| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Transplantation and Immunobiology Group, John P. Robarts Research Institute, and Departments of Microbiology and Immunology, and Medicine, University of Western Ontario, London, Ontario, Canada;
Center for Neurological Diseases, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and
Genetics Institute Inc., Cambridge, MA 02140
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
It has been reported that phosphotyrosine-dependent recruitment of the SHP-2 phosphatase to CTLA-4 inhibits T cell activation and expansion by dephosphorylation of CD3/TCR chains (10, 11). However, phosphorylation of CTLA-4 is not required for its negative function (11, 12, 13, 14), although it is needed for CTLA-4 retention on the T cell membrane along with the TCR complex (15, 16).
Recent genetic evidence indicates that CTLA-4 and CD28 may interact with the catalytic domain of serine/threonine phosphatase 2A (PP2A)5 (17). The biochemical basis and the functional implications of these associations are unknown. By using a yeast two-hybrid system, we have identified the regulatory subunit of PP2A (also called PP2AA) as one of the interacting molecules that bind to the tail of CTLA-4. Our results suggest that binding of PP2AA to CTLA-4 down-regulates CTLA-4 function, while coligation of the TCR with CTLA-4 causes phosphorylation and dissociation of PP2AA from CTLA-4 and inhibition of T cell activation. The association between PP2AA and CTLA-4 is mediated by a conserved lysine (K)-rich motif in the juxtamembrane portion of the cytoplasmic tail of CTLA-4 because K-less mutants of CTLA-4 (mutant molecules without these lysine residues) have significantly reduced binding to PP2AA and show enhanced CTLA-4 function. These results indicate that the K-rich region of the CTLA-4 molecule can be used as a target for the identification of agonists of CTLA-4 function.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
The panel of Jurkat T cells transfected with a regulatable, doxycycline-sensitive CTLA-4 cDNA has been previously reported (6, 13). The K-less mutant was generated using the PFU polymerase-based QuikChange Site Directed Mutagenesis kit (Stratagene, La Jolla, CA) according to manufacturer’s instructions using the oligonucleotides: CCTCACAGCTGTTTCTTTGAGCGCAATGCTAGCGGCAAGAAGCCCTCTTACAACAGGGG and its complement, CCCCTGTTGTAAGAGGGCTTCTTCCCGCTAGCATTGCGCTCAAAGAAACAGCTGTGAGG as mutagenic primers and human CTLA-4/pBIG2i as template. Plasmid isolates were recovered and human CTLA-4, K-less mutant clones were confirmed by sequencing. A luciferase reporter cDNA under the control of the IL-2 promoter and enhancer elements (kindly provided by Dr. A. Weiss, University of California, San Francisco, CA) was transfected in these cells, and clones isolated after limiting dilution were used for these experiments. The 0.45 lymphoblastoid B cell line that expresses HLA-DR1 and B7.1 was kindly provided by Dr. E. Long (National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD). Both cell lines were cultured under standard conditions.
Plasmid construction
The cytoplasmic regions of mouse CTLA-4, CD28, and ICOS were generated by PCR. The cDNA encoding murine CTLA-4 cytoplasmic domain was inserted into the EcoRI site of bait vector PEG202 (Origene Technologies, Rockville, MD) to yield a Lex-A DNA binding fusion plasmid. Similarly, cytoplasmic regions of murine CD28 and ICOS were subcloned into the EcoRI site of bait vector PEG202.
The 1-kb SalI fragment of clone 54 or the 1.7-kb SalI fragment of full-length murine PP2AA was inserted into the SalI site of vector pCMV-myc (Clontech Laboratories, Palo Alto, CA), which contains an oligonucleotide encoding the myc peptide inserted into the 5' end of the multiple cloning site of the mammalian expression vector pCMV. Full-length CTLA-4 was expressed as a hemagglutinin (HA)-tagged fusion protein by inserting the CTLA-4 cDNA into the EcoRI/XhoI sites of pCMV-HA (Clontech Laboratories). Similarly, full-length CD28 and ICOS were cloned into the EcoRI/SalI sites of pCMV-HA.
Yeast two-hybrid system
A yeast two-hybrid screen of a murine Th1 T cell library was performed by cotransfecting the bait CTLA-4-PEG202 into the yeast strain EGY4-8 (Origene Technologies) along with a murine Th1 T cell library constructed in the B42 activation domain of pJG4-5 (Origene Technologies), using the Duplex A yeast two-hybrid system (Origene Technologies). The Th1 library was obtained from Drs. S. Szabo and L. Glimcher (Harvard School of Public Health, Boston, MA). Screening was performed on 2 million transformants.
Protein interactions
The plasmid vectors encoding the myc-tagged PP2AA 392–589(392–589) or full-length PP2AA and HA-tagged CD28, CTLA-4, or vector alone were cotransfected into human 293 cells using Lipofectamine reagent (Invitrogen, Carlsbad, CA) and following the manufacturer’s protocol. Transfected cells were harvested and lysed at 4°C in 1% Nonidet P-40 lysis buffer. Cell lysates were precleared and immunoprecipitated using protein G beads coated with anti-HA Abs. After an overnight incubation at 4°C, the immunoprecipitates were washed using 1% Nonidet P-40 lysis buffer. Bound proteins were eluted by boiling in SDS sample buffer, separated by SDS/15% PAGE, and transferred onto polyvinylidene difluoride membranes. Membranes were blocked with 3% BSA in PBS and then incubated with anti-mPP2AA or anti-myc Abs for detecting PP2AA 392–589(392–589). For the detection of CTLA-4 and CD28, polyvinylidene difluoride membranes were blotted with anti-CD28 and anti-CTLA-4 Abs. Subsequently, the membranes were incubated with HRP-conjugated secondary Abs, before visualization using chemiluminescence reagents.
Biochemistry
Jurkat T cells (cell number normalized for protein content) were cultured overnight in the absence or presence of doxycycline (5 µg/ml), and were stimulated for 10 min with 0.45 cells (5:1 ratio) preincubated with Staphylococcal enterotoxin E (SEE) (Toxin Technology, Sarasota, FL) for 40 min at 37°C. Cells were subsequently lysed in standard lysis buffer containing Triton X-100 (1%). Lysates were precleared with protein G agarose beads (Roche, Laval, Canada), followed by immunoprecipitation with dithiobis (succinimidyl propronate)-cross-linked Abs on protein G agarose beads, and Western blotting as previously described (13, 18, 19).
Cell surface biotinylation
Doxycycline-induced wild-type (WT)-CTLA-4-transfected cells were incubated with biotin (Pierce, Rockford, IL) (0.5 mg/ml) for 30 min at room temperature. Cells were washed with PBS and incubated with 0.45 cells for 10 min at 37°C. Cell lysates were prepared and used to immunoprecipitate with anti-biotin Abs (Jackson ImmunoResearch Laboratories, West Grove, PA). Immunoprecipitates were either eluted with sample buffer under reducing conditions or with lysis buffer (200 µl) for 10 min at 95°C to perform a second immunoprecipitation with a mAb anti-MHC class I molecule (HC10) or a mixture of anti-CTLA-4 Abs (CTLA-4-11 and CTLA-4-24), following by immunoblotting for CTLA-4 or PP2AA.
Reagents
Abs used for these experiments were: a goat polyclonal
antiserum against PP2AA
regulatory subunit, and a goat polyclonal
antiserum against Dok-1 (Santa Cruz Biotechnology, Santa Cruz, CA), a
mouse mAb against PP2A catalytic subunit (from Santa Cruz
Biotechnology and from Upstate Biotechnology, Lake Placid, NY),
a mouse mAb against phosphotyrosine (kindly provided by Dr. B. Drukker,
Oregon Health Sciences University, Portland, OR), a mouse mAb against
human CTLA-4.11, the chimeric B7.2-human IgG1 molecule (B7.2 IgG) was
obtained from Genetics Institute (Cambridge, MA), and a goat polyclonal
antiserum against a peptide from the extracellular portion of human
CD28 was purchased from Santa Cruz Biotechnology. PMA and ionomycin
were purchased from Sigma-Aldrich (St. Louis, MO).
Luciferase assay
Doxycycline-treated Jurkat T cells (0.25 x 106 cells/group) were stimulated for 4 h with 0.45 cells (ratio 2:1) preincubated overnight with different concentrations of SEE or with anti-CD3/CTLA-4 mAb-coated tosyl beads. mAb-coated beads were prepared with anti-CD3 mAb (1 µg/bead) and anti-CTLA-4 mAb (4 µg/bead) as previously described (6, 13). Beads were added to untreated or doxycycline-induced cells (ratio 1:1) in the presence of soluble anti-CD28 mAb (20 µg/ml; CD28.2; BD PharMingen, Mississauga, Canada). Luciferase assay was performed using the Promega Luciferase Assay System (Promega, Madison, WI).
Flow cytometry
Doxycycline-treated Jurkat T cells (1 x 106 cell/group) were washed and stained for CTLA-4 expression using a PE-labeled mAb against human CTLA-4 (BD PharMingen). Cells were examined by flow cytometry using a FACScan Flow Cytometer (BD Biosciences, Mountain View, CA). Statistical analyses were performed with CellQuest computer software (BD Biosciences).
Confocal microscopy
Doxycycline-treated Jurkat T cells (1 x 106 cell/group) were incubated at 37°C for 2 h on 35-mm polyl-lysine-coated glass bottom microwell dishes (MatTek, Ashland, MA). APC (0.5 x 106) were preincubated for 1 h with 100 ng/ml SEE and incubated with the T cells on the dish for 30 min. Dishes were washed twice with PBS + 1% FCS and stained sequentially on ice with PE-CTLA-4 (BD PharMingen) and FITC-CD3 (BD PharMingen) for 30 min each. Analysis was performed on a confocal microscope (Zeiss, Oberkochen, Germany) and analyzed by LSM 510 software (Zeiss and Microsoft, Redmond, WA).
|
Results and Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
-galactosidase activity (Fig. 1
A). Both clones were
identified as containing a cDNA insert spanning aa 392–589 of the
C-terminal end of PP2AA.
|
-galactosidase activity, we found
that mPP2AA 392–589(392–589) did not interact with CD28 and ICOS (Fig. 1
B), demonstrating that the mPP2AA 392–589(392–589) contained an
interacting motif specific for the cytoplasmic domain of mouse CTLA-4.
To confirm this observation in a mammalian cell system, clone 54,
representing mPP2AA 392–589(392–589), was expressed as a myc-tagged protein
of 23 kDa in H293K cells cotransfected with HA-tagged full-length
CTLA-4 or CD28 molecules. When Abs against HA were used to
immunoprecipitate HA-CD28 or HA-CTLA-4, only CTLA-4, but not CD28, was
found to associate with mPP2AA 392–589(392–589) (Fig. 2A). The absence of
interaction between mPP2AA 392–589(392–589) and CD28, even in a H293K
expression system, verified the findings in the yeast system.
Additionally, it suggested that the domain of mPP2AA encompassing aa
392–589 probably contains anchor residues that mediate binding to
CTLA-4, but not its close homolog CD28.
|
B).
This was in marked contrast to the results observed with mPP2AA
392–589(392–589) domain in both yeast and H293K cells. Together, the yeast
two-hybrid screen and the coimmunoprecipitation data in the H293K
system indicated that the full-length mPP2AA can interact with both
CD28 and CTLA-4. However, these molecules associate with PP2AA using
distinct domains for interaction. Specifically, the domain containing
residues 392–589 binds exclusively to CTLA-4, but residues 1–392
either alone or together with other residues associate with
CD28. Transient cell surface expression of CTLA-4 coupled with low levels of surface expression have been a major impediment in elucidating the molecular mechanisms involved in CTLA-4-mediated T cell function. We circumvented this problem using a well-characterized system in which Jurkat cells are induced to express transfected CTLA-4 upon exposure to doxycycline (6, 13). We have used this system previously to elucidate the structure-function relationship of CTLA-4 and its role on T cell down-regulation, and thus it offered us an excellent tool to determine the functional relevance of the CTLA-4-PP2AA association. We first investigated whether Jurkat cells expressed PP2AA. We observed that resting, noninduced Jurkat cells expressed abundant PP2AA that migrated as a 65-kDa band on Western blotting (data not shown). Furthermore, the level of endogenous PP2AA expression remained constant even after doxycycline mediated induction of CTLA-4. Hence, we concluded that the levels of endogenous PP2AA are not affected by doxycycline induction of Jurkat cells.
Next, we sought to establish the association between PP2AA and CTLA-4
in transfected Jurkat cells. We found that immunoprecipitation of the
65-kDa regulatory subunit of PP2A coprecipitated a band with a size and
blotting reactivity comparable to that of CTLA-4 (Fig. 3A). This band was absent in
H293K cells, and in a HLA-DR-1+,
B7+ lymphoblastoid B cell line used as APCs, as
well as in immunoprecipitates of CTLA-4-expressing cells with a control
goat antiserum against Dok-1 (Fig. 3A, lane labeled as
IP:Ctrl Ab). To test whether PP2AA was associated with surface CTLA-4,
we looked at the levels of CTLA-4 and PP2AA in biotinylated
CTLA-4-expressing cells after immunoprecipitation with anti-biotin
alone (Fig. 3B, 1st ip) or a sequential immunoprecipitation
with anti-biotin and anti-MHC class I Ab as control Ab, or with
anti-biotin and anti-CTLA-4 Abs. As shown in Fig. 3B, CTLA-4 was only detectable in cells induced with
doxycycline either after immunoprecipitation with anti-biotin or
after sequential immunoprecipitation with anti-biotin and
anti-CTLA-4 Abs. A 36-kDa band of unknown identity was occasionally
seen upon CTLA-4 blotting of these immunoprecipitates. Furthermore, as
shown in Fig. 3C, PP2AA was detected after
immunoprecipitation with anti-biotin alone, suggesting that PP2AA
binds to different T cell surface molecules (Fig. 3C). Most
importantly, we detected a small fraction of PP2AA specifically
associated to CTLA-4, as implied by its presence after reprecipitation
with mAb against CTLA-4 but not after reprecipitation with a mAb
against a control surface molecule (Fig. 3C).
|
A). The association between
PP2A and CTLA-4 also involved the catalytic subunit of this phosphatase
(PP2AC), consistent with reports indicating that free catalytic subunit
of PP2A cannot be found in intact cells (20). As shown in
Fig. 4B, we found that PP2AC coprecipitated with CTLA-4,
indicating that both the regulatory and catalytic subunits of PP2A can
interact with CTLA-4.
|
1/V8.1 Ag receptor complex, we tested the effects of TCR or
TCR-CTLA-4 coligation using a system in which the superantigen SEE is
presented by HLA-DR1-expressing, B7.1+ APC
(21). As shown in Fig. 5A, coligation of the TCR and
CTLA-4 with SEE and APC resulted in a time-dependent decrease in the
levels of PP2AA associated with CTLA-4, while the total levels of PP2AA
and PP2AC remained constant. Previous reports have implicated
phosphorylation of the catalytic subunit of PP2A by several kinases
including p56lck in the inactivation of PP2A
(22). This prompted us to investigate whether TCR ligation
resulted in the tyrosine phosphorylation of PP2AA as well. We found
that TCR ligation by SEE and APC caused an increase in tyrosine
phosphorylation of the regulatory subunit of PP2A in a time-dependent
fashion (Fig. 5B). The decrease in PP2AA-CTLA-4 association
was not due to a loss of CTLA-4, because the levels of surface CTLA-4
increased with stimulation as predicted from previous characterization
of the system (Fig. 5C). The precise kinetics and
stoichiometry of the association between PP2AA and CTLA-4 is currently
under investigation. It will be interesting to examine whether TCR
internalization and/or decreased TCR-mediated signaling might be
involved in the specific turnover of this association.
|
If the above model is correct, then a mutant CTLA-4 incapable of
binding to PP2AA should be a better inhibitor of T cell function than
the WT molecule. It has been reported that the sequence HENRKL in SV40
small T Ag and in the kinase domain of Casein kinase 2 is the
sequence required for binding of these proteins to the PP2A core enzyme
(23, 24). Based on this evidence, we looked for the
presence of a similar sequence in the cytoplasmic tail of CTLA-4 and in
those proteins known to form stable complexes with PP2A
(25). We found that the cytoplasmic tail of CTLA-4
contained a K-rich motif, SKMLKKRSP, in the juxtamembrane portion of
its cytoplasmic tail. Such sequence meets a consensus also found in
PP2A-binding proteins (23, 24, 25), XK/R/HXXK/R/HKXXX, and
located within regions identified as important for binding to the
regulatory subunit of PP2A (Ref. 27 ; Fig. 6A). The consensus sequence in
CTLA-4 is located immediately upstream of tyrosine residue 165, which
was shown to be critical for the binding between CTLA-4 and the
catalytic subunit of PP2A in the yeast two-hybrid study reported by
Thompson and colleagues (17). The consensus sequence
requirements for binding of proteins to the PP2AA subunit or to the
PP2AC subunit remain to be determined. However, the linear arrangement
suggested by Chuang et al. (17) and our data may secure
the association of both the catalytic and the regulatory subunits of
PP2A with CTLA-4 (20). Of interest, we could not find any
similar sequence in the cytoplasmic tail of CD28, and this could
explain the differential binding observed for PP2AA and PP2AC between
CD28 and CTLA-4 (Ref. 17 and our data).
|
B). The cause for the lower levels of cell surface
expression of this mutant molecule is currently under investigation.
However, the K-less CTLA-4 molecules were able to colocalize with the
TCR in a manner similar to that seen with WT CTLA-4 (Fig. 6C), suggesting that these molecules do not disturb the
gross arrangement of the immunological synapse.
Next, we investigated whether the mutant K-less CTLA-4, which lacks the
potential anchor residues that may mediate interaction with PP2AA, is
still capable of forming CTLA-4-PP2A complexes. Because the level of
CTLA-4 surface expression in the K-less-transfected T cells is lower
than in the WT CTLA-4-expressing cells, we sorted these cells by FACS
to achieve similar levels of surface CTLA-4 expression. Jurkat cell
lysates from these cells were used to immunoprecipitate PP2AA (Fig. 7). Unlike the WT CTLA-4, mutant K-less
CTLA-4 failed to coimmunoprecipitate with PP2AA in significant amounts.
This was not due to the inability or decreased reactivity of
anti-CTLA-4 Abs used to detect mutant K-less CTLA-4. This finding
confirmed our assumption that the lysine residues are indeed critical
for binding of CTLA-4 to PP2AA. Furthermore, it offered us an
opportunity to delineate the functional relevance of the CTLA-4-PP2A
interaction in T cells.
|
, A
and B). The enhanced inhibition of the K-less mutant was
verified by comparing the percentages of inhibition at maximal relative
luciferase unit response, to rule out intrinsic differences between the
mutants ability to transcribe IL-2. In addition, stimulation with
ionomycin and PMA showed similar responsiveness in both WT CTLA-4 and
K-less CTLA-4 T cells (Fig. 8C). Specifically, luciferase
activity was inhibited by 70–80% in K-less mutants compared with
35–55% by the WT CTLA-4 upon TCR-CTLA-4 coligation. This enhanced
inhibition is particularly significant in the context of a much lower
surface expression of K-less CTLA-4. Therefore, the lack of association
between PP2AA and K-less CTLA-4 correlated with an enhanced inhibition
of IL-2 gene transcription by CTLA-4, implying that PP2A could operate
as a negative regulator of CTLA-4 function. This required the lysine
residues at the juxtamembrane region of CTLA-4.
|
D),
ruling out any intrinsic difference in IL-2 responses due to CTLA-4
expression in the absence of its ligation. The effects of the
association of PP2A with CTLA-4 were also validated in this system
(Fig. 8D), although the enhanced function of K-less CTLA-4
over that of WT CTLA-4 using Ab-coated beads was less pronounced than
with SEE/APC stimulation. This could be due to better inhibition of WT
CTLA-4 upon forced coligation with the TCR. Furthermore, the inhibition
of T cell activation by K-less CTLA-4 is due to negative signaling,
because IL-2 gene transcription decreased after direct coligation of
CD3 and CTLA-4 using mAb-coated beads (Fig. 8D). Because PP2A plays a critical role in regulating diverse functions including cell proliferation, differentiation, and survival in different cell types (23, 24, 25), it is not difficult to envision a role for this molecule in regulating T cell-dependent immune responses. The recent identification of the catalytic subunit of PP2A as potential modulator of the function of T cells by association with CD28 supports the concept that PP2A may be a major mediator in controlling T cell responsiveness, expansion, and homeostasis (17). Our study demonstrates an association of the regulatory subunit of PP2A with the cytoplasmic domain of both CTLA-4 and CD28. Sharing a 30% sequence within their cytoplasmic domains, both molecules have a consensus phosphatidylinositol 3-kinase src homology 2 domain-binding motif and proline-rich sequences (28), and can be targets for src kinases (17, 29, 30). Hence, the association of CTLA-4 and CD28 with PP2A positions these receptors as major regulators in kinase cascades modulating signaling events in T cell activation. Both PP2A and CTLA-4 have been shown to regulate the activity of extracellular signal-related kinase (ERK) in the mitogen-activated protein kinase pathway (13, 20, 31). Interestingly, whereas CTLA-4 coligation with the TCR results in the inhibition of ERK activation, TCR ligation induces ERK activation that can be prolonged by okadaic acid, an inhibitor of PP2A, suggesting a role for PP2A in the dephosphorylation of ERK. A plausible explanation could be that TCR-CTLA-4 coligation could result in the release of PP2A from the CTLA-4-PP2A complex, with the subsequent dephosphorylation of ERK by PP2A and down-regulation of mitogen-activated protein kinase-dependent T cell responses.
The ability of CTLA-4 to cocap with the TCR at the immunological
synapse on receptor coligation suggests that a more elaborate mechanism
might be operational. The cytoplasmic domain of CTLA-4 has been
demonstrated to associate with SHP-2 (10) and the TCR
chain (11). Thus, one may argue that SHP-2-mediated
dephosphorylation of TCR may involve a CTLA-4-initiated
translocation of signaling components, including PP2A, to the center of
the immunological synapse that will prevent activation-induced
serine-threonine phosphorylation of CD28. However, the fact that the
K-less mutant can cocap with TCR just as well as the WT, but is more
effective at inhibiting IL-2 in the face of lower association with
PP2A, seems to suggest that this may not be the case. On the contrary,
these findings imply that PP2A is indeed a negative regulator of CTLA-4
function. In light of the recent definition of the crystal structure of
CTLA-4:B7 complex (32, 33, 34), it is tempting to speculate
that the formation of supramolecular arrays of CTLA-4 may be favored
upon dissociation of PP2A from CTLA-4, and thus facilitate the
inhibition of TCR-mediated activation.
The precise nature of the interaction between PP2AA and the K-rich
region of the CTLA-4 cytoplasmic tail remains to be defined. One could
propose that electrostatic interactions maintain these two molecules
together, as it has been reported for the association between Ly-49
with DAP-12 in NK cells (35, 36, 37, 38). Coligation of TCR and
CTLA-4 may favor electrostatic interactions between TCR and CTLA-4,
following phosphorylation and dissociation of PP2A from CTLA-4. This
hypothesis is further supported by recent data that also
identify the first 7 aa of the CTLA-4 tail (and particularly the two
distal lysine residues) as important for the proper interaction between
CTLA-4 and TCR and subsequent inhibition of TCR-mediated
signaling (K. Lee, M. Griffin, and J. A. Bluestone, unpublished
observations). However, our data indicate that this region is important
for the negative regulation of CTLA-4 function before TCR ligation and
T cell activation. Because the occupancy of this domain by either PP2AA
or TCR is dictated by the activation status of the cell, it is possible
that the juxtamembrane region functions as an anchor for PP2A in
resting cells "containing" T cell activation. In contrast, after T
cell activation, the lysine-rich motif becomes available for TCR
association and T cell down-regulation mediated by CTLA-4. This may
explain why the lack of the three juxtamembrane lysine residues on the
CTLA-4 tail enhance the function of CTLA-4 by causing a net increase in
PP2AA-free CTLA-4 that can then interact with TCR, albeit in less
kinetically favorable conditions.
The multilayered complexity of CTLA-4 function likely carries the advantage of a very precise regulation of its function, something not surprising to those studying the biology of this molecule. However, the definition of the lysine-rich motif in CTLA-4 as the binding site for PP2A provides an important tool for the search of small molecules that can interfere with the association of CTLA-4 with PP2AA, and thus allows to target CTLA-4 for down-modulation of T cell-mediated immune responses.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 M.L.B., L.V., E.B., and P.J.D. share first authorship.
3 J.M. and V.K. share senior authorship.
4 Address correspondence and reprint requests to Dr. Joaquín Madrenas, Transplantation and Immunobiology Group, John P. Robarts Research Institute, 100 Perth Drive, Room 2.05, P.O. Box 5015, London, Ontario N6A 5K8, Canada. E-mail address: madrenas{at}rri.on.ca
5 Abbreviations used in this paper: PP2A, serine/threonine phosphatase 2A; HA, hemagglutinin; WT, wild type; SEE, Staphylococcal enterotoxin E; ERK, extracellular signal-related kinase.
Received for publication September 18, 2001. Accepted for publication March 7, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
-specific T cell receptor internalization. Mol. Immunol. 33:891.[Medline]
. Science 276:952. regulatory subunit of protein phosphatase 2A is a target for regulation by double-stranded RNA-dependent protein kinase PKR. Mol. Cell Biol. 20:5285. and ZAP70. J. Exp. Med. 186:1645.This article has been cited by other articles:
|
|
 |
|
  H. Hoff, K. Knieke, Z. Cabail, H. Hirseland, G. Vratsanos, G.-R. Burmester, G. Jorch, S. G. Nadler, B. Broker, K. Hebel, et al. Surface CD152 (CTLA-4) Expression and Signaling Dictates Longevity of CD28null T Cells J. Immunol., May 1, 2009; 182(9): 5342 - 5351. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Tsatsanis, K. Vaporidi, V. Zacharioudaki, A. Androulidaki, Y. Sykulev, A. N. Margioris, and P. N. Tsichlis Tpl2 and ERK transduce antiproliferative T cell receptor signals and inhibit transformation of chronically stimulated T cells PNAS, February 26, 2008; 105(8): 2987 - 2992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Teft and J. Madrenas Molecular Determinants of Inverse Agonist Activity of Biologicals Targeting CTLA-4 J. Immunol., September 15, 2007; 179(6): 3631 - 3637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. S. Hodi Cytotoxic T-Lymphocyte Associated Antigen-4 Clin. Cancer Res., September 15, 2007; 13(18): 5238 - 5242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. V. Parry, J. M. Chemnitz, K. A. Frauwirth, A. R. Lanfranco, I. Braunstein, S. V. Kobayashi, P. S. Linsley, C. B. Thompson, and J. L. Riley CTLA-4 and PD-1 Receptors Inhibit T-Cell Activation by Distinct Mechanisms Mol. Cell. Biol., November 1, 2005; 25(21): 9543 - 9553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Madrenas, L. A. Chau, W. A. Teft, P. W. Wu, J. Jussif, M. Kasaian, B. M. Carreno, and V. Ling Conversion of CTLA-4 from Inhibitor to Activator of T Cells with a Bispecific Tandem Single-Chain Fv Ligand J. Immunol., May 15, 2004; 172(10): 5948 - 5956. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Siu, B. M. Carreno, and J. Madrenas TCR subunit specificity of CTLA-4-mediated signaling J. Leukoc. Biol., December 1, 2003; 74(6): 1102 - 1107. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or K-less (
)
CTLA-4-transfected T cells were stained with an Ab against CTLA-4 in
the presence of increasing concentrations of doxycycline for 18 h,
and examined by flow cytometry (MFU, mean fluorescence units).
C, WT and K-less CTLA-4 colocalize into the
immunological synapse upon coligation with TCR. WT CTLA-4-expressing
and K-less CTLA-4-expressing Jurkat T cell transfectants (1 x
106) were induced with doxycycline and stimulated with 100
ng/ml of SEE and DR.1/B7-expressing APC for 30 min. Cells were double
immunostained for CTLA-4 (red, top left panel) and CD3
(green, lower left panel) and analyzed by confocal
microscopy. The two color panels were overlayed on the light field
panel (upper right panel) to reveal points of overlap
(yellow, lower right panel).
); or B, K-less (
) CTLA-4-transfected T cells were stimulated for 4 h with
APCs and increasing concentrations of SEE in the absence (