|
|
||||||||

* Laboratory of Experimental Immunology, Center for Cancer Research, and
Intramural Research Support Program, SAIC-Frederick, National Cancer Institute, Frederick, MD 21702
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The activation of Ly49 genes during murine NK cell development presents an interesting system for the study of selective gene expression. It has been proposed that a stochastic process controls the activation of Ly49 gene transcription, because the proportion of NK cells that express two Ly49 proteins is roughly equivalent to the product of the proportion of NK cells expressing the individual receptors (9). Single cell RT-PCR analysis of Ly49 expression has shown that the majority of NK cells express from one to four different receptors per cell and NK cells with five or more Ly49 proteins are extremely rare, supporting the theory that the Ly49 genes are activated by a probabilistic mechanism (10).
The promoter region responsible for the expression of Ly49a in mature NK/NK-T cells has been cloned, and the role of cis-acting elements in gene activation and cell-specific transcription has been studied (11, 12, 13). The trans-acting T cell-specific factor-1 has been shown to be required for the acquisition of Ly49A expression during development (13). The activating transcription factor-2 binds to a 13-bp element adjacent to the predicted TATAA of Ly49a, and it is the major factor responsible for Ly49a transcription in EL-4 cells (12). A study of the 5' region of the Ly49i gene identified a core promoter that is preferentially transcribed in a Ly49-expressing cell line, EL-4 (14). Surprisingly, sequence elements immediately upstream from the core promoter were found to inhibit activity, and no enhancers were detected in the upstream region analyzed. An inhibitory upstream element was also detected in a functional analysis of the Ly49c and j promoters (15). The lack of detectable enhancer elements immediately upstream of these promoters suggests that additional control elements may exist elsewhere. The current knowledge of Ly49 promoter structure and function has not provided any insight with respect to the mechanisms responsible for the stochastic activation of Ly49 genes.
Extensive screening of a 129/J liver NK cell cDNA library resulted in the identification of several novel Ly49 genes, including an unusual cDNA clone of Ly49g containing an alternative first exon (16). This result indicated the presence of an alternative Ly49 promoter. This study describes the isolation and characterization of the novel promoter from several Ly49 genes.
| Materials and Methods |
|---|
|
|
|---|
EL-4 and P815 cell lines were cultured in RPMI 1640 supplemented with 10% FBS, 100 U/ml penicillin, and 100 U/ml streptomycin. The LNK cell line (17) was cultured in RPMI 1640 containing 2-ME, nonessential amino acids, 10% FBS, 100 U/ml penicillin, 100 U/ml streptomycin, sodium pyruvate, L-glutamine, HEPES, and IL-2 (8000 IU/ml).
Cell isolation
Mouse NK cells were purified from livers or spleens of 129/J or B6 mice. Liver NK cells were isolated as previously described (18). Routinely, 7580% of the resulting cells were NK1.1+. Spleen cells were sorted for DX5+CD3- NK cells or DX5+CD3+ NK-T cells on a MoFlo Cell Sorter (Cytomation, Ft. Collins, CO). Bone marrow cells were isolated from the femurs and tibias of B6 mice. After lysis of RBCs, the remaining cells were washed with PBS and counted. Total liver and thymus cell suspensions were isolated from day-15 B6 embryos. Animal care was provided in accordance with the procedures outlined in "A Guide for the Care and Use of Laboratory Animals" (National Institutes of Health, publication no. 86-23, 1985).
RT-PCR analysis of promoter use
Cellular poly(A)+ RNA was isolated using the QuickPrep mRNA kit (Amersham Pharmacia Biotech, Piscataway, NJ). Oligo(dT)-primed cDNA was synthesized using the Superscript cDNA synthesis kit (Invitrogen, Carlsbad, CA). One microliter of cDNA was amplified using 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s with specific primers using Platinum PCR Supermix (Invitrogen). The antisense primer used to detect promoter (Pro)3-1 activity was from a conserved region of exon 4 at position 261 of the Ly49 coding sequence (5'-TCACTTTGCATGTTGCTGCAG). A degenerate antisense primer spanning the Ly49 termination codon (5'-CTSRTTGGARARTYAATSAGG) was used to amplify and clone the complete coding region. The -1a exon forward primers were 5'-GCAAGTCCTCCCAGTGAAGC and 5'-TTGCAGCTGTGCAATGATAG, and the exon 1 forward primer was 5'-GAGGTTGAGTATCACTCAGTGG.
RNase protection assays
The RNase protection assay (RPA) was performed according to the
manufacturers protocol using an RPA kit (RPA II; Ambion, Austin, TX).
To localize the transcription initiation site of the Ly49g
alternative promoter in EL-4 cells, an antisense Ly49g RNA
probe was generated from the Ly49g Pro-1 clone in
pCR2.1-TOPO linearized with HindIII. In vitro transcription
was performed according to the manufacturers protocols using the T7
MAXIscript (Ambion) in vitro transcription kit. The
[
-33P]RNA was separated on a 6% denaturing
polyacrylamide gel and the full-length 500-bp probe was excised and
eluted by overnight incubation at 37°C in gel elution buffer
(Ambion). Approximately 2 x 105 cpm of the
gel-purified Ly49g-specific probe was added to 1 µg of
poly(A)+ mRNA from either LNK or EL-4 cells in
each reaction mixture. The protected mRNA products were separated on a
6% denaturing polyacrylamide gel. The gel was dried and exposed for
72 h in a PhosphorImager cassette (Molecular Dynamics, Sunnyvale,
CA). The image was visualized using PhosphorImager SI analysis and
ImageQuaNT (Molecular Dynamics).
Generation of luciferase reporter plasmids
The Ly49i-Pro1 construct was generated by PCR from a 5-kb
PstI fragment of the Ly49i promoter region
(14) using a reverse primer within the predicted exon -1a
(5'-AACCTGTCATAGTCACAGCC) and a T7 primer from the vector. The 330-bp
PCR product was subcloned into the pCR-XL-TOPO vector (Invitrogen). A
400-bp XhoI/HindIII fragment was purified from
pCR-XL-TOPO and inserted into the pGL3-basic vector (Promega, Madison,
WI). To generate the Ly49i-3'-Pro1 construct, Ly49i-Pro1 was digested
with SmaI and BstZ17I to remove the 5' region of
the promoter, and the remaining vector was religated. The Ly49i-5'-Pro1
construct was generated by digestion of Ly49i-Pro1 with
BstZ17I and HindIII to remove the 3' region, and
the remaining vector was religated using Klenow to fill in the
HindIII site. To generate a Ly49j construct
similar to Ly49i-altpro, PCR was performed on a B6 BAC clone (RPCI-23
416H5) with primers corresponding to the 5' and 3' ends of Ly49i-altpro
(forward, CCTGCTATCATGTTTATTACATTCC; reverse,
GGGAGGACTTGCTTATCCTG). The PCR product was subcloned into
pCR2.1-TOPO and then transferred to pGL3-basic using SacI
and XhoI, resulting in the Ly49j-altpro luciferase
construct. The Ly49g alternative promoter region was
isolated by PCR from a 129/J BAC clone (RPCI-22, 10L7) using primers
(forward 5'-TTCCTTGCACTCAGTGCTTG; reverse 5'-CAGTCAGACCCTTGGACTG)
and cloned into pCR2.1-TOPO. The cloned insert was shown to contain the
alternative promoter region of Ly49g (Fig. 1
B). A fragment containing the
core promoter region was generated using primers (forward
5'-CAGGGTAAATACAAGAACAGG; reverse 5'-CCAGTGTCCCACCTCTTGG) and
cloned into pCR2.1-TOPO. The Ly49g Pro-1 core was
transferred to pGL3-basic using HindIII and XhoI,
resulting in the Ly49g-Pro1 luciferase construct. The Ly49a-Pro2
construct was generated by ligating a XbaI-EcoRV
fragment of the Ly49a promoter region (12) into
pGL3-basic. The Ly49a-2kb construct was generated by PCR from a B6 BAC
clone (RPCI-23 416H5) using the following primers: forward,
CAATCTATTAGGAGTCAGGC; reverse, CCACTGAGAGATACTCACCTC.
Ly49a-2kb+Pro-1 was generated by inserting the Ly49g Pro-1
core in front of the 2-kb region using SacI and
XhoI. All constructs were verified by sequencing with
specific primers. Sequence analysis was performed with the SeqWeb
package at the Frederick Cancer Reaearch and Development Center
supercomputing center (Frederick, MD).
|
A total of 4 x 106 P815 cells in RPMI medium without serum were transfected with 10 µg of the individual reporter constructs by electroporation using a GenePulser (Bio-Rad, Richmond, CA) set at 240 mV, 960 µF. EL-4 or LNK cells were plated at 3 x 105 cells per well in a six-well plate and transfected with 1 µg of the individual reporter constructs plus 0.1 µg of the Renilla luciferase pRL-SV40 control DNA using Lipofectamine (Life Technologies, Gaithersburg, MD) according to the manufacturers protocol. Luciferase activity was assayed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturers instructions. Cells were washed with PBS and lysed in 500 µl of passive lysis buffer. A clear lysate was obtained by centrifugation at 12,000 rpm for 30 s. A total of 20 µl of the supernatant was added to 100 µl of luciferase assay reagent and the firefly luciferase activity was read. To measure the activity of the Renilla luciferase control, 100 µl of Stop and Glow reagent (Promega) was added and the sample was read. The luciferase activity of the Ly49 promoter constructs was normalized relative to the activity of the Renilla luciferase produced by the pRL-SV40 control vector.
| Results |
|---|
|
|
|---|
The studies of Ly49 promoter function reported to date
have focused on the region preceding the 5' end of cDNAs isolated from
mature NK cells. The isolation of a variant of Ly49g from
129/J liver NK cells that contained a novel 5' untranslated region
suggested that an additional promoter existed. A search of GenBank with
the novel sequence yielded significant matches to a region 5' of the
Ly49a promoter and two regions upstream of the
Ly49i promoter. This result indicated the presence of an
additional promoter as well as an additional noncoding exon upstream of
the Ly49g promoter. Three B6 BAC clones were identified
(GenBank accession nos. AC087336, AC090127, and AC090563) that
contained the intergenic sequences preceding the Ly49a,
cf, hk, m, and n genes.
Sequences corresponding to the predicted novel exons were found in all
Ly49 genes examined; however, this sequence was less
homologous in the activating Ly49 genes. We have named the
novel exons as exon -1a and exon -1b. For the purposes of this
discussion, the novel promoter is designated as Pro-1. The promoter
responsible for the majority of Ly49 transcripts in mature
NK cells is referred to as Pro-2, and the promoter located next to exon
2 recently described by McQueen et al. (15) is referred to
as Pro-3. The relative position of each promoter is shown in Fig. 1
A. Primers from conserved regions of the available Pro-1
sequences were used to isolate the Pro-1 region of the 129/J
Ly49g and j genes by PCR. The nucleotide
sequences of the novel promoter and downstream exon regions of
Ly49a, d, e, g,
i, and j are presented in Fig. 1
, B
and C. Exon -1b was flanked by consensus splice donor and
acceptor sequences in the Ly49a, d, g,
h, k, and n genes, but the splice
acceptor sequence of the putative exon -1b was altered in the
Ly49c, e, f, i, and
j genes, suggesting that it is nonfunctional in the
Ly49e/c subfamily (Fig. 1
C). The genomic DNA
sequence preceding the Pro-1 region of the activating Ly49
genes was found to be significantly different from that of the
inhibitory Ly49s, whereas the region upstream of the
previously described Pro-2 is highly conserved among all
Ly49s (19). The Pro-1 sequence was compared
against the available rat genomic Ly49 sequences (GenBank
accession no. AC103500; Fig. 1
B). The Pro-1 region was
conserved to the same extent as the sequences surrounding exons
(>80%), while intron sequences were less conserved (60%), suggesting
that Pro-1 represents an important functional element that has been
conserved between the two species.
Detection of Ly49 mRNAs containing exon -1a
To survey cell lines and tissues for Pro-1 activity, an
oligonucleotide primer from a conserved region of exon -1a was used in
conjunction with an antisense primer from a conserved region of exon 4
to perform RT-PCR on mRNA isolated from bone marrow, thymus, spleen NK,
liver NK, NK-T cells, the LNK cell line, and the EL-4 cell line. Fig. 2
A shows the results of an RT-PCR experiment performed with
the exon -1a forward primer as well as a control exon 1 forward primer
on mRNAs isolated from 6- to 8-wk-old B6 mice. Purified liver NK cell
mRNA generated Ly49 PCR products corresponding to spliced
transcripts containing exon -1a or exon 1, whereas purified NK-T cell
mRNA produced only Pro-2-derived PCR products. Transcripts derived from
Pro-1 were detected in bone marrow and liver NK cells, but not in
thymus or spleen NK cells. Several PCR products were cloned and
sequenced from each reaction to verify that the bands observed
represented Pro-1 or Pro-2 transcripts. In the experiment shown in Fig. 2
A, all cloned Pro-1 PCR products represented
Ly49g transcripts. Previous PCR cloning experiments have
shown a bias toward Ly49g amplification (16);
therefore, it is possible that Pro-1 transcripts for other inhibitory
Ly49 genes are present, but they are not readily isolated
using the PCR approach. To demonstrate the existence of a Pro-1
transcript for the Ly49a and o genes, Pro-1
forward and exon 4 reverse primers specific for Ly49a/o were
synthesized and used to clone the Ly49a/o Pro-1
transcripts from liver and LNK mRNA. Analysis of the EL-4 and LNK cell
lines demonstrated that Pro-1 is used in LNK but not EL-4 cells. EL-4
represents a mature
Ly49+NKRP1+CD3+
NK-T cell tumor (20), whereas the LNK cell line represents
a
Ly49-CD3-IL-2R
+CD16+CD94+
cell that lacks NK activity (17). The Ly49g
Pro-1 PCR product from LNK (BALB/c derived) was sequenced, and it was
identical to the 129/J Ly49g alternative transcript. The
Pro-2 transcript amplified from LNK was from the Ly49a gene.
However, the Ly49a Pro-1 transcript contains exon 1 and
includes the Pro-2 primer site, indicating that Pro-2 may not be active
in the LNK cell line because no Pro-2 Ly49g transcript was
detected, and the Ly49g Pro-1 transcript does not contain
exon 1. Fig. 2
B shows the results of RT-PCR on mRNAs derived
from day-15 embryonic liver and thymus. Products containing either exon
1 or exon -1a were detected; however, the exon -1a products were less
intense. Exon -1a-containing PCR products generated from thymus were
cloned into the pCR2.1 vector and sequenced. All of the clones analyzed
corresponded to transcripts from the alternative promoter of
Ly49e. This is in agreement with the previous report of
Ly49E expression in fetal thymus (21). In addition, all
clones of Ly49e contained exon -1a but not exon -1b, as
predicted by the absence of a consensus splice acceptor preceding exon
-1b in the Ly49e gene. To determine whether Pro-1 was
active at a time when most Ly49 protein expression is initiated, mRNAs
isolated from 1- to 2-wk-old B6 mice were analyzed. Fig. 2
C
demonstrates significant Pro-1 activity in the bone marrow of
neonatal mice.
|
Pro-1 transcripts containing the complete Ly49 coding region were
isolated by PCR with the exon -1a primer and a degenerate reverse
primer located 3' of the Ly49 termination codon. Products
from 129/J and B6 liver NK cell mRNA were cloned into the pCR2.1 vector
and 10 clones were sequenced from each strain. A summary of the
observed cDNAs derived from Pro-1 is shown in Fig. 3
. Both strains produced several cDNAs
corresponding to Ly49g that contained exons -1a and -1b,
but skipped exon 1, splicing directly to exon 2. The B6- and
129/J-derived transcripts of Ly49e lacked exon -1b and used
an exon 1 splice acceptor close to the Pro-2 start site. Pro-1-derived
transcripts of Ly49v isolated from 129/J NK cells contained
both exons -1a and -1b; however, exon 1 was also found in all
Ly49v clones due to the use of a splice acceptor 175 bp
upstream from the previously described Pro-2 initiation site in the
Ly49a gene (11). Pro-1 transcripts of
Ly49a could not be isolated with the exon -1a primer used
for PCR analysis, so an additional primer near the 3' end of exon -1a
was used to successfully amplify the Pro-1 Ly49a transcript.
Exon -1b of Ly49a was 117 bp larger than the
Ly49g and v exon -1b due to the use of an
upstream splice acceptor site. The Ly49a exon 1 splice
acceptor site was the same as that used by the Ly49v Pro-1
transcripts, and this provides an explanation for the previous
identification of Ly49a cDNAs that extend 5' of the reported
Pro-2 start site (22, 23). The Ly49a,
o, and v Pro-1 transcripts contain the Pro-2
region, preventing specific detection of Pro-2 transcripts if
Ly49a, o, or v Pro-1 transcripts are
present. Of the five Ly49v clones sequenced, three
represented alternatively spliced products lacking a complete open
reading frame. Three clones did not contain exon 3, and one of these
also contained a novel alternative exon contained in intron 6, as
determined by comparing the Ly49v sequence with the partial
B6 Ly49v sequence contained in GenBank (accession no.
AC090563). The novel exon (6b) contains an in-frame stop codon,
resulting in a truncated Ly49 coding region. The Pro-1 transcripts of
Ly49a, e, g, v, and
alt-v have been deposited in GenBank and can be found under
accession numbers AY078436, AF419251, AF419249, AF419250, and AF444273,
respectively. To determine whether full-length transcripts from the
promoter in intron 2 (Pro-3) could be detected, a forward primer from
intron 2 was used in conjunction with an exon 7 antisense primer. Fully
spliced Ly49g and v cDNAs derived from Pro-3 were
detected in spleen NK cell mRNA (data not shown).
|
Cloning and sequencing of cDNAs produced from Pro-1 indicated that
the Ly49g gene was actively transcribed from this
alternative promoter in LNK cells. To determine the transcription
initiation site, an RNA probe encompassing the Pro-1 region of
Ly49g was synthesized and used to perform an RPA on mRNA
purified from LNK cells. Fig. 4
shows the
region of the Ly49g gene contained within the probe, as well
as the protected fragments observed. Protected fragments of 158 and 161
bp were detected in LNK mRNA, but not in mRNA from EL-4 cells which
lack detectable alternative promoter activity. This result indicates
the presence of two transcription start sites 13 and 16 bp upstream of
the 5' end of the alternative Ly49g cDNA isolated from 129/J
NK cells. The region protected by the antisense probe and the location
of the predicted start sites are indicated in Fig. 1
B. To
rule out the possibility of additional upstream start sites, RT-PCR was
performed with a series of 5' primers spanning the predicted start
site. Primers upstream of the predicted initiation region were unable
to amplify Pro-1 cDNA, indicating that there are no additional upstream
start sites (data not shown).
|
To locate and characterize sequence elements required for Pro-1
activity in LNK cells, several luciferase reporter constructs were
generated. The regions cloned and the reporter constructs generated are
shown in Fig. 5
A. Examination
of the region preceding exon -1a in the Ly49i gene revealed
a potential TATAA-related element (CATAAAA) 25 nt upstream from the 5'
end of the region with homology to the Ly49g cDNA. A
(CATAAAA) sequence is also found 29 bp upstream from the Pro-2
initiation site of the Ly49a promoter (11). To
test this region for promoter activity, a 250-bp fragment containing
the predicted Pro-1 element of Ly49i was cloned into the
pGL3 luciferase reporter vector. Transfection of this construct
(Ly49i-Pro1) into EL-4 and LNK cells revealed the presence of a
promoter that displayed strong activity in the LNK cell line and no
detectable activity in EL-4 cells (Fig. 5
B), consistent with
the PCR results shown in Fig. 2
. Removal of the 5' half of the
Ly49i-Pro1 construct yielded a 140-bp fragment that retained the same
relative promoter activity, localizing the core promoter region. A
Ly49j luciferase construct similar to Ly49i-Pro1 was tested
and no activity was found. The CATAAAA element is not present in
Ly49j, and the region encompassing the transcriptional start
site has been deleted. Although the Ly49g Pro-1 region does
not contain a CATAAAA element, a TATAAA element is located 25 nt
upstream from the predicted transcription initiation sites. A
luciferase construct containing the Ly49g alternative
promoter region also possessed LNK-specific transcriptional activity. A
luciferase construct containing the previously characterized
Ly49a promoter (Ly49a-Pro2) was used as a control, and it
was active in EL-4 but not LNK cells. An additional construct
containing 2 kb upstream of the Ly49a Pro-2 core promoter
(Ly49a-2kb) was tested and shown to contain the same inhibitory
activity observed in the Ly49c, i, and
j promoters. The lack of Pro-2 activity in LNK cells is
contrary to the observed Pro-2 transcripts detected by PCR in Fig. 2
;
however, the Ly49a Pro-1 transcript contains the Pro-2 start
site, resulting in a false positive result for Pro-2 because
Ly49a Pro-1 transcripts are present. Cloning of the Pro-2
PCR band indicated that it corresponded to the Ly49a
transcript. To determine whether Pro-1 was capable of activating Pro-2
transcription, the core Pro-1 element without the exon -1a splice
donor was added to the extended Ly49a construct
(Ly49a-2kb+Pro1). The exon -1a splice donor was not included in the
Ly49a-2kb+Pro1 construct to avoid the production of spliced transcripts
that could result in luciferase activity driven by Pro-1. Pro-1
transcripts produced from this construct would contain a long noncoding
region that would presumably inhibit luciferase translation.
Transfection of this construct into LNK cells did not result in
significant luciferase activity, which may be due to the inability of
the Pro-2 core to function in LNK cells coupled with inefficient
translation of the unspliced Pro-1 transcript. To reliably test for the
ability of Pro-1 transcription to overcome the inhibitory effects of
the region preceding Pro-2 it will be necessary to identify a cell line
that is permissive for both Pro-1 and Pro-2.
|
| Discussion |
|---|
|
|
|---|
The 5' untranslated region of Pro-1 transcripts is significantly longer than that of Pro-2 transcripts, suggesting possible differences in their translation efficiencies. Transfection of full-length Ly49g Pro-1 or Pro-2 cDNAs into 293T cells failed to show any differences in the surface expression of Ly49G (data not shown). One potential effect of the Pro-1-derived 5' region may relate to the production of alternatively spliced products. Three of five Ly49v clones isolated were missing exon 3, and one clone contained a novel alternative exon (6b) that disrupted the open reading frame. Perhaps the presence of the Pro-1 noncoding region enhances the production of alternatively spliced Ly49 mRNAs. Our laboratory has been unable to identify any Ly49 protein products resulting from cDNAs lacking the third exon (27), suggesting that the primary role of Pro-1 transcription may be to activate the gene, and Ly49 protein expression from this promoter is down-regulated by alternative splicing.
Studies of the Ly49 promoter used by mature NK cells (Pro-2) have not provided an explanation for the stochastic activation of Ly49 genes. The discovery of an upstream Ly49 promoter (Pro-1) that is primarily active in tissues where Ly49 expression is initiated suggests that further study of this novel promoter may lead to an understanding of the mechanisms underlying the seemingly random activation of Ly49 genes. Generation of Ly49 transgenic mice with mutations in the Pro-1 region will enable a direct evaluation of the role of Pro-1 in the stochastic process of Ly49 gene activation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Stephen K. Anderson, SAIC-Frederick, National Cancer Institute-Frederick Cancer Research and Development Center, Building 560, Room 31-93, Frederick, MD 21702-1201. E-mail address: andersn{at}ncifcrf.gov ![]()
3 Abbreviations used in this paper: Pro, promoter; RPA, RNase protection assay. ![]()
Received for publication November 15, 2001. Accepted for publication March 12, 2002.
| References |
|---|
|
|
|---|
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine NK cell clones. J. Immunol. 157:3967.[Abstract]
-globin gene constructs suggests a novel mechanism for gene regulation. Nature 322:562.[Medline]
This article has been cited by other articles:
![]() |
A. Rouhi, C. B. Lai, T. P. Cheng, F. Takei, W. M. Yokoyama, and D. L. Mager Evidence for high bi-allelic expression of activating Ly49 receptors Nucleic Acids Res., July 15, 2009; (2009) gkp592v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cichocki, R. J. Hanson, T. Lenvik, M. Pitt, V. McCullar, H. Li, S. K. Anderson, and J. S. Miller The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element Blood, April 2, 2009; 113(14): 3245 - 3253. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pascal, N. R. Nathan, E. Claudio, U. Siebenlist, and S. K. Anderson NF-{kappa}B p50/p65 Affects the Frequency of Ly49 Gene Expression by NK Cells J. Immunol., August 1, 2007; 179(3): 1751 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kveberg, C. J. Back, K.-Z. Dai, M. Inngjerdingen, B. Rolstad, J. C. Ryan, J. T. Vaage, and C. Naper The Novel Inhibitory NKR-P1C Receptor and Ly49s3 Identify Two Complementary, Functionally Distinct NK Cell Subsets in Rats J. Immunol., April 1, 2006; 176(7): 4133 - 4140. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rouhi, L. Gagnier, F. Takei, and D. L. Mager Evidence for epigenetic maintenance of Ly49A monoallelic gene expression. J. Immunol., March 1, 2006; 176(5): 2991 - 2999. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Tanamachi, D. C. Moniot, D. Cado, S. D. Liu, J. K. Hsia, and D. H. Raulet Genomic Ly49A Transgenes: Basis of Variegated Ly49A Gene Expression and Identification of a Critical Regulatory Element J. Immunol., January 15, 2004; 172(2): 1074 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. T. Wilhelm, J.-R. Landry, F. Takei, and D. L. Mager Transcriptional Control of Murine CD94 Gene: Differential Usage of Dual Promoters by Lymphoid Cell Types J. Immunol., October 15, 2003; 171(8): 4219 - 4226. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ljutic, J. R. Carlyle, and J. C. Zuniga-Pflucker Identification of Upstream cis-Acting Regulatory Elements Controlling Lineage-specific Expression of the Mouse NK Cell Activation Receptor, NKR-P1C J. Biol. Chem., August 22, 2003; 278(34): 31909 - 31917. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |