| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Division of Developmental and Clinical Immunology and Department of Microbiology, University of Alabama, Birmingham, AL 35294
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although the majority of B cells in spleen are located in the follicular (FO)3 area, B cells of slightly larger size, and expressing different levels of differentiation Ags, are present in the marginal zone (MZ) (3, 4).
Studies with gene-targeted mice have shown that CD19, btk,
pyk2, NF-
B, aiolos, DOCK2, and Lsc are required for the
development of MZ B cells but do not appear to be as critical in the
development of FO B cells (5, 6, 7, 8, 9, 10). MZ B cells also develop
independently of T cells (11, 12). Additionally,
transgenic (TG) mice expressing certain Ig H chains show clonal
enrichment in the MZ B cell compartments (5). Together
these data indicate that various genes modulate the selection of B cell
subsets, and that the localization of FO and MZ B cells is mediated by
B cell receptor signals, migratory signals, and other survival signals
from dendritic cells or macrophages in the spleen (13, 14).
MZ and FO B cells differ in functional capabilities in vitro as well as in vivo (15, 16). MZ B cells respond and proliferate more rapidly than FO B cells to a variety of stimuli, including LPS and anti-CD40. In addition, they are much more readily activated to differentiate into plasmablasts than are FO B cells (11). MZ B cells preferentially secrete Abs of IgM and IgG3 isotypes, while FO B cells preferentially secrete IgG1 or other Ig isotypes after stimulation, reflecting the role of MZ B cells in the primary T-independent (TI) response. The exposure of MZ B cells to blood, by their intimate association with the marginal sinus, enables MZ B cells to provide a rapid and early defense against blood-borne organisms (17, 18, 19).
The B1 subset of B cells is localized preferentially in the peritoneal and pleural cavities, although minor populations of B1 cells are also found in spleen and lymph nodes (20). B1 cells are similar to MZ B cells with respect to expression patterns of CD23, IgM, and IgD and their ability to rapidly differentiate into plasma cells (21, 22, 23). However, they differ in expression of other surface markers such as CD5, CD1, and preferential IgA switching by B1 cells (24, 25).
Phenotypically, MZ B cells have been distinguished from FO B cells by the differential expression of several surface markers. MZ B cells are CD23-/lowCD21highCD1highIgMhighIgDlow, while FO B cells are CD23highCD21intCD1intIgMintIgDhigh (1, 12, 16, 26, 27). Similarly, B1 cells are described as CD23-/lowIgMhighIgDlowIL-5R+CD43+CD5+B220low (20, 23, 28, 29).
Until now, there have been no definitive surface markers that directly distinguish MZ B from FO B cells in mice. Such marker(s) would be useful in tracing the development and the functions of MZ B cells. With this in mind, we attempted to identify novel surface markers of MZ B cells by generating subset-specific mAbs. In the process, we generated a panel of mAbs specific to MZ B cells and showed that one of them, MZ3, recognizes the tetraspanin CD9 (30).
CD9 is a cell surface glycoprotein belonging to the tetraspanin (TM4SF)
family, which is characterized by four transmembrane-spanning domains
and two extracellular domains. This family also includes CD37, CD53,
CD63, CD81, CD82, and CD151 (31). Although its exact
function is unknown, previous studies implicated CD9 in cell adhesion,
migration, or signal transduction (32, 33, 34). Biochemical
studies have shown that CD9 is physically associated with various
membrane proteins such as integrins (preferentially
1 integrin), MHC class II, CD19, CD5, or other
tetraspanin members, depending on the cell types (32, 35, 36, 37, 38, 39). Collectively, these studies show that CD9 may modulate
the function of associated molecules.
CD9 is expressed ubiquitously on a variety of hematopoietic cells, nerve, muscle, keratinocytes, fibroblasts, and ova (34, 35, 36, 37, 38, 39, 40, 41). CD9 is expressed on human pre-B cells (42); however, within the B cell lineage, CD9 expression on mature B cell subsets in mice has not been well addressed. In this report, we show that within the B cell lineage CD9 is a unique marker for MZ, B1, and plasma cells in mice.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c, C57BL/6, CBA/CaN (xid), and CBA/CaJ (xid control) mice were purchased from The Jackson Laboratory (Bar Harbor, ME) or Charles River Breeding Laboratories (Wilmington, MA), and 8- to 12-wk-old female mice, unless stated differently, were used for analysis and cell sorting. All mice were bred and maintained in our facility at the University of Alabama (Birmingham, AL). VH81X-BALB/c H chain TG mice (BALB/c background) were previously derived in our laboratory (43). CD19-deficient mice (44) were generously provided by Dr. R. Carter (University of Alabama).
Production of mAbs specific for MZ B cells
A total of 106 FACS-sorted MZ B cells and FO B cells from a VH81X H chain TG mouse were repetitively injected s.c. into Fisher rats (The Jackson Laboratory) at 3-day intervals for 15 days. Popliteal and inguinal lymph nodes were dissected and fused with the murine plasmacytoma, P3 x 63Ag8.653, and dispensed into 96-well plates. At 14 days after fusion, hybridoma supernatants from each well were collected and tested on spleen B cells from BALB/c mice.
Biotin surface labeling and immunoprecipitation
The CH31 B cell line was surface-labeled with EZ-Link
sulfo-NHS-LC-biotin as described by the manufacturer (Pierce, Rockford,
IL). Briefly, 107 cells of biotin-labeled CH31
were lysed in 1 ml of 1% Nonidet P-40, 150 mM NaCl, 50 mM Tris (pH
7.5), plus a protease inhibitor mixture tablet (Boehringer Mannheim,
Indianapolis, IN) and incubated overnight with protein G beads
preabsorbed to either MZ3 or an isotype control (IgG2a, ) mAb. The
eluted samples were electrophoresed on 12% SDS-PAGE gel, transferred
to nitrocellulose membrane, blotted with streptavidin (SA)-peroxidase
(Southern Biotechnology Associates, Birmingham, AL), and developed with
ECL reagent (Life Technologies, Rockville, MD).
Transfection of CD9 cDNA into 293 T cells
293T cells transfected with a mouse CD9 cDNA plasmid were tested by flow cytometry for the surface expression of CD9 2 days after liposome transfection as described by the manufacturer (Promega, Madison, WI). Anti-CD9 mAb (KMC8; BD PharMingen, San Diego, CA) was used as a positive control mAb.
Flow cytometry
Spleen and peritoneal cavity (PEC) cells were isolated from 8- to 12-wk-old female mice. Spleen cells were stained with FITC-anti-CD23, PE-anti-CD21, biotin-MZ3, and biotin-anti-CD9 (KMC8), while PEC cells were stained with FITC-anti-B220, PE-anti-CD5, and either biotin-MZ3 or biotin-anti-CD9 (KMC8) (BD PharMingen). SA-allophycocyanin (BD PharMingen) was used as the secondary developing agent for biotinylated Abs. Dead cells were excluded by propidium iodide staining. Cultured cells were blocked with anti-CD16/32 (FcR blocker; BD PharMingen) for 5 min and stained with anti-syndecan 1 (Synd1)-PE and either biotin-anti-CD9 or biotin isotype control Ab and then developed with SA-allophycocyanin. After LPS, LPS plus IL-4, or LPS plus IL-5 stimulation, the levels of bound CD21-PE or CD5-PE used for sorting were negligible. For cytoplasmic staining, cells were incubated with 1% paraformaldehyde in PBS overnight and permeabilized with 0.2% Tween 20 in PBS for 40 min (45). Cells were analyzed on a FACSCalibur flow cytometer (BD Biosciences, Mountain View, CA) and plotted by using WINMDI version 2.8 (The Scripps Institute, La Jolla, CA).
Cell sorting and in vitro stimulation by mitogens
Spleen cells were first depleted of T cells, dendritic cells, and macrophages by using magnetic beads coupled with anti-CD43, CD11b, and CD11c (AutoMACS; Miltenyi Biotec, Auburn, CA). The B cell-enriched preparation was stained by anti-CD23-FITC and anti-CD21-PE and sorted on a MoFlo cell sorter (Cytomation, Fort Collins, CO). Sorted MZ and FO B cells, at 5 x 105 (or 1 x 105) cells/ml, were stimulated in 96- or 24-well flat-bottom plates for 1, 3, and 5 days with anti-CD40 (HM40-3, 1 µg/ml; BD PharMingen), LPS (20 or 50 µg/ml; Sigma-Aldrich, St. Louis, MO), anti-IgM (10 µg/ml; Southern Biotechnology Associates), or IL-4 (100 U/ml), IL-5 (1 ng/ml; Sigma-Aldrich), or with combinations thereof. IL-4 was obtained from the supernatant of P3 x 63Ag8.653 cells transfected with the appropriate expression constructs as previously described (16). For PEC B1 cells, PEC cells were stained with anti-B220-FITC, anti-CD5-PE, and anti-CD9 (MZ3)-biotin, which was developed with SA-allophycocyanin. Purified CD9+ and CD9- B1a cells at 1 x 105 (or 0.25 x 105)/ml were stimulated with LPS or LPS plus IL-5.
mRNA analysis
mRNA and cDNA analysis of sorted cells or cultured cells was
performed by standard methods. Serial dilution of cDNA was used in a
semiquantitative PCR assay. -actin was used as a reference control.
The primers used were as follows: CD9 (5' primer CTCATGATGCTGGTTGGTTTCC
and 3' primer CTCTAGACCATTTCTCGGCTCC) and -actin (5' primer
CCTAAGGCCAACCGTGAAAAG and 3' primer TCTTCATGGTGCTAGGAGCCA). The
amplification conditions were 94°C for 1 min, 57°C for 1 min, and
72°C for 1 min by 30 cycles after denaturation for 3 min at 94°C.
The PCR products were electrophoresed on 0.8% agarose gels and the
pictures were taken by Alpha Imager 2200 documentation and analysis
system (Alpha Innotech, San Leandro, CA).
Immunization
Heat-killed Streptococcus pneumoniae, R36A, was prepared as previously described (46). A total of 108 R36A cells or 150 µl of packed SRBC (Vector Laboratories, Burlingame, CA) was injected i.v. into the tail vein of C57BL/6 mice.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Of the panel of mAbs reactive with splenic B cell subsets, MZ3
reacted with the majority of MZ, but not FO, B cells (Fig. 1
A). The MZ3 epitope was also
expressed on bone marrow myeloid cells, platelets, T cells, NK cells,
and two mouse B1 cell lines, CH12 and CH31 (data not shown).
Immunoprecipitation of the biotin surface-labeled CH31 B1 cell line
with MZ3 mAb revealed a specific protein band of 
26 kDa (Fig. 1B), and MZ3 reacted with CD9 transfected T cells but not
the parental 293T cells. These results showed that CD9 is a novel
marker that distinguishes MZ B cells from FO B cells.
|
). As previously reported,
CD19-deficient mice, with few MZ B cells (5, 12), had
reduced CD9+ B cells compared with control mice
(Fig. 2B). It is of interest that in CBA/CaN
(xid) mice B cells of the MZ phenotype are reduced slightly,
but the majority do not express or have low levels of CD9 compared with
control mice (Fig. 2B).
|
). In C57BL/6 mice, a subset of B2 cells
also expressed CD9.
|
CD9 mRNA transcripts are detected in fresh MZ but not FO B cells
To determine whether CD9 expression is controlled at the mRNA
level, we compared levels of CD9 mRNA transcripts in freshly
FACS-sorted MZ B and FO B cells by RT-PCR. As shown in Fig. 4A, MZ B cells, but not FO B
cells, clearly expressed CD9 transcripts. CD9 mRNA expression is
consistent in both BALB/c and C57BL/6 mice.
|
To determine whether CD9 could be induced or up-regulated in
mature B subsets, MZ B and FO B cells were activated by LPS,
anti-CD40, anti-IgM, and various cytokines, singly or in
combinations (data not shown). As shown in Fig. 4
C, LPS
caused MZ B cells to increase CD9 expression at days 1 and 3. In
contrast, neither CD9 mRNA nor protein was induced in purified FO B
cells by any stimulus at day 1. However, after day 3, a minor
population of FO B cells began to express surface CD9. The appearance
of CD9+ cells correlated with the detection of
CD9 mRNA in the cultures. At day 5, the fraction of
CD9+ cells increased to 20% (Fig. 4B). These results show that CD9 is induced during the late
stage of FO B cell differentiation into plasma cells. We also observed
better induction of CD9 and Synd1 in low-density cultures (1 x
104/ml), where 60% of FO B cells expressed
CD9 at day 5, and only 20% in high-density cultures (Fig. 4, B and D). It appears that CD9 is expressed before
synd1, depending on culture conditions, and then remains at the same
level in Synd1+ cells (Fig. 4D).
Isotype-switched
IgG1+Synd1+ cells were also
generated from FO B cells by LPS plus IL-4 stimulation
(47), and at day 6 these cells also expressed CD9 (Fig. 4E).
In summary, our results show that, although freshly isolated MZ B cells already express CD9 and FO B cells are CD9-, FO B cells express CD9 late after in vitro activation and then maintain the same level as they differentiate into Synd1+ plasma cells. This finding also holds for MZ B cells, which initially express CD9 and remain CD9+ at the Synd1+ plasma cell stage.
Plasma cells express CD9 in vivo
Because FO B cells can become
CD9+Synd1+ after
stimulation in vitro, we next determined whether CD9 is also expressed
on activated B cells and plasma cells in vivo. In unimmunized normal
mice and CBA/CaJ control mice, the spontaneously generated
IgM+ plasma cells all expressed CD9, but
IgM+ plasma cells in CBA/CAN (xid)
mice did not (Fig. 5, A and
B), and the frequency of plasma cells was less. We next
examined two different types of induced plasma cells. Short-lived
IgM+ and phosphoryl choline-specific
plasma cells generated by immunization with the TI-2 Ag, heat-killed
S. pneumoniae vaccine, R36A at day 3 expressed CD9 at
levels similar to MZ B cells (Fig. 5A) (5).
Additionally, we used SRBC as an Ag to generate isotype-switched plasma
cells, which were examined at days 3, 7, and 14 after immunization. As
shown in Fig. 5C, although germinal center (GC) B cells did
not express CD9 at day 7, IgG1 and IgA isotype-switched as well as IgM
plasma cells (data not shown) analyzed at the same time point were
CD9+ (Fig. 5C).
|
Comparison of ability of CD9+ and CD9- B1a cells to differentiate to plasma cells
We next determined whether the division of B1 cells into two
subsets by CD9 expression in BALB/c mice reflects functional
differences. Because the number of B1b cells in BALB/c mice is low and,
as a result, they are difficult to isolate, we divided PEC B1a cells
into CD9+ and CD9-
populations based on expression of B220, CD5, and CD9 (Fig. 6A). Interestingly, we found
that CD9 mRNA was also present in CD9- B1a
cells, even though the level was much lower than
CD9+ in B1a cells (Fig. 6A). As in FO
B cells, either IL-5 plus LPS or LPS stimulation (data not shown) also
induced CD9 on CD9- B1a cells. However, the
kinetics of CD9 up-regulation and plasma cell generation was much
faster than for FO B cells and was comparable to MZ B cells.
CD9+ B1a cells also produced plasma cells more
rapidly and at a higher frequency than CD9- B1a
cells (Fig. 6B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Multiple combinations of cytokines (IL-4, IL-5, IL-6, and IL-10), anti-IgM, anti-CD40, or LPS failed to induce CD9 expression on FO B cells in a short term. In contrast, MZ B cells rapidly up-regulated CD9 as early as 1 day after LPS or anti-CD40 treatment. However, after 3 days in culture, a minor population of FO B cells began to express surface CD9 with LPS or LPS plus cytokines. As expected, the frequency of CD9+ cells was much more increased in the low-density culture, as was the coexpression of Synd1, indicative of mature plasma cell formation. These results are in accord with previous findings, which showed that low-density LPS cultures favored B cell maturation and isotype switching (48). From these results, we conclude that CD9 is expressed on plasma cells derived from both MZ and late FO B cells in vitro as well as in vivo. However, CD9 is clearly not expressed on GC B cells in Peyer’s patches (data not shown) and in spleen of SRBC-immunized mice. Thus, CD9 is a late-appearing Ag in the T cell-dependent progression from GC B cells to mature plasma cells. This hypothesis is supported by the expression of CD9 on presumptively GC-derived isotype-switched IgG1 and IgA plasma cells. Previously, it was shown that human tonsil plasma cells also express CD9, but in mice the expression of CD9 on plasma cells has not been addressed (49). The fact that CD9 is expressed on both IgM+ and isotype-switched plasma cells makes it a useful new marker along with Synd1, CD43, and Ly6C for plasma cell analysis in mice. Detailed studies with this panel may lead to further phenotypic, functional division, and life span differences within plasmablast and mature plasma cell subsets (50, 51, 52). Recently, it was shown that mice deficient in the transcription factor XBP-1 generate very few plasma cells and are defective in Ab secretion. Although it is not known whether XBP-1 is expressed constitutively during plasma cell differentiation, it will be informative to examine the expression of CD9 on B cell subsets in these mice (53, 54).
It is of interest that in xid mice MZ B cells (CD21highCD23-/low) were present, but there are only a few weakly CD9+ B cells. We also observed that spontaneous IgM+ plasma cells in unimmunized xid mice are approximately three times lower in frequency compared with control mice and also did not express CD9. It is known that xid mice contain an R28C mutation in the btk gene, have low levels of serum IgM and IgG3, and do not make TI-2 Ab responses. It appears that btk and CD9 may be involved in plasma cell differentiation during the primary humoral response (55, 56, 57).
We show that CD9 is also a marker for B1 cells. However, the strain dependence of CD9 expression by PEC B1 cells is not clearly understood at this point. In addition, our results suggest that there are at least two functionally or developmentally distinct populations among B1 cells in BALB/c mice. Interestingly, CD9- B1 cells contain CD9 mRNA transcripts, although the level was much lower than in CD9+ B1 cells. The low levels of mRNA probably relate to the rapid induction of CD9- B1 cells during differentiation into plasma cells. As the kinetics of plasma cell generation by CD9+ B1a cells occurred more quickly and lead to a higher frequency of plasma cells than for CD9- B1a cells, it appears that CD9+ B1a cells are closer to a plasma cell stage than are CD9- B1a cells. This principle also applies to FO B cells, because we have shown that MZ B cells are more differentiated or activated toward plasma cells than FO B cells, as shown by the high resting levels of Blimp-1 transcription factor in MZ B cells (19, 54).
The presence of the CD9- B1 cells in the PEC also suggests that in the B1 populations, which are chronically activated, there is a hierarchy of commitment to plasma cell and Ab production. Thus, the division of labor postulated for MZ and FO B cells may be further subdivided within each of these subsets and is reflective of further hierarchies of function and probable spatial compartmentalization.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. John F. Kearney, Division of Developmental and Clinical Immunology, University of Alabama, Wallace Tumor Institute, 6th Avenue South, Room 378, Birmingham, AL 35294-3300. E-mail address: john.kearney{at}ccc.uab.edu
3 Abbreviations used in this paper: FO, follicular; MZ, marginal zone; TI, T independent; TG, transgenic; PEC, peritoneal cavity; SA, streptavidin; synd1, syndecan 1; GC, germinal center.
Received for publication January 8, 2002. Accepted for publication April 3, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B is required for the development of marginal zone B lymphocytes. J. Exp. Med. 192:1175.
R. Ann. NY Acad. Sci. 651:84.[Medline]
2-microglobulin-dependent and independent forms. J. Immunol. 161:1710.
61: implications for murine fertilization. Proc. Natl. Acad. Sci. USA 96:11830.This article has been cited by other articles:
|
|
 |
|
  R. Song, Y.-W. Kim, B.-K. Koo, H.-W. Jeong, M.-J. Yoon, K.-J. Yoon, D.-J. Jun, S.-K. Im, J. Shin, M.-P. Kong, et al. Mind bomb 1 in the lymphopoietic niches is essential for T and marginal zone B cell development J. Exp. Med., October 27, 2008; 205(11): 2525 - 2536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Racine, M. Chatterjee, and G. M. Winslow CD11c Expression Identifies a Population of Extrafollicular Antigen-Specific Splenic Plasmablasts Responsible for CD4 T-Independent Antibody Responses during Intracellular Bacterial Infection J. Immunol., July 15, 2008; 181(2): 1375 - 1385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. W. Kin, D. M. Crawford, J. Liu, T. W. Behrens, and J. F. Kearney DNA Microarray Gene Expression Profile of Marginal Zone versus Follicular B Cells and Idiotype Positive Marginal Zone B Cells before and after Immunization with Streptococcus pneumoniae J. Immunol., May 15, 2008; 180(10): 6663 - 6674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Marino, M. Batten, J. Groom, S. Walters, D. Liuwantara, F. Mackay, and S. T. Grey Marginal-Zone B-Cells of Nonobese Diabetic Mice Expand With Diabetes Onset, Invade the Pancreatic Lymph Nodes, and Present Autoantigen to Diabetogenic T-Cells Diabetes, February 1, 2008; 57(2): 395 - 404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-J. Won, M. F. Bachmann, and J. F. Kearney CD36 Is Differentially Expressed on B Cell Subsets during Development and in Responses to Antigen J. Immunol., January 1, 2008; 180(1): 230 - 237. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Pellegrini, N. Guinazu, M. P. Aoki, I. C. Calero, E. A. Carrera-Silva, N. Girones, M. Fresno, and S. Gea Spleen B cells from BALB/c are more prone to activation than spleen B cells from C57BL/6 mice during a secondary immune response to cruzipain Int. Immunol., December 1, 2007; 19(12): 1395 - 1402. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ostrowski, M. Vermeulen, O. Zabal, P. I. Zamorano, A. M. Sadir, J. R. Geffner, and O. J. Lopez The Early Protective Thymus-Independent Antibody Response to Foot-and-Mouth Disease Virus Is Mediated by Splenic CD9+ B Lymphocytes J. Virol., September 1, 2007; 81(17): 9357 - 9367. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Kaminski and J. Stavnezer Antibody class switching differs among SJL, C57BL/6 and 129 mice Int. Immunol., April 1, 2007; 19(4): 545 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Unternaehrer, A. Chow, M. Pypaert, K. Inaba, and I. Mellman The tetraspanin CD9 mediates lateral association of MHC class II molecules on the dendritic cell surface PNAS, January 2, 2007; 104(1): 234 - 239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-J. Won, J. B. Foote, M. R. Odom, J. Pan, J. F. Kearney, and R. S. Davis Fc Receptor Homolog 3 Is a Novel Immunoregulatory Marker of Marginal Zone and B1 B Cells J. Immunol., November 15, 2006; 177(10): 6815 - 6823. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-a. Ha, M. Tsuji, K. Suzuki, B. Meek, N. Yasuda, T. Kaisho, and S. Fagarasan Regulation of B1 cell migration by signals through Toll-like receptors J. Exp. Med., October 30, 2006; 203(11): 2541 - 2550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Hoek, P. Antony, J. Lowe, N. Shinners, B. Sarmah, S. R. Wente, D. Wang, R. M. Gerstein, and W. N. Khan Transitional B Cell Fate Is Associated with Developmental Stage-Specific Regulation of Diacylglycerol and Calcium Signaling upon B Cell Receptor Engagement J. Immunol., October 15, 2006; 177(8): 5405 - 5413. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hassler, C. Ramsey, M. C. Karlsson, D. Larsson, B. Herrmann, B. Rozell, M. Backheden, L. Peltonen, O. Kampe, and O. Winqvist Aire-deficient mice develop hematopoetic irregularities and marginal zone B-cell lymphoma Blood, September 15, 2006; 108(6): 1941 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nijnik, H. Ferry, G. Lewis, E. Rapsomaniki, J. C. H. Leung, A. Daser, T. Lambe, C. C. Goodnow, and R. J. Cornall Spontaneous B cell hyperactivity in autoimmune-prone MRL mice Int. Immunol., July 1, 2006; 18(7): 1127 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yamanishi, T. Iizumi, E. Watanabe, M. Shimizu, S. Kamiya, K. Nagata, Y. Kumagai, Y. Fukunaga, and H. Takahashi Implications for Induction of Autoimmunity via Activation of B-1 Cells by Helicobacter pylori Urease Infect. Immun., January 1, 2006; 74(1): 248 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Viau, N. S. Longo, P. E. Lipsky, and M. Zouali Staphylococcal Protein A Deletes B-1a and Marginal Zone B Lymphocytes Expressing Human Immunoglobulins: An Immune Evasion Mechanism J. Immunol., December 1, 2005; 175(11): 7719 - 7727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Srivastava, W. J. Quinn III, K. Hazard, J. Erikson, and D. Allman Characterization of marginal zone B cell precursors J. Exp. Med., November 7, 2005; 202(9): 1225 - 1234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Cariappa, T. Shoham, H. Liu, S. Levy, C. Boucheix, and S. Pillai The CD9 Tetraspanin Is Not Required for the Development of Peripheral B Cells or for Humoral Immunity J. Immunol., September 1, 2005; 175(5): 2925 - 2930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Vora, E. Nichols, G. Porter, Y. Cui, C. A. Keohane, R. Hajdu, J. Hale, W. Neway, D. Zaller, and S. Mandala Sphingosine 1-phosphate receptor agonist FTY720-phosphate causes marginal zone B cell displacement J. Leukoc. Biol., August 1, 2005; 78(2): 471 - 480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Choudhury, M. A. Maldonado, P. L. Cohen, and R. A. Eisenberg The Role of Host CD4 T Cells in the Pathogenesis of the Chronic Graft-versus-Host Model of Systemic Lupus Erythematosus J. Immunol., June 15, 2005; 174(12): 7600 - 7609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Rolf, V. Motta, N. Duarte, M. Lundholm, E. Berntman, M.-L. Bergman, L. Sorokin, S. L. Cardell, and D. Holmberg The Enlarged Population of Marginal Zone/CD1dhigh B Lymphocytes in Nonobese Diabetic Mice Maps to Diabetes Susceptibility Region Idd11 J. Immunol., April 15, 2005; 174(8): 4821 - 4827. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Girkontaite, V. Sakk, M. Wagner, T. Borggrefe, K. Tedford, J. Chun, and K.-D. Fischer The Sphingosine-1-Phosphate (S1P) Lysophospholipid Receptor S1P3 Regulates MAdCAM-1+ Endothelial Cells in Splenic Marginal Sinus Organization J. Exp. Med., December 6, 2004; 200(11): 1491 - 1501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Whitmore, H. R. Neely, R. Diz, and P. M. Flood Rapid Induction of Splenic and Peritoneal B-1a Cells in Adult Mice by Thymus-Independent Type-2 Antigen J. Immunol., November 1, 2004; 173(9): 5406 - 5414. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ato, H. Nakano, T. Kakiuchi, and P. M. Kaye Localization of Marginal Zone Macrophages Is Regulated by C-C Chemokine Ligands 21/19 J. Immunol., October 15, 2004; 173(8): 4815 - 4820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Gatto, C. Ruedl, B. Odermatt, and M. F. Bachmann Rapid Response of Marginal Zone B Cells to Viral Particles J. Immunol., October 1, 2004; 173(7): 4308 - 4316. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Burke, A. J. Stagg, P. A. Bedford, N. English, and S. C. Knight IL-10-Producing B220+CD11c- APC in Mouse Spleen J. Immunol., August 15, 2004; 173(4): 2362 - 2372. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Goodyear and G. J. Silverman Staphylococcal toxin induced preferential and prolonged in vivo deletion of innate-like B lymphocytes PNAS, August 3, 2004; 101(31): 11392 - 11397. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Cancro and J. F. Kearney B Cell Positive Selection: Road Map to the Primary Repertoire? J. Immunol., July 1, 2004; 173(1): 15 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Arce, E. Luger, G. Muehlinghaus, G. Cassese, A. Hauser, A. Horst, K. Lehnert, M. Odendahl, D. Honemann, K.-D. Heller, et al. CD38 low IgG-secreting cells are precursors of various CD38 high-expressing plasma cell populations J. Leukoc. Biol., June 1, 2004; 75(6): 1022 - 1028. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Attanavanich and J. F. Kearney Marginal Zone, but Not Follicular B Cells, Are Potent Activators of Naive CD4 T Cells J. Immunol., January 15, 2004; 172(2): 803 - 811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kretschmer, A. Jungebloud, J. Stopkowicz, T. Kleinke, R. Hoffmann, and S. Weiss The Selection of Marginal Zone B Cells Differs from That of B-1a Cells J. Immunol., December 15, 2003; 171(12): 6495 - 6501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ferry, M. Jones, D. J. Vaux, I. S.D. Roberts, and R. J. Cornall The Cellular Location of Self-antigen Determines the Positive and Negative Selection of Autoreactive B Cells J. Exp. Med., November 3, 2003; 198(9): 1415 - 1425. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A K Singh and Y Jiang Lipopolysaccharide (LPS) induced activation of the immune system in control rats and rats chronically exposed to a low level of the organothiophosphate insecticide, acephate Toxicology and Industrial Health, March 1, 2003; 19(2-6): 93 - 108. [Abstract] [PDF]
|
|
|
|
|
|
H. Amano, E. Amano, T. Moll, D. Marinkovic, N. Ibnou-Zekri, E. Martinez-Soria, I. Semac, T. Wirth, L. Nitschke, and S. Izui The Yaa Mutation Promoting Murine Lupus Causes Defective Development of Marginal Zone B Cells J. Immunol., March 1, 2003; 170(5): 2293 - 2301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Dalwadi, B. Wei, M. Schrage, T. T. Su, D. J. Rawlings, and J. Braun B Cell Developmental Requirement for the G{alpha}i2 Gene J. Immunol., February 15, 2003; 170(4): 1707 - 1715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wadehra, R. Iyer, L. Goodglick, and J. Braun The Tetraspan Protein Epithelial Membrane Protein-2 Interacts with beta 1 Integrins and Regulates Adhesion J. Biol. Chem., October 18, 2002; 277(43): 41094 - 41100. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
