble
(s)hIL-23R-V5-His6). Rabbit IgG fraction was prepared from serum
by caprylic acid precipitation (4). hIL-23R-specific Ab
was purified by absorption and elution from an affinity column
containing rhIL-23R extracellular domain fused to the Fc region of
hIgG1 (hIL-23R-Ig).
Cells and cell lines
The hIL-2-dependent T cell line Kit225 (5) which binds and responds to IL-12 (6, 7) was kindly provided by Dr. J. Johnston (DNAX, Palo Alto, CA). mIL-3-dependent Ba/F3 cells were as described (1, 8). Human PHA blast preparation was as described (1).
Human T cell clone 37 was derived from CD4+CD45RA+ peripheral blood T cells following two rounds of activation by anti-CD3 cross-linked on L cells expressing CD32, CD80, and CD58 in the presence of IL-2 (20 U/ml; R&D Systems) and IL-12 (1 ng/ml; R&D Systems). This population of cells was subsequently cloned by limiting dilution using PHA and feeder cells (9). T cell clone 37 has a Th1 phenotype. The human NK leukemic cell line NKL (10) was cultured in Yssels medium supplemented with 1% human serum and 100 U/ml IL-2.
NKL assay
NKL cells (2 x 105 cells/well) were
incubated in 200 µl Yssels medium in the absence or presence of
IL-2 (200 U/ml), IL-12 (1 ng/ml), IL-18 (100 ng/ml), and IL-23 (100
ng/ml) either alone or in specified combinations for 72 h.
Supernatants were harvested and the amount of IFN-
determined by
specific ELISA (R&D Systems).
BALB/c bone marrow-derived macrophages
BALB/c bone marrow-derived macrophages were cultured for 10 days
in GM-CSF (40 ng/ml) + anti-mIL-10R (1 µg/ml). On day 10,
cultures were stimulated for 24 h under each of the following
conditions: anti-IL-10R + IFN-
(5 ng/ml) + LPS (10 µg/ml),
anti-IL-10R + IFN-
, anti-IL-10R + LPS, and
anti-IL-10R only.
cDNA libraries and expression cloning of hIL-23R
Total cellular RNA was isolated by lysis of cells in guanidinium
isothiocyanate and centrifugation through a CsCl pad. Poly(A)+ mRNA was
selected using an Oligotex mRNA kit (Qiagen, Valencia, CA). Retroviral
expression cDNA libraries were prepared in the pMX expression vector
(11) using the Superscript RT cDNA library kit (Life
Technologies, Rockville, MD). Retrovirus was generated from cDNA
libraries via transient transfection of BOSC23 cells as described
(12) and used to infect 107 Ba/F3
cells expressing hIL-12R
1 (1) for 2448 h on petri
dishes coated with 30 µg/ml recombinant fibronectin fragments
(Retronectin; Takara Bio, Shiga, Japan). Infection efficiencies
of 8098% were regularly obtained. Infected cells were cultured in
mIL-3 for 23 days, then washed three times to remove mIL-3, plated at
1.21.5 x 104 cells/well in 96-well plates
in medium containing 50 ng/ml hIL-23, and allowed to grow for 2 wk.
Cultures were supplemented with fresh hIL-23-containing medium every
45 days. Cells growing in the presence of hIL-23 were tested for
hIL-23-dependent proliferation in an assay using Alamar Blue (Trek
Diagnostic Systems, Westlake, OH) as described (1, 8).
Genomic DNA was isolated (DNeasy Tissue kit; Qiagen) from
hIL-23-dependent cell lines and subjected to PCR amplification using
pMX vector-specific primers (11)
(5'-CCCGGGGGTGGACCATCCTCT-3' and 5'-CTACAGGTGGGGTCTTTCATTCC-3'),
followed by another round of amplification using a second, "nested"
set of pMX vector primers (5'-TTGGATACACGCCGCCCACGTGAAGGCTGCCGA-3'
and 5'-CTTTTATTTTATCGTCGACCACTGTGCTGGC-3'). High m.w. (>2 kb) PCR
products were cloned in pCR2.1-TOPO (Invitrogen) and sequenced.
A candidate hIL-23R cDNA identified by this method (see
Results) was used to screen Kit225 and human NK cell cDNA
libraries by hybridization and several of the resulting full-length
hIL-23R cDNAs were subcloned in pMX containing a puromycin resistance
gene (pMX-puro; Ref. 11). Retrovirus was generated and
used to infect Ba/F3-hIL-12R
1 cells. Cells resistant to 2 µg/ml
puromycin were tested for hIL-23-dependent growth.
hIL-23R and mIL-23R genomic genes and mIL-23R cDNA
The hIL-23R gene was determined to be closely linked to the gene
encoding hIL-12R
2 on chromosome 1p31.2-32.1 (see
Results). Accordingly, we obtained mIL-12R
2 bacterial
artificial chromosome (BAC) genomic DNA clones from C57BL/6 and 129 ES
cell genomic DNA libraries (Incyte Genomics, St. Louis, MO) by
hybridization to an mIL-12R
2 cDNA probe (1, 13). BAC
DNAs were restricted and analyzed by pulsed-field electrophoresis (CHEF
Mapper XA system; Bio-Rad, Richmond, CA) and DNA blot hybridization
using either mIL-12R
2 or hIL-23R cDNAs as probes. Restriction
fragments hybridizing to the hIL-23R probe were subcloned and
sequenced, allowing identification of several exons of the mIL-23R
gene. PCR-amplified exons were used to probe a cDNA library derived
from 7-day polarized mouse Th2 cells. Hybridizing clones were sequenced
and full-length cDNAs transferred to pMX-puro for expression in Ba/F3
cells expressing rmIL-12R
1 (1). Cells were assessed for
responsiveness to mIL-23 and hIL-23 as described above.
Binding of IL-23 to cells and rIL-23R
Binding of IL-23 to cells expressing IL-12R
1, IL-23R, or both
IL-12R
1 and IL-23R was detected by FACS staining using anti-FLAG
or anti-p40 Abs as described (1). To detect this
interaction by ELISA, plates were coated with 1 µg/ml hIL-23R-Ig,
then incubated with various concentrations of hIL-23 or an irrelevant
ligand (FLAG-hIL-10) in PBS + 10% FCS for 2 h at room
temperature, followed by successive incubations with
biotin-anti-FLAG (Sigma-Aldrich) and streptavidin-HRP (BD
PharMingen, San Diego, CA).
Interaction of hIL-23 and the soluble extracellular domain of hIL-23R was also demonstrated by immunoprecipitation. shIL-23R-V5-His6 was expressed in 293T cells; similarly, FLAG-hp40 and FLAG-hp19 were coexpressed in 293T cells. The respective supernatants were combined for coprecipitation experiments and incubated overnight at 4°C. Immunoprecipitations were performed in the presence of 0.1% Brij96 using anti-FLAG-M2 agarose (Sigma-Aldrich) or Ni-NTA agarose (Qiagen). Precipitated proteins were separated by nonreducing SDS-PAGE and detected by Western blot using anti-FLAG-HRP (Sigma-Aldrich) or anti-V5-HRP (Invitrogen) Abs according to the manufacturers recommendations.
Quantitative PCR
A total of 50 ng of DNA from various cDNA libraries was analyzed
for expression of hIL-23R or mIL-23R by the flourogenic 5'-nuclease PCR
assay using the ABI Prism 7700 Sequence Detection System (PerkinElmer,
Foster City, CA) as described (1). The following primer
and probes were used: hIL-23R, forward: CGCAAAACTCGCTATTCGACA, reverse:
ATGGCTTCCCTCAGGCAGA, probe:
6-carboxyfluorescein-TTCCTGATCTCAACACTGGATATAAACCCCAA-6-carboxytetramethylrhodamine;
hIL-12R
1, forward: GCATCGAAGTGCAGGTTTCTG, reverse:
CACGAGAAGGATGCTCAGGAA, probe:
6FAM-TGGCTCATCTTCTTCGCCTCCCTG-TAMRA; hIL-12R
2, forward:
AAGACACAGCTGCCCTTGGA, reverse: TGACCAGCGGTTCAGGATCT, probe:
6FAM-CTCCTGATAGACTGGCCCACGCCTG-TAMRA; mIL-23R, forward:
TGAAAGAGACCCTACATCCCTTGA, reverse: CAGAAAATTGGAAGTTGGGATATGTT,
probe: 6FAM-ACCACAGATGACCACTTTGCCAGATTGA-TAMRA; and mIL-12R
2,
forward: GATCTCAGTTGGTGTTGCTCCA, reverse: GGCCACAGTTCCATTTTCTCC,
probe: 6FAM-AGCCACCTCAAAACATATCATGTGTCCAGG-TAMRA. Probes for
Taqman analysis were obtained as Molecular Beacons from Synthetic
Genetics (San Diego, CA) or from PerkinElmer. Analysis of RT-cDNA
samples from cultured cells was corrected for expression of 18S rRNA
using a VIC-labeled probe (PerkinElmer) in multiplex
reactions.
Signal transduction assays
Abs used in immunoprecipitation were obtained from Upstate Biotechnology (Lake Placid, NY), Santa Cruz Biotechnology (Santa Cruz, CA), BD PharMingen, or New England Biolabs (Beverly, MA). Cells grown to log phase were serum-starved for 46 h in RPMI 1640 + 0.5% BSA. Cells were centrifuged and resuspended to 24 x 107 cells/ml and stimulated with cytokine for 10 min at 37°C. After incubation, cells were centrifuged and washed in PBS + 1.5 mM sodium vanadate, then lysed in Brij buffer (10 mM Tris (pH 7.5), 2 mM EDTA, 0.15 M NaCl, 0.875% Brij 97 (Sigma-Aldrich)), 0.125% NP-40, complete protease inhibitors (Roche, Indianapolis, IN), and 3 mM Pefabloc protease inhibitor (Roche). Lysates were centrifuged and supernatants were either immunoprecipitated or prepared for SDS-PAGE by addition of of reducing NuPAGE LDS loading buffer (Invitrogen). For immunoprecipitation, 2 µg Ab and 50 µl of protein A agarose beads (Sigma-Aldrich) were added to each reaction. Tubes were agitated at 4°C for 224 h. Following washes with Brij buffer and PBS, beads were resuspended in PBS wash buffer with reducing NuPAGE LDS loading buffer. Lysates or immunoprecipitates were subjected to 412% NuPAGE SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA) per manufacturers recommendations. Membranes were blocked in 3% BSA/TBST (for anti-phosphotyrosine blots) or 5% milk blocking buffer. Membranes were first probed with anti-phosphotyrosine (4G10; Upstate Biotechnology), and then stripped and reprobed for STAT 1,2,3,4 (BD Transduction Laboratories, Lexington, KY), STAT 5,6 (Santa Cruz Biotechnology), or Jak1 (BD Transduction Laboratories,), Jak2 (Upstate Biotechnology or Santa Cruz Biotechnology), or Jak3 or Tyk2 (Santa Cruz Biotechnology) as appropriate.
Receptor coimmunoprecipitation experiments were done as described
above, using Kit225, or Ba/F3 transfected with hIL-12R
1 and
c-myc epitope-tagged hIL-23R. Lysates were
immunoprecipitated with rabbit anti-shIL-23R-V5-His6. Western blots
were probed with anti-c-myc, rat anti-hIL-23R
polyclonal Ab (provided by T. Churakova, DNAX), or anti-Jak/Stat
Abs as described above.
| Results |
|---|
|
|
|---|
Kit225 is a human T cell line that proliferates in response to
IL-2 and IL-12 (5, 14, 15, 16). Although Kit225 cells readily
lost growth factor dependence in culture and were thus not suitable for
routine cytokine bioassays, we nonetheless demonstrated a proliferative
response to IL-23 (Fig. 1
).
|
We prepared cDNA libraries from Kit225, human PHA blasts
(1), and human T cell clone 37 in the retroviral
expression vector pMX. Ba/F3 cells expressing hIL-12R
1 were infected
with cDNA library retrovirus and then allowed to grow in mIL-3 for
4872 h. The resulting cells were washed, distributed at 11.5
x 104/well in 96-well plates, and cultured in
hIL-23. Individual cell cultures growing in the presence of hIL-23 were
analyzed for hIL-23-dependent growth. Genomic DNA from hIL-23-dependent
cells was subjected to two rounds of PCR amplification with
vector-specific primers; amplified cDNAs
2 kb were subcloned and
sequenced. Among these subclones we identified a 2.9-kb cDNA encoding a
629-aa type I transmembrane protein with homology to cytokine
receptors; its closest relatives appeared to be IL-12R
2 (Fig. 2
a) and gp130 (data not
shown). Retrospective PCR analysis of IL-23-dependent cell lines
isolated from screens of all three cDNA libraries revealed that 51/54
such cell lines harbored integrated retrovirus containing this
"hIL-23R" cDNA insert.
|
1 cells, and the resulting cells
tested for growth in hIL-23. Ba/F3 cells expressing both hIL-12R
1
and IL-23R ("8c"), but not the individual subunits, responded to
hIL-23 (Fig. 3
1 (Fig. 3
1
and anti-hIL-23R Abs (Fig. 3
|
A basic local alignment search tool search of the
high-throughput genomic (HTG) database located the hIL-23R gene
on human chromosome 1 (1p31.2-32.1) on the same 151-kb segment as
hIL-12R
2. Using sequence derived from several HTG entries, we
assembled what appears to be the complete hIL-23R gene structure (Table I
). The hIL-23R ORF is encoded by 10
exons spanning
92 kb of human genomic DNA.
|
2 cDNA. Two of eight BAC clones also hybridized to the
hIL-23R probe. We subcloned and sequenced two HindIII
fragments that hybridized to hIL-23R. These fragments contained mIL-23R
exons corresponding to exons 8 and 10 of the hIL-23R gene.
PCR-amplified mIL-23R exons were then used to screen a cDNA library of
BALB/c mouse 7-day Th2-polarized T cells; two full-length cDNA clones
were obtained encoding identical 644-aa type I transmembrane proteins
with 66% identity and 77% similarity to hIL-23R (Fig. 2
a).
DNA sequence homology was
84% in the protein-coding regions (data
not shown).
mIL-23R cDNA was expressed in Ba/F3 cells together with mIL-12R
1
(1). Ba/F3 cells expressing both mIL12R
1 and
mIL-23R responded to IL-23 (Fig. 3
e). Both mIL-23 and
hIL-23 were active on mouse and human cells as reported earlier
(1) and on cells expressing the respective
rIL-12R
1/IL-23R complexes (Fig. 3
e).
Structure of IL-23R
The extracellular domain of IL-23R contains a signal sequence, an
N-terminal Ig-like domain and two cytokine receptor domains (Fig. 2
, a and b). The extracellular domains are all
related to corresponding domains of IL-12R
2 (Fig. 2
a). In
contrast to IL-12R
2, IL-23R does not contain three
transmembrane-proximal fibronectin type III domains. There are
eight and seven potential N-linked glycosylation sites in
mIL-23R and hIL-23R, respectively.
The transmembrane-proximal cytokine receptor domain of both mIL-23R and hIL-23R contains a sequence (WQPWS) similar to the cytokine receptor signature WSXWS motif. Interestingly, the mIL-23R cDNA sequence contains a 20-aa duplication including this motif. We also found this duplication in BAC genomic DNA clones (129 strain). Moreover, among eight mouse cDNA libraries from BALB/c and C57BL/6 that contained mIL-23R cDNAs, we found only mIL-23R cDNAs containing this duplication (data not shown). Thus, we conclude that the mIL-23R gene and protein contain this 20-aa duplication.
The 252-aa hIL-23R cytoplasmic domain contains seven tyrosine residues,
six of which are conserved in mIL-23R (hIL-23R Y463 is not conserved).
Three of these tyrosines define potential Src homology 2
domain-binding sites, Y399, Y484, and Y611 (Fig. 2
a). The
Y399EDI sequence is a potential SHP2 binding site
(17) and Y611FPQ is a potential
stat1 and stat3 binding site (18). The
GY484KPQIS sequence resembles to a degree the
motif in stat4 and IL-12R
2 known to bind to stat4 (GYL/VPS; Refs.
19 and 20). Although it is difficult to
discern a proline-rich region that would be predicted to bind a Jak
kinase, IL-23R does associate with Jak2 (see Fig. 7
).
|
Binding of hIL-23 to hIL-23R was readily detected by FACS
analysis (Fig. 4
a); hIL-12 did
not bind to hIL-23R (data not shown) and hIL-23R did not associate with
hIL-12R
1 in the presence of hIL-12 (see Fig. 7
). hIL-23 bound
to shIL-23R-V5-His6 coated on ELISA plates (Fig. 4
b). In
addition, FLAG-hp19 and FLAG-hp40 expressed together in 293T cells
could associate with shIL-23R-V5-His6 in solution (Fig. 4
c).
|
IL-23R expression
hIL-23R mRNA was expressed at levels too low to detect by RNA blot
except in Kit225 cells which expressed a 2.83-kb hIL-23R mRNA (Fig. 5
a), consistent with the size
of the hIL-23R cDNA clone. Therefore, we analyzed expression of both
hIL-23R and mIL-23R by quantitative real-time PCR (Taqman). hIL-23R
mRNA is expressed by a human Th1 and Th0 clone as well as several NK
cell lines and clones, including NKL (Fig. 5
b). cDNA
libraries prepared from several cultured monocyte and dendritic cell
populations (Fig. 5
b) expressed very low levels of hIL-23R.
Relatively low but detectable hIL-23R mRNA levels were observed in
EBV-transformed B cells and anti-CD3/anti-CD28/LPS-activated
PBMC (Fig. 5
b). This expression pattern was similar to that
of hIL-12R
2 (Fig. 5
c). PBMC used in these experiments
were activated for short time periods up to 24 h; higher receptor
expression levels were seen at 4872 h (data not shown). In addition,
nine hIL-23R expressed sequence tags were found by basic local
alignment search tool search; all were derived from a cDNA library of
bone marrow from chronic myelogenous leukemia patient(s).
|
Bone marrow macrophages activated by LPS in the presence of either
IL-10 or neutralizing anti-IL-10R mAb (21)
expressed mIL-23R, in contrast to peritoneal macrophages (Fig. 5
d). However, these same cells expressed little or no
detectable IL-12R
1. Therefore, we examined IL-12R
1 and IL-23R
expression in these cells under different conditions and found that
activation in the presence of anti-IL-10R mAb and IFN-
induced
expression of both receptor subunits while in the presence of LPS
IL-12R
1 mRNA expression was not detected (Fig. 5
, df).
Our observation of IL-12R
1 expression by monocyte/macrophage cells
is consistent with a number of reports in the literature
(22, 23, 24, 25, 26, 27, 28, 29).
mCD4+CD45RBlow memory T
cells respond to IL-23 but relatively poorly or not at all to IL-12; in
contrast, CD4+CD45RBhigh
cells respond well to IL-12, but poorly to IL-23 (1).
Therefore, we analyzed mIL-23R and mIL-12R
2 expression in these
cells. Consistent with these cells cytokine responses,
CD4+CD45RBlow cells
expressed IL-23R mRNA and low levels of IL-12R
2, while
CD4+CD45RBhigh cells
expressed IL-12R
2 and little or no detectable IL-23R (Fig. 5
g).
Signal transduction in response to IL-23
In view of the structural and biological activity similarities
exhibited by IL-23 and IL-12, we examined the Jak kinase and stat
transcription factor molecules activated by IL-23. Previous work showed
that IL-23, like IL-12, activates Stat4, although to a lesser extent
(1). Results shown in Fig. 6
, ad, demonstrate that
IL-23 activates the same spectrum of Jak/Stat molecules as IL-12
(30, 31, 32, 33, 34, 35, 36, 37): Jak2, Tyk2, and Stat1, -3, -4, and -5. However,
Stat4 activation is notably weaker in response to IL-23 (Fig. 6
b), and differences were also evident in EMSA experiments
(Fig. 7
, a and b).
In contrast to IL-12, which induces a strong Stat4-containing EMSA band
(33, 35, 38), IL-23 induces a heterogeneous set of at
least three bands. In Kit225 cells, the top and bottom bands contain
Stat3 and Stat1, respectively, as shown by "supershift"
experiments. Stat5 was not detected with the M67 SIE oligonucleotide
probe, as noted by others (39, 40). Ab supershift
experiments suggested that the middle band, faintest of the three, may
contain both Stat3 and Stat4. In PHA blast T cells (Fig. 7
b)
and NKL cells (data not shown), the composition of the three bands was
somewhat different: as for Kit225 the prominent upper band contained
Stat3, but the lower band contained Stat4, and the middle band clearly
contained both Stat3 and Stat4. We could not reliably detect IL-23- or
IL-12-induced Stat1 activation in PHA blasts and NKL cells.
|
1 (Fig. 7
2,
IL-23R associates with Jak2. However, we were unable to consistently
demonstrate association of Stat4 with IL-23R such as that reported for
IL-12R
2 (Refs. 19 and 20 ; data not
shown). | Discussion |
|---|
|
|
|---|
1 together comprise the IL-23 receptor complex on
IL-23-responsive cells, as evidenced by: 1) the proliferative response
to IL-23 of cells expressing rIL-23R and rIL-12R
1, and 2) the
ability of anti-IL-23R Abs to block responses of cells to this
cytokine (Fig. 3
2 and gp130. However, unlike its
close relatives, the IL-23R extracellular region does not contain three
membrane-proximal fibronectin III-like domains; rather it contains one
Ig-like domain and two cytokine receptor domains, similar to IL-6R
,
IL-11R
, and CNTFR
(18, 41). The latter "short"
cytokine receptor subunits generally provide little in the way of
signal-transducing functions in the cytokine-receptor complex; IL-23R
thus appears to be an exception in this regard. Mouse IL-23R contains a
20-aa duplication including the signature cytokine receptor WSXWS box
(WQPWS, Fig. 2
IL-23 signal transduction engages the same Jak-Stat signaling molecules
as IL-12: Jak2, Tyk2, Stat1, Stat3, Stat4, and Stat5 (Fig. 6
). These
results suggest that, consistent with the reported biology of IL-23
(1, 2), some signal transduction mechanisms engaged
by IL-23 are similar to those of IL-12 (30, 31, 32, 33, 34, 35, 36, 37).
However, in contrast to IL-12, the most prominent Stat induced by IL-23
is Stat3 rather than Stat4. Moreover, the compositions of DNA-binding
Stat complexes induced by IL-12 and IL-23 exhibit potentially important
differences. As shown in Fig. 7
, IL-12 induces a DNA-binding complex
containing only Stat4, while IL-23 induces several complexes containing
Stat3, Stat1, Stat4, and possibly Stat3/Stat4. This pattern of EMSA
bands induced by IL-23 is similar to that reported to be induced by
IL-12 at longer times of stimulation (
25 min; Ref. 35).
Thus, while the same Jak kinases and Stat proteins are activated by
IL-12 and IL-23, the resulting DNA-binding Stat transcription factor
complexes can be different. These observations suggest that significant
differences should be expected in the biological responses induced by
IL-23 and IL-12. This area is the subject of ongoing investigation.
Human IL-23R is expressed by both T cells and NK cells, including NKL
cells (Fig. 5
, a and b), consistent with the
ability of these cells to respond to IL-23. We demonstrate here that
IL-23 enhanced the production of IFN-
by NKL cells. The combination
of IL-2, IL-18, and IL-23 induced levels of IFN-
that were
substantially greater than those induced by either cytokine alone or
when combined solely with IL-2. Polyclonal anti-IL-23R and
anti-IL-12R
1 Abs inhibited the enhanced production of IFN-
induced by IL-23 (Fig. 3
d).
The hIL-23R expression pattern overlaps with that of hIL-12R
2, in
agreement with the observation that most human cells that respond to
IL-23 also respond to IL-12 (Ref. 1 and R. de Waal
Malefyt, unpublished observations). The proximity of the IL-23R and
IL-12R
2 genes is also consistent with possible coordinate regulation
of expression.
Mouse bone marrow macrophages express IL-23R. Activation in the
presence of IFN-
induced coordinate expression of IL-23R and
IL-12R
1, while in the presence of LPS induction of IL-12R
1 mRNA
was markedly reduced (Fig. 5
, df; D. Rennick, J.
Cheung, and T. McClanahan, unpublished observations). These
observations suggest the intriguing possibility that IFN-
(perhaps
induced by accessory cell IL-12) induces macrophages to become
responsive to IL-23. Moreover, the pathology of the p19 transgenic
mouse (2) also suggests the possibility of as yet
uncharacterized biologic responses of myeloid cells to IL-23.
Mouse CD4+CD45RBlow memory
cells respond to IL-23 but poorly to IL-12, while naive
CD4+CD45RBhigh cells
respond well to IL-12 but poorly to IL-23 (1). We have
demonstrated in this study (Fig. 5
g) that IL-23R is
expressed by CD4+CD45RBlow
cells and at comparatively much lower levels by
CD4+CD45RBhigh cells.
Moreover, for IL-12R
2, the reciprocal expression pattern is
observed. Thus, the responses of these mouse cell types to IL-12 or
IL-23 correlate with the relative expression levels of IL-12R
2 or
IL-23R, respectively.
The identification of both IL-23 and its specific receptor component
IL-23R defines a new cytokine produced by accessory cells that
stimulates T cells, NK cells, and possibly certain macrophage/myeloid
cells. In contrast to anti-IL-12p70 mAbs that target both IL-12 and
IL-23, specific reagents such as anti-IL-23R neutralizing mAbs will
facilitate distinguishing the functions of IL-12 and IL-23 in the
induction and development of immune responses. Of particular interest
will be the respective roles played by these two cytokines in
regulation of memory T cells, as the ability to therapeutically alter
memory T cell responses has important implications for treatment of
autoimmune disease. In addition, genetic deficiencies in the IL-12p40,
IL-12R
1, IL-12R
2, IFN-
R1, and IFN-
R2 genes have been
associated with diminished ability to combat mycobacterial infections
and enhanced atopic disease (42). It is possible that
mutations in either the IL-23p19 or IL-23R genes may explain similar
deficiencies in individuals who lack genetic defects in the
IL-12/IFN-
R/ligand systems.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 C.P. and M.C. contributed equally to this paper. ![]()
3 Current address: Corgentech, 1651 Page Mill Road, Palo Alto, CA 94304. ![]()
4 Current address: Sugen, 230 East Grand Avenue, South San Francisco, CA 94080. ![]()
5 Address correspondence and reprint requests to Dr. Kevin W. Moore, Department of Immunology, DNAX Research Institute of Molecular Biology, 901 California Avenue, Palo Alto, CA 94304-1104. E-mail address: kevin.moore{at}dnax.org ![]()
6 Abbreviations used in this paper: h, human; m, mouse; BAC, bacterial artificial chromosome; s, soluble; HTG, high-throughput genomic. ![]()
Received for publication December 10, 2001. Accepted for publication April 4, 2002.
| References |
|---|
|
|
|---|
chain. Eur. J. Immunol. 26:345.[Medline]
2 in developing and committed Th2 cells does not affect the production of IL-4 or induce the production of IFN
. J. Immunol. 164:2861.
-receptor, epidermal growth factor receptor, and insulin receptor substrate-1-derived phosphopeptides. J. Biol. Chem. 269:10467.
. J. Immunol. 167:221.
by IL-12/IL-18-activated macrophages requires STAT4 signaling and is inhibited by IL-4. J. Immunol. 166:3075.
and IL-18 exert opposite regulatory effects on the IL-12 receptor expression and IL-12-induced IFN-
production in mouse macrophages: novel pathways in the regulation of the inflammatory response of macrophages. J. Leukocyte Biol. 68:707.
production in IFN regulatory factor-1 knockout mice during endotoxemia is secondary to a loss of both IL-12 and IL-12 receptor expression. J. Immunol. 165:3970.
1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells. Eur. J. Immunol. 27:147.[Medline]
signaling, although it is required for IL-12-mediated T cell function. Immunity 13:561.[Medline]
production and activates IRAK and NF
B. Immunity 7:571.[Medline]
in host defense against mycobacteria and salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]This article has been cited by other articles:
![]() |
B. PAZAR, E. SAFRANY, P. GERGELY, S. SZANTO, Z. SZEKANECZ, and G. POOR Association of ARTS1 Gene Polymorphisms with Ankylosing Spondylitis in the Hungarian Population: The rs27044 Variant Is Associated with HLA-B*2705 Subtype in Hungarian Patients with Ankylosing Spondylitis J Rheumatol, February 1, 2010; 37(2): 379 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Munoz, M. M. Heimesaat, K. Danker, D. Struck, U. Lohmann, R. Plickert, S. Bereswill, A. Fischer, I. R. Dunay, K. Wolk, et al. Interleukin (IL)-23 mediates Toxoplasma gondii-induced immunopathology in the gut via matrixmetalloproteinase-2 and IL-22 but independent of IL-17 J. Exp. Med., December 21, 2009; 206(13): 3047 - 3059. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Oyamada, H. Ikebe, M. Itsumi, H. Saiwai, S. Okada, K. Shimoda, Y. Iwakura, K. I. Nakayama, Y. Iwamoto, Y. Yoshikai, et al. Tyrosine Kinase 2 Plays Critical Roles in the Pathogenic CD4 T Cell Responses for the Development of Experimental Autoimmune Encephalomyelitis J. Immunol., December 1, 2009; 183(11): 7539 - 7546. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hillyer, M. J. Larche, E. P. Bowman, T. K. McClanahan, R. de Waal Malefyt, L. P. Schewitz, G. Giddins, M. Feldmann, R. A. Kastelein, and F. M. Brennan Investigating the role of the interleukin-23/-17A axis in rheumatoid arthritis Rheumatology, December 1, 2009; 48(12): 1581 - 1589. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Kleinschek, U. Muller, N. Schutze, R. Sabat, R. K. Straubinger, W. M. Blumenschein, T. McClanahan, R. A. Kastelein, and G. Alber Administration of IL-23 engages innate and adaptive immune mechanisms during fungal infection Int. Immunol., November 30, 2009; (2009) dxp117v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y. Wan and R. A. Flavell How Diverse--CD4 Effector T Cells and their Functions J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, X. Ouyang, J. Yang, J. Liu, Q. Li, Y. Gu, M. Fukata, T. Lin, J. C. He, M. Abreu, et al. AP-1 Activated by Toll-like Receptors Regulates Expression of IL-23 p19 J. Biol. Chem., September 4, 2009; 284(36): 24006 - 24016. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Goodman, A. D. Levine, J. V. Massari, H. Sugiyama, T. S. McCormick, and K. D. Cooper IL-6 Signaling in Psoriasis Prevents Immune Suppression by Regulatory T Cells J. Immunol., September 1, 2009; 183(5): 3170 - 3176. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, G. Wagoner, J. C. Douglas, and P. D. Drew Liver X receptor agonist regulation of Th17 lymphocyte function in autoimmunity J. Leukoc. Biol., August 1, 2009; 86(2): 401 - 409. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, J. Weiner, Y. Liu, A. J. Smith, D. J. Huss, R. Winger, H. Peng, P. D. Cravens, M. K. Racke, and A. E. Lovett-Racke T-bet is essential for encephalitogenicity of both Th1 and Th17 cells J. Exp. Med., July 6, 2009; 206(7): 1549 - 1564. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohyama, N. Kato-Kogoe, A. Kuhara, F. Nishimura, K. Nakasho, K. Yamanegi, N. Yamada, M. Hata, J. Yamane, and N. Terada The Involvement of IL-23 and the Th17 Pathway in Periodontitis Journal of Dental Research, July 1, 2009; 88(7): 633 - 638. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Spach, R. Noubade, B. McElvany, W. F. Hickey, E. P. Blankenhorn, and C. Teuscher A Single Nucleotide Polymorphism in Tyk2 Controls Susceptibility to Experimental Allergic Encephalomyelitis J. Immunol., June 15, 2009; 182(12): 7776 - 7783. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nady, J. Ignatz-Hoover, and M. T. Shata Interleukin-12 Is the Optimum Cytokine To Expand Human Th17 Cells In Vitro Clin. Vaccine Immunol., June 1, 2009; 16(6): 798 - 805. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Awasthi and V. K. Kuchroo Th17 cells: from precursors to players in inflammation and infection Int. Immunol., May 1, 2009; 21(5): 489 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Skarica, T. Wang, E. McCadden, D. Kardian, P. A. Calabresi, D. Small, and K. A. Whartenby Signal Transduction Inhibition of APCs Diminishes Th17 and Th1 Responses in Experimental Autoimmune Encephalomyelitis J. Immunol., April 1, 2009; 182(7): 4192 - 4199. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Karaderi, D. Harvey, C. Farrar, L. H. Appleton, M. A. Stone, R. D. Sturrock, M. A. Brown, P. Wordsworth, and J. J. Pointon Association between the interleukin 23 receptor and ankylosing spondylitis is confirmed by a new UK case-control study and meta-analysis of published series Rheumatology, April 1, 2009; 48(4): 386 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Kleinschek, K. Boniface, S. Sadekova, J. Grein, E. E. Murphy, S. P. Turner, L. Raskin, B. Desai, W. A. Faubion, R. de Waal Malefyt, et al. Circulating and gut-resident human Th17 cells express CD161 and promote intestinal inflammation J. Exp. Med., March 16, 2009; 206(3): 525 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Das, X. Chen, R. Komorowski, M. J. Hessner, and W. R. Drobyski Interleukin-23 secretion by donor antigen-presenting cells is critical for organ-specific pathology in graft-versus-host disease Blood, March 5, 2009; 113(10): 2352 - 2362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lopez Kostka, S. Dinges, K. Griewank, Y. Iwakura, M. C. Udey, and E. von Stebut IL-17 Promotes Progression of Cutaneous Leishmaniasis in Susceptible Mice J. Immunol., March 1, 2009; 182(5): 3039 - 3046. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van de Wetering, R. A. de Paus, J. T. van Dissel, and E. van de Vosse IL-23 modulates CD56+/CD3- NK Cell and CD56+/CD3+ NK-like T Cell function differentially from IL-12 Int. Immunol., February 1, 2009; 21(2): 145 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takatori, Y. Kanno, W. T. Watford, C. M. Tato, G. Weiss, I. I. Ivanov, D. R. Littman, and J. J. O'Shea Lymphoid tissue inducer-like cells are an innate source of IL-17 and IL-22 J. Exp. Med., January 16, 2009; 206(1): 35 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Oukka Th17 cells in immunity and autoimmunity Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii26 - iii29. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Castilow, K. L. Legge, and S. M. Varga Cutting Edge: Eosinophils Do Not Contribute to Respiratory Syncytial Virus Vaccine-Enhanced Disease J. Immunol., November 15, 2008; 181(10): 6692 - 6696. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wakashin, K. Hirose, Y. Maezawa, S.-i. Kagami, A. Suto, N. Watanabe, Y. Saito, M. Hatano, T. Tokuhisa, Y. Iwakura, et al. IL-23 and Th17 Cells Enhance Th2-Cell-mediated Eosinophilic Airway Inflammation in Mice Am. J. Respir. Crit. Care Med., November 15, 2008; 178(10): 1023 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mo, W. Chearwae, J. T. O'Malley, S. M. Adams, S. Kanakasabai, C. C. Walline, G. L. Stritesky, S. R. Good, N. B. Perumal, M. H. Kaplan, et al. Stat4 Isoforms Differentially Regulate Inflammation and Demyelination in Experimental Allergic Encephalomyelitis J. Immunol., October 15, 2008; 181(8): 5681 - 5690. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. W. Quinn, N. A. Sims, H. Saleh, D. Mirosa, K. Thompson, S. Bouralexis, E. C. Walker, T. J. Martin, and M. T. Gillespie IL-23 Inhibits Osteoclastogenesis Indirectly through Lymphocytes and Is Required for the Maintenance of Bone Mass in Mice J. Immunol., October 15, 2008; 181(8): 5720 - 5729. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Rueda, G Orozco, E Raya, J L Fernandez-Sueiro, J Mulero, F J Blanco, C Vilches, M A Gonzalez-Gay, and J Martin The IL23R Arg381Gln non-synonymous polymorphism confers susceptibility to ankylosing spondylitis Ann Rheum Dis, October 1, 2008; 67(10): 1451 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Y Patel, R Doffinger, G Barcenas-Morales, and D S Kumararatne Genetically determined susceptibility to mycobacterial infection J. Clin. Pathol., September 1, 2008; 61(9): 1006 - 1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Ma, G. Y.J. Chew, N. Simpson, A. Priyadarshi, M. Wong, B. Grimbacher, D. A. Fulcher, S. G. Tangye, and M. C. Cook Deficiency of Th17 cells in hyper IgE syndrome due to mutations in STAT3 J. Exp. Med., July 7, 2008; 205(7): 1551 - 1557. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-J. Kim, J.-I. Youn, S.-H. Seo, H.-T. Jin, and Y.-C. Sung Differential Regulation of Antigen-Specific CD8+ T Cell Responses by IL-12p40 in a Dose-Dependent Manner J. Immunol., June 1, 2008; 180(11): 7167 - 7174. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muhlbauer, P. M. Chilton, T. C. Mitchell, and C. Jobin Impaired Bcl3 Up-regulation Leads to Enhanced Lipopolysaccharide-induced Interleukin (IL)-23P19 Gene Expression in IL-10-/- Mice J. Biol. Chem., May 23, 2008; 283(21): 14182 - 14189. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Rachitskaya, A. M. Hansen, R. Horai, Z. Li, R. Villasmil, D. Luger, R. B. Nussenblatt, and R. R. Caspi Cutting Edge: NKT Cells Constitutively Express IL-23 Receptor and ROR{gamma}t and Rapidly Produce IL-17 upon Receptor Ligation in an IL-6-Independent Fashion J. Immunol., April 15, 2008; 180(8): 5167 - 5171. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Y. Cheung, C. K. Wong, and C. W. K. Lam Molecular Mechanisms of Cytokine and Chemokine Release from Eosinophils Activated by IL-17A, IL-17F, and IL-23: Implication for Th17 Lymphocytes-Mediated Allergic Inflammation J. Immunol., April 15, 2008; 180(8): 5625 - 5635. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tanaka, K. Ichiyama, M. Hashimoto, H. Yoshida, T. Takimoto, G. Takaesu, T. Torisu, T. Hanada, H. Yasukawa, S. Fukuyama, et al. Loss of Suppressor of Cytokine Signaling 1 in Helper T Cells Leads to Defective Th17 Differentiation by Enhancing Antagonistic Effects of IFN-{gamma} on STAT3 and Smads J. Immunol., March 15, 2008; 180(6): 3746 - 3756. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Huber, E. M. Jacobson, K. Jazdzewski, E. S. Concepcion, and Y. Tomer Interleukin (IL)-23 Receptor Is a Major Susceptibility Gene for Graves' Ophthalmopathy: The IL-23/T-helper 17 Axis Extends to Thyroid Autoimmunity J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 1077 - 1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Ruby, R. Montler, R. Zheng, S. Shu, and A. D. Weinberg IL-12 Is Required for Anti-OX40-Mediated CD4 T Cell Survival J. Immunol., February 15, 2008; 180(4): 2140 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukata, K. Breglio, A. Chen, A. S. Vamadevan, T. Goo, D. Hsu, D. Conduah, R. Xu, and M. T. Abreu The Myeloid Differentiation Factor 88 (MyD88) Is Required for CD4+ T Cell Effector Function in a Murine Model of Inflammatory Bowel Disease J. Immunol., February 1, 2008; 180(3): 1886 - 1894. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mise-Omata, E. Kuroda, J. Niikura, U. Yamashita, Y. Obata, and T. S. Doi A Proximal {kappa}B Site in the IL-23 p19 Promoter Is Responsible for RelA- and c-Rel-Dependent Transcription J. Immunol., November 15, 2007; 179(10): 6596 - 6603. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rider, A. Shatrova, E. P. Feener, L. Webb, and M. Diakonova JAK2 Tyrosine Kinase Phosphorylates PAK1 and Regulates PAK1 Activity and Functions J. Biol. Chem., October 19, 2007; 282(42): 30985 - 30996. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kohyama, S. Ohno, A. Isoda, O. Moriya, M. L. Belladonna, H. Hayashi, Y. Iwakura, T. Yoshimoto, T. Akatsuka, and M. Matsui IL-23 Enhances Host Defense against Vaccinia Virus Infection Via a Mechanism Partly Involving IL-17 J. Immunol., September 15, 2007; 179(6): 3917 - 3925. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-L. Liu, C.-H. Chen, S.-J. Chu, J.-H. Chen, J.-H. Lai, H.-K. Sytwu, and D.-M. Chang Interleukin (IL)-23 p19 expression induced by IL-1{beta} in human fibroblast-like synoviocytes with rheumatoid arthritis via active nuclear factor-{kappa}B and AP-1 dependent pathway Rheumatology, August 1, 2007; 46(8): 1266 - 1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tokumasa, A. Suto, S.-i. Kagami, S. Furuta, K. Hirose, N. Watanabe, Y. Saito, K. Shimoda, I. Iwamoto, and H. Nakajima Expression of Tyk2 in dendritic cells is required for IL-12, IL-23, and IFN-{gamma} production and the induction of Th1 cell differentiation Blood, July 15, 2007; 110(2): 553 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kaiga, M. Sato, H. Kaneda, Y. Iwakura, T. Takayama, and H. Tahara Systemic Administration of IL-23 Induces Potent Antitumor Immunity Primarily Mediated through Th1-Type Response in Association with the Endogenously Expressed IL-12 J. Immunol., June 15, 2007; 178(12): 7571 - 7580. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. L. Rudner, K. I. Happel, E. A. Young, and J. E. Shellito Interleukin-23 (IL-23)-IL-17 Cytokine Axis in Murine Pneumocystis carinii Infection Infect. Immun., June 1, 2007; 75(6): 3055 - 3061. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Mathur, H.-C. Chang, D. G. Zisoulis, G. L. Stritesky, Q. Yu, J. T. O'Malley, R. Kapur, D. E. Levy, G. S. Kansas, and M. H. Kaplan Stat3 and Stat4 Direct Development of IL-17-Secreting Th Cells J. Immunol., April 15, 2007; 178(8): 4901 - 4907. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Jung, J. S. Lee, Y. J. Kim, Y.-I. Jeong, C.-M. Lee, T. Baumruker, A. Billlich, Y. Banno, M. G. Lee, S.-C. Ahn, et al. Sphingosine kinase inhibitor suppresses a Th1 polarization via the inhibition of immunostimulatory activity in murine bone marrow-derived dendritic cells Int. Immunol., April 1, 2007; 19(4): 411 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. O. Yang, A. D. Panopoulos, R. Nurieva, S. H. Chang, D. Wang, S. S. Watowich, and C. Dong STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells J. Biol. Chem., March 30, 2007; 282(13): 9358 - 9363. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Hildner, P. Schirmacher, I. Atreya, M. Dittmayer, B. Bartsch, P. R. Galle, S. Wirtz, and M. F. Neurath Targeting of the Transcription Factor STAT4 by Antisense Phosphorothioate Oligonucleotides Suppresses Collagen-Induced Arthritis J. Immunol., March 15, 2007; 178(6): 3427 - 3436. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Umemura, A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, et al. IL-17-Mediated Regulation of Innate and Acquired Immune Response against Pulmonary Mycobacterium bovis Bacille Calmette-Guerin Infection J. Immunol., March 15, 2007; 178(6): 3786 - 3796. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Wozniak, A. A. Ryan, and W. J. Britton Interleukin-23 Restores Immunity to Mycobacterium tuberculosis Infection in IL-12p40-Deficient Mice and Is Not Required for the Development of IL-17-Secreting T Cell Responses J. Immunol., December 15, 2006; 177(12): 8684 - 8692. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Duerr, K. D. Taylor, S. R. Brant, J. D. Rioux, M. S. Silverberg, M. J. Daly, A. H. Steinhart, C. Abraham, M. Regueiro, A. Griffiths, et al. A Genome-Wide Association Study Identifies IL23R as an Inflammatory Bowel Disease Gene Science, December 1, 2006; 314(5804): 1461 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Chan, W. Blumenschein, E. Murphy, C. Diveu, M. Wiekowski, S. Abbondanzo, L. Lucian, R. Geissler, S. Brodie, A. B. Kimball, et al. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis J. Exp. Med., November 27, 2006; 203(12): 2577 - 2587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Kullberg, D. Jankovic, C. G. Feng, S. Hue, P. L. Gorelick, B. S. McKenzie, D. J. Cua, F. Powrie, A. W. Cheever, K. J. Maloy, et al. IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis J. Exp. Med., October 30, 2006; 203(11): 2485 - 2494. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Mathur, H.-C. Chang, D. G. Zisoulis, R. Kapur, M. L. Belladonna, G. S. Kansas, and M. H. Kaplan T-bet is a critical determinant in the instability of the IL-17-secreting T-helper phenotype Blood, September 1, 2006; 108(5): 1595 - 1601. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, N. Chu, A. Rostami, and G.-X. Zhang Dendritic Cells Transduced with SOCS-3 Exhibit a Tolerogenic/DC2 Phenotype That Directs Type 2 Th Cell Differentiation In Vitro and In Vivo J. Immunol., August 1, 2006; 177(3): 1679 - 1688. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Fahey, R. A. Robins, K. B. Kindle, D. M. Heery, and C. S. Constantinescu Effects of glucocorticoids on STAT4 activation in human T cells are stimulus-dependent J. Leukoc. Biol., July 1, 2006; 80(1): 133 - 144. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Oniki, H. Nagai, T. Horikawa, J. Furukawa, M. L. Belladonna, T. Yoshimoto, I. Hara, and C. Nishigori Interleukin-23 and interleukin-27 exert quite different antitumor and vaccine effects on poorly immunogenic melanoma. Cancer Res., June 15, 2006; 66(12): 6395 - 6404. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, A. Laurence, Y. Kanno, M. Pacher-Zavisin, B.-M. Zhu, C. Tato, A. Yoshimura, L. Hennighausen, and J. J. O'Shea Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells PNAS, May 23, 2006; 103(21): 8137 - 8142. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Overwijk, K. E. de Visser, F. H. Tirion, L. A. de Jong, T. W. H. Pols, Y. U. van der Velden, J. G. van den Boorn, A. M. Keller, W. A. Buurman, M. R. Theoret, et al. Immunological and Antitumor Effects of IL-23 as a Cancer Vaccine Adjuvant J. Immunol., May 1, 2006; 176(9): 5213 - 5222. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. Cho, J.-W. Kang, Y.-M. Moon, H.-J. Nam, J.-Y. Jhun, S.-B. Heo, H.-T. Jin, S.-Y. Min, J.-H. Ju, K.-S. Park, et al. STAT3 and NF-{kappa}B Signal Pathway Is Required for IL-23-Mediated IL-17 Production in Spontaneous Arthritis Animal Model IL-1 Receptor Antagonist-Deficient Mice J. Immunol., May 1, 2006; 176(9): 5652 - 5661. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O Huising, C. P Kruiswijk, and G. Flik Phylogeny and evolution of class-I helical cytokines. J. Endocrinol., April 1, 2006; 189(1): 1 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lai, R. A. Zeff, and I. Goldschneider A recombinant single-chain IL-7/HGFbeta hybrid cytokine induces juxtacrine interactions of the IL-7 and HGF (c-Met) receptors and stimulates the proliferation of CFU-S12, CLPs, and pre-pro-B cells Blood, March 1, 2006; 107(5): 1776 - 1784. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Kleinschek, U. Muller, S. J. Brodie, W. Stenzel, G. Kohler, W. M. Blumenschein, R. K. Straubinger, T. McClanahan, R. A. Kastelein, and G. Alber IL-23 Enhances the Inflammatory Cell Response in Cryptococcus neoformans Infection and Induces a Cytokine Pattern Distinct from IL-12 J. Immunol., January 15, 2006; 176(2): 1098 - 1106. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Wozniak, A. A. Ryan, J. A. Triccas, and W. J. Britton Plasmid Interleukin-23 (IL-23), but Not Plasmid IL-27, Enhances the Protective Efficacy of a DNA Vaccine against Mycobacterium tuberculosis Infection Infect. Immun., January 1, 2006; 74(1): 557 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kidoya, M. Umemura, T. Kawabe, G. Matsuzaki, A. Yahagi, R. Imamura, and T. Suda Fas Ligand Induces Cell-Autonomous IL-23 Production in Dendritic Cells, a Mechanism for Fas Ligand-Induced IL-17 Production J. Immunol., December 15, 2005; 175(12): 8024 - 8031. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Drakes, T. G. Blanchard, and S. J. Czinn Colon lamina propria dendritic cells induce a proinflammatory cytokine response in lamina propria T cells in the SCID mouse model of colitis J. Leukoc. Biol., December 1, 2005; 78(6): 1291 - 1300. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Happel, P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, et al. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae J. Exp. Med., September 19, 2005; 202(6): 761 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. I. Rutitzky, J. R. Lopes da Rosa, and M. J. Stadecker Severe CD4 T Cell-Mediated Immunopathology in Murine Schistosomiasis Is Dependent on IL-12p40 and Correlates with High Levels of IL-17 J. Immunol., September 15, 2005; 175(6): 3920 - 3926. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Happel, E. A. Lockhart, C. M. Mason, E. Porretta, E. Keoshkerian, A. R. Odden, S. Nelson, and A. J. Ramsay Pulmonary Interleukin-23 Gene Delivery Increases Local T-Cell Immunity and Controls Growth of Mycobacterium tuberculosis in the Lungs Infect. Immun., September 1, 2005; 73(9): 5782 - 5788. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Khader, J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper IL-23 Compensates for the Absence of IL-12p70 and Is Essential for the IL-17 Response during Tuberculosis but Is Dispensable for Protection and Antigen-Specific IFN-{gamma} Responses if IL-12p70 Is Available J. Immunol., July 15, 2005; 175(2): 788 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Schuetze, S. Schoeneberger, U. Mueller, M. A. Freudenberg, G. Alber, and R. K. Straubinger IL-12 family members: differential kinetics of their TLR4-mediated induction by Salmonella Enteritidis and the impact of IL-10 in bone marrow-derived macrophages Int. Immunol., May 1, 2005; 17(5): 649 - 659. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Arsenescu, A. M. Blum, A. Metwali, D. E. Elliott, and J. V. Weinstock IL-12 Induction of mRNA Encoding Substance P in Murine Macrophages from the Spleen and Sites of Inflammation J. Immunol., April 1, 2005; 174(7): 3906 - 3911. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schnurr, T. Toy, A. Shin, M. Wagner, J. Cebon, and E. Maraskovsky Extracellular nucleotide signaling by P2 receptors inhibits IL-12 and enhances IL-23 expression in human dendritic cells: a novel role for the cAMP pathway Blood, February 15, 2005; 105(4): 1582 - 1589. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bettelli and V. K. Kuchroo IL-12- and IL-23-induced T helper cell subsets: birds of the same feather flock together J. Exp. Med., January 18, 2005; 201(2): 169 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun, M. Walsh, A. V. Villarino, L. Cervi, C. A. Hunter, Y. Choi, and E. J. Pearce TLR Ligands Can Activate Dendritic Cells to Provide a MyD88-Dependent Negative Signal for Th2 Cell Development J. Immunol., January 15, 2005; 174(2): 742 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fairweather, S. Frisancho-Kiss, S. A. Yusung, M. A. Barrett, S. E. Davis, R. A. Steele, S. J. L. Gatewood, and N. R. Rose IL-12 Protects against Coxsackievirus B3-Induced Myocarditis by Increasing IFN-{gamma} and Macrophage and Neutrophil Populations in the Heart J. Immunol., January 1, 2005; 174(1): 261 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Salcedo, J. K. Stauffer, E. Lincoln, T. C. Back, J. A. Hixon, C. Hahn, K. Shafer-Weaver, A. Malyguine, R. Kastelein, and J. M. Wigginton IL-27 Mediates Complete Regression of Orthotopic Primary and Metastatic Murine Neuroblastoma Tumors: Role for CD8+ T Cells J. Immunol., December 15, 2004; 173(12): 7170 - 7182. [Abstract] [Full Text] [PDF] |
||||
![]() |
J J O'Shea Targeting the Jak/STAT pathway for immunosuppression Ann Rheum Dis, November 1, 2004; 63(suppl_2): ii67 - ii71. [Full Text] [PDF] |
||||
![]() |
C. Fieschi, M. Bosticardo, L. de Beaucoudrey, S. Boisson-Dupuis, J. Feinberg, O. F. Santos, J. Bustamante, J. Levy, F. Candotti, and J.-L. Casanova A novel form of complete IL-12/IL-23 receptor {beta}1 deficiency with cell surface-expressed nonfunctional receptors Blood, October 1, 2004; 104(7): 2095 - 2101. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Morinobu, Y. Kanno, and J. J. O'Shea Discrete Roles for Histone Acetylation in Human T Helper 1 Cell-specific Gene Expression J. Biol. Chem., September 24, 2004; 279(39): 40640 - 40646. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Z. Wang, Y.-X. Bao, C. L. Rosenberger, Y. Tesfaigzi, J. M. Stark, and K. S. Harrod IL-12p40 and IL-18 Modulate Inflammatory and Immune Responses to Respiratory Syncytial Virus Infection J. Immunol., September 15, 2004; 173(6): 4040 - 4049. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsui, O. Moriya, M. L. Belladonna, S. Kamiya, F. A. Lemonnier, T. Yoshimoto, and T. Akatsuka Adjuvant Activities of Novel Cytokines, Interleukin-23 (IL-23) and IL-27, for Induction of Hepatitis C Virus-Specific Cytotoxic T Lymphocytes in HLA-A*0201 Transgenic Mice J. Virol., September 1, 2004; 78(17): 9093 - 9104. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wassink, P. L. Vieira, H. H. Smits, G. A. Kingsbury, A. J. Coyle, M. L. Kapsenberg, and E. A. Wierenga ICOS Expression by Activated Human Th Cells Is Enhanced by IL-12 and IL-23: Increased ICOS Expression Enhances the Effector Function of Both Th1 and Th2 Cells J. Immunol., August 1, 2004; 173(3): 1779 - 1786. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |