The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parham, C.
Right arrow Articles by Moore, K. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parham, C.
Right arrow Articles by Moore, K. W.
The Journal of Immunology, 2002, 168: 5699-5708.
Copyright © 2002 by The American Association of Immunologists

A Receptor for the Heterodimeric Cytokine IL-23 Is Composed of IL-12R{beta}1 and a Novel Cytokine Receptor Subunit, IL-23R1

Christi Parham2,3,*, Madaline Chirica2,*, Jacqueline Timans{dagger}, Elena Vaisberg*, Marilyn Travis*, Jeanne Cheung*, Stefan Pflanz{dagger}, Rebecca Zhang{dagger}, Komal P. Singh*, Felix Vega{dagger}, Wayne To{dagger}, Janet Wagner{dagger}, Anne-Marie O’Farrell4,*, Terrill McClanahan{ddagger}, Sandra Zurawski{dagger}, Charles Hannum{dagger}, Daniel Gorman{dagger}, Donna M. Rennick*, Robert A. Kastelein{dagger}, Rene de Waal Malefyt* and Kevin W. Moore5,*

Departments of * Immunology, {dagger} Molecular Biology, and {ddagger} Molecular Pathology, DNAX Research, Palo Alto, CA 94304


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-23 is a heterodimeric cytokine composed of the IL-12p40 "soluble receptor" subunit and a novel cytokine-like subunit related to IL-12p35, termed p19. Human and mouse IL-23 exhibit some activities similar to IL-12, but differ in their capacities to stimulate particular populations of memory T cells. Like IL-12, IL-23 binds to the IL-12R subunit IL-12R{beta}1. However, it does not use IL-12R{beta}2. In this study, we identify a novel member of the hemopoietin receptor family as a subunit of the receptor for IL-23, "IL-23R." IL-23R pairs with IL-12R{beta}1 to confer IL-23 responsiveness on cells expressing both subunits. Human IL-23, but not IL-12, exhibits detectable affinity for human IL-23R. Anti-IL-12R{beta}1 and anti-IL-23R Abs block IL-23 responses of an NK cell line and Ba/F3 cells expressing the two receptor chains. IL-23 activates the same Jak-stat signaling molecules as IL-12: Jak2, Tyk2, and stat1, -3, -4, and -5, but stat4 activation is substantially weaker and different DNA-binding stat complexes form in response to IL-23 compared with IL-12. IL-23R associates constitutively with Jak2 and in a ligand-dependent manner with stat3. The ability of cells to respond to IL-23 or IL-12 correlates with expression of IL-23R or IL-12R{beta}2, respectively. The human IL-23R gene is on human chromosome 1 within 150 kb of IL-12R{beta}2.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The growth, differentiation, and function of cells in the immune system are regulated by an array of soluble proteins termed cytokines. Cytokines can be classified into several protein families whose members share structural homology, e.g., the TNF family, IL-1 and related proteins, and hemopoietic cytokines. The latter family is a large group of cytokines that have a four {alpha}-helical bundle structure and collectively play important and varied roles in immune regulation.

IL-23 is a covalently linked heterodimeric hemopoietic cytokine that shares the p40 (soluble cytokine receptor-like) subunit of IL-12 but is distinguished from the latter by its cytokine subunit, p19 (1). IL-23-like IL-12 induces proliferation and IFN-{gamma} production by human T cells. In contrast to IL-12, IL-23 preferentially stimulates memory as opposed to naive T cell populations in both human and mouse (1). Transgenic mice ubiquitously expressing the p19 subunit of IL-23 develop a severe multiorgan inflammatory syndrome with elevated expression levels of TNF and IL-1 (2), suggesting direct or indirect effects on myeloid cells as well as NK and T cells. This pathology can be transferred with transgenic bone marrow, suggesting that the principal source of the proinflammatory mediator (IL-23) is hemapoietic cells (2).

Consistent with the structural and biological similarities of IL-12 and IL-23, the IL-23R complex shares a subunit with that of IL-12 (IL-12R{beta}1); however, it does not use or detectably bind to IL-12R{beta}2 (1). To facilitate a more detailed understanding of IL-23’s function, we have identified and characterized an additional subunit of the IL-23R complex, termed "IL-23R." In this study, we show that IL-23R is a novel member of the hemopoietin receptor superfamily encoded by a gene that maps within 150 kb of the gene for IL-12R{beta}2 on human chromosome 1. IL-23 uses the same Jak-stat signaling molecules as IL-12, and IL-23R associates with Jak2 and stat3. The ability of cells to respond to either IL-12 or IL-23 is determined by expression of IL-12R{beta}2 or IL-23R, respectively.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokines

Human (h)6 IL-12 and mouse (m)IL-12 were purchased from R&D Systems (Minneapolis, MN). rhIL-23 and rmIL-23 were covalently linked fusion proteins (3) containing FLAG epitope tags as described (1).

Antibodies

Goat anti-hIL-12R{beta}1 was from R&D Systems. Anti-FLAG epitope Abs were from Sigma-Aldrich (St. Louis, MO). Rabbit anti-hIL-23R anti-serum was prepared by immunizing rabbits (Josman LLC, Napa, CA) with rIL-23R extracellular domain containing C-terminal V5 (Invitrogen, Carlsbad, CA) and His6 epitope tags (soluble (s)hIL-23R-V5-His6). Rabbit IgG fraction was prepared from serum by caprylic acid precipitation (4). hIL-23R-specific Ab was purified by absorption and elution from an affinity column containing rhIL-23R extracellular domain fused to the Fc region of hIgG1 (hIL-23R-Ig).

Cells and cell lines

The hIL-2-dependent T cell line Kit225 (5) which binds and responds to IL-12 (6, 7) was kindly provided by Dr. J. Johnston (DNAX, Palo Alto, CA). mIL-3-dependent Ba/F3 cells were as described (1, 8). Human PHA blast preparation was as described (1).

Human T cell clone 37 was derived from CD4+CD45RA+ peripheral blood T cells following two rounds of activation by anti-CD3 cross-linked on L cells expressing CD32, CD80, and CD58 in the presence of IL-2 (20 U/ml; R&D Systems) and IL-12 (1 ng/ml; R&D Systems). This population of cells was subsequently cloned by limiting dilution using PHA and feeder cells (9). T cell clone 37 has a Th1 phenotype. The human NK leukemic cell line NKL (10) was cultured in Yssel’s medium supplemented with 1% human serum and 100 U/ml IL-2.

NKL assay

NKL cells (2 x 105 cells/well) were incubated in 200 µl Yssel’s medium in the absence or presence of IL-2 (200 U/ml), IL-12 (1 ng/ml), IL-18 (100 ng/ml), and IL-23 (100 ng/ml) either alone or in specified combinations for 72 h. Supernatants were harvested and the amount of IFN-{gamma} determined by specific ELISA (R&D Systems).

BALB/c bone marrow-derived macrophages

BALB/c bone marrow-derived macrophages were cultured for 10 days in GM-CSF (40 ng/ml) + anti-mIL-10R (1 µg/ml). On day 10, cultures were stimulated for 24 h under each of the following conditions: anti-IL-10R + IFN-{gamma} (5 ng/ml) + LPS (10 µg/ml), anti-IL-10R + IFN-{gamma}, anti-IL-10R + LPS, and anti-IL-10R only.

cDNA libraries and expression cloning of hIL-23R

Total cellular RNA was isolated by lysis of cells in guanidinium isothiocyanate and centrifugation through a CsCl pad. Poly(A)+ mRNA was selected using an Oligotex mRNA kit (Qiagen, Valencia, CA). Retroviral expression cDNA libraries were prepared in the pMX expression vector (11) using the Superscript RT cDNA library kit (Life Technologies, Rockville, MD). Retrovirus was generated from cDNA libraries via transient transfection of BOSC23 cells as described (12) and used to infect 107 Ba/F3 cells expressing hIL-12R{beta}1 (1) for 24–48 h on petri dishes coated with 30 µg/ml recombinant fibronectin fragments (Retronectin; Takara Bio, Shiga, Japan). Infection efficiencies of 80–98% were regularly obtained. Infected cells were cultured in mIL-3 for 2–3 days, then washed three times to remove mIL-3, plated at 1.2–1.5 x 104 cells/well in 96-well plates in medium containing 50 ng/ml hIL-23, and allowed to grow for 2 wk. Cultures were supplemented with fresh hIL-23-containing medium every 4–5 days. Cells growing in the presence of hIL-23 were tested for hIL-23-dependent proliferation in an assay using Alamar Blue (Trek Diagnostic Systems, Westlake, OH) as described (1, 8). Genomic DNA was isolated (DNeasy Tissue kit; Qiagen) from hIL-23-dependent cell lines and subjected to PCR amplification using pMX vector-specific primers (11) (5'-CCCGGGGGTGGACCATCCTCT-3' and 5'-CTACAGGTGGGGTCTTTCATTCC-3'), followed by another round of amplification using a second, "nested" set of pMX vector primers (5'-TTGGATACACGCCGCCCACGTGAAGGCTGCCGA-3' and 5'-CTTTTATTTTATCGTCGACCACTGTGCTGGC-3'). High m.w. (>2 kb) PCR products were cloned in pCR2.1-TOPO (Invitrogen) and sequenced.

A candidate hIL-23R cDNA identified by this method (see Results) was used to screen Kit225 and human NK cell cDNA libraries by hybridization and several of the resulting full-length hIL-23R cDNAs were subcloned in pMX containing a puromycin resistance gene (pMX-puro; Ref. 11). Retrovirus was generated and used to infect Ba/F3-hIL-12R{beta}1 cells. Cells resistant to 2 µg/ml puromycin were tested for hIL-23-dependent growth.

hIL-23R and mIL-23R genomic genes and mIL-23R cDNA

The hIL-23R gene was determined to be closely linked to the gene encoding hIL-12R{beta}2 on chromosome 1p31.2-32.1 (see Results). Accordingly, we obtained mIL-12R{beta}2 bacterial artificial chromosome (BAC) genomic DNA clones from C57BL/6 and 129 ES cell genomic DNA libraries (Incyte Genomics, St. Louis, MO) by hybridization to an mIL-12R{beta}2 cDNA probe (1, 13). BAC DNAs were restricted and analyzed by pulsed-field electrophoresis (CHEF Mapper XA system; Bio-Rad, Richmond, CA) and DNA blot hybridization using either mIL-12R{beta}2 or hIL-23R cDNAs as probes. Restriction fragments hybridizing to the hIL-23R probe were subcloned and sequenced, allowing identification of several exons of the mIL-23R gene. PCR-amplified exons were used to probe a cDNA library derived from 7-day polarized mouse Th2 cells. Hybridizing clones were sequenced and full-length cDNAs transferred to pMX-puro for expression in Ba/F3 cells expressing rmIL-12R{beta}1 (1). Cells were assessed for responsiveness to mIL-23 and hIL-23 as described above.

Binding of IL-23 to cells and rIL-23R

Binding of IL-23 to cells expressing IL-12R{beta}1, IL-23R, or both IL-12R{beta}1 and IL-23R was detected by FACS staining using anti-FLAG or anti-p40 Abs as described (1). To detect this interaction by ELISA, plates were coated with 1 µg/ml hIL-23R-Ig, then incubated with various concentrations of hIL-23 or an irrelevant ligand (FLAG-hIL-10) in PBS + 10% FCS for 2 h at room temperature, followed by successive incubations with biotin-anti-FLAG (Sigma-Aldrich) and streptavidin-HRP (BD PharMingen, San Diego, CA).

Interaction of hIL-23 and the soluble extracellular domain of hIL-23R was also demonstrated by immunoprecipitation. shIL-23R-V5-His6 was expressed in 293T cells; similarly, FLAG-hp40 and FLAG-hp19 were coexpressed in 293T cells. The respective supernatants were combined for coprecipitation experiments and incubated overnight at 4°C. Immunoprecipitations were performed in the presence of 0.1% Brij96 using anti-FLAG-M2 agarose (Sigma-Aldrich) or Ni-NTA agarose (Qiagen). Precipitated proteins were separated by nonreducing SDS-PAGE and detected by Western blot using anti-FLAG-HRP (Sigma-Aldrich) or anti-V5-HRP (Invitrogen) Abs according to the manufacturer’s recommendations.

Quantitative PCR

A total of 50 ng of DNA from various cDNA libraries was analyzed for expression of hIL-23R or mIL-23R by the flourogenic 5'-nuclease PCR assay using the ABI Prism 7700 Sequence Detection System (PerkinElmer, Foster City, CA) as described (1). The following primer and probes were used: hIL-23R, forward: CGCAAAACTCGCTATTCGACA, reverse: ATGGCTTCCCTCAGGCAGA, probe: 6-carboxyfluorescein-TTCCTGATCTCAACACTGGATATAAACCCCAA-6-carboxytetramethylrhodamine; hIL-12R{beta}1, forward: GCATCGAAGTGCAGGTTTCTG, reverse: CACGAGAAGGATGCTCAGGAA, probe: 6FAM-TGGCTCATCTTCTTCGCCTCCCTG-TAMRA; hIL-12R{beta}2, forward: AAGACACAGCTGCCCTTGGA, reverse: TGACCAGCGGTTCAGGATCT, probe: 6FAM-CTCCTGATAGACTGGCCCACGCCTG-TAMRA; mIL-23R, forward: TGAAAGAGACCCTACATCCCTTGA, reverse: CAGAAAATTGGAAGTTGGGATATGTT, probe: 6FAM-ACCACAGATGACCACTTTGCCAGATTGA-TAMRA; and mIL-12R{beta}2, forward: GATCTCAGTTGGTGTTGCTCCA, reverse: GGCCACAGTTCCATTTTCTCC, probe: 6FAM-AGCCACCTCAAAACATATCATGTGTCCAGG-TAMRA. Probes for Taqman analysis were obtained as Molecular Beacons from Synthetic Genetics (San Diego, CA) or from PerkinElmer. Analysis of RT-cDNA samples from cultured cells was corrected for expression of 18S rRNA using a VIC-labeled probe (PerkinElmer) in multiplex reactions.

Signal transduction assays

Abs used in immunoprecipitation were obtained from Upstate Biotechnology (Lake Placid, NY), Santa Cruz Biotechnology (Santa Cruz, CA), BD PharMingen, or New England Biolabs (Beverly, MA). Cells grown to log phase were serum-starved for 4–6 h in RPMI 1640 + 0.5% BSA. Cells were centrifuged and resuspended to 2–4 x 107 cells/ml and stimulated with cytokine for 10 min at 37°C. After incubation, cells were centrifuged and washed in PBS + 1.5 mM sodium vanadate, then lysed in Brij buffer (10 mM Tris (pH 7.5), 2 mM EDTA, 0.15 M NaCl, 0.875% Brij 97 (Sigma-Aldrich)), 0.125% NP-40, complete protease inhibitors (Roche, Indianapolis, IN), and 3 mM Pefabloc protease inhibitor (Roche). Lysates were centrifuged and supernatants were either immunoprecipitated or prepared for SDS-PAGE by addition of of reducing NuPAGE LDS loading buffer (Invitrogen). For immunoprecipitation, 2 µg Ab and 50 µl of protein A agarose beads (Sigma-Aldrich) were added to each reaction. Tubes were agitated at 4°C for 2–24 h. Following washes with Brij buffer and PBS, beads were resuspended in PBS wash buffer with reducing NuPAGE LDS loading buffer. Lysates or immunoprecipitates were subjected to 4–12% NuPAGE SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA) per manufacturer’s recommendations. Membranes were blocked in 3% BSA/TBST (for anti-phosphotyrosine blots) or 5% milk blocking buffer. Membranes were first probed with anti-phosphotyrosine (4G10; Upstate Biotechnology), and then stripped and reprobed for STAT 1,2,3,4 (BD Transduction Laboratories, Lexington, KY), STAT 5,6 (Santa Cruz Biotechnology), or Jak1 (BD Transduction Laboratories,), Jak2 (Upstate Biotechnology or Santa Cruz Biotechnology), or Jak3 or Tyk2 (Santa Cruz Biotechnology) as appropriate.

Receptor coimmunoprecipitation experiments were done as described above, using Kit225, or Ba/F3 transfected with hIL-12R{beta}1 and c-myc epitope-tagged hIL-23R. Lysates were immunoprecipitated with rabbit anti-shIL-23R-V5-His6. Western blots were probed with anti-c-myc, rat anti-hIL-23R polyclonal Ab (provided by T. Churakova, DNAX), or anti-Jak/Stat Abs as described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Kit225 cells respond to both IL-12 and IL-23

Kit225 is a human T cell line that proliferates in response to IL-2 and IL-12 (5, 14, 15, 16). Although Kit225 cells readily lost growth factor dependence in culture and were thus not suitable for routine cytokine bioassays, we nonetheless demonstrated a proliferative response to IL-23 (Fig. 1Go).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 1. Kit225 cells respond to IL-23. Error bars represent the range of duplicate measurements.

 
Expression cloning of hIL-23R

We prepared cDNA libraries from Kit225, human PHA blasts (1), and human T cell clone 37 in the retroviral expression vector pMX. Ba/F3 cells expressing hIL-12R{beta}1 were infected with cDNA library retrovirus and then allowed to grow in mIL-3 for 48–72 h. The resulting cells were washed, distributed at 1–1.5 x 104/well in 96-well plates, and cultured in hIL-23. Individual cell cultures growing in the presence of hIL-23 were analyzed for hIL-23-dependent growth. Genomic DNA from hIL-23-dependent cells was subjected to two rounds of PCR amplification with vector-specific primers; amplified cDNAs >=2 kb were subcloned and sequenced. Among these subclones we identified a 2.9-kb cDNA encoding a 629-aa type I transmembrane protein with homology to cytokine receptors; its closest relatives appeared to be IL-12R{beta}2 (Fig. 2Goa) and gp130 (data not shown). Retrospective PCR analysis of IL-23-dependent cell lines isolated from screens of all three cDNA libraries revealed that 51/54 such cell lines harbored integrated retrovirus containing this "hIL-23R" cDNA insert.



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 2. Structure of a receptor complex for IL-23. a, Alignment of amino acid sequences of hIL-23R, mIL-23R, and hIL-12R{beta}2. Only the Ig-like and cytokine receptor domains of hIL-12R{beta}2 are shown. Predicted signal sequences, the WSXWS boxes, and transmembrane domains are indicated by black boxes. Potential N-linked glycosylation sites are indicated by dark red boxes and potential Src homology 2 domain binding sites by blue boxes. b, Schematic of receptors for IL-12 and IL-23. Ig-like domains are shown in light gray, cytokine receptor domains in white, and fibronectin type III domains in dark gray. The WSXWS box motif is indicated by the thick black line and conserved cysteine residues by thin black lines. IL-23R cDNA sequences have been deposited in the GenBank database with accession numbers AF461422 (hIL-23R) and AF461423 (mIL-23R).

 
To confirm function as a receptor for hIL-23, candidate hIL-23R cDNAs were expressed in Ba/F3-hIL-12R{beta}1 cells, and the resulting cells tested for growth in hIL-23. Ba/F3 cells expressing both hIL-12R{beta}1 and IL-23R ("8c"), but not the individual subunits, responded to hIL-23 (Fig. 3Goa) and mIL-23 (data not shown). This response could be inhibited by anti-hIL-12R{beta}1 (Fig. 3Gob) and affinity-purified rabbit anti-hIL-23R Abs (Fig. 3Goc). Moreover, the response of human NKL cells to hIL-23 was also inhibited by anti-hIL-12R{beta}1 and anti-hIL-23R Abs (Fig. 3God).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 3. IL-23R is required for cellular responses to IL-23. a, Ba/F3-hIL-12R{beta}1/hIL-23R (8c) cells respond to hIL-23. Inhibition of 8c response to IL-23 by anti-hIL-12R{beta}1 (b) and anti-hIL-23R (c). d, Anti-hIL-23R and anti-hIL-12R{beta}1 inhibit the response of human NKL cells to IL-23. e, Ba/F3-mIL-12R{beta}1/mIL-23R cells respond to m,hIL-23. Error bars represent the range of duplicate measurements.

 
Human and mouse genomic IL-23R genes

A basic local alignment search tool search of the high-throughput genomic (HTG) database located the hIL-23R gene on human chromosome 1 (1p31.2-32.1) on the same 151-kb segment as hIL-12R{beta}2. Using sequence derived from several HTG entries, we assembled what appears to be the complete hIL-23R gene structure (Table IGo). The hIL-23R ORF is encoded by 10 exons spanning ~92 kb of human genomic DNA.


View this table:
[in this window]
[in a new window]
 
Table I. Exon and intron distribution of the hIL-23R gene on human chromosome 1. The complete hIL-23R genomic sequence was assembled from the following HTG entries: AC026054, AL109843, AL389925, AC068536, AC025693, and AL358512

 
To obtain the mIL-23R genomic gene and cDNA, we isolated eight BAC genomic clones from two different libraries by hybridization to a mIL-12R{beta}2 cDNA. Two of eight BAC clones also hybridized to the hIL-23R probe. We subcloned and sequenced two HindIII fragments that hybridized to hIL-23R. These fragments contained mIL-23R exons corresponding to exons 8 and 10 of the hIL-23R gene.

PCR-amplified mIL-23R exons were then used to screen a cDNA library of BALB/c mouse 7-day Th2-polarized T cells; two full-length cDNA clones were obtained encoding identical 644-aa type I transmembrane proteins with 66% identity and 77% similarity to hIL-23R (Fig. 2Goa). DNA sequence homology was ~84% in the protein-coding regions (data not shown).

mIL-23R cDNA was expressed in Ba/F3 cells together with mIL-12R{beta}1 (1). Ba/F3 cells expressing both mIL12R{beta}1 and mIL-23R responded to IL-23 (Fig. 3Goe). Both mIL-23 and hIL-23 were active on mouse and human cells as reported earlier (1) and on cells expressing the respective rIL-12R{beta}1/IL-23R complexes (Fig. 3Goe).

Structure of IL-23R

The extracellular domain of IL-23R contains a signal sequence, an N-terminal Ig-like domain and two cytokine receptor domains (Fig. 2Go, a and b). The extracellular domains are all related to corresponding domains of IL-12R{beta}2 (Fig. 2Goa). In contrast to IL-12R{beta}2, IL-23R does not contain three transmembrane-proximal fibronectin type III domains. There are eight and seven potential N-linked glycosylation sites in mIL-23R and hIL-23R, respectively.

The transmembrane-proximal cytokine receptor domain of both mIL-23R and hIL-23R contains a sequence (WQPWS) similar to the cytokine receptor signature WSXWS motif. Interestingly, the mIL-23R cDNA sequence contains a 20-aa duplication including this motif. We also found this duplication in BAC genomic DNA clones (129 strain). Moreover, among eight mouse cDNA libraries from BALB/c and C57BL/6 that contained mIL-23R cDNAs, we found only mIL-23R cDNAs containing this duplication (data not shown). Thus, we conclude that the mIL-23R gene and protein contain this 20-aa duplication.

The 252-aa hIL-23R cytoplasmic domain contains seven tyrosine residues, six of which are conserved in mIL-23R (hIL-23R Y463 is not conserved). Three of these tyrosines define potential Src homology 2 domain-binding sites, Y399, Y484, and Y611 (Fig. 2Goa). The Y399EDI sequence is a potential SHP2 binding site (17) and Y611FPQ is a potential stat1 and stat3 binding site (18). The GY484KPQIS sequence resembles to a degree the motif in stat4 and IL-12R{beta}2 known to bind to stat4 (GYL/VPS; Refs. 19 and 20). Although it is difficult to discern a proline-rich region that would be predicted to bind a Jak kinase, IL-23R does associate with Jak2 (see Fig. 7Go).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 7. IL-23R signal transduction and association with signaling molecules. a and b, EMSA pattern of DNA-binding Stat transcription factor complexes induced by IL-12 and IL-23 in Kit225 and PHA blast cells. 32P-labeled double-stranded M67 SIE probe (5'-CATTTCCCGTAAATC-3') was used; cells were stimulated for 10 min with IL-12 or IL-23. c, IL-23R associates with IL-12R{beta}1 in the presence of IL-23, but not IL-12 in Kit225 cells; d, IL-23R associates constitutively with Jak2, inducibly with stat3, and is tyrosine-phosphorylated in response to IL-23 in Ba/F3 cells expressing hIL-12R{beta}1 and c-myc-epitope-tagged hIL-23R.

 
Interaction of IL-23 with IL-23R

Binding of hIL-23 to hIL-23R was readily detected by FACS analysis (Fig. 4Goa); hIL-12 did not bind to hIL-23R (data not shown) and hIL-23R did not associate with hIL-12R{beta}1 in the presence of hIL-12 (see Fig. 7Go). hIL-23 bound to shIL-23R-V5-His6 coated on ELISA plates (Fig. 4Gob). In addition, FLAG-hp19 and FLAG-hp40 expressed together in 293T cells could associate with shIL-23R-V5-His6 in solution (Fig. 4Goc).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 4. IL-23 binds to IL-23R. a, hIL-23 binds to both hIL-12R{beta}1 and hIL-23R individually expressed on Ba/F3 cells; b, Detection of hIL-23 binding to shIL-23R-V5-His6 by ELISA. Wells were coated with hIL-23R-Ig fusion protein or rFlt3 ligand (irrelevant receptor), incubated with varying concentrations of either hIL-23 or FLAG-hIL-10 (irrelevant ligand), and developed with detecting Abs and substrate as described in Materials and Methods. c, hIL-23 coimmunoprecipitates with shIL-23R-V5-His6.

 
We were unable to demonstrate ability of hIL-23R-Ig or shIL-23R-V5-His6 to act as effective antagonists of hIL-23 stimulation of 8c cells (data not shown), nor could we see evidence of these proteins’ ability to augment cytokine activity.

IL-23R expression

hIL-23R mRNA was expressed at levels too low to detect by RNA blot except in Kit225 cells which expressed a 2.8–3-kb hIL-23R mRNA (Fig. 5Goa), consistent with the size of the hIL-23R cDNA clone. Therefore, we analyzed expression of both hIL-23R and mIL-23R by quantitative real-time PCR (Taqman). hIL-23R mRNA is expressed by a human Th1 and Th0 clone as well as several NK cell lines and clones, including NKL (Fig. 5Gob). cDNA libraries prepared from several cultured monocyte and dendritic cell populations (Fig. 5Gob) expressed very low levels of hIL-23R. Relatively low but detectable hIL-23R mRNA levels were observed in EBV-transformed B cells and anti-CD3/anti-CD28/LPS-activated PBMC (Fig. 5Gob). This expression pattern was similar to that of hIL-12R{beta}2 (Fig. 5Goc). PBMC used in these experiments were activated for short time periods up to 24 h; higher receptor expression levels were seen at 48–72 h (data not shown). In addition, nine hIL-23R expressed sequence tags were found by basic local alignment search tool search; all were derived from a cDNA library of bone marrow from chronic myelogenous leukemia patient(s).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 5. Expression of IL-23R mRNA. a, RNA blot demonstrating 2.8 kb hIL-23R mRNA in Kit225 cells. b and c, hIL-23R, hIL-12R{beta}1, and hIL-12R{beta}2 Taqman expression profiles; d and e, mIL-23R, mIL-12R{beta}1, and mIL-12R{beta}2 Taqman expression profiles. f, Mouse bone marrow macrophages activated in the presence of anti-mIL-10R and IFN-{gamma} express both IL-12R{beta}1 and IL-23R mRNA. g, mIL-23R expression in murine CD4+CD45RBlow and CD4+CD45RBhigh T cells. Units are fg/100 ng cDNA in a–d and g; f, Expression levels are given relative to ubiquitin mRNA.

 
mIL-23R expression (Fig. 5Go, d and e) was detected in BALB/c 7-day polarized Th1 and Th2 cells and 3-wk polarized, activated Th2 cells and bone marrow dendritic cells. Neither the J774 macrophage cell line nor several mast cell lines expressed significant mIL-23R mRNA levels. These results suggest either a degree of difference in the expression patterns of hIL-23R and mIL-23R, or more likely that the respective human and mouse cell populations examined are not functionally equivalent.

Bone marrow macrophages activated by LPS in the presence of either IL-10 or neutralizing anti-IL-10R mAb (21) expressed mIL-23R, in contrast to peritoneal macrophages (Fig. 5God). However, these same cells expressed little or no detectable IL-12R{beta}1. Therefore, we examined IL-12R{beta}1 and IL-23R expression in these cells under different conditions and found that activation in the presence of anti-IL-10R mAb and IFN-{gamma} induced expression of both receptor subunits while in the presence of LPS IL-12R{beta}1 mRNA expression was not detected (Fig. 5Go, d–f). Our observation of IL-12R{beta}1 expression by monocyte/macrophage cells is consistent with a number of reports in the literature (22, 23, 24, 25, 26, 27, 28, 29).

mCD4+CD45RBlow memory T cells respond to IL-23 but relatively poorly or not at all to IL-12; in contrast, CD4+CD45RBhigh cells respond well to IL-12, but poorly to IL-23 (1). Therefore, we analyzed mIL-23R and mIL-12R{beta}2 expression in these cells. Consistent with these cells’ cytokine responses, CD4+CD45RBlow cells expressed IL-23R mRNA and low levels of IL-12R{beta}2, while CD4+CD45RBhigh cells expressed IL-12R{beta}2 and little or no detectable IL-23R (Fig. 5Gog).

Signal transduction in response to IL-23

In view of the structural and biological activity similarities exhibited by IL-23 and IL-12, we examined the Jak kinase and stat transcription factor molecules activated by IL-23. Previous work showed that IL-23, like IL-12, activates Stat4, although to a lesser extent (1). Results shown in Fig. 6Go, a–d, demonstrate that IL-23 activates the same spectrum of Jak/Stat molecules as IL-12 (30, 31, 32, 33, 34, 35, 36, 37): Jak2, Tyk2, and Stat1, -3, -4, and -5. However, Stat4 activation is notably weaker in response to IL-23 (Fig. 6Gob), and differences were also evident in EMSA experiments (Fig. 7Go, a and b). In contrast to IL-12, which induces a strong Stat4-containing EMSA band (33, 35, 38), IL-23 induces a heterogeneous set of at least three bands. In Kit225 cells, the top and bottom bands contain Stat3 and Stat1, respectively, as shown by "supershift" experiments. Stat5 was not detected with the M67 SIE oligonucleotide probe, as noted by others (39, 40). Ab supershift experiments suggested that the middle band, faintest of the three, may contain both Stat3 and Stat4. In PHA blast T cells (Fig. 7Gob) and NKL cells (data not shown), the composition of the three bands was somewhat different: as for Kit225 the prominent upper band contained Stat3, but the lower band contained Stat4, and the middle band clearly contained both Stat3 and Stat4. We could not reliably detect IL-23- or IL-12-induced Stat1 activation in PHA blasts and NKL cells.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 6. Jak/Stat signaling by IL-23R. a and b, IL-23 induces tyrosine phosphorylation of stat1, -3, and -4; c, IL-23 induces tyrosine phosphorylation of stat5; d, IL-23 induces tyrosine phosphorylation of tyrosine kinases Jak2 and Tyk2.

 
In the presence of IL-23, IL-23R can be immunoprecipitated in association with IL-12R{beta}1 (Fig. 7Goc). In addition, Jak2 and Stat3 physically associate with IL-23R, the latter in a ligand-dependent manner, and IL-23R itself is tyrosine-phosphorylated in response to IL-23 (Fig. 7God). Thus, like IL-12R{beta}2, IL-23R associates with Jak2. However, we were unable to consistently demonstrate association of Stat4 with IL-23R such as that reported for IL-12R{beta}2 (Refs. 19 and 20 ; data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have cloned and characterized a novel hemopoietic cytokine receptor that is a subunit of the receptor for IL-23, IL-23R. IL-23R and IL-12R{beta}1 together comprise the IL-23 receptor complex on IL-23-responsive cells, as evidenced by: 1) the proliferative response to IL-23 of cells expressing rIL-23R and rIL-12R{beta}1, and 2) the ability of anti-IL-23R Abs to block responses of cells to this cytokine (Fig. 3Go). Although we cannot rule out that the IL-23R complex contains yet an additional subunit, our findings so far do not support this possibility. IL-23R is a member of the hemopoietic cytokine receptor family related to IL-12R{beta}2 and gp130. However, unlike its close relatives, the IL-23R extracellular region does not contain three membrane-proximal fibronectin III-like domains; rather it contains one Ig-like domain and two cytokine receptor domains, similar to IL-6R{alpha}, IL-11R{alpha}, and CNTFR{alpha} (18, 41). The latter "short" cytokine receptor subunits generally provide little in the way of signal-transducing functions in the cytokine-receptor complex; IL-23R thus appears to be an exception in this regard. Mouse IL-23R contains a 20-aa duplication including the signature cytokine receptor WSXWS box (WQPWS, Fig. 2Goa). This duplication was present in mIL-23R mRNA or genomic DNA from three different mouse strains and thus appears to be encoded in the mIL-23R gene. Despite this insertion, mIL-23R is functional (Fig. 3Goe). Whether this structural difference between hIL-23R and mIL-23R has any consequences for the biological roles of IL-23 in the human and mouse systems respectively is presently unknown.

IL-23 signal transduction engages the same Jak-Stat signaling molecules as IL-12: Jak2, Tyk2, Stat1, Stat3, Stat4, and Stat5 (Fig. 6Go). These results suggest that, consistent with the reported biology of IL-23 (1, 2), some signal transduction mechanisms engaged by IL-23 are similar to those of IL-12 (30, 31, 32, 33, 34, 35, 36, 37).

However, in contrast to IL-12, the most prominent Stat induced by IL-23 is Stat3 rather than Stat4. Moreover, the compositions of DNA-binding Stat complexes induced by IL-12 and IL-23 exhibit potentially important differences. As shown in Fig. 7Go, IL-12 induces a DNA-binding complex containing only Stat4, while IL-23 induces several complexes containing Stat3, Stat1, Stat4, and possibly Stat3/Stat4. This pattern of EMSA bands induced by IL-23 is similar to that reported to be induced by IL-12 at longer times of stimulation (>=25 min; Ref. 35). Thus, while the same Jak kinases and Stat proteins are activated by IL-12 and IL-23, the resulting DNA-binding Stat transcription factor complexes can be different. These observations suggest that significant differences should be expected in the biological responses induced by IL-23 and IL-12. This area is the subject of ongoing investigation.

Human IL-23R is expressed by both T cells and NK cells, including NKL cells (Fig. 5Go, a and b), consistent with the ability of these cells to respond to IL-23. We demonstrate here that IL-23 enhanced the production of IFN-{gamma} by NKL cells. The combination of IL-2, IL-18, and IL-23 induced levels of IFN-{gamma} that were substantially greater than those induced by either cytokine alone or when combined solely with IL-2. Polyclonal anti-IL-23R and anti-IL-12R{beta}1 Abs inhibited the enhanced production of IFN-{gamma} induced by IL-23 (Fig. 3God).

The hIL-23R expression pattern overlaps with that of hIL-12R{beta}2, in agreement with the observation that most human cells that respond to IL-23 also respond to IL-12 (Ref. 1 and R. de Waal Malefyt, unpublished observations). The proximity of the IL-23R and IL-12R{beta}2 genes is also consistent with possible coordinate regulation of expression.

Mouse bone marrow macrophages express IL-23R. Activation in the presence of IFN-{gamma} induced coordinate expression of IL-23R and IL-12R{beta}1, while in the presence of LPS induction of IL-12R{beta}1 mRNA was markedly reduced (Fig. 5Go, d–f; D. Rennick, J. Cheung, and T. McClanahan, unpublished observations). These observations suggest the intriguing possibility that IFN-{gamma} (perhaps induced by accessory cell IL-12) induces macrophages to become responsive to IL-23. Moreover, the pathology of the p19 transgenic mouse (2) also suggests the possibility of as yet uncharacterized biologic responses of myeloid cells to IL-23.

Mouse CD4+CD45RBlow memory cells respond to IL-23 but poorly to IL-12, while naive CD4+CD45RBhigh cells respond well to IL-12 but poorly to IL-23 (1). We have demonstrated in this study (Fig. 5Gog) that IL-23R is expressed by CD4+CD45RBlow cells and at comparatively much lower levels by CD4+CD45RBhigh cells. Moreover, for IL-12R{beta}2, the reciprocal expression pattern is observed. Thus, the responses of these mouse cell types to IL-12 or IL-23 correlate with the relative expression levels of IL-12R{beta}2 or IL-23R, respectively.

The identification of both IL-23 and its specific receptor component IL-23R defines a new cytokine produced by accessory cells that stimulates T cells, NK cells, and possibly certain macrophage/myeloid cells. In contrast to anti-IL-12p70 mAbs that target both IL-12 and IL-23, specific reagents such as anti-IL-23R neutralizing mAbs will facilitate distinguishing the functions of IL-12 and IL-23 in the induction and development of immune responses. Of particular interest will be the respective roles played by these two cytokines in regulation of memory T cells, as the ability to therapeutically alter memory T cell responses has important implications for treatment of autoimmune disease. In addition, genetic deficiencies in the IL-12p40, IL-12R{beta}1, IL-12R{beta}2, IFN-{gamma}R1, and IFN-{gamma}R2 genes have been associated with diminished ability to combat mycobacterial infections and enhanced atopic disease (42). It is possible that mutations in either the IL-23p19 or IL-23R genes may explain similar deficiencies in individuals who lack genetic defects in the IL-12/IFN-{gamma}R/ligand systems.


    Acknowledgments
 
We thank Jing Wang and Thomas J. Cradick for contributions to the early phases of this project, Dr. Ken Murphy (Washington University, St. Louis, MO) for valuable discussion, Dr. Jonathan Sedgwick for critical reading of the manuscript, and Gary Burget for assistance with the figures.


    Footnotes
 
1 S.P. is supported by a DNAX postdoctoral fellowship. DNAX Research is supported by Schering-Plough Corporation. Back

2 C.P. and M.C. contributed equally to this paper. Back

3 Current address: Corgentech, 1651 Page Mill Road, Palo Alto, CA 94304. Back

4 Current address: Sugen, 230 East Grand Avenue, South San Francisco, CA 94080. Back

5 Address correspondence and reprint requests to Dr. Kevin W. Moore, Department of Immunology, DNAX Research Institute of Molecular Biology, 901 California Avenue, Palo Alto, CA 94304-1104. E-mail address: kevin.moore{at}dnax.org Back

6 Abbreviations used in this paper: h, human; m, mouse; BAC, bacterial artificial chromosome; s, soluble; HTG, high-throughput genomic. Back

Received for publication December 10, 2001. Accepted for publication April 4, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13:715.[Medline]
  2. Wiekowski, M. T., M. W. Leach, E. W. Evans, L. Sullivan, S. C. Chen, G. Vassileva, J. F. Bazan, D. M. Gorman, R. A. Kastelein, S. Narula, S. A. Lira. 2001. Ubiquitous transgenic expression of the IL-23 subunit p19 induces multiorgan inflammation, runting, infertility, and premature death. J. Immunol. 166:7563.[Abstract/Free Full Text]
  3. Fischer, M., J. Goldschmitt, C. Peschel, J. P. Brakenhoff, K. J. Kallen, A. Wollmer, J. Grotzinger, S. Rose-John. 1997. A bioactive designer cytokine for human hematopoietic progenitor cell expansion. Nat. Biotechnol. 15:142.[Medline]
  4. McKinney, M. M., A. Parkinson. 1987. A simple, non-chromatographic procedure to purify immunoglobulins from serum and ascites fluid. J. Immunol. Methods 96:271.[Medline]
  5. Hori, T., T. Uchiyama, M. Tsudo, H. Umadome, H. Ohno, S. Fukuhara, K. Kita, H. Uchino. 1987. Establishment of an interleukin 2-dependent human T cell line from a patient with T cell chronic lymphocytic leukemia who is not infected with human T cell leukemia/lymphoma virus. Blood 70:1069.[Abstract/Free Full Text]
  6. Al-Harthi, L., K. A. Roebuck, A. Landay. 1998. Induction of HIV-1 replication by type 1-like cytokines, interleukin (IL)-12 and IL-15: effect on viral transcriptional activation, cellular proliferation, and endogenous cytokine production. J. Clin. Immunol. 18:124.[Medline]
  7. Wu, C. Y., R. R. Warrier, D. M. Carvajal, A. O. Chua, L. J. Minetti, R. Chizzonite, P. K. Mongini, A. S. Stern, U. Gubler, D. H. Presky, M. K. Gately. 1996. Biological function and distribution of human interleukin-12 receptor {beta} chain. Eur. J. Immunol. 26:345.[Medline]
  8. Ho, A. S.-Y., Y. Liu, T. A. Khan, D.-H. Hsu, J. F. Bazan, K. W. Moore. 1993. A receptor for interleukin-10 is related to interferon receptors. Proc. Natl. Acad. Sci. USA 90:11267.[Abstract/Free Full Text]
  9. Spits, H., H. Yssel, C. Terhorst, J. E. de Vries. 1982. Establishment of human T lymphocyte clones highly cytotoxic for an EBV-transformed B cell line in serum-free medium: isolation of clones that differ in phenotype and specificity. J. Immunol. 128:95.[Medline]
  10. Robertson, M. J., K. J. Cochran, C. Cameron, J. M. Le, R. Tantravahi, J. Ritz. 1996. Characterization of a cell line, NKL, derived from an aggressive human natural killer cell leukemia. Exp. Hematol. 24:406.[Medline]
  11. Kitamura, T.. 1998. New experimental approaches in retrovirus-mediated expression screening. Int. J. Hematol. 67:351.[Medline]
  12. Kitamura, T., M. Onishi, S. Kinoshita, A. Shibuya, A. Miyajima, G. P. Nolan. 1995. Efficient screening of retroviral cDNA expression libraries. Proc. Natl. Acad. Sci. USA 92:9146.[Abstract/Free Full Text]
  13. Heath, V. L., L. Showe, C. Crain, F. J. Barrat, G. Trinchieri, A. O’Garra. 2000. Ectopic expression of the IL-12 receptor-{beta}2 in developing and committed Th2 cells does not affect the production of IL-4 or induce the production of IFN{gamma}. J. Immunol. 164:2861.[Abstract/Free Full Text]
  14. Desai, B. B., P. M. Quinn, A. G. Wolitzky, P. K. Mongini, R. Chizzonite, M. K. Gately. 1992. IL-12 receptor. II. Distribution and regulation of receptor expression. J. Immunol. 148:3125.[Abstract]
  15. Desai, B., T. Truitt, S. Honasoga, R. Warrier, R. Chizzonite, M. Gately. 1993. Expression of functional IL-12R on a human IL-2-dependent T cell line. J. Immunol. 150:207A.
  16. Mehrotra, P. T., A. J. Grant, J. P. Siegel. 1995. Synergistic effects of IL-7 and IL-12 on human T cell activation. J. Immunol. 154:5093.[Abstract]
  17. Case, R. D., E. Piccione, G. Wolf, A. M. Benett, R. J. Lechleider, B. G. Neel, S. E. Shoelson. 1994. SH-PTP2/Syp SH2 domain binding specificity is defined by direct interactions with platelet-derived growth factor {beta}-receptor, epidermal growth factor receptor, and insulin receptor substrate-1-derived phosphopeptides. J. Biol. Chem. 269:10467.[Abstract/Free Full Text]
  18. Heinrich, P. C., I. Behrmann, G. Muller-Newen, F. Schaper, L. Graeve. 1998. Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem. J. 334:297.
  19. Naeger, L. K., J. McKinney, A. Salvekar, T. Hoey. 1999. Identification of a STAT4 binding site in the interleukin-12 receptor required for signaling. J. Biol. Chem. 274:1875.[Abstract/Free Full Text]
  20. Yao, B. B., P. Niu, C. S. Surowy, C. R. Faltynek. 1999. Direct interaction of STAT4 with the IL-12 receptor. Arch. Biochem. Biophys. 368:147.[Medline]
  21. O’Farrell, A.-M., Y. Liu, K. W. Moore, A. L.-F. Mui. 1998. IL-10 inhibits macrophage activation and proliferation by distinct signalling mechanisms: evidence for stat3-dependent and -independent pathways. EMBO J. 17:1006.[Medline]
  22. Grohmann, U., M. L. Belladonna, C. Vacca, R. Bianchi, F. Fallarino, C. Orabona, M. C. Fioretti, P. Puccetti. 2001. Positive regulatory role of IL-12 in macrophages and modulation by IFN-{gamma}. J. Immunol. 167:221.[Abstract/Free Full Text]
  23. Schindler, H., M. B. Lutz, M. Rollinghoff, C. Bogdan. 2001. The production of IFN-{gamma} by IL-12/IL-18-activated macrophages requires STAT4 signaling and is inhibited by IL-4. J. Immunol. 166:3075.[Abstract/Free Full Text]
  24. Fantuzzi, L., P. Puddu, B. Varano, M. Del Corno, F. Belardelli, S. Gessani. 2000. IFN-{alpha} and IL-18 exert opposite regulatory effects on the IL-12 receptor expression and IL-12-induced IFN-{gamma} production in mouse macrophages: novel pathways in the regulation of the inflammatory response of macrophages. J. Leukocyte Biol. 68:707.[Abstract/Free Full Text]
  25. Salkowski, C. A., K. E. Thomas, M. J. Cody, S. N. Vogel. 2000. Impaired IFN-{gamma} production in IFN regulatory factor-1 knockout mice during endotoxemia is secondary to a loss of both IL-12 and IL-12 receptor expression. J. Immunol. 165:3970.[Abstract/Free Full Text]
  26. Nagayama, H., K. Sato, H. Kawasaki, M. Enomoto, C. Morimoto, K. Tadokoro, T. Juji, S. Asano, T. A. Takahashi. 2000. IL-12 responsiveness and expression of IL-12 receptor in human peripheral blood monocyte-derived dendritic cells. J. Immunol. 165:59.[Abstract/Free Full Text]
  27. Ha, S. J., C. H. Lee, S. B. Lee, C. M. Kim, K. L. Jang, H. S. Shin, Y. C. Sung. 1999. A novel function of IL-12p40 as a chemotactic molecule for macrophages. J. Immunol. 163:2902.[Abstract/Free Full Text]
  28. Fisher, G. M., S. Iqball, S. C. Knight. 1999. Gene expression during differentiation of human dendritic cells from cord blood cd34 stem cells. Cytokine 11:111.[Medline]
  29. Wu, C., R. R. Warrier, X. Wang, D. H. Presky, M. K. Gately. 1997. Regulation of interleukin-12 receptor {beta}1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells. Eur. J. Immunol. 27:147.[Medline]
  30. Shimoda, K., K. Kato, K. Aoki, T. Matsuda, A. Miyamoto, M. Shibamori, M. Yamashita, A. Numata, K. Takase, S. Kobayashi, et al 2000. Tyk2 plays a restricted role in IFN{alpha} signaling, although it is required for IL-12-mediated T cell function. Immunity 13:561.[Medline]
  31. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  32. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  33. Bacon, C. M., 3rd E. F. Petricoin, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  34. Bacon, C. M., D. W. McVicar, J. R. Ortaldo, R. C. Rees, J. J. O’Shea, J. A. Johnston. 1995. Interleukin 12 (IL-12) induces tyrosine phosphorylation of JAK2 and TYK2: differential use of Janus family tyrosine kinases by IL-2 and IL-12. J. Exp. Med. 181:399.[Abstract/Free Full Text]
  35. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, Jr J. E. Darnell, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  36. Jacobson, N. G., S. J. Szabo, M. L. Guler, J. D. Gorham, K. M. Murphy. 1996. Regulation of interleukin-12 signalling during T helper phenotype development. Adv. Exp. Med. Biol. 409:61.[Medline]
  37. Gollob, J. A., E. A. Murphy, S. Mahajan, C. P. Schnipper, J. Ritz, D. A. Frank. 1998. Altered interleukin-12 responsiveness in Th1 and Th2 cells is associated with the differential activation of STAT5 and STAT1. Blood 91:1341.[Abstract/Free Full Text]
  38. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7:571.[Medline]
  39. Novak, U., A. Mui, A. Miyajima, L. Paradiso. 1996. Formation of STAT5-containing DNA binding complexes in response to colony-stimulating factor-1 and platelet-derived growth factor. J. Biol. Chem. 271:18350.[Abstract/Free Full Text]
  40. Silva, C. M., H. Lu, R. N. Day. 1996. Characterization and cloning of STAT5 from IM-9 cells and its activation by growth hormone. Mol. Endocrinol. 10:508.[Abstract/Free Full Text]
  41. Bazan, J. F.. 1990. Structural design and molecular evolution of a cytokine receptor superfamily. Proc. Natl. Acad. Sci. USA 87:6934.[Abstract/Free Full Text]
  42. Jouanguy, E., R. Doffinger, S. Dupuis, A. Pallier, F. Altare, J. L. Casanova. 1999. IL-12 and IFN-{gamma} in host defense against mycobacteria and salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]



This article has been cited by other articles:


Home page
The Journal of RheumatologyHome page
B. PAZAR, E. SAFRANY, P. GERGELY, S. SZANTO, Z. SZEKANECZ, and G. POOR
Association of ARTS1 Gene Polymorphisms with Ankylosing Spondylitis in the Hungarian Population: The rs27044 Variant Is Associated with HLA-B*2705 Subtype in Hungarian Patients with Ankylosing Spondylitis
J Rheumatol, February 1, 2010; 37(2): 379 - 384.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Munoz, M. M. Heimesaat, K. Danker, D. Struck, U. Lohmann, R. Plickert, S. Bereswill, A. Fischer, I. R. Dunay, K. Wolk, et al.
Interleukin (IL)-23 mediates Toxoplasma gondii-induced immunopathology in the gut via matrixmetalloproteinase-2 and IL-22 but independent of IL-17
J. Exp. Med., December 21, 2009; 206(13): 3047 - 3059.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Oyamada, H. Ikebe, M. Itsumi, H. Saiwai, S. Okada, K. Shimoda, Y. Iwakura, K. I. Nakayama, Y. Iwamoto, Y. Yoshikai, et al.
Tyrosine Kinase 2 Plays Critical Roles in the Pathogenic CD4 T Cell Responses for the Development of Experimental Autoimmune Encephalomyelitis
J. Immunol., December 1, 2009; 183(11): 7539 - 7546.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
P. Hillyer, M. J. Larche, E. P. Bowman, T. K. McClanahan, R. de Waal Malefyt, L. P. Schewitz, G. Giddins, M. Feldmann, R. A. Kastelein, and F. M. Brennan
Investigating the role of the interleukin-23/-17A axis in rheumatoid arthritis
Rheumatology, December 1, 2009; 48(12): 1581 - 1589.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. A. Kleinschek, U. Muller, N. Schutze, R. Sabat, R. K. Straubinger, W. M. Blumenschein, T. McClanahan, R. A. Kastelein, and G. Alber
Administration of IL-23 engages innate and adaptive immune mechanisms during fungal infection
Int. Immunol., November 30, 2009; (2009) dxp117v1.
[Abstract] [Full Text] [PDF]


Home page
J Mol Cell BiolHome page
Y. Y. Wan and R. A. Flavell
How Diverse--CD4 Effector T Cells and their Functions
J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Liu, X. Ouyang, J. Yang, J. Liu, Q. Li, Y. Gu, M. Fukata, T. Lin, J. C. He, M. Abreu, et al.
AP-1 Activated by Toll-like Receptors Regulates Expression of IL-23 p19
J. Biol. Chem., September 4, 2009; 284(36): 24006 - 24016.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. A. Goodman, A. D. Levine, J. V. Massari, H. Sugiyama, T. S. McCormick, and K. D. Cooper
IL-6 Signaling in Psoriasis Prevents Immune Suppression by Regulatory T Cells
J. Immunol., September 1, 2009; 183(5): 3170 - 3176.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Xu, G. Wagoner, J. C. Douglas, and P. D. Drew
Liver X receptor agonist regulation of Th17 lymphocyte function in autoimmunity
J. Leukoc. Biol., August 1, 2009; 86(2): 401 - 409.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y. Yang, J. Weiner, Y. Liu, A. J. Smith, D. J. Huss, R. Winger, H. Peng, P. D. Cravens, M. K. Racke, and A. E. Lovett-Racke
T-bet is essential for encephalitogenicity of both Th1 and Th17 cells
J. Exp. Med., July 6, 2009; 206(7): 1549 - 1564.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
H. Ohyama, N. Kato-Kogoe, A. Kuhara, F. Nishimura, K. Nakasho, K. Yamanegi, N. Yamada, M. Hata, J. Yamane, and N. Terada
The Involvement of IL-23 and the Th17 Pathway in Periodontitis
Journal of Dental Research, July 1, 2009; 88(7): 633 - 638.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. M. Spach, R. Noubade, B. McElvany, W. F. Hickey, E. P. Blankenhorn, and C. Teuscher
A Single Nucleotide Polymorphism in Tyk2 Controls Susceptibility to Experimental Allergic Encephalomyelitis
J. Immunol., June 15, 2009; 182(12): 7776 - 7783.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
S. Nady, J. Ignatz-Hoover, and M. T. Shata
Interleukin-12 Is the Optimum Cytokine To Expand Human Th17 Cells In Vitro
Clin. Vaccine Immunol., June 1, 2009; 16(6): 798 - 805.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
A. Awasthi and V. K. Kuchroo
Th17 cells: from precursors to players in inflammation and infection
Int. Immunol., May 1, 2009; 21(5): 489 - 498.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Skarica, T. Wang, E. McCadden, D. Kardian, P. A. Calabresi, D. Small, and K. A. Whartenby
Signal Transduction Inhibition of APCs Diminishes Th17 and Th1 Responses in Experimental Autoimmune Encephalomyelitis
J. Immunol., April 1, 2009; 182(7): 4192 - 4199.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
T. Karaderi, D. Harvey, C. Farrar, L. H. Appleton, M. A. Stone, R. D. Sturrock, M. A. Brown, P. Wordsworth, and J. J. Pointon
Association between the interleukin 23 receptor and ankylosing spondylitis is confirmed by a new UK case-control study and meta-analysis of published series
Rheumatology, April 1, 2009; 48(4): 386 - 389.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. A. Kleinschek, K. Boniface, S. Sadekova, J. Grein, E. E. Murphy, S. P. Turner, L. Raskin, B. Desai, W. A. Faubion, R. de Waal Malefyt, et al.
Circulating and gut-resident human Th17 cells express CD161 and promote intestinal inflammation
J. Exp. Med., March 16, 2009; 206(3): 525 - 534.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Das, X. Chen, R. Komorowski, M. J. Hessner, and W. R. Drobyski
Interleukin-23 secretion by donor antigen-presenting cells is critical for organ-specific pathology in graft-versus-host disease
Blood, March 5, 2009; 113(10): 2352 - 2362.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Lopez Kostka, S. Dinges, K. Griewank, Y. Iwakura, M. C. Udey, and E. von Stebut
IL-17 Promotes Progression of Cutaneous Leishmaniasis in Susceptible Mice
J. Immunol., March 1, 2009; 182(5): 3039 - 3046.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
D. van de Wetering, R. A. de Paus, J. T. van Dissel, and E. van de Vosse
IL-23 modulates CD56+/CD3- NK Cell and CD56+/CD3+ NK-like T Cell function differentially from IL-12
Int. Immunol., February 1, 2009; 21(2): 145 - 153.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. Takatori, Y. Kanno, W. T. Watford, C. M. Tato, G. Weiss, I. I. Ivanov, D. R. Littman, and J. J. O'Shea
Lymphoid tissue inducer-like cells are an innate source of IL-17 and IL-22
J. Exp. Med., January 16, 2009; 206(1): 35 - 41.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
M Oukka
Th17 cells in immunity and autoimmunity
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii26 - iii29.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. M. Castilow, K. L. Legge, and S. M. Varga
Cutting Edge: Eosinophils Do Not Contribute to Respiratory Syncytial Virus Vaccine-Enhanced Disease
J. Immunol., November 15, 2008; 181(10): 6692 - 6696.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Wakashin, K. Hirose, Y. Maezawa, S.-i. Kagami, A. Suto, N. Watanabe, Y. Saito, M. Hatano, T. Tokuhisa, Y. Iwakura, et al.
IL-23 and Th17 Cells Enhance Th2-Cell-mediated Eosinophilic Airway Inflammation in Mice
Am. J. Respir. Crit. Care Med., November 15, 2008; 178(10): 1023 - 1032.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Mo, W. Chearwae, J. T. O'Malley, S. M. Adams, S. Kanakasabai, C. C. Walline, G. L. Stritesky, S. R. Good, N. B. Perumal, M. H. Kaplan, et al.
Stat4 Isoforms Differentially Regulate Inflammation and Demyelination in Experimental Allergic Encephalomyelitis
J. Immunol., October 15, 2008; 181(8): 5681 - 5690.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. W. Quinn, N. A. Sims, H. Saleh, D. Mirosa, K. Thompson, S. Bouralexis, E. C. Walker, T. J. Martin, and M. T. Gillespie
IL-23 Inhibits Osteoclastogenesis Indirectly through Lymphocytes and Is Required for the Maintenance of Bone Mass in Mice
J. Immunol., October 15, 2008; 181(8): 5720 - 5729.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
B Rueda, G Orozco, E Raya, J L Fernandez-Sueiro, J Mulero, F J Blanco, C Vilches, M A Gonzalez-Gay, and J Martin
The IL23R Arg381Gln non-synonymous polymorphism confers susceptibility to ankylosing spondylitis
Ann Rheum Dis, October 1, 2008; 67(10): 1451 - 1454.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
S Y Patel, R Doffinger, G Barcenas-Morales, and D S Kumararatne
Genetically determined susceptibility to mycobacterial infection
J. Clin. Pathol., September 1, 2008; 61(9): 1006 - 1012.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. S. Ma, G. Y.J. Chew, N. Simpson, A. Priyadarshi, M. Wong, B. Grimbacher, D. A. Fulcher, S. G. Tangye, and M. C. Cook
Deficiency of Th17 cells in hyper IgE syndrome due to mutations in STAT3
J. Exp. Med., July 7, 2008; 205(7): 1551 - 1557.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D.-J. Kim, J.-I. Youn, S.-H. Seo, H.-T. Jin, and Y.-C. Sung
Differential Regulation of Antigen-Specific CD8+ T Cell Responses by IL-12p40 in a Dose-Dependent Manner
J. Immunol., June 1, 2008; 180(11): 7167 - 7174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Muhlbauer, P. M. Chilton, T. C. Mitchell, and C. Jobin
Impaired Bcl3 Up-regulation Leads to Enhanced Lipopolysaccharide-induced Interleukin (IL)-23P19 Gene Expression in IL-10-/- Mice
J. Biol. Chem., May 23, 2008; 283(21): 14182 - 14189.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. V. Rachitskaya, A. M. Hansen, R. Horai, Z. Li, R. Villasmil, D. Luger, R. B. Nussenblatt, and R. R. Caspi
Cutting Edge: NKT Cells Constitutively Express IL-23 Receptor and ROR{gamma}t and Rapidly Produce IL-17 upon Receptor Ligation in an IL-6-Independent Fashion
J. Immunol., April 15, 2008; 180(8): 5167 - 5171.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. F. Y. Cheung, C. K. Wong, and C. W. K. Lam
Molecular Mechanisms of Cytokine and Chemokine Release from Eosinophils Activated by IL-17A, IL-17F, and IL-23: Implication for Th17 Lymphocytes-Mediated Allergic Inflammation
J. Immunol., April 15, 2008; 180(8): 5625 - 5635.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Tanaka, K. Ichiyama, M. Hashimoto, H. Yoshida, T. Takimoto, G. Takaesu, T. Torisu, T. Hanada, H. Yasukawa, S. Fukuyama, et al.
Loss of Suppressor of Cytokine Signaling 1 in Helper T Cells Leads to Defective Th17 Differentiation by Enhancing Antagonistic Effects of IFN-{gamma} on STAT3 and Smads
J. Immunol., March 15, 2008; 180(6): 3746 - 3756.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. K. Huber, E. M. Jacobson, K. Jazdzewski, E. S. Concepcion, and Y. Tomer
Interleukin (IL)-23 Receptor Is a Major Susceptibility Gene for Graves' Ophthalmopathy: The IL-23/T-helper 17 Axis Extends to Thyroid Autoimmunity
J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 1077 - 1081.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. E. Ruby, R. Montler, R. Zheng, S. Shu, and A. D. Weinberg
IL-12 Is Required for Anti-OX40-Mediated CD4 T Cell Survival
J. Immunol., February 15, 2008; 180(4): 2140 - 2148.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Fukata, K. Breglio, A. Chen, A. S. Vamadevan, T. Goo, D. Hsu, D. Conduah, R. Xu, and M. T. Abreu
The Myeloid Differentiation Factor 88 (MyD88) Is Required for CD4+ T Cell Effector Function in a Murine Model of Inflammatory Bowel Disease
J. Immunol., February 1, 2008; 180(3): 1886 - 1894.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Mise-Omata, E. Kuroda, J. Niikura, U. Yamashita, Y. Obata, and T. S. Doi
A Proximal {kappa}B Site in the IL-23 p19 Promoter Is Responsible for RelA- and c-Rel-Dependent Transcription
J. Immunol., November 15, 2007; 179(10): 6596 - 6603.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Rider, A. Shatrova, E. P. Feener, L. Webb, and M. Diakonova
JAK2 Tyrosine Kinase Phosphorylates PAK1 and Regulates PAK1 Activity and Functions
J. Biol. Chem., October 19, 2007; 282(42): 30985 - 30996.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Kohyama, S. Ohno, A. Isoda, O. Moriya, M. L. Belladonna, H. Hayashi, Y. Iwakura, T. Yoshimoto, T. Akatsuka, and M. Matsui
IL-23 Enhances Host Defense against Vaccinia Virus Infection Via a Mechanism Partly Involving IL-17
J. Immunol., September 15, 2007; 179(6): 3917 - 3925.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
F.-L. Liu, C.-H. Chen, S.-J. Chu, J.-H. Chen, J.-H. Lai, H.-K. Sytwu, and D.-M. Chang
Interleukin (IL)-23 p19 expression induced by IL-1{beta} in human fibroblast-like synoviocytes with rheumatoid arthritis via active nuclear factor-{kappa}B and AP-1 dependent pathway
Rheumatology, August 1, 2007; 46(8): 1266 - 1273.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Tokumasa, A. Suto, S.-i. Kagami, S. Furuta, K. Hirose, N. Watanabe, Y. Saito, K. Shimoda, I. Iwamoto, and H. Nakajima
Expression of Tyk2 in dendritic cells is required for IL-12, IL-23, and IFN-{gamma} production and the induction of Th1 cell differentiation
Blood, July 15, 2007; 110(2): 553 - 560.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kaiga, M. Sato, H. Kaneda, Y. Iwakura, T. Takayama, and H. Tahara
Systemic Administration of IL-23 Induces Potent Antitumor Immunity Primarily Mediated through Th1-Type Response in Association with the Endogenously Expressed IL-12
J. Immunol., June 15, 2007; 178(12): 7571 - 7580.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
X. L. Rudner, K. I. Happel, E. A. Young, and J. E. Shellito
Interleukin-23 (IL-23)-IL-17 Cytokine Axis in Murine Pneumocystis carinii Infection
Infect. Immun., June 1, 2007; 75(6): 3055 - 3061.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. N. Mathur, H.-C. Chang, D. G. Zisoulis, G. L. Stritesky, Q. Yu, J. T. O'Malley, R. Kapur, D. E. Levy, G. S. Kansas, and M. H. Kaplan
Stat3 and Stat4 Direct Development of IL-17-Secreting Th Cells
J. Immunol., April 15, 2007; 178(8): 4901 - 4907.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
I. D. Jung, J. S. Lee, Y. J. Kim, Y.-I. Jeong, C.-M. Lee, T. Baumruker, A. Billlich, Y. Banno, M. G. Lee, S.-C. Ahn, et al.
Sphingosine kinase inhibitor suppresses a Th1 polarization via the inhibition of immunostimulatory activity in murine bone marrow-derived dendritic cells
Int. Immunol., April 1, 2007; 19(4): 411 - 426.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. O. Yang, A. D. Panopoulos, R. Nurieva, S. H. Chang, D. Wang, S. S. Watowich, and C. Dong
STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells
J. Biol. Chem., March 30, 2007; 282(13): 9358 - 9363.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. M. Hildner, P. Schirmacher, I. Atreya, M. Dittmayer, B. Bartsch, P. R. Galle, S. Wirtz, and M. F. Neurath
Targeting of the Transcription Factor STAT4 by Antisense Phosphorothioate Oligonucleotides Suppresses Collagen-Induced Arthritis
J. Immunol., March 15, 2007; 178(6): 3427 - 3436.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Umemura, A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, et al.
IL-17-Mediated Regulation of Innate and Acquired Immune Response against Pulmonary Mycobacterium bovis Bacille Calmette-Guerin Infection
J. Immunol., March 15, 2007; 178(6): 3786 - 3796.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. M. Wozniak, A. A. Ryan, and W. J. Britton
Interleukin-23 Restores Immunity to Mycobacterium tuberculosis Infection in IL-12p40-Deficient Mice and Is Not Required for the Development of IL-17-Secreting T Cell Responses
J. Immunol., December 15, 2006; 177(12): 8684 - 8692.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
R. H. Duerr, K. D. Taylor, S. R. Brant, J. D. Rioux, M. S. Silverberg, M. J. Daly, A. H. Steinhart, C. Abraham, M. Regueiro, A. Griffiths, et al.
A Genome-Wide Association Study Identifies IL23R as an Inflammatory Bowel Disease Gene
Science, December 1, 2006; 314(5804): 1461 - 1463.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. R. Chan, W. Blumenschein, E. Murphy, C. Diveu, M. Wiekowski, S. Abbondanzo, L. Lucian, R. Geissler, S. Brodie, A. B. Kimball, et al.
IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis
J. Exp. Med., November 27, 2006; 203(12): 2577 - 2587.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. C. Kullberg, D. Jankovic, C. G. Feng, S. Hue, P. L. Gorelick, B. S. McKenzie, D. J. Cua, F. Powrie, A. W. Cheever, K. J. Maloy, et al.
IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis
J. Exp. Med., October 30, 2006; 203(11): 2485 - 2494.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. N. Mathur, H.-C. Chang, D. G. Zisoulis, R. Kapur, M. L. Belladonna, G. S. Kansas, and M. H. Kaplan
T-bet is a critical determinant in the instability of the IL-17-secreting T-helper phenotype
Blood, September 1, 2006; 108(5): 1595 - 1601.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Li, N. Chu, A. Rostami, and G.-X. Zhang
Dendritic Cells Transduced with SOCS-3 Exhibit a Tolerogenic/DC2 Phenotype That Directs Type 2 Th Cell Differentiation In Vitro and In Vivo
J. Immunol., August 1, 2006; 177(3): 1679 - 1688.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. J. Fahey, R. A. Robins, K. B. Kindle, D. M. Heery, and C. S. Constantinescu
Effects of glucocorticoids on STAT4 activation in human T cells are stimulus-dependent
J. Leukoc. Biol., July 1, 2006; 80(1): 133 - 144.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Oniki, H. Nagai, T. Horikawa, J. Furukawa, M. L. Belladonna, T. Yoshimoto, I. Hara, and C. Nishigori
Interleukin-23 and interleukin-27 exert quite different antitumor and vaccine effects on poorly immunogenic melanoma.
Cancer Res., June 15, 2006; 66(12): 6395 - 6404.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Chen, A. Laurence, Y. Kanno, M. Pacher-Zavisin, B.-M. Zhu, C. Tato, A. Yoshimura, L. Hennighausen, and J. J. O'Shea
Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells
PNAS, May 23, 2006; 103(21): 8137 - 8142.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. W. Overwijk, K. E. de Visser, F. H. Tirion, L. A. de Jong, T. W. H. Pols, Y. U. van der Velden, J. G. van den Boorn, A. M. Keller, W. A. Buurman, M. R. Theoret, et al.
Immunological and Antitumor Effects of IL-23 as a Cancer Vaccine Adjuvant
J. Immunol., May 1, 2006; 176(9): 5213 - 5222.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M.-L. Cho, J.-W. Kang, Y.-M. Moon, H.-J. Nam, J.-Y. Jhun, S.-B. Heo, H.-T. Jin, S.-Y. Min, J.-H. Ju, K.-S. Park, et al.
STAT3 and NF-{kappa}B Signal Pathway Is Required for IL-23-Mediated IL-17 Production in Spontaneous Arthritis Animal Model IL-1 Receptor Antagonist-Deficient Mice
J. Immunol., May 1, 2006; 176(9): 5652 - 5661.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. O Huising, C. P Kruiswijk, and G. Flik
Phylogeny and evolution of class-I helical cytokines.
J. Endocrinol., April 1, 2006; 189(1): 1 - 25.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Lai, R. A. Zeff, and I. Goldschneider
A recombinant single-chain IL-7/HGFbeta hybrid cytokine induces juxtacrine interactions of the IL-7 and HGF (c-Met) receptors and stimulates the proliferation of CFU-S12, CLPs, and pre-pro-B cells
Blood, March 1, 2006; 107(5): 1776 - 1784.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Kleinschek, U. Muller, S. J. Brodie, W. Stenzel, G. Kohler, W. M. Blumenschein, R. K. Straubinger, T. McClanahan, R. A. Kastelein, and G. Alber
IL-23 Enhances the Inflammatory Cell Response in Cryptococcus neoformans Infection and Induces a Cytokine Pattern Distinct from IL-12
J. Immunol., January 15, 2006; 176(2): 1098 - 1106.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. M. Wozniak, A. A. Ryan, J. A. Triccas, and W. J. Britton
Plasmid Interleukin-23 (IL-23), but Not Plasmid IL-27, Enhances the Protective Efficacy of a DNA Vaccine against Mycobacterium tuberculosis Infection
Infect. Immun., January 1, 2006; 74(1): 557 - 565.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kidoya, M. Umemura, T. Kawabe, G. Matsuzaki, A. Yahagi, R. Imamura, and T. Suda
Fas Ligand Induces Cell-Autonomous IL-23 Production in Dendritic Cells, a Mechanism for Fas Ligand-Induced IL-17 Production
J. Immunol., December 15, 2005; 175(12): 8024 - 8031.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. L. Drakes, T. G. Blanchard, and S. J. Czinn
Colon lamina propria dendritic cells induce a proinflammatory cytokine response in lamina propria T cells in the SCID mouse model of colitis
J. Leukoc. Biol., December 1, 2005; 78(6): 1291 - 1300.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. I. Happel, P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, et al.
Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae
J. Exp. Med., September 19, 2005; 202(6): 761 - 769.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. I. Rutitzky, J. R. Lopes da Rosa, and M. J. Stadecker
Severe CD4 T Cell-Mediated Immunopathology in Murine Schistosomiasis Is Dependent on IL-12p40 and Correlates with High Levels of IL-17
J. Immunol., September 15, 2005; 175(6): 3920 - 3926.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. I. Happel, E. A. Lockhart, C. M. Mason, E. Porretta, E. Keoshkerian, A. R. Odden, S. Nelson, and A. J. Ramsay
Pulmonary Interleukin-23 Gene Delivery Increases Local T-Cell Immunity and Controls Growth of Mycobacterium tuberculosis in the Lungs
Infect. Immun., September 1, 2005; 73(9): 5782 - 5788.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Khader, J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper
IL-23 Compensates for the Absence of IL-12p70 and Is Essential for the IL-17 Response during Tuberculosis but Is Dispensable for Protection and Antigen-Specific IFN-{gamma} Responses if IL-12p70 Is Available
J. Immunol., July 15, 2005; 175(2): 788 - 795.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Schuetze, S. Schoeneberger, U. Mueller, M. A. Freudenberg, G. Alber, and R. K. Straubinger
IL-12 family members: differential kinetics of their TLR4-mediated induction by Salmonella Enteritidis and the impact of IL-10 in bone marrow-derived macrophages
Int. Immunol., May 1, 2005; 17(5): 649 - 659.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Arsenescu, A. M. Blum, A. Metwali, D. E. Elliott, and J. V. Weinstock
IL-12 Induction of mRNA Encoding Substance P in Murine Macrophages from the Spleen and Sites of Inflammation
J. Immunol., April 1, 2005; 174(7): 3906 - 3911.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Schnurr, T. Toy, A. Shin, M. Wagner, J. Cebon, and E. Maraskovsky
Extracellular nucleotide signaling by P2 receptors inhibits IL-12 and enhances IL-23 expression in human dendritic cells: a novel role for the cAMP pathway
Blood, February 15, 2005; 105(4): 1582 - 1589.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. Bettelli and V. K. Kuchroo
IL-12- and IL-23-induced T helper cell subsets: birds of the same feather flock together
J. Exp. Med., January 18, 2005; 201(2): 169 - 171.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sun, M. Walsh, A. V. Villarino, L. Cervi, C. A. Hunter, Y. Choi, and E. J. Pearce
TLR Ligands Can Activate Dendritic Cells to Provide a MyD88-Dependent Negative Signal for Th2 Cell Development
J. Immunol., January 15, 2005; 174(2): 742 - 751.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Fairweather, S. Frisancho-Kiss, S. A. Yusung, M. A. Barrett, S. E. Davis, R. A. Steele, S. J. L. Gatewood, and N. R. Rose
IL-12 Protects against Coxsackievirus B3-Induced Myocarditis by Increasing IFN-{gamma} and Macrophage and Neutrophil Populations in the Heart
J. Immunol., January 1, 2005; 174(1): 261 - 269.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Salcedo, J. K. Stauffer, E. Lincoln, T. C. Back, J. A. Hixon, C. Hahn, K. Shafer-Weaver, A. Malyguine, R. Kastelein, and J. M. Wigginton
IL-27 Mediates Complete Regression of Orthotopic Primary and Metastatic Murine Neuroblastoma Tumors: Role for CD8+ T Cells
J. Immunol., December 15, 2004; 173(12): 7170 - 7182.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
J J O'Shea
Targeting the Jak/STAT pathway for immunosuppression
Ann Rheum Dis, November 1, 2004; 63(suppl_2): ii67 - ii71.
[Full Text] [PDF]


Home page
BloodHome page
C. Fieschi, M. Bosticardo, L. de Beaucoudrey, S. Boisson-Dupuis, J. Feinberg, O. F. Santos, J. Bustamante, J. Levy, F. Candotti, and J.-L. Casanova
A novel form of complete IL-12/IL-23 receptor {beta}1 deficiency with cell surface-expressed nonfunctional receptors
Blood, October 1, 2004; 104(7): 2095 - 2101.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Morinobu, Y. Kanno, and J. J. O'Shea
Discrete Roles for Histone Acetylation in Human T Helper 1 Cell-specific Gene Expression
J. Biol. Chem., September 24, 2004; 279(39): 40640 - 40646.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-Z. Wang, Y.-X. Bao, C. L. Rosenberger, Y. Tesfaigzi, J. M. Stark, and K. S. Harrod
IL-12p40 and IL-18 Modulate Inflammatory and Immune Responses to Respiratory Syncytial Virus Infection
J. Immunol., September 15, 2004; 173(6): 4040 - 4049.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Matsui, O. Moriya, M. L. Belladonna, S. Kamiya, F. A. Lemonnier, T. Yoshimoto, and T. Akatsuka
Adjuvant Activities of Novel Cytokines, Interleukin-23 (IL-23) and IL-27, for Induction of Hepatitis C Virus-Specific Cytotoxic T Lymphocytes in HLA-A*0201 Transgenic Mice
J. Virol., September 1, 2004; 78(17): 9093 - 9104.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen
Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages
J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Wassink, P. L. Vieira, H. H. Smits, G. A. Kingsbury, A. J. Coyle, M. L. Kapsenberg, and E. A. Wierenga
ICOS Expression by Activated Human Th Cells Is Enhanced by IL-12 and IL-23: Increased ICOS Expression Enhances the Effector Function of Both Th1 and Th2 Cells
J. Immunol., August 1, 2004; 173(3): 1779 - 1786.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parham, C.
Right arrow Articles by Moore, K. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parham, C.
Right arrow Articles by Moore, K. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS