HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mariner, J. M. Articles by Azimi, N. Search for Related Content PubMed PubMed Citation Articles by Mariner, J. M. Articles by Azimi, N.

IFN Regulatory Factor 4 Participates in the Human T Cell Lymphotropic Virus Type I-Mediated Activation of the IL-15 Receptor Promoter¹

Jennifer M. Mariner^*, Yael Mamane, John Hiscott, Thomas A. Waldmann^* and Nazli Azimi^2,*

^* Metabolism Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and Terry Fox Molecular Oncology Group, Lady Davis Institute for Medical Research, and Departments of Microbiology and Immunology, Medicine, and Oncology, McGill University, Montreal, Canada

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-15R mRNA and protein levels are increased in human T cell lymphotropic virus type-I (HTLV-I)-associated adult T cell leukemia. Previously, we demonstrated that IL-15R expression was activated by HTLV-I Tax, in part, through the action of NF-B. However, there appeared to be additional motifs within the IL-15R promoter that were responsive to HTLV-I Tax. In this study, we demonstrated that IL-15R mRNA expression was activated in human monocytes by IFN treatment, suggesting a role for IFN regulatory factors (IRFs) in IL-15R transcription. In addition, an IRF element within the Tax-responsive element of the IL-15R promoter was necessary for maximal Tax-induced activation of this promoter. Furthermore, we demonstrated that IRF-4, a transcription factor known to be elevated in HTLV-I-infected cells, activated the IL-15R promoter. Inhibition of IRF-4 action lead to reduced Tax-induced activation of the IL-15R promoter, while inhibition of both IRF-4 and NF-B severely inhibited the Tax-induced activation of this promoter. These findings suggest a role for both NF-B and IRF-4 in the transcriptional regulation of IL-15R by HTLV-I Tax. It is possible that the HTLV-I Tax-mediated induction of IL-15R and IL-15 may lead to an autocrine cytokine-mediated stimulatory loop leading to the proliferation of HTLV-I infected cells. This loop of proliferation may facilitate viral propagation and play a role in HTLV-I-mediated disease progression.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Interleukin-15 is a member of the 4-helix bundle cytokine family that shares similar properties with IL-2 (1, 2). These functional similarities can be explained in part by the use of common receptors. IL-2 and IL-15 share the IL-2R and the common receptor subunits (1, 2, 3, 4), yet each cytokine has its own distinct receptor, namely IL-2R (5) and IL-15R (6), respectively. IL-2 and IL-15 use the and common chains to initiate similar signal transduction pathways. This common signaling pathway contributes to the shared functions of IL-2 and IL-15 in both T and NK cells.

There are expression and functional differences between IL-2 and IL-15. IL-2 mRNA is largely restricted to lymphoid tissues, yet IL-15 has a widespread mRNA expression in many cells and tissues including T cells, B cells, liver, and skeletal muscle (7). IL-15 also has activities that are not shared with IL-2. For example, addition of IL-15 to a myoblast cell line affected skeletal muscle fiber hypertrophy, suggesting that IL-15 may be an anabolic agent that increases skeletal muscle mass (8). IL-15 also plays a major role in the development, survival, and activation of NK cells (9, 10, 11, 12). IL-2 and IL-15 also have profoundly different effects on activation-induced cell death. IL-2 activates self-reactive T cell suicide and thus, plays a role in peripheral tolerance (13, 14, 15). IL-2 is also important in the inhibition of CD8⁺ memory T cell maintenance (16). In contrast, IL-15 has an anti-apoptotic effect on T and B cells (17), inhibits IL-2-induced activation-induced cell death (18), and is critical for the survival of CD8⁺ memory cells (16, 19). IL-15 also stimulates the proliferation of mast cells (20).

The effects of IL-15 can be explained in part not only by its widespread mRNA expression, but also in part by the expression of its distinct receptor IL-15R. IL-15R is a 58–60-kDa type I transmembrane protein that does not belong to the cytokine receptor family (6). IL-15R-mediated functions were demonstrated in IL-15R null (IL-15R^-/-) mice (21). These mice are deficient in NK cells, CD8⁺ lymphocytes, and TCR intraepithelial lymphocytes. In addition, IL-15R knockout mice exhibit marked lymphopenia due to decreased homing of lymphocytes to peripheral lymph nodes. Furthermore, IL-15 knockout mice exhibited marked reductions in the number of thymic and peripheral NK cells, CD8⁺ lymphocytes, and populations of intraepithelial lymphocytes (22). These findings suggest that both IL-15 and its binding receptor are necessary for the development of NK and some T cells.

IL-15 has been shown to be elevated in a number of diseases including rheumatoid arthritis, inflammatory bowel disease, human T cell lymphotropic virus type-I (HTLV-I)³-associated adult T cell leukemia (ATL) (23), and HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP) (24). In addition, IL-15R levels are also elevated in the T cells of ATL patients (25). Increased levels of IL-15 and IL-15R in HTLV-I-associated diseases are induced by the HTLV-I Tax protein. Tax is expressed from the pX sequence within the HTLV-I proviral genome (26) and is responsible for the transactivation of the HTLV-I long terminal repeat (LTR) (27). In addition, HTLV-I Tax activates a variety of cellular host genes including IL-2 (28, 29), IL-2R (29, 30), IL-15 (23), and IL-15R (25). Activation of cellular genes by HTLV-I Tax is mediated by a number of cis-acting DNA elements including cAMP responsive element (26), serum responsive elements (31), and NF-B motifs (32). Many of these genes are ILs or growth factors that may aid the virus in its propagation.

HTLV-I infection also plays a role in the expression of IFN regulatory factor (IRF)-4. IRFs are activated upon viral infection or IFN activation and act as transcription factors (33). IRF-4 was originally cloned as ICSAT, an IFN consensus binding protein that was overexpressed in ATL cell lines (34). This finding suggested that IRF-4 was activated by HTLV-I infection. Additional studies revealed that IRF-4 mRNA expression was elevated in Jurkat cells following transient expression of the HTLV-I Tax protein (34), implying that Tax was involved in the transactivation of the IRF-4 gene. Furthermore, IRF-4 is constitutively expressed in HTLV-I-infected cell lines and the IRF-4 promoter is activated by Tax expression (35). In addition, the peripheral blood cells of ATL patients have elevated levels of IRF-4 protein.⁴ Up-regulation of IRF-4 by HTLV-I Tax suggests that IRF-4 may be involved in the transformation of T cells by HTLV-I (35).

We have previously demonstrated that IL-15R is activated by HTLV-I Tax in part through the action of NF-B (25). In this study, we delineate additional Tax-responsive elements within the IL-15R promoter. Specifically, we demonstrated that an IRF element (IRF-E) was necessary for Tax-induced activation of the IL-15R promoter. In addition, we showed that IRF-4 was capable of activating the IL-15R promoter and that inhibition of IRF-4 action reduced the Tax-induced activation of the IL-15R promoter. These findings suggest that HTLV-I Tax is capable of activating IL-15R in part through the action of IRF-4.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell culture

Jurkat T cell lines were cultured in RPMI 1640 medium (Life Technologies, Gaithersburg, MD) containing 10% FCS, 2 mM L-glutamine, 0.2 M HEPES, and 100 U/ml Pen/Strep antibiotic. COS-7 cells were cultured in DMEM medium containing 10% FCS, 2 mM L-glutamine, and 100 U/ml Pen/Strep antibiotic. Cultures were incubated at 37°C in 5%CO₂/95% air.

Analysis of alternative Tax-responsive elements within the IL-15R promoter

To delineate additional Tax-activated sites within the Tax responsive element of the IL-15R promoter (Del.1/pGL3pro), deletion constructs were made that included or excluded the NF-B site (Fig. 1). Plasmid 209 contained the NF-B site (bases -970 to -1061), while plasmid 207 contained the remaining bases in the Del.1/pGL3pro construct (bases -844 to -971), excluding the NF-B site and all bases 5' to it. Sense and anti-sense primers of the promoter inserts were prepared with KpnI and XhoI restriction sites at the 5' and 3' ends, respectively. To anneal the primers, 10 µg of each primer was added to 10 mM NaCl and placed in a 95°C heat block. The heat block was immediately placed at room temperature and the primers were allowed to anneal gradually. Once the heat block attained room temperature, the annealed primers were ethanol precipitated. The precipitated DNA was then ligated to the pGL3 promoter vector using the XhoI and KpnI sites overhangs found on the annealed primers (see primer sequences below) and the resulting product was transformed into One Shot (Invitrogen, San Diego, CA) competent cells. The primer sequences for plasmid 207 were as follows: 5'-C(XhoI)ATTGTTAATTTTTAAATTTGATCTTATCATCTTGAGATTTATTATTAAGTATTGAGAGAAATTGAATAATGTGGGATTTCCCCAGTTGGAC(KpnI)-3' (sense) and 5'-TCGAG(XhoI)TCCAACTGGGGAAATCCCACATTATTCAATTTCTCTCAATACTTAATAATAAATCTCAAGATGATAAGATCAAATTTAAAAATTAACAATGGTAC(KpnI)-3' (antisense). The primer sequences for plasmid 209 were as follows: 5'-C(XhoI)GTAAGGGTGGCTATTCCTGCTTAGAAAAAAAGAATGGACCTTGTGTGGTCACTGCCGGATGGTAGGTTCATTATTCTTTCTACTTTTTTTTTTTAAATTTAAGAGACAGGAACTGGCTGTGTTGCCCAC(KpnI)-3' (sense) and 5'-TCGAG(XhoI)TGGGCAACACAGCCAGTTCCTGTCTCTTAAATTTAAAAAAAAAAAGTAGAAAGAATAATGAACCTACCATCCGGCAGTGACCACACAAGGTCCATTCTTTTTTTCTAAGCAGGAATAGCCACCCTTACGGTAC(KpnI)-3' (antisense). The HTLV-I LTR/pGL3 luciferase construct was a kind gift from J. Brady (National Cancer Institute, National Institutes of Health, Bethesda, MD). Plasmids were tested for luciferase activity in Jurkat cells using transient transfection assays. Four million cells containing 100 ng of luciferase construct and 2 µg Tax/pBC72 or Tax M22/pBC72 expression plasmids were electroporated at 280 V and 950 µF. Electroporated cells were transferred into 6-well plates and luciferase activity was determined at 24 h posttransfection. All results are reported as the fold induction over that of the pGL3 promoter alone and represent an average of three independent experiments. Error bars represent the SD of the fold induction of samples.

View larger version (21K): [in this window] [in a new window]   FIGURE 1. Deletion analysis yields additional Tax-responsive elements within the IL-15R promoter. A, Schematic representation of the IL-15R promoter deletion constructs. B, The IL-15R Tax responsive element (Del.1/pGL3pro) was divided into two sections, one retaining the NF-B site (plasmid 209), and one without the NF-B site (plasmid 207). Both portions of the IL-15R promoter were activated by Tax expression, suggesting that additional Tax responsive elements were located within plasmid 207. Two segments of plasmid 207, plasmids 254, and 256, were significantly induced by Tax expression, while plasmids 255 and 257 demonstrated lower levels of Tax-induced activation. Activation of the minimal promoter elements within the luciferase vector (pGL3pro) is shown as a control.

Detection of IL-15R mRNA by Northern blot analysis

To analyze the possible role of IFNs in the regulation of IL-15R, human-elutriated monocytes were treated under various conditions. A total of 3 x 10⁷ freshly elutriated monocytes were treated with media, PHA (1 µg/ml; Sigma-Aldrich, St. Louis, MO), LPS (1 µg/ml; Calbiochem, La Jolla, CA), IFN- (1000 U/ml; Biosource International, Camarillo, CA), IFN- (1000 U/ml; Biosource International), or IFN- (1000 U/ml; R&D Systems, Minneapolis, MN) for 6.5 h at 37°C. Cells were also treated with combinations of IFN and LPS. Immediately following treatment, RNA was extracted from each sample using the Purescript RNA isolation kit (Gentra, Minneappolis, MN). A total of 10 µg of total RNA was run on a formaldyhyde containing agarose gel and transferred to nitrocellulose. The blot was probed with a labeled IL-15R, IL-15 probes, and subsequently with an -actin probe to analyze mRNA loading. Fold induction of IL-15R expression was analyzed using phosphoimager quantitation. Samples were normalized to -actin levels. Fold induction of IL-15R was calculated based on the media alone control.

Mutation of IRF-E within the IL-15R promoter

Sequence analysis revealed two putative IRF-E located within the Tax responsive region of the IL-15R promoter (Del.1/pGL3pro). The IRF-E located within this region of the IL-15R promoter were mutated using site-directed mutatgenesis as previously described for the mutation of the NF-B site (25). Each of the IRF-E was mutated at three bases. Mutations were made in the 254 and 256 promoter constructs as well as the full-length IL-15R promoter (IL-15Rpro/pGL3). The first mutation was located at -943 to -945. Primers for mutation of this site in plasmid 254 were as follows: 5'-GGTGGCTATTCCTGCTTAGA(AG)(AG)(AG)AAACTCGAGATCTGCGATCT-3' (sense) and 5'-AGATCGCAGATCTCGAGTTT(TC)(TC)(TC)TCTAAGCAGGAATAGCCACC-3' (antisense). Primers for the IL-15Rpro/pGL3 at position -943 to -945 were as follows: 5'-GGTGGCTATTCCTGCTTAGA(AG)(AG)(AG)AAAGAATGGACCTTGTGTGG-3' (sense) and 5'-CCACACAAGGTGCATTCTTT(TC)(TC)(TC)TCTAAGCAGGAATAGCCACC-3' (anti-sense). The second mutation was located at position -894 to -896 and the following primers were used in the mutagenesis of plasmid 256: 5'-TTCATTATTCTTTCTACT(TC)(TC)(TC)TTTTTTTCTCGAGATCTG-3' (sense) and 5'-CAGATCTCGAGAAAAAAA(AG)(AG)(AG)AGTAGAAAGAATAATGAA-3' (antisense). Primers for the IL-15Rpro/pGl3 construct were: 5'-CCGGATGGTAGGTTCATTATTCTTTCTACT(TC)(TC)(TC)TTTTTTTAAATTTAAGAGACAGGAACTGGC-3' (sense) and 5'-GCCAGTTCCTGTCTCTTAAATTTAAAAAAA(AG)(AG)(AG)AGTAGAAAGAATAATGAACCTACCATCCGG-3' (antisense). To analyze the effects of these mutations on Tax responsiveness of the promoter, cotransfection studies were performed in Jurkat cells. All transfections and luciferase procedures were conducted as described above.

Analysis of IL-15R activation by IRFs

Cotransfection studies were performed using 50 ng of the full-length IL-15R (IL-15R/pGL3) reporter construct and 2 µg of IRF-1/pACT (36), IRF-3 (5D)/CMVBL (37), IRF-4/pCDNA3 (38), and IRF-7/pFlag-CMV-2 (39) expression plasmids. COS-7 cells were transfected using the DEAE Dextran method in 6-well dishes. Briefly, 2.5 x 10⁵ cells were seeded per well and incubated overnight. Cells were washed with PBS and transfection mixtures (300 µl PBS containing DNA and 300 µg DEAE Dextran) were added for 30 min at 37°C, gently rocking every 5 min. Following the incubation, 1.5 ml DMEM media containing 80 µM chloroquine was added to each well and plates were incubated at 37°C for 2.5 h. Chloroquine was aspirated from the wells and 1.5 ml of DMEM containing 10% DMSO was added to each well for 2.5 min. Media was aspirated from the wells and 4 ml of DMEM was added to each well. Cells were incubated at 37°C and luciferase activity was measured at 24 h posttransfection. Assays were performed in triplicate and error bars represent the SD of the fold induction of samples over that of the negative control (pGL3 basic).

In addition, the effect of IRF-4 inhibition on Tax activation of the IL-15R promoter was analyzed in cotransfection studies in COS-7 cells. A total of 50 ng of the IL-15R/pGL3 reporter construct, 100 ng Tax/pBC72 (a kind gift from J. Brady), and 2 µg of FKBP52/pFLAG (38) and/or 2 µg super dominant IB/pCDNA3 were cotransfected using the DEAE Dextran method described above. Luciferase assays were performed as previously described.

Western blot analysis of IRFs

Transfected COS-7 cells were trysinized from plates and divided in half for luciferase activity or radioimmunoprecipitation buffer lysis. Thirty micrograms of each sample were run on a 4–12% NuPage SDS polyacrylamide gel (Invitrogen) and transferred to polyvinylidene difluoride membrane. Membranes were blocked with Super Block (Pierce, Rockford, IL) overnight and probed with anti-IRF-1, anti-IRF-3, anti-IRF-4, and anti-IRF-7 (all from Santa Cruz Biotechnology, Santa Cruz, CA). Reprobing with anti-vinculin (Sigma-Aldrich) served as a loading control.

Analysis of transcription factor consensus sequences using EMSA

We performed EMSA using whole-cell extracts from HTLV-I-infected MT-2 cells. Cells were lysed in modified lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 50 mM NaF, 1 mM Na₃VO₄, 30 mM sodium pyrophosphate, 0.5% Nonidet P-40, complete protease inhibitor and diisopropylfluorophosphate) and incubated on ice for 15 min. Lysates were centrifuged at 42,000 rpm for 30 min at 4°C. The probes used in this assay were double stranded ³²P-labeled oligonucleotides encompassing the IL-15R IRF-E (IL-15R IRF-E) motif (GGTAGGTTCATTATTCTTTCTACTTTTTTTTTTT) or a consensus IRF-E motif (cIRF-E)(CTAGCGAGAAATAAAAGGAAGTGAAACCAAGT) from the B element (35). Extracts were then mixed with radiolabeled probes, unlabeled competitor probes, poly (dI-dC), Buffer D (20 mM HEPES (pH 7.9), 20% v/v glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, and 0.5 mM PMSF) and BSA at room temperature for 45 min. Probes for competition included the IL-15R IRF-E, the cIRF-E, and a nonspecific consensus NF-B probe (25). An Ab to IRF-4 (Santa Cruz Biotechnology) was added to the cell extracts for 30 min on ice. Extracts were then mixed with the IL-15R IRF-E radiolabeled probe, poly(dI-dC), and BSA at room temperature for 30 min. Samples were loaded onto an acrylamide (30%)/bis-acrylamide (0.8%) gel and subjected to electrophoresis at 150 V for the initial 10 min followed by 120 V for the remainder of the run. Gels were dried and exposed to Kodak MS film (Kodak, Rochester, NY).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Additional Tax-responsive elements within the IL-15R promoter

In previous studies, we demonstrated that the IL-15R promoter was induced by HTLV-I Tax expression (25). This promoter activation was mediated in part by an NF-B motif within a 220 bp Tax-responsive element of the promoter. In addition, mutation of the NF-B motif within the Tax-responsive region (Del.1/pGL3pro) as well as mutation of the NF-B motif within the full-length promoter (IL-15R pro/pGL3) dramatically reduced Tax activation of the IL-15R promoter. In this study, to further address the importance of NF-B in the Tax-induced activation of the IL-15R promoter, we demonstrated that a mutant form of Tax that does not activate NF-B (M22) also eliminates Del.1/pGL3pro promoter activity (data not shown). In addition, a reporter construct bearing the HTLV-I LTR was activated by M22, thus demonstrating the necessity of NF-B activation for IL-15R, but not the HTLV-I LTR. Previous studies showed that the HTLV-I LTR is not significantly activated by NF-B (40). Furthermore, the level of activation of the Del.1/pGL3pro was comparable to that of the HTLV-I LTR with wild-type Tax. This finding further demonstrates that IL-15R promoter activity needs NF-B.

Cotransfection studies previously performed (25) with the Del.1/pGL3pro, Tax, and super dominant IB showed that IB could inhibit the Tax-induced activation of the IL-15R promoter mediated by NF-B. However, we did not demonstrate complete inhibition of Tax activation using this NF-B inhibitor. This finding also suggested that additional sites within the first 200 bp of the IL-15R promoter were activated by Tax. To delineate these sites, we made deletion constructs within the 200 bp region and analyzed each for Tax responsiveness.

Del.1/pGL3pro was first divided into two regions, one containing the NF-B site (plasmid 209) and the other containing the 3' end of this fragment (plasmid 207) (Fig. 1A). Each plasmid was analyzed for promoter activity in the presence or absence of wild-type Tax expression (Fig. 1B) in Jurkat cells. As expected, plasmid 209 was responsive to Tax expression. Interestingly, plasmid 207 was also activated by Tax expression. This finding indicated the presence of additional Tax-responsive elements within the IL-15R promoter.

Based on this observation, plasmid 207 was divided into four segments and each segment was cloned into the pGL3 promoter reporter construct (Fig. 1A). These plasmids (254, 255, 256, and 257) were then used in cotransfection studies in the presence or absence of Tax expression in Jurkat cells. As shown in Fig. 1B, reporter activities of plasmids 255 and 257 were not enhanced by Tax expression at the same level as plasmid 207. However, plasmids 254 and 256 were activated by Tax expression at a level greater than that of plasmid 207. This suggested that motifs located in these regions of the promoter were important for the additional Tax-induced activation of plasmid 207. Furthermore, increased Tax-induced activation of these promoter regions suggested that negative regulatory elements found in the sequence of 207 were eliminated in plasmids 254 and 256, thus increasing Tax-induced activation.

Analysis of the DNA sequence in these regions of the IL-15R promoter (GenBank accession no. AF283296) showed the presence of two putative IRF-Es. This was interesting in that the IL-15 promoter was activated in part by NF-B, IRF-1, and IRF-3 transcription factors (23, 41). Knowing that IL-15 and IL-15R were activated similarly by NF-B, it was possible that IL-15R was also similarly regulated by IRFs.

IL-15R mRNA expression in human moncytes was increased upon treatment with IFNs and LPS

To examine whether IL-15R expression was influenced by IRFs, we first analyzed IL-15R mRNA expression in elutriated monocytes following treatment with IFNs. Monocytes were used because they are known to up-regulate both IL-15 and IL-15R upon treatment with IFNs (6, 42). IRFs are transcription factors induced upon viral infection and/or upon treatment with IFNs. If IRFs were responsible for IL-15R activation, treatment with IFNs would likely activate IL-15R mRNA expression.

Elutriated human monocytes were treated with PHA, LPS, IFN-, IFN-, IFN-, or LPS + IFN-, -, or - for 6.5 h. Elutriated monocytes were used to obtain a homogeneous population of monocytes capable of responding to IFN stimulation. Following treatment, total RNA was isolated from each condition and analyzed in a Northern blot assay for IL-15R, IL-15, and -actin expression. Blots were analyzed by a phosphoimager and IL-15R induction was measured after normalization for -actin loading. As shown in Fig. 2, PHA had no effect on IL-15R expression, yet LPS induced IL-15R expression 12.2-fold over that of the media alone control. Furthermore, IFN-, IFN-, and IFN- increased IL-15R expression 27.4-, 20.2-, and 29.5-fold, respectively. The combination of LPS and IFN-, IFN-, or IFN- yielded 44.8-, 37.9-, and 44.7-fold induction of IL-15R mRNA expression, respectively. IL-15 induction by IFNs served as a positive control (41). These findings demonstrated that IFNs were capable of activating IL-15R mRNA expression. In turn, this suggested that IRFs played a role in the transcriptional regulation of the gene.

View larger version (76K): [in this window] [in a new window]   FIGURE 2. Treatment of human monocytes with IFNs activates IL-15R mRNA expression. Elutriated human monocytes were treated for 6.5 h with IFNs, and total RNAs from treated cells were examined for IL-15R expression in a Northern blot analysis. Cells were treated with media (lane 1), PHA (lane 2), LPS (lane 3), IFN- (lane 4), IFN- (lane 5), IFN- (lane 6), IFN- + LPS (lane 7), IFN- + LPS (lane 8), or IFN- + LPS (lane 9). The total RNA was analyzed for IL-15R, IL-15, and -actin expression. The fold induction levels for IL-15R were calculated after normalization for -actin expression.

Mutations in the IRF-E within the IL-15R promoter lead to reduced Tax-induced activation

Mutations within the IRF-Es of the IL-15R promoter were made to analyze their effect on Tax-induced activation of these regions of the promoter in cotransfection studies using Jurkat cells. First, mutations were made in plasmids 254 and 256, the smallest regions of the IL-15R promoter that were induced by Tax expression. All mutations were made within the putative IRF-Es at sites consistent with consensus IRF-E motifs. As shown in Fig. 3, mutation of three bases within the putative IRF-E at positions -943 to -945 (TTTCCC) using site-directed mutagenesis (plasmid 261) reduced the Tax-induced activation of this site 56%. This suggested that the putative IRF-E at this site was important for Tax-induced activation. In addition, mutations of plasmid 256 were made at positions -894 to -896 (TTTCCC) using site-directed mutagenesis (plasmid 262). Tax-induced activation of this plasmid was inhibited 87% when compared with that of the wild-type 256 plasmid (Fig. 3). Interestingly, plasmids 254 and 256 were not activated by the NF-B inactive mutant of Tax, M22 (data not shown). Although this result was surprising, it was shown previously by Grumont and Gerondakis (43) that IRFs could be activated by NF-B. Therefore, in the context of plasmids 254 and 256, NF-B might activate the IRF that acts on the IL-15R IRF-E sites (see Discussion). These observations indicated that the IRF-E within these isolated regions of the promoter and were essential for the Tax responsiveness of the wild-type promoter.

View larger version (24K): [in this window] [in a new window]   FIGURE 3. Mutations of IRF-E sites within plasmids 254 and 256 inhibit the Tax-induced activation of these regions of the promoter. Plasmids 254 and 256 were each mutated at 3 bp in their putative IRF-E sites and renamed plasmids 261 and 262. Mutations are highlighted using cross-hatches. A, Mutation of the IRF-E in plasmid 261 reduced Tax activation when compared with that of plasmid 254. B, Mutation of the IRF-E in plasmid 262 caused a severe reduction in Tax activation when compared with that of plasmid 256.

View larger version (21K): [in this window] [in a new window]   FIGURE 4. Mutations in the IRF-E and NF-B sites reduced the Tax responsiveness of the full-length IL-15R promoter. Constructs bearing the full-length IL-15R promoter (IL-15Rpro/pGL3) were mutated at the IRF-E and NF-B sites. Mutations are indicated by cross-hatches. Mutation of the second IRF-E (plasmid 270) and the NF-B site (plasmid 230) caused significant reductions in the Tax activation of the promoter. Mutation of the first IRF-E site (plasmid 263) had no effect on the Tax-induced activation of the full-length promoter. Double mutations of both IRF-E and the NF-B (plasmids 271 and 272) as well as a triple mutation of all elements (plasmid 273) also significantly decreased the Tax activation of the promoter.

IRF-4 is involved in the activation of the IL-15R promoter

Mutational analysis of deletion constructs and the full-length promoter demonstrated that an IRF-E site was important for the transactivation of the IL-15R promoter (IL-15Rpro/pGL3). We next analyzed the promoter activity of the IL-15R reporter construct in cotransfection assays of COS-7 cells using expression plasmids for various IRFs. We used COS-7 cells instead of Jurkat cells as shown above due to the higher transfection efficiency of COS-7 cells. Detectable levels of IRFs were seen in these cells as demonstrated by Western blot analysis (see below). In this study, cells were cotransfected with IRF-1 and IRF-3 (5D), a constitutively active form of IRF-3, both of which were previously shown to activate the IL-15 promoter (41). In the same experiment, we also cotransfected IRF-7, an IRF that is restricted to lymphoid cells, and IRF-4, an IRF expressed in HTLV-I infected cells. Although IRF-1, IRF-3 (5D), and IRF-7 were capable of activating the IL-15R promoter 12, 10-, and 30-fold, respectively, IRF-4 expression demonstrated the strongest activation with an 185-fold increase over the pGL3 basic construct (Fig. 5A). Expression patterns of the various IRFs are demonstrated in Fig. 5B by Western blot analysis to ensure comparable levels were expressed to activate the IRF-E within the IL-15R promoter.

View larger version (30K): [in this window] [in a new window]   FIGURE 5. IRF-4 activates the IL-15R promoter. A, IRF-1, IRF-3(5D), IRF-4, and IRF-7 were used in cotransfection assays of COS-7 cells with the IL-15R promoter (IL-15Rpro/pGL3) construct. IRF-4 induced the strongest activation of the IL-15R promoter when compared with the other expression plasmids examined. B, Lysates from cells transfected with IL-15Rpro/pGL3 alone (lane 1), or in combination with IRF-1 (lane 2), IRF-3(5D) (lane 3), IRF-4 (lane 4), or IRF-7 (lane 5) were examined by Western blot for protein expression. Vinculin was added to demonstrate protein loading.

An inhibitor of IRF-4 reduced the Tax-induced activation of the IL-15R promoter

Initial studies demonstrated that HTLV-I Tax activated the IL-15R promoter via an NF-B site (25). The super dominant IB molecule inhibited Tax activation of the IL-15R promoter; however, this inhibition was not complete. As demonstrated above, an IRF-E also played a role in the Tax-induced activation of the promoter. In addition, we demonstrated that IRF-4 activated the IL-15R promoter in the absence of Tax expression. To examine the role of IRF-4 in the Tax-induced activation of the promoter, we performed transient coexpression assays in COS-7 cells with Tax and FKBP52, an inhibitor of IRF-4. FKBP52 inhibits IRF-4 DNA binding through its peptidyl-propyl isomerase activity (38). Furthermore, FKBP52 inhibits the action of IRF-4, but does not inhibit the action of NF-B. As shown in Fig. 6, Tax activated the IL-15R promoter 83.2-fold over that of the pGL3 vector alone. The Tax-induced activation of the IL-15R promoter was again inhibited by a super dominant IB expression plasmid in a transient transfection assay. The expression of super dominant-IB reduced the fold activation of the IL-15R promoter by Tax to 2.8-fold over the pGL3 basic construct. In addition, the IRF-4 inhibitor FKBP52 also inhibited the Tax-induced activation of the promoter to 7.1-fold over the pGL3 basic plasmid. Tax activation of the IL-15R promoter was also inhibited by the coexpression of both super dominant IB and FKBP52 to 1.6-fold over that of pGL3 vector alone. These findings showed that both NF-B and IRF-4 played roles in the Tax-activation of the IL-15R promoter. In addition, these findings demonstrated that both NF-B and IRF-4 are necessary for the complete activation of the IL-15R promoter by HTLV-I Tax.

View larger version (12K): [in this window] [in a new window]   FIGURE 6. FKBP52, an inhibitor of IRF-4, inhibits the Tax-induced activation of the IL-15R promoter. Cotransfection assays were performed in COS-7 cells using the full length IL-15R promoter (IL-15Rpro/pGL3), HTLV-I Tax (Tax/pBC72), super dominant IB/pCDNA3, and/or FKBP52 (FKBP52/pFLAG). Inhibition of both NF-B and IRF-4-reduced Tax-induced activation and inhibition of both factors almost completely inhibited Tax-induced activation of the IL-15R promoter.

The functional IRF-E within the IL-15R promoter bound proteins in the lysates of the HTLV-I-infected T cell line, MT-2

To determine whether the IRF-E motif in the IL-15R promoter was capable of binding IRF-4 proteins, we performed EMSA analysis using the lysates from the HTLV-I-infected T cell line MT-2. MT-2 cells were chosen because they express high levels of IRF-4 protein.⁴ As shown in Fig. 7, the IL-15R IRF-E motif exhibited binding in the absence of cold competitive probes (Fig. 7, lane 1). This binding was specific because cold IL-15R IRF-E oligonucleotides competed out the binding of the labeled probe in a dose-dependent manner (Fig. 7, lanes 2–5). In addition, the binding of the IL-15R IRF-E was also competed out with the addition of a cold IRF-4 consensus probe (cIRF-E; Fig. 7, lanes 6–9). This finding suggested that IRF-4 was involved in the binding seen in Fig. 7 (lane 1). Furthermore, cold consensus NF-B probe was used as a negative binding control. This probe did not compete for the binding of the labeled IL-15R IRF-E probe (Fig. 7, lanes 10–13), suggesting that the binding seen in Fig. 7 (lane 1) is specific for IRF-4. Furthermore, addition of an anti-IRF-4 Ab completely abrogated the binding of the labeled probe. This finding suggested that the interaction of IRF-4 with the IL-15R IRF-E site was inhibited by the addition of Abs to IRF-4. Taken together, these findings suggested that cellular proteins are capable of binding the IL-15R IRF-E, and that this binding is mediated by IRF-4.

View larger version (98K): [in this window] [in a new window]   FIGURE 7. The IRF-E site that is responsible for Tax-induced activation of the IL-15R promoter functions like that of a consensus IRF-4 binding motif. EMSA analysis was performed on the Tax-responsive IRF-E site in the presence or absence of cold competition probes. Binding was inhibited in the presence of the specific IL-15R IRF-E and cIRF-E probes while the nonspecific consensus NF-B probe had no effect on binding. The addition of an anti-IRF-4 Ab abolished IL-15R IRF-E binding, suggesting that IRF-4 specifically binds to this site.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

IFNs are cytokines that are activated in response to viral pathogens. IFN- and IFN- are activated in many cell types upon viral infection, while IFN- is produced in activated T cells and NK cells. Human monocytes treated with IFN- and LPS have increased levels of IL-15 mRNA (42), suggesting that effector molecules downstream of IFN- regulate IL-15 expression. In addition, IL-15R mRNA levels were increased in human monocytes following treatment with IFN-, IFN-, and IFN- (Fig. 2). Activation of genes by IFNs or viral infection is mediated by downstream transcription factors termed IRFs. These transcription factors in turn activate IFN-responsive genes. The IL-15 promoter is activated by IRF-1 and IRF-3 (41).

We asked which IRF was responsible for the Tax activation of the IL-15R promoter. The initial study that characterized IRF-4 demonstrated that this factor is elevated in ATL patient cells (34). In addition, HTLV-I Tax activates the IRF-4 promoter in cotransfection studies (35). These findings suggest a role for IRF-4 in HTLV-I-associated disorders; however, they do not demonstrate the downstream targets of IRF-4 activation.

In this study, we showed through mutational analysis and cotransfection studies that the IRF-E sites within the IL-15R promoter were necessary for its maximal Tax-induced activation (Figs. 3 and 4). The IRF-E site within the IL-15R promoter was essential for maximal Tax activation; however, it is important to note that the NF-B site is the dominant factor involved in Tax activation. For example, IRF-E sites within the IL-15R promoter were not activated by a Tax mutant deficient in NF-B activation. This result suggested that NF-B was involved in the activation of IRF-4 by HTLV-I Tax. Grumont and Gerondakis (43) previously demonstrated that IRF-4 expression was activated by NF-B in lymphoid cells. These findings taken together suggest that NF-B is essential for maximal Tax-induced activation of the IL-15R promoter.

Furthermore, we demonstrated that IRF-4 activated the IL-15R promoter in the absence of Tax (Fig. 5). This finding suggests that the Tax-responsive IRF-E site within the IL-15R promoter is responsive to IRF-4. We also demonstrated that inhibition of IRF-4 by FKBP52 severely inhibited Tax-induced activation of the IL-15R promoter (Fig. 6). FKBP52 exhibits peptidyl-propyl isomerase activity and interferes with the binding of IRF-4 to its DNA binding site. FKBP52 does not inhibit NF-B activity (38); therefore, the reduced Tax activation seen in this experiment is contributed to IRF-4 inhibition. Furthermore, we demonstrated that the IRF-E within the IL-15R promoter was capable of binding IRF-4 proteins (Fig. 7). These findings suggested that IRF-4 activated the transcription of IL-15R under the influence of Tax. Taken in concert with HTLV-I Tax activation of IL-15, activation of IL-15R by IRF-4 and NF-B by HTLV-I Tax (Fig. 8) could represent an activation of a host immune response to retroviral-induced proliferation of HTLV-I-infected cells.

View larger version (11K): [in this window] [in a new window]   FIGURE 8. IL-15R is transcriptionally regulated by HTLV-I Tax through the actions of NF-B and IRF-4. HTLV-I Tax activates both NF-B and IRF-4 in infected T cells. These transcription factors in turn activate target genes such as IL-15 and IL-15R. The Tax-induced activation of both cytokine and its specific binding receptor are thought to drive an autocrine loop of spontaneous T cell proliferation in HTLV-I-infected cells.

Model for IL-15R in HTLV-I-associated diseases

IL-15R expression is regulated by both NF-B and IRF-4 in HTLV-I-infected cells. Studies by Azimi et al. (23, 41) showed that IL-15 is also activated by both NF-B and IRFs. HTLV-I Tax activates both IL-15 and IL-15R levels, suggesting that activation of these genes is important for viral propagation. Patients with the HTLV-I-associated neurological disorder HAM/TSP maintain spontaneous proliferation of ex vivo PBMC cultures in the absence of exogenous cytokines or growth factors. Based on these data, it is possible that both IL-15 and IL-15R participate in an autocrine/paracrine loop of proliferation in HAM/TSP T cell cultures much like that demonstrated previously for IL-2 and IL-2R (29). Therefore, we propose a model in which IL-2, IL-15, and their binding receptors are transcriptionally regulated by HTLV-I Tax. Upon HTLV-I infection, Tax induces the transcription of these cytokine systems via downstream transcription factors such as NF-B and IRFs. IL-15R is transcriptionally regulated by these virally induced factors and in turn can participate in the spontaneous proliferation of HAM/TSP or ATL T cells. This production of cytokines and their receptors could lead to an autocrine/paracrine loop of spontaneous proliferation of T cells. Understanding the mechanisms behind the regulation of these cytokine systems could lead a to combinatorial approach directed against both IL-2 and IL-15 or their receptors for the treatment of patients with HTLV-I-associated diseases.

	Acknowledgments

 
We thank Dr. John Brady (National Cancer Institute, National Institutes of Health, Bethesda, MD) for the kind gift of the Tax/pBC72, Tax M22/pBC72, and HTLV-I LTR/pGL3 plasmids. We also thank him for his assistance in the preparation of this manuscript.

	Footnotes

 
¹ This work was supported in part by a grant from the National Cancer Institute of Canada (to J.H.).

² Address correspondence and reprint requests to Dr. Nazli Azimi, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 10 Center Drive MSC 1374, Building 10, Room 4N-102, Bethesda, MD 20892-1374. E-mail address: nazli{at}helix.nih.gov

³ Abbreviations used in this paper: HTLV-I, human T cell lymphotrophic virus type I; ATL, adult T cell leukemia; HAM/TSP, HTLV-I associated myelopathy/tropical spastic paraparesis; IRF, IFN regulatory factor; IRF-E, IRF element; LTR, long terminal repeat; cIRF-E, consensus IRF-E.

⁴ S. Sharma, N. Grandvaux, Y. Mamane, P. Genin, N. Azimi, T. Waldmann, and J. Hiscott. Regulation of IFN regulatory factor 4 expression in HTLV-I infected leukemic T cells. Submitted for publication.

Received for publication November 16, 2001. Accepted for publication March 29, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Burton, J. D., R. N. Bamford, C. Peters, A. J. Grant, G. Kurys, C. K. Goldman, J. Brennan, E. Roessler, T. A. Waldmann. 1994. A lymphokine, provisionally designated interleukin T and produced by a human adult T-cell leukemia line, stimulates T-cell proliferation and the induction of lymphokine-activated killer cells. Proc. Natl. Acad. Sci. USA 91:4935.[Abstract/Free Full Text]
2. Grabstein, K. H., J. Eisenman, K. Shanebeck, C. Rauch, S. Srinivasan, V. Fung, C. Beers, J. Richardson, M. A. Schoenborn, M. Ahdieh, et al 1994. Cloning of a T cell growth factor that interacts with the chain of the interleukin-2 receptor. Science 264:965.[Abstract/Free Full Text]
3. Bamford, R. N., A. J. Grant, J. D. Burton, C. Peters, G. Kurys, C. K. Goldman, J. Brennan, E. Roessler, T. A. Waldmann. 1994. The interleukin (IL) 2 receptor chain is shared by IL-2 and a cytokine, provisionally designated IL-T, that stimulates T-cell proliferation and the induction of lymphokine-activated killer cells. Proc. Natl. Acad. Sci. USA 91:4940.[Abstract/Free Full Text]
4. Giri, J. G., M. Ahdieh, J. Eisenman, K. Shanebeck, K. H. Grabstein, S. Kumaki, A. Namen, L. S. Park, D. Cosman, D. M. Anderson. 1994. Utilization of the and chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 13:2822.[Medline]
5. Leonard, W. J., J. M. Depper, G. R. Crabtree, S. Rudikoff, J. Pumphrey, R. J. Robb, M. Kronke, P. B. Svetlik, N. J. Peffer, T. A. Waldmann. 1984. Molecular cloning and expression of cDNAs for the human interleukin-2 receptor. Nature 311:626.[Medline]
6. Giri, J. G., S. Kumaki, M. Ahdieh, D. J. Friend, A. Loomis, K. Shanebeck, R. DuBose, D. Cosman, L. S. Park, D. M. Anderson. 1995. Identification and cloning of a novel IL-15 binding protein that is structurally related to the chain of the IL-2 receptor. EMBO J. 14:3654.[Medline]
7. Anderson, D. M., S. Kumaki, M. Ahdieh, J. Bertles, M. Tometsko, A. Loomis, J. Giri, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, et al 1995. Functional characterization of the human interleukin 15 receptor chain and close linkage of IL-15RA and IL-2RA genes. J. Biol. Chem. 270:29862.[Abstract/Free Full Text]
8. Quinn, L. S., K. L. Haugk, K. H. Grabstein. 1995. Interleukin-15: a novel anabolic cytokine for skeletal muscle. Endocrinol. 136:3669.[Abstract]
9. Leclercq, G., V. Debacker, M. D. Smest, J. Plum. 1996. Differential effects of interleukin-15 and interleukin-2 on differentiation of bi-potential T/natural killer progenitor cells. J. Exp. Med. 184:325.[Abstract/Free Full Text]
10. Carson, W. E., T. A. Fehniger, S. Haldar, K. Eckhert, M. J. Lindemann, C.-F. Lai, C. M. Croce, H. Baumann, M. A. Caligiuri. 1997. Potential role for interleukin-15 in the regulation of human natural killer cell survival. J. Clin. Invest. 99:937.[Medline]
11. Puzanov, I. J., N. S. Williams, J. Schatzle, P. V. Sivakumar, M. Bennet, V. Kumar. 1997. Ontogeny of NK cells and the bone marrow microenvironment: where does IL-15 fit in?. Res. Immunol. 148:195.[Medline]
12. Ogasawara, K., S. Hida, N. Azimi, Y. Tagaya, T. Sato, T. Yokochi-Fukuda, T. A. Waldmann, T. Taniguchi, S. Taki. 1998. Requirement for IRF-1 in the microenvironment supporting development of natural killer cells. Nature 391:700.[Medline]
13. Sadlack, B., H. Merz, H. Schorle, A. Schimpi, A. C. Feller, I. Horack. 1993. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75:253.[Medline]
14. Suzuki, H., T. M. Kundig, C. Furlonger, A. Wakeman, E. Timms, T. Matsuyama, R. Schimts, J. J. L. Simard, P. S. Ohashi, H. Greisser, et al 1995. Deregulated T cell activation and autoimmunity in mice lacking IL-2 receptor . Science 268:1472.[Abstract/Free Full Text]
15. Willerford, D. M., J. Chen, J. A. Ferry, L. Davidson, A. Ma, F. W. Alt. 1995. Interleukin-2 receptor chain regulates the size and content of the peripheral lymphoid compartment. Immunity 3:521.[Medline]
16. Ku, C. C., M. Murakami, A. Sakamoto, J. Kappler, P. Marrack. 2000. Control of homeostasis of CD8⁺ memory T cells by opposing cytokines. Science 288:675.[Abstract/Free Full Text]
17. Bulfone-Paus, S., D. Ungureanu, T. Pohl, G. Lindner, R. Paus, R. Ruckert, H. Krause, U. Kunzendorf. 1997. Interleukin-15 protects from lethal apoptosis in vivo. Nat. Med. 3:1124.[Medline]
18. Marks-Konczalik, J., S. Dubois, J. M. Losi, H. Sabzevari, N. Yamada, L. Feigenbaum, T. A. Waldmann, Y. Tagaya. 2000. IL-2-induced activation-induced cell death is inhibited in IL-15 transgenic mice. Prot. Natl. Acad. Sci. USA 97:11445.[Abstract/Free Full Text]
19. Zhang, X., S. Sun, I. Hwang, D. F. Tough, J. Sprent. 1998. Potent and selective stimulation of memory-phenotype CD8⁺ T cells in vivo by IL-15. Immunity 8:591.[Medline]
20. Tagaya, Y., J. D. Burton, Y. Miyamoto, T. A. Waldmann. 1996. Identification of a novel receptor/signal transduction pathway for IL-15/T in mast cells. EMBO J. 15:4928.[Medline]
21. Lodolce, J. P., D. L. Boone, S. Chai, R. E. Swain, T. Dassopoulos, S. Trettin, A. Ma. 1998. IL-15 receptor maintains lymphoid homeostais by supporting lymphocyte homing and proliferation. Immunity 9:669.[Medline]
22. Kennedy, M. K., M. Glaccum, S. N. Brown, E. A. Butz, J. L. Viney, M. Embers, N. Matsuki, K. Charrier, L. Sedger, C. R. Willis, et al 2000. Reversible effects on natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J. Exp. Med. 191:771.[Abstract/Free Full Text]
23. Azimi, N., K. Brown, R. N. Bamford, Y. Tagaya, U. Siebenlist, T. A. Waldmann. 1998. Human T cell lymphotropic virus type I Tax protein trans-activates interleukin 15 gene transcription through an NF-B site. Proc. Natl. Acad. Sci. USA 95:2452.[Abstract/Free Full Text]
24. Azimi, N., S. Jacobson, T. Leist, T. A. Waldmann. 1999. Involvement of IL-15 in the pathogenesis of human T lymphotropic virus type I-associated myelopathy/tropical spastic paraparesis: implications for therapy with a monoclonal antibody directed to the IL-2/15R receptor. J. Immunol. 163:4064.[Abstract/Free Full Text]
25. Mariner, J. M., V. Lantz, T. A. Waldmann, N. Azimi. 2001. Human T cell lymphotropic virus type I Tax activates IL-15R gene expression through an NF-B site. J. Immunol. 166:2602.[Abstract/Free Full Text]
26. Jeang, K. T., I. Boros, J. Brady, M. Radonovich, G. Khoury. 1988. Characterization of cellular factors that interact with the human T-cell leukemia virus type I p40x-responsive 21-base pair sequence. J. Virol. 62:4499.[Abstract/Free Full Text]
27. Felber, B. K., H. Paskalis, E. C. Kleinman, S. F. Wong, G. N. Pavlakis. 1985. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats. Science 229:675.[Abstract/Free Full Text]
28. Siekevitz, M., M. B. Feinberg, N. Holbrook, F. Wong-Staal, W. C. Greene. 1987. Activation of interleukin 2 and interleukin 2 receptor (Tac) promoter expression by the trans-activator (tat) gene product of human T-cell leukemia virus, type I. Proc. Natl. Acad. Sci. USA 84:5389.[Abstract/Free Full Text]
29. Tendler, C. L., S. J. Greenberg, W. A. Blattner, A. Manns, W. Murphy, T. Fleisher, B. Hanchard, O. Morgan, J. D. Burton, D. L. Nelson, T. A. Waldmann. 1990. Transactivation of Interleukin 2 and its receptor induces immune activation in human T-cell lymphotropic virus type I-associated myelopathy: pathogenic implications and a rationale for immunotherapy. Proc. Natl. Acad. Sci. USA 87:5218.[Abstract/Free Full Text]
30. Inoue, J., M. Seiki, T. Taniguchi, S. Tsuru, M. Yoshida. 1986. Induction of Interleukin 2 receptor gene expression by p40x encoded by human T cell leukemia virus type 1. EMBO J. 5:2883.[Medline]
31. Fujii, M., P. Sassone-Corsi, I. M. Verma. 1988. c-fos promoter trans-activation by the tax1 protein of human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 85:8526.[Abstract/Free Full Text]
32. Kanno, T., K. Brown, G. Franzoso, U. Siebenlist. 1994. Kinetic analysis of human T-cell leukemia virus type I Tax-mediated activation of NF-B. Mol. Cell. Biol. 14:6443.[Abstract/Free Full Text]
33. Taniguchi, T., L. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623.[Medline]
34. Yamagata, T., J. Nishida, T. Tanaka, R. Sakai, K. Mitani, M. Yoshida, T. Taniguchi, Y. Yazaki, H. Hirai. 1996. A novel interferon regulatory factor family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes. Mol. Cell. Biol. 16:1283.[Abstract]
35. Sharma, S., Y. Mamane, N. Grandvaux, J. Bartlett, L. Petropoulos, R. Lin, J. Hiscott. 2000. Activation and regulation of interferon regulatory factor 4 in HTLV type I-infected T lymphocytes. AIDS Res. Hum. Retroviruses 16:1613.[Medline]
36. Harada, H., K. Willison, J. Sakakibara, M. Miyamoto, T. Fujita, T. Taniguchi. 1990. Absence of the type I IFN system in EC cells: transcriptional activator (IRF-1) and repressor (IRF-2) genes are developmentally regulated. Cell 63:303.[Medline]
37. Juang, Y. T., W. Lowther, M. Kellum, W. C. Au, R. Lin, J. Hiscott, P. M. Pitha. 1998. Primary activation of interferon A and interferon B gene transcription by interferon regulatory factor 3. Proc. Natl. Acad. Sci. USA 95:9837.[Abstract/Free Full Text]
38. Mamane, Y., S. Sharma, L. Petropoulos, R. Lin, J. Hiscott. 2000. Posttranslational regulation of IRF-4 activity by the immunophilin FKBP52. Immunity 12:129.[Medline]
39. Lin, R., P. Genin, Y. Mamane, J. Hiscott. 2000. Selective DNA binding and association with the CREB binding protein coactivator contribute to differential activation of / interferon genes by interferon regulatory factors 3 and 7. Mol. Cell Biol. 20:6342.[Abstract/Free Full Text]
40. Smith, M., W. Greene. 1990. Identification of HTLV-I tax transactivator mutants exhibiting novel transcriptional phenotypes. Genes Dev. 4:1875.[Abstract/Free Full Text]
41. Azimi, N., Y. Tagaya, J. Mariner, T. A. Waldmann. 2000. Viral activation of interleukin-15 (IL-15): characterization of a virus-inducible element in the IL-15 promoter region. J. Virol. 74:7338.[Abstract/Free Full Text]
42. Bamford, R. N., A. P. Battiata, J. D. Burton, H. Sharma, T. A. Waldmann. 1996. Interleukin (IL) 15/IL-T production by the adult T-cell leukemia cell line HuT-102 is associated with a human T-cell lymphotrophic virus type I R region/IL-15 fusion message that lacks many upstream AUGs that normally attenuate IL-15 mRNA. Proc. Natl. Acad. Sci. USA 93:2897.