The Journal of Immunology, 2002, 168: 5070-5078.
Copyright © 2002 by The American Association of Immunologists
Inhibition of CTLA-4 Function by the Regulatory Subunit of Serine/Threonine Phosphatase 2A1
Miren L. Baroja2,*,
Lalitha Vijayakrishnan2,
,
Estelle Bettelli2,
,
Peter J. Darlington2,*,
Thu A. Chau*,
Vincent Ling
,
Mary Collins
,
Beatriz M. Carreno
,
Joaquín Madrenas3,4,* and
Vijay K. Kuchroo3,
* Transplantation and Immunobiology Group, John P. Robarts Research Institute, and Departments of Microbiology and Immunology, and Medicine, University of Western Ontario, London, Ontario, Canada;
Center for Neurological Diseases, Brigham and Womens Hospital and Harvard Medical School, Boston, MA 02115; and
Genetics Institute Inc., Cambridge, MA 02140
 |
Abstract
|
|---|
The catalytic subunit of the serine/threonine phosphatase 2A (PP2A)
can interact with the cytoplasmic tail of CTLA-4. However, the
molecular basis and the biological significance of this interaction are
unknown. In this study, we report that the regulatory subunit of PP2A
(PP2AA) also interacts with the cytoplasmic tail of CTLA-4.
Interestingly, TCR ligation induces tyrosine phosphorylation of PP2AA
and its dissociation from CTLA-4 when coligated. The association
between PP2AA and CTLA-4 involves a conserved three-lysine motif in the
juxtamembrane portion of the cytoplasmic tail of CTLA-4. Mutations of
these lysine residues prevent the binding of PP2AA and enhance the
inhibition of IL-2 gene transcription by CTLA-4, indicating that PP2A
represses CTLA-4 function. Our data imply that the lysine-rich motif in
CTLA-4 may be used to identify small molecules that block its binding
to PP2A and act as agonists for CTLA-4 function.
 |
Introduction
|
|---|
Activation
of T lymphocytes through their Ag receptor (TCR) induces up-regulation
of CTLA-4 expression (1, 2, 3, 4, 5). Subsequent coligation of
CTLA-4 with the TCR inhibits T cell responses by at least two
mechanisms: antagonism of CD28 costimulation by sequestration of B7,
and delivery of a negative signal into T cells (6, 7). The
inhibitory function of CTLA-4 has made it a potentially important
therapeutic target for the treatment of cancer, autoimmune diseases,
and transplant rejection. Although blockade of CTLA-4 has been easy to
achieve and is currently in early stages of clinical development
(8, 9), enhancement of CTLA-4 function has not been
possible because of the lack of sufficient knowledge about the
mechanism by which CTLA-4 inhibits T cell activation and function.
Furthermore, within the CTLA-4 molecule, it is not clear which
interactions and regions of the molecule need to be targeted to enhance
its inhibitory function. Such an enhancement of its function would be
of direct value in turning off unwanted immune responses.
It has been reported that phosphotyrosine-dependent recruitment of the
SHP-2 phosphatase to CTLA-4 inhibits T cell activation and
expansion by dephosphorylation of CD3/TCR chains (10, 11).
However, phosphorylation of CTLA-4 is not required for its negative
function (11, 12, 13, 14), although it is needed for CTLA-4
retention on the T cell membrane along with the TCR complex (15, 16).
Recent genetic evidence indicates that CTLA-4 and CD28 may interact
with the catalytic domain of serine/threonine phosphatase 2A
(PP2A)5
(17). The biochemical basis and the functional
implications of these associations are unknown. By using a yeast
two-hybrid system, we have identified the regulatory subunit of PP2A
(also called PP2AA) as one of the interacting molecules that bind to
the tail of CTLA-4. Our results suggest that binding of PP2AA to CTLA-4
down-regulates CTLA-4 function, while coligation of the TCR with CTLA-4
causes phosphorylation and dissociation of PP2AA from CTLA-4 and
inhibition of T cell activation. The association between PP2AA and
CTLA-4 is mediated by a conserved lysine (K)-rich motif in the
juxtamembrane portion of the cytoplasmic tail of CTLA-4 because K-less
mutants of CTLA-4 (mutant molecules without these lysine residues) have
significantly reduced binding to PP2AA and show enhanced CTLA-4
function. These results indicate that the K-rich region of the CTLA-4
molecule can be used as a target for the identification of agonists of
CTLA-4 function.
 |
Materials and Methods
|
|---|
Cells
The panel of Jurkat T cells transfected with a regulatable,
doxycycline-sensitive CTLA-4 cDNA has been previously reported
(6, 13). The K-less mutant was generated using the PFU
polymerase-based QuikChange Site Directed Mutagenesis kit (Stratagene,
La Jolla, CA) according to manufacturers instructions using the
oligonucleotides:
CCTCACAGCTGTTTCTTTGAGCGCAATGCTAGCGGCAAGAAGCCCTCTTACAACAGGGG
and its complement,
CCCCTGTTGTAAGAGGGCTTCTTCCCGCTAGCATTGCGCTCAAAGAAACAGCTGTGAGG as
mutagenic primers and human CTLA-4/pBIG2i as template. Plasmid isolates
were recovered and human CTLA-4, K-less mutant clones were confirmed by
sequencing. A luciferase reporter cDNA under the control of the IL-2
promoter and enhancer elements (kindly provided by Dr. A. Weiss,
University of California, San Francisco, CA) was transfected in these
cells, and clones isolated after limiting dilution were used for these
experiments. The 0.45 lymphoblastoid B cell line that expresses HLA-DR1
and B7.1 was kindly provided by Dr. E. Long (National Institute of
Allergy and Infectious Diseases, National Institutes of Health,
Bethesda, MD). Both cell lines were cultured under standard
conditions.
Plasmid construction
The cytoplasmic regions of mouse CTLA-4, CD28, and ICOS
were generated by PCR. The cDNA encoding murine CTLA-4 cytoplasmic
domain was inserted into the EcoRI site of bait vector
PEG202 (Origene Technologies, Rockville, MD) to yield a Lex-A DNA
binding fusion plasmid. Similarly, cytoplasmic regions of murine CD28
and ICOS were subcloned into the EcoRI site of bait vector
PEG202.
The 1-kb SalI fragment of clone 54 or the 1.7-kb
SalI fragment of full-length murine PP2AA was inserted into
the SalI site of vector pCMV-myc (Clontech Laboratories,
Palo Alto, CA), which contains an oligonucleotide encoding the
myc peptide inserted into the 5' end of the multiple cloning
site of the mammalian expression vector pCMV. Full-length CTLA-4 was
expressed as a hemagglutinin (HA)-tagged fusion protein by
inserting the CTLA-4 cDNA into the EcoRI/XhoI
sites of pCMV-HA (Clontech Laboratories). Similarly, full-length CD28
and ICOS were cloned into the EcoRI/SalI sites of
pCMV-HA.
Yeast two-hybrid system
A yeast two-hybrid screen of a murine Th1 T cell library was
performed by cotransfecting the bait CTLA-4-PEG202 into the yeast
strain EGY4-8 (Origene Technologies) along with a murine Th1 T cell
library constructed in the B42 activation domain of pJG4-5 (Origene
Technologies), using the Duplex A yeast two-hybrid system (Origene
Technologies). The Th1 library was obtained from Drs. S. Szabo and L.
Glimcher (Harvard School of Public Health, Boston, MA). Screening was
performed on 2 million transformants.
Protein interactions
The plasmid vectors encoding the myc-tagged PP2AA 392589(392589) or
full-length PP2AA and HA-tagged CD28, CTLA-4, or vector alone were
cotransfected into human 293 cells using Lipofectamine reagent
(Invitrogen, Carlsbad, CA) and following the manufacturers
protocol. Transfected cells were harvested and lysed at 4°C in
1% Nonidet P-40 lysis buffer. Cell lysates were precleared and
immunoprecipitated using protein G beads coated with anti-HA Abs.
After an overnight incubation at 4°C, the immunoprecipitates were
washed using 1% Nonidet P-40 lysis buffer. Bound proteins were eluted
by boiling in SDS sample buffer, separated by SDS/15% PAGE, and
transferred onto polyvinylidene difluoride membranes. Membranes
were blocked with 3% BSA in PBS and then incubated with
anti-mPP2AA or anti-myc Abs for detecting PP2AA 392589(392589). For
the detection of CTLA-4 and CD28, polyvinylidene difluoride membranes
were blotted with anti-CD28 and anti-CTLA-4 Abs. Subsequently,
the membranes were incubated with HRP-conjugated secondary Abs, before
visualization using chemiluminescence reagents.
Biochemistry
Jurkat T cells (cell number normalized for protein content) were
cultured overnight in the absence or presence of doxycycline (5
µg/ml), and were stimulated for 10 min with 0.45 cells (5:1 ratio)
preincubated with Staphylococcal enterotoxin E
(SEE) (Toxin Technology, Sarasota, FL) for 40 min at 37°C. Cells were
subsequently lysed in standard lysis buffer containing Triton X-100
(1%). Lysates were precleared with protein G agarose beads (Roche,
Laval, Canada), followed by immunoprecipitation with dithiobis
(succinimidyl propronate)-cross-linked Abs on protein G agarose beads,
and Western blotting as previously described (13, 18, 19).
Cell surface biotinylation
Doxycycline-induced wild-type (WT)-CTLA-4-transfected cells were
incubated with biotin (Pierce, Rockford, IL) (0.5 mg/ml) for 30 min at
room temperature. Cells were washed with PBS and incubated with 0.45
cells for 10 min at 37°C. Cell lysates were prepared and used to
immunoprecipitate with anti-biotin Abs (Jackson ImmunoResearch
Laboratories, West Grove, PA). Immunoprecipitates were either eluted
with sample buffer under reducing conditions or with lysis buffer (200
µl) for 10 min at 95°C to perform a second immunoprecipitation with
a mAb anti-MHC class I molecule (HC10) or a mixture of
anti-CTLA-4 Abs (CTLA-4-11 and CTLA-4-24), following by
immunoblotting for CTLA-4 or PP2AA.
Reagents
Abs used for these experiments were: a goat polyclonal
antiserum against PP2AA
regulatory subunit, and a goat polyclonal
antiserum against Dok-1 (Santa Cruz Biotechnology, Santa Cruz, CA), a
mouse mAb against PP2A catalytic subunit (from Santa Cruz
Biotechnology and from Upstate Biotechnology, Lake Placid, NY),
a mouse mAb against phosphotyrosine (kindly provided by Dr. B. Drukker,
Oregon Health Sciences University, Portland, OR), a mouse mAb against
human CTLA-4.11, the chimeric B7.2-human IgG1 molecule (B7.2 IgG) was
obtained from Genetics Institute (Cambridge, MA), and a goat polyclonal
antiserum against a peptide from the extracellular portion of human
CD28 was purchased from Santa Cruz Biotechnology. PMA and ionomycin
were purchased from Sigma-Aldrich (St. Louis, MO).
Luciferase assay
Doxycycline-treated Jurkat T cells (0.25 x
106 cells/group) were stimulated for 4 h
with 0.45 cells (ratio 2:1) preincubated overnight with different
concentrations of SEE or with anti-CD3/CTLA-4 mAb-coated tosyl
beads. mAb-coated beads were prepared with anti-CD3 mAb (1
µg/bead) and anti-CTLA-4 mAb (4 µg/bead) as previously
described (6, 13). Beads were added to untreated or
doxycycline-induced cells (ratio 1:1) in the presence of soluble
anti-CD28 mAb (20 µg/ml; CD28.2; BD PharMingen, Mississauga,
Canada). Luciferase assay was performed using the Promega Luciferase
Assay System (Promega, Madison, WI).
Flow cytometry
Doxycycline-treated Jurkat T cells (1 x
106 cell/group) were washed and stained for
CTLA-4 expression using a PE-labeled mAb against human CTLA-4 (BD
PharMingen). Cells were examined by flow cytometry using a FACScan Flow
Cytometer (BD Biosciences, Mountain View, CA). Statistical analyses
were performed with CellQuest computer software (BD Biosciences).
Confocal microscopy
Doxycycline-treated Jurkat T cells (1 x
106 cell/group) were incubated at 37°C for
2 h on 35-mm polyl-lysine-coated glass bottom microwell dishes
(MatTek, Ashland, MA). APC (0.5 x 106) were
preincubated for 1 h with 100 ng/ml SEE and incubated with the T
cells on the dish for 30 min. Dishes were washed twice with PBS + 1%
FCS and stained sequentially on ice with PE-CTLA-4 (BD PharMingen) and
FITC-CD3 (BD PharMingen) for 30 min each. Analysis was performed on a
confocal microscope (Zeiss, Oberkochen, Germany) and analyzed by LSM
510 software (Zeiss and Microsoft, Redmond, WA).
 |
Results and Discussion
|
|---|
To gain an understanding of the molecular mechanisms involved in
CTLA-4-mediated T cell down-regulation, we undertook a yeast two-hybrid
screen to identify putative proteins interacting with the cytoplasmic
domain of CTLA-4. Because it was more likely that such proteins would
be expressed in an activated T cell, we screened an activated Th1 T
cell library with the cytoplasmic domain of mouse CTLA-4 fused to the
DNA-binding domain of Lex-A as bait. Of the 2 million transformants
screened, two clones interacted specifically when tested for
nutritional selection and
-galactosidase activity (Fig. 1
A). Both clones were
identified as containing a cDNA insert spanning aa 392589 of the
C-terminal end of PP2AA.

View larger version (18K):
[in this window]
[in a new window]
|
FIGURE 1. Genetic evidence for the association of PP2AA with CTLA-4.
A, The cytoplasmic domain of murine CTLA-4 was used to
screen a cDNA library generated from a Th1 clone, using the Duplex A
yeast two-hybrid system. Positive interaction was confirmed by
expression of both the Leu2 and lacZ genes, thereby
conferring ability of positive clones to grow on media lacking Leu2 and
turn blue on media containing X-Gal. Of the 15 CTLA-4-specific clones
identified, 2 encoded the regulatory subunit of murine PP2A.
B, To establish the specificity of interaction, plasmids
containing clones 54 and 48, identified as molecules interacting with
cytoplasmic domain of CTLA-4 in yeast, were reisolated from the library
plasmid, pJG4-5. This was then retransformed into EGY4-8 along with the
cytoplasmic domain of CTLA-4, CD28, and ICOS. Positive interaction was
scored by the expression of Leu2 or lacZ on media containing
Leu/Gal or Gal/X-Gal. The relative -galactosidase activity is
indicated. Positive interactions were assigned a score of 1+
(upper panels). Specific interaction of the C-terminal
of PP2AA (aa 392589) with the cytoplasmic tail of CTLA-4: yeast cells
were cotransformed with plasmids encoding the GAL4bd fused to the
library-derived fragment of PP2AA (aa 392589), and a plasmid encoding
the GAL4bd fused to cytoplasmic domain of either CTLA-4, CD28, or ICOS.
Transformed cells were streaked on X-Gal containing plates. Plasmid
vector with no insert was included as control (lower
panel).
|
|
To verify the specificity of this interaction, we determined the
ability of the mouse 392589 domain of PP2AA (mPP2AA 392589(392589)) to
interact with CD28, a closely related molecule which shares extensive
structural and sequence homologies with CTLA-4. As an additional
control, we used the cytoplasmic tail of the newly discovered CD28
family member ICOS. cDNAs encoding the cytoplasmic domains of CD28 and
ICOS were cloned in the bait vector, and used to retransform yeast
cells along with mPP2AA 392589(392589). When assessed for growth on
nutritionally selective media and
-galactosidase activity, we found
that mPP2AA 392589(392589) did not interact with CD28 and ICOS (Fig. 1
B), demonstrating that the mPP2AA 392589(392589) contained an
interacting motif specific for the cytoplasmic domain of mouse CTLA-4.
To confirm this observation in a mammalian cell system, clone 54,
representing mPP2AA 392589(392589), was expressed as a myc-tagged protein
of 23 kDa in H293K cells cotransfected with HA-tagged full-length
CTLA-4 or CD28 molecules. When Abs against HA were used to
immunoprecipitate HA-CD28 or HA-CTLA-4, only CTLA-4, but not CD28, was
found to associate with mPP2AA 392589(392589) (Fig. 2
A). The absence of
interaction between mPP2AA 392589(392589) and CD28, even in a H293K
expression system, verified the findings in the yeast system.
Additionally, it suggested that the domain of mPP2AA encompassing aa
392589 probably contains anchor residues that mediate binding to
CTLA-4, but not its close homolog CD28.

View larger version (43K):
[in this window]
[in a new window]
|
FIGURE 2. Distinct domains on murine PP2AA mediate interaction with CD28 and
CTLA-4 in H293K cells. A, Association of mPP2AA
(392589) with CTLA-4. H293K cells were transiently transfected with
myc-tagged mPP2AA (392589) and either HA-CTLA-4, HA-CD28, or HA
vector alone. HA-tagged proteins were immunoprecipitated and
immunoblotted for myc (left panel), CTLA-4,
or CD28 (right panel) using specific Abs. Lower
panel, Similar levels for PP2AA (392589) in cell lysates.
B, Full-length PP2AA interacts with both CTLA-4 and
CD28. H293K cells were transfected with HA-tagged CTLA-4, HA-CD28, or
HA-vector and the full-length regulatory domain of mouse PP2AA. Anti-HA
immunoprecipitates were probed for the presence of bound PP2AA using
anti-PP2AA-specific Abs. Western blotting for CTLA-4 and CD28 in
the anti-HA immunoprecipitates were confirmed using specific
Abs.
|
|
To extend this observation to full-length PP2AA, we amplified this
ubiquitously expressed protein from activated murine spleen
cells. Recombinant mouse PP2AA migrated as a 61-kDa protein when
expressed in H293K cells. To test for interaction of full-length PP2AA
with CTLA-4, PP2AA was expressed as a myc-tagged protein and
cotransfected with either HA-CTLA-4, HA-CD28, or HA-vector alone.
Surprisingly, upon immunoprecipitating the lysates of H293K
cells with anti-HA Ab, both PP2AA-CTLA-4 and PP2AA-CD28 immune
complexes could be detected by Western blotting. (Fig. 2
B).
This was in marked contrast to the results observed with mPP2AA
392589(392589) domain in both yeast and H293K cells. Together, the yeast
two-hybrid screen and the coimmunoprecipitation data in the H293K
system indicated that the full-length mPP2AA can interact with both
CD28 and CTLA-4. However, these molecules associate with PP2AA using
distinct domains for interaction. Specifically, the domain containing
residues 392589 binds exclusively to CTLA-4, but residues 1392
either alone or together with other residues associate with
CD28.
Transient cell surface expression of CTLA-4 coupled with low levels of
surface expression have been a major impediment in elucidating the
molecular mechanisms involved in CTLA-4-mediated T cell function. We
circumvented this problem using a well-characterized system in which
Jurkat cells are induced to express transfected CTLA-4 upon exposure to
doxycycline (6, 13). We have used this system previously
to elucidate the structure-function relationship of CTLA-4 and its role
on T cell down-regulation, and thus it offered us an excellent tool to
determine the functional relevance of the CTLA-4-PP2AA association. We
first investigated whether Jurkat cells expressed PP2AA. We observed
that resting, noninduced Jurkat cells expressed abundant PP2AA that
migrated as a 65-kDa band on Western blotting (data not shown).
Furthermore, the level of endogenous PP2AA expression remained constant
even after doxycycline mediated induction of CTLA-4. Hence, we
concluded that the levels of endogenous PP2AA are not affected by
doxycycline induction of Jurkat cells.
Next, we sought to establish the association between PP2AA and CTLA-4
in transfected Jurkat cells. We found that immunoprecipitation of the
65-kDa regulatory subunit of PP2A coprecipitated a band with a size and
blotting reactivity comparable to that of CTLA-4 (Fig. 3
A). This band was absent in
H293K cells, and in a HLA-DR-1+,
B7+ lymphoblastoid B cell line used as APCs, as
well as in immunoprecipitates of CTLA-4-expressing cells with a control
goat antiserum against Dok-1 (Fig. 3
A, lane labeled as
IP:Ctrl Ab). To test whether PP2AA was associated with surface CTLA-4,
we looked at the levels of CTLA-4 and PP2AA in biotinylated
CTLA-4-expressing cells after immunoprecipitation with anti-biotin
alone (Fig. 3
B, 1st ip) or a sequential immunoprecipitation
with anti-biotin and anti-MHC class I Ab as control Ab, or with
anti-biotin and anti-CTLA-4 Abs. As shown in Fig. 3
B, CTLA-4 was only detectable in cells induced with
doxycycline either after immunoprecipitation with anti-biotin or
after sequential immunoprecipitation with anti-biotin and
anti-CTLA-4 Abs. A 36-kDa band of unknown identity was occasionally
seen upon CTLA-4 blotting of these immunoprecipitates. Furthermore, as
shown in Fig. 3
C, PP2AA was detected after
immunoprecipitation with anti-biotin alone, suggesting that PP2AA
binds to different T cell surface molecules (Fig. 3
C). Most
importantly, we detected a small fraction of PP2AA specifically
associated to CTLA-4, as implied by its presence after reprecipitation
with mAb against CTLA-4 but not after reprecipitation with a mAb
against a control surface molecule (Fig. 3
C).

View larger version (52K):
[in this window]
[in a new window]
|
FIGURE 3. The regulatory subunit of PP2A (PP2AA) associates with surface CTLA-4
in T cells. A, CTLA-4-transfected Jurkat T cells
(40 x 106 cells/group) plus APCs 0.45 lymphoblastoid
B cell line: 8 x 106 cells/group were incubated with
or without doxycycline (5 µg/ml) for induction of CTLA-4 expression.
Subsequently, cell lysates were prepared and used for
immunoprecipitation of PP2AA, followed by immunoblotting for CTLA-4
(upper panel) and PP2AA (bottom panel). A
nonlymphoid cell line (H293K: 30 x 106 cells/group),
APC (0.45 cells: 30 x 106 cells/group), and
CTLA-4-transfected cell lysates immunoprecipitated with a goat
antiserum against the cytosolic protein Dok-1 (IP: Ctrl Ab) were added
as controls. Beads: immunoprecipitating Ab without cell lysate.
Whole-cell lysates from the same samples were used for direct
immunoblotting for CTLA-4 to confirm induction of CTLA-4 expression and
for expression of PP2AA. B, Doxycline-induced or
noninduced CTLA-4-transfected cells (100 x 106
cells/group) were biotinylated as indicated in Materials and
Methods. Cell lysates were immunoprecipitated with
anti-biotin alone (1st ip) or with anti-biotin followed by a
second immunoprecipitation with anti-CTLA-4 Abs (2nd ip) and
immunoblotted for CTLA-4. A control mAb against MHC class I molecules
(Ctrl. lanes) was used for the second immunoprecipitation following
anti-biotin ip. C, Doxycline-induced or noninduced
CTLA-4-transfected cells (100 x 106 cells/group) were
biotinylated as indicated in Materials and Methods. Cell
lysates were immunoprecipitated with anti-biotin alone (1st ip) or
with anti-biotin followed by a second immunoprecipitation with
either a control Ab against MHC class I molecules or with
anti-CTLA-4 Abs (2nd ip). These immunoprecipitates were then
immunoblotted for PP2AA. Beads, immunoprecipitating Ab without cell
lysate; CL, cell lysate.
|
|
Because parental Jurkat cells only express CD28 but not CTLA-4, we used
these cells to establish the association of PP2AA with CD28 using B7.2
IgG fusion protein. Western blotting with anti-PP2AA Ab after
immunoprecipitation with B7.2 IgG revealed that PP2A also bound to
CD28. These data confirmed our findings obtained in the H293K system in
that PP2AA associated with CD28 as well as CTLA-4 (Fig. 4
A). The association between
PP2A and CTLA-4 also involved the catalytic subunit of this phosphatase
(PP2AC), consistent with reports indicating that free catalytic subunit
of PP2A cannot be found in intact cells (20). As shown in
Fig. 4
B, we found that PP2AC coprecipitated with CTLA-4,
indicating that both the regulatory and catalytic subunits of PP2A can
interact with CTLA-4.

View larger version (35K):
[in this window]
[in a new window]
|
FIGURE 4. The regulatory subunit of PP2A (PP2AA) also associates with CD28.
A, Cell lysates from parental E6.1 Jurkat cells
expressing CD28 (CD28+) or very low levels of CD28
(CD28low) were used (10 x 106
cells/group) for immunoprecipitation of B7 ligands with B7.2. IgG,
followed by immunoblotting for PP2AA, CTLA-4, and CD28 as controls for
the association of PP2AA with CD28. B, The catalytic
subunit of PP2A associates with CTLA-4. CTLA-4-transfected Jurkat T
cells (30 x 106 cells/group) were treated overnight
with doxycycline (5 µg/ml). Subsequently, cell lysates were prepared
and used for immunoprecipitation of PP2AC, followed by immunoblotting
for CTLA-4 and PP2AC. Whole-cell lysates from the same samples were
used for direct immunoblotting for CTLA-4 and PP2AC.
|
|
Next, we examined the effect of TCR-CTLA-4 coligation on the
association between CTLA-4 and PP2AA. Because Jurkat cells express a
TCR V
1/V
8.1 Ag receptor complex, we tested the effects of TCR or
TCR-CTLA-4 coligation using a system in which the superantigen SEE is
presented by HLA-DR1-expressing, B7.1+ APC
(21). As shown in Fig. 5
A, coligation of the TCR and
CTLA-4 with SEE and APC resulted in a time-dependent decrease in the
levels of PP2AA associated with CTLA-4, while the total levels of PP2AA
and PP2AC remained constant. Previous reports have implicated
phosphorylation of the catalytic subunit of PP2A by several kinases
including p56lck in the inactivation of PP2A
(22). This prompted us to investigate whether TCR ligation
resulted in the tyrosine phosphorylation of PP2AA as well. We found
that TCR ligation by SEE and APC caused an increase in tyrosine
phosphorylation of the regulatory subunit of PP2A in a time-dependent
fashion (Fig. 5
B). The decrease in PP2AA-CTLA-4 association
was not due to a loss of CTLA-4, because the levels of surface CTLA-4
increased with stimulation as predicted from previous characterization
of the system (Fig. 5
C). The precise kinetics and
stoichiometry of the association between PP2AA and CTLA-4 is currently
under investigation. It will be interesting to examine whether TCR
internalization and/or decreased TCR-mediated signaling might be
involved in the specific turnover of this association.

View larger version (42K):
[in this window]
[in a new window]
|
FIGURE 5. Dissociation from CTLA-4 and tyrosine phosphorylation of regulatory
(PP2AA) subunits of PP2A following TCR-CTLA-4 coligation.
A, Dissociation of PP2AA from CTLA-4 upon coligation
with TCR. Jurkat T cell transfectants (20 x 106
cells/group) noninduced or induced with doxycycline for CTLA-4
expression were stimulated with SEE (1 ng/ml) and 0.45 APC for
different times. Whole-cell lysates were prepared and used for
immunoprecipitation of PP2AA and immunoblotted for CTLA-4 (upper
panel), PP2AA, and PP2AC (middle panels).
Whole-cell lysates from the same samples were used for direct
immunoblotting for CTLA-4 (lower panel).
B, CTLA-4-transfected Jurkat T cells were stimulated
with 0.45 cells and SEE (100 ng/ml) for different times, after
overnight induction of CTLA-4 expression with doxycycline (5 µg/ml).
Subsequently, cell lysates were prepared and used for
immunoprecipitation of PP2AA, following by immunoblotting for
phosphotyrosine (with 4G10 Ab). Equal loading in each lane was
confirmed by blotting for total levels of PP2AA. C,
Surface CTLA-4 expression upon T cell stimulation with SEE and APC.
Jurkat T cell transfectants noninduced or induced with doxycycline were
stimulated with SEE (100 ng/ml) and APC for different times and
analyzed for CTLA-4 expression by flow cytometry. Light gray solid:
noninduced, PBS stain; light gray dotted: noninduced; dark gray solid:
induced nonstimulated; black dash: induced, 1' stimulation; solid
black: induced, 3' stimulation; black long dash: induced 10'
stimulation; black broken dash: induced 1 h stimulation. (' =
min). Mean fluorescent units (MFU) for these different groups are shown
in graph aside.
|
|
Our data are consistent with the possibility that TCR-dependent
tyrosine phosphorylation of PP2AA may regulate the association of PP2A
with CTLA-4 and subsequent effects of TCR-CTLA-4 coligation. Various
studies have documented the importance of the PP2A holoenzyme as both a
negative and positive regulator of cell growth and cell cycle
progression proteins (23, 24, 25). Considering the fact that
both PP2AA and CTLA-4 can exist in resting T cells, the association of
PP2AA and CTLA-4 may be a mechanism by which the phosphatase prevents
the inhibitory function of CTLA-4 before TCR-CTLA-4 coligation.
According to this model, activation and subsequent coligation of CTLA-4
and TCR could result in the tyrosine phosphorylation of both CTLA-4 and
PP2AA, resulting in retention of CTLA-4 in the cell surface and the
dissociation of CTLA-4 from PP2AA, respectively. Reversible
phosphorylation of PP2A and its association with various intracellular
molecules that regulate cell cycle progression have been previously
reported (23, 26). Dissociation from PP2AA could then
result in the restoration of CTLA-4 functional activity.
If the above model is correct, then a mutant CTLA-4 incapable of
binding to PP2AA should be a better inhibitor of T cell function than
the WT molecule. It has been reported that the sequence HENRKL in SV40
small T Ag and in the kinase domain of Casein kinase 2
is the
sequence required for binding of these proteins to the PP2A core enzyme
(23, 24). Based on this evidence, we looked for the
presence of a similar sequence in the cytoplasmic tail of CTLA-4 and in
those proteins known to form stable complexes with PP2A
(25). We found that the cytoplasmic tail of CTLA-4
contained a K-rich motif, SKMLKKRSP, in the juxtamembrane portion of
its cytoplasmic tail. Such sequence meets a consensus also found in
PP2A-binding proteins (23, 24, 25), XK/R/HXXK/R/HKXXX, and
located within regions identified as important for binding to the
regulatory subunit of PP2A (Ref. 27 ; Fig. 6
A). The consensus sequence in
CTLA-4 is located immediately upstream of tyrosine residue 165, which
was shown to be critical for the binding between CTLA-4 and the
catalytic subunit of PP2A in the yeast two-hybrid study reported by
Thompson and colleagues (17). The consensus sequence
requirements for binding of proteins to the PP2AA subunit or to the
PP2AC subunit remain to be determined. However, the linear arrangement
suggested by Chuang et al. (17) and our data may secure
the association of both the catalytic and the regulatory subunits of
PP2A with CTLA-4 (20). Of interest, we could not find any
similar sequence in the cytoplasmic tail of CD28, and this could
explain the differential binding observed for PP2AA and PP2AC between
CD28 and CTLA-4 (Ref. 17 and our data).
Based on the previous analysis, we generated a Jurkat T cell clone that
expressed a mutant K-less CTLA-4 molecule lacking the three lysine
residues in the juxtamembrane region (K152A/K155A/K156A). Upon
induction with doxycycline, the K-less CTLA-4 mutant was found to be
expressed at significantly lower levels than WT CTLA-4 (Fig. 6
B). The cause for the lower levels of cell surface
expression of this mutant molecule is currently under investigation.
However, the K-less CTLA-4 molecules were able to colocalize with the
TCR in a manner similar to that seen with WT CTLA-4 (Fig. 6
C), suggesting that these molecules do not disturb the
gross arrangement of the immunological synapse.
Next, we investigated whether the mutant K-less CTLA-4, which lacks the
potential anchor residues that may mediate interaction with PP2AA, is
still capable of forming CTLA-4-PP2A complexes. Because the level of
CTLA-4 surface expression in the K-less-transfected T cells is lower
than in the WT CTLA-4-expressing cells, we sorted these cells by FACS
to achieve similar levels of surface CTLA-4 expression. Jurkat cell
lysates from these cells were used to immunoprecipitate PP2AA (Fig. 7
). Unlike the WT CTLA-4, mutant K-less
CTLA-4 failed to coimmunoprecipitate with PP2AA in significant amounts.
This was not due to the inability or decreased reactivity of
anti-CTLA-4 Abs used to detect mutant K-less CTLA-4. This finding
confirmed our assumption that the lysine residues are indeed critical
for binding of CTLA-4 to PP2AA. Furthermore, it offered us an
opportunity to delineate the functional relevance of the CTLA-4-PP2A
interaction in T cells.

View larger version (20K):
[in this window]
[in a new window]
|
FIGURE 7. Loss of PP2AA binding by K-less CTLA-4 mutant. Doxycycline-treated WT
CTLA-4 (0.1 µg/ml) and K-less CTLA-4 (5 µg/ml) transfected T cells
were sorted by FACS to obtain similar levels of surface CTLA-4
expression (left panel). Whole-cell lysates from these
cells (30 x 106 cells/group) were prepared and used
for immunoprecipitation of PP2AA, followed by immunoblotting for CTLA-4
(right panel) and PP2AA (bottom right
panel). Beads, immunoprecipitating Ab-coated beads without cell
lysate.
|
|
To assess the functional effects of K-less CTLA-4 on T cell responses,
Jurkat cells expressing WT CTLA-4 or mutant CTLA-4 were cotransfected
with a luciferase reporter gene under the control of the IL-2 promoter
and enhancer elements. Surprisingly, upon stimulation of
doxycycline-induced Jurkat cells with SEE and APC, we observed that
K-less CTLA-4 was far more efficient than WT CTLA-4 at inhibiting IL-2
gene transcription (Fig. 8
, A
and B). The enhanced inhibition of the K-less mutant was
verified by comparing the percentages of inhibition at maximal relative
luciferase unit response, to rule out intrinsic differences between the
mutants ability to transcribe IL-2. In addition, stimulation with
ionomycin and PMA showed similar responsiveness in both WT CTLA-4 and
K-less CTLA-4 T cells (Fig. 8
C). Specifically, luciferase
activity was inhibited by 7080% in K-less mutants compared with
3555% by the WT CTLA-4 upon TCR-CTLA-4 coligation. This enhanced
inhibition is particularly significant in the context of a much lower
surface expression of K-less CTLA-4. Therefore, the lack of association
between PP2AA and K-less CTLA-4 correlated with an enhanced inhibition
of IL-2 gene transcription by CTLA-4, implying that PP2A could operate
as a negative regulator of CTLA-4 function. This required the lysine
residues at the juxtamembrane region of CTLA-4.
To compare the functional implications of PP2A interactions with CTLA-4
and CD28, we examined the response of WT CTLA-4-expressing T cells and
K-less CTLA-4-expressing T cells after stimulation with anti-CD3 or
anti-CD3/anti-CTLA-4-coated beads in the presence of soluble,
nonlimiting concentrations of anti-CD28 mAb (6, 13).
Jurkat T cells do not produce IL-2 in response to TCR ligation with
anti-CD3-coated beads in the absence of anti-CD28 soluble (data
not shown). Importantly, IL-2 response after TCR/CD28 ligation is not
significantly different between WT and K-less CTLA-4-expressing
T cells in the presence or absence of doxycycline (Fig. 8
D),
ruling out any intrinsic difference in IL-2 responses due to CTLA-4
expression in the absence of its ligation. The effects of the
association of PP2A with CTLA-4 were also validated in this system
(Fig. 8
D), although the enhanced function of K-less CTLA-4
over that of WT CTLA-4 using Ab-coated beads was less pronounced than
with SEE/APC stimulation. This could be due to better inhibition of WT
CTLA-4 upon forced coligation with the TCR. Furthermore, the inhibition
of T cell activation by K-less CTLA-4 is due to negative signaling,
because IL-2 gene transcription decreased after direct coligation of
CD3 and CTLA-4 using mAb-coated beads (Fig. 8
D).
Because PP2A plays a critical role in regulating diverse functions
including cell proliferation, differentiation, and survival in
different cell types (23, 24, 25), it is not difficult to
envision a role for this molecule in regulating T cell-dependent immune
responses. The recent identification of the catalytic subunit of PP2A
as potential modulator of the function of T cells by association with
CD28 supports the concept that PP2A may be a major mediator in
controlling T cell responsiveness, expansion, and homeostasis
(17). Our study demonstrates an association of the
regulatory subunit of PP2A with the cytoplasmic domain of both CTLA-4
and CD28. Sharing a 30% sequence within their cytoplasmic domains,
both molecules have a consensus phosphatidylinositol 3-kinase src
homology 2 domain-binding motif and proline-rich sequences
(28), and can be targets for src kinases (17, 29, 30). Hence, the association of CTLA-4 and CD28 with PP2A
positions these receptors as major regulators in kinase cascades
modulating signaling events in T cell activation. Both PP2A and CTLA-4
have been shown to regulate the activity of extracellular
signal-related kinase (ERK) in the mitogen-activated protein
kinase pathway (13, 20, 31). Interestingly, whereas
CTLA-4 coligation with the TCR results in the inhibition of ERK
activation, TCR ligation induces ERK activation that can be prolonged
by okadaic acid, an inhibitor of PP2A, suggesting a role for PP2A in
the dephosphorylation of ERK. A plausible explanation could be that
TCR-CTLA-4 coligation could result in the release of PP2A from the
CTLA-4-PP2A complex, with the subsequent dephosphorylation of ERK by
PP2A and down-regulation of mitogen-activated protein kinase-dependent
T cell responses.
The ability of CTLA-4 to cocap with the TCR at the immunological
synapse on receptor coligation suggests that a more elaborate mechanism
might be operational. The cytoplasmic domain of CTLA-4 has been
demonstrated to associate with SHP-2 (10) and the TCR
chain (11). Thus, one may argue that SHP-2-mediated
dephosphorylation of TCR
may involve a CTLA-4-initiated
translocation of signaling components, including PP2A, to the center of
the immunological synapse that will prevent activation-induced
serine-threonine phosphorylation of CD28. However, the fact that the
K-less mutant can cocap with TCR just as well as the WT, but is more
effective at inhibiting IL-2 in the face of lower association with
PP2A, seems to suggest that this may not be the case. On the contrary,
these findings imply that PP2A is indeed a negative regulator of CTLA-4
function. In light of the recent definition of the crystal structure of
CTLA-4:B7 complex (32, 33, 34), it is tempting to speculate
that the formation of supramolecular arrays of CTLA-4 may be favored
upon dissociation of PP2A from CTLA-4, and thus facilitate the
inhibition of TCR-mediated activation.
The precise nature of the interaction between PP2AA and the K-rich
region of the CTLA-4 cytoplasmic tail remains to be defined. One could
propose that electrostatic interactions maintain these two molecules
together, as it has been reported for the association between Ly-49
with DAP-12 in NK cells (35, 36, 37, 38). Coligation of TCR and
CTLA-4 may favor electrostatic interactions between TCR and CTLA-4,
following phosphorylation and dissociation of PP2A from CTLA-4. This
hypothesis is further supported by recent data that also
identify the first 7 aa of the CTLA-4 tail (and particularly the two
distal lysine residues) as important for the proper interaction between
CTLA-4 and TCR
and subsequent inhibition of TCR
-mediated
signaling (K. Lee, M. Griffin, and J. A. Bluestone, unpublished
observations). However, our data indicate that this region is important
for the negative regulation of CTLA-4 function before TCR ligation and
T cell activation. Because the occupancy of this domain by either PP2AA
or TCR is dictated by the activation status of the cell, it is possible
that the juxtamembrane region functions as an anchor for PP2A in
resting cells "containing" T cell activation. In contrast, after T
cell activation, the lysine-rich motif becomes available for TCR
association and T cell down-regulation mediated by CTLA-4. This may
explain why the lack of the three juxtamembrane lysine residues on the
CTLA-4 tail enhance the function of CTLA-4 by causing a net increase in
PP2AA-free CTLA-4 that can then interact with TCR
, albeit in less
kinetically favorable conditions.
The multilayered complexity of CTLA-4 function likely carries the
advantage of a very precise regulation of its function, something not
surprising to those studying the biology of this molecule. However, the
definition of the lysine-rich motif in CTLA-4 as the binding site for
PP2A provides an important tool for the search of small molecules that
can interfere with the association of CTLA-4 with PP2AA, and thus
allows to target CTLA-4 for down-modulation of T cell-mediated immune
responses.
 |
Acknowledgments
|
|---|
We thank Dr. J. A. Bluestone (University of California) and
his colleagues for sharing with us unpublished observations on the role
of the juxtamembrane region of the cytoplasmic tail of mouse
CTLA-4.
 |
Footnotes
|
|---|
1 This work was supported by grants from the Medical Research Council of Canada/Canadian Institutes of Health Research, the Kidney Foundation of Canada, the Juvenile Diabetes Foundation International, and Genetics Institute-Wyeth Research (to J.M.), and Grants P01-AI39671, RO1-NS35685, and RO1-CA75174 from the National Institutes of Health (to V.K.). J.M. holds a Canada Research Chair in Transplantation and Immunobiology. M.L.B. is on leave from the Instituto de Inmunología of the Universidad Central de Venezuela, Caracas, Venezuela. 
2 M.L.B., L.V., E.B., and P.J.D. share first authorship. 
3 J.M. and V.K. share senior authorship. 
4 Address correspondence and reprint requests to Dr. Joaquín Madrenas, Transplantation and Immunobiology Group, John P. Robarts Research Institute, 100 Perth Drive, Room 2.05, P.O. Box 5015, London, Ontario N6A 5K8, Canada. E-mail address: madrenas{at}rri.on.ca 
5 Abbreviations used in this paper: PP2A, serine/threonine phosphatase 2A; HA, hemagglutinin; WT, wild type; SEE, Staphylococcal enterotoxin E; ERK, extracellular signal-related kinase. 
Received for publication September 18, 2001.
Accepted for publication March 7, 2002.
 |
References
|
|---|
-
Chambers, C. A., J. P. Allison. 1999. Costimulatory regulation of T cell function. Curr. Opin. Cell Biol. 11:203.[Medline]
-
Slavik, J. M., J. E. Hutchcroft, B. E. Bierer. 1999. CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol. Res. 19:1.[Medline]
-
Oosterwegel, M. A., R. J. Greenwald, D. A. Mandelbrot, R. B. Lorsbach, A. H. Sharpe. 1999. CTLA-4 and T cell activation. Curr. Opin. Immunol. 11:294.[Medline]
-
Ravetch, J. V., L. L. Lanier. 2000. Immune inhibitory receptors. Science 290:84.[Abstract/Free Full Text]
-
Sansom, D. M.. 2000. Review article: CD28, CTLA-4 and their ligands: who does what and to whom?. Immunology 101:169.[Medline]
-
Carreno, B. M., F. Bennett, T. A. Chau, V. Ling, D. Luxenberg, J. Jussif, M. L. Baroja, J. Madrenas. 2000. CTLA-4 (CD152) can inhibit T cell activation by two different mechanisms depending on its level of cell surface expression. J. Immunol. 165:1352.[Abstract/Free Full Text]
-
Masteller, E. L., E. Chuang, A. C. Mullen, S. L. Reiner, C. B. Thompson. 2000. Structural analysis of CTLA-4 function in vivo. J. Immunol. 164:5319.[Abstract/Free Full Text]
-
Leach, D. R., M. F. Krummel, J. P. Allison. 1996. Enhancement of antitumor immunity by CTLA-4 blockade. Science 271:1734.[Abstract]
-
Abrams, J. R., M. G. Lebwohl, C. A. Guzzo, B. V. Jegasothy, M. T. Goldfarb, B. S. Goffe, A. Menter, N. J. Lowe, G. Krueger, M. J. Brown, et al 1999. CTLA4Ig-mediated blockade of T-cell costimulation in patients with psoriasis vulgaris. J. Clin. Invest. 103:1243.[Medline]
-
Marengere, L. E., P. Waterhouse, G. S. Duncan, H. W. Mittrucker, G. S. Feng, T. W. Mak. 1996. Regulation of T cell receptor signaling by tyrosine phosphatase SYP association with CTLA-4. Science 272:1170.[Abstract]
-
Lee, K. M., E. Chuang, M. Griffin, R. Khattri, D. K. Hong, W. Zhang, D. Straus, L. E. Samelson, C. B. Thompson, J. A. Bluestone. 1998. Molecular basis of T cell inactivation by CTLA-4. Science 282:2263.[Abstract/Free Full Text]
-
Nakaseko, C., S. Miyatake, T. Iida, S. Hara, R. Abe, H. Ohno, T. Saito. 1999. Cytotoxic T lymphocyte antigen 4 (CTLA-4) engagement delivers an inhibitory signal through the membrane-proximal region in the absence of the tyrosine motif in the cytoplasmic tail. J. Exp. Med. 190:765.[Abstract/Free Full Text]
-
Baroja, M. L., D. Luxenberg, T. Chau, V. Ling, C. A. Strathdee, B. M. Carreno, J. Madrenas. 2000. The inhibitory function of CTLA-4 does not require its tyrosine phosphorylation. J. Immunol. 164:49.[Abstract/Free Full Text]
-
Cinek, T., A. Sadra, J. B. Imboden. 2000. Cutting edge: tyrosine-independent transmission of inhibitory signals by CTLA-4. J. Immunol. 164:5.[Abstract/Free Full Text]
-
Shiratori, T., S. Miyatake, H. Ohno, C. Nakaseko, K. Isono, J. S. Bonifacino, T. Saito. 1997. Tyrosine phosphorylation controls internalization of CTLA-4 by regulating its interaction with clathrin-associated adaptor complex AP-2. Immunity 6:583.[Medline]
-
Zhang, Y., J. P. Allison. 1997. Interaction of CTLA-4 with AP50, a clathrin-coated pit adaptor protein. Proc. Natl. Acad. Sci. USA 94:9273.[Abstract/Free Full Text]
-
Chuang, E., T. S. Fisher, R. W. Morgan, M. D. Robbins, J. M. Duerr, M. G. Vander Heiden, J. P. Gardner, J. E. Hambor, M. J. Neveu, C. B. Thompson. 2000. The CD28 and CTLA-4 receptors associate with the serine/threonine phosphatase PP2A. Immunity 13:313.[Medline]
-
Madrenas, J., L. A. Chau, J. Smith, J. A. Bluestone, R. N. Germain. 1997. The efficiency of CD4 recruitment to ligand-engaged TCR controls the agonist/partial agonist properties of peptide-MHC molecule ligands. J. Exp. Med. 185:219.[Abstract/Free Full Text]
-
Chau, L. A., J. A. Bluestone, J. Madrenas. 1998. Dissociation of intracellular signaling pathways in response to partial agonist ligands of the T cell receptor. J. Exp. Med. 187:1699.[Abstract/Free Full Text]
-
Goldberg, Y.. 1999. Protein phosphatase 2A: who shall regulate the regulator?. Biochem. Pharmacol. 57:321.[Medline]
-
Makida, R., M. F. Hofer, K. Takase, J. C. Cambier, D. Y. Leung. 1996. Bacterial superantigens induce V
-specific T cell receptor internalization. Mol. Immunol. 33:891.[Medline]
-
Chen, J., B. L. Martin, D. L. Brautigan. 1992. Regulation of protein serine-threonine phosphatase type-2A by tyrosine phosphorylation. Science 257:1261.[Abstract/Free Full Text]
-
Sontag, E., S. Fedorov, C. Kamibayashi, D. Robbins, M. Cobb, M. Mumby. 1993. The interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map kinase pathway and induces cell proliferation. Cell 75:887.[Medline]
-
Heriche, J. K., F. Lebrin, T. Rabilloud, D. Leroy, E. M. Chambaz, Y. Goldberg. 1997. Regulation of protein phosphatase 2A by direct interaction with casein kinase 2
. Science 276:952.[Abstract/Free Full Text]
-
Millward, T. A., S. Zolnierowicz, B. A. Hemmings. 1999. Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem. Sci. 24:186.[Medline]
-
Xu, Z., B. R. Williams. 2000. The B56
regulatory subunit of protein phosphatase 2A is a target for regulation by double-stranded RNA-dependent protein kinase PKR. Mol. Cell Biol. 20:5285.[Abstract/Free Full Text]
-
Campbell, K. S., K. R. Auger, B. A. Hemmings, T. M. Roberts, D. C. Pallas. 1995. Identification of regions in polyomavirus middle T and small T antigens important for association with protein phosphatase 2A. J. Virol. 69:3721.[Abstract]
-
Schneider, H., K. V. Prasad, S. E. Shoelson, C. E. Rudd. 1995. CTLA-4 binding to the lipid kinase phosphatidylinositol 3-kinase in T cells. J. Exp. Med. 181:351.[Abstract/Free Full Text]
-
Miyatake, S., C. Nakaseko, H. Umemori, T. Yamamoto, T. Saito. 1998. Src family tyrosine kinases associate with and phosphorylate CTLA-4 (CD152). Biochem. Biophys. Res. Commun. 249:444.[Medline]
-
Chuang, E., K. M. Lee, M. D. Robbins, J. M. Duerr, M. L. Alegre, J. E. Hambor, M. J. Neveu, J. A. Bluestone, C. B. Thompson. 1999. Regulation of cytotoxic T lymphocyte-associated molecule-4 by Src kinases. J. Immunol. 162:1270.[Abstract/Free Full Text]
-
Calvo, C. R., D. Amsen, A. M. Kruisbeek. 1997. Cytotoxic T lymphocyte antigen 4 (CTLA-4) interferes with extracellular signal-regulated kinase (ERK) and Jun NH2-terminal kinase (JNK) activation, but does not affect phosphorylation of T cell receptor
and ZAP70. J. Exp. Med. 186:1645.[Abstract/Free Full Text]
-
Ostrov, D. A., W. Shi, J. C. Schwartz, S. C. Almo, S. G. Nathenson. 2000. Structure of murine CTLA-4 and its role in modulating T cell responsiveness. Science 290:816.[Abstract/Free Full Text]
-
Schwartz, J. C., X. Zhang, A. A. Fedorov, S. G. Nathenson, S. C. Almo. 2001. Structural basis for co-stimulation by the human CTLA-4/B7-2 complex. Nature 410:604.[Medline]
-
Stamper, C. C., Y. Zhang, J. F. Tobin, D. V. Erbe, S. Ikemizu, S. J. Davis, M. L. Stahl, J. Seehra, W. S. Somers, L. Mosyak. 2001. Crystal structure of the B7-1/CTLA-4 complex that inhibits human immune responses. Nature 410:608.[Medline]
-
Lanier, L. L., B. Corliss, J. Wu, J. H. Phillips. 1998. Association of DAP12 with activating CD94/NKG2C NK cell receptors. Immunity 8:693.[Medline]
-
Smith, K. M., J. Wu, A. B. Bakker, J. H. Phillips, L. L. Lanier. 1998. Ly-49D and Ly-49H associate with mouse DAP12 and form activating receptors. J. Immunol. 161:7.[Abstract/Free Full Text]
-
Lanier, L. L., B. C. Corliss, J. Wu, C. Leong, J. H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391:703.[Medline]
-
Wu, J., Y. Song, A. B. Bakker, S. Bauer, T. Spies, L. L. Lanier, J. H. Phillips. 1999. An activating immunoreceptor complex formed by NKG2D and DAP10. Science 285:730.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
C. Tsatsanis, K. Vaporidi, V. Zacharioudaki, A. Androulidaki, Y. Sykulev, A. N. Margioris, and P. N. Tsichlis
Tpl2 and ERK transduce antiproliferative T cell receptor signals and inhibit transformation of chronically stimulated T cells
PNAS,
February 26, 2008;
105(8):
2987 - 2992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. A. Teft and J. Madrenas
Molecular Determinants of Inverse Agonist Activity of Biologicals Targeting CTLA-4
J. Immunol.,
September 15, 2007;
179(6):
3631 - 3637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. S. Hodi
Cytotoxic T-Lymphocyte Associated Antigen-4
Clin. Cancer Res.,
September 15, 2007;
13(18):
5238 - 5242.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. V. Parry, J. M. Chemnitz, K. A. Frauwirth, A. R. Lanfranco, I. Braunstein, S. V. Kobayashi, P. S. Linsley, C. B. Thompson, and J. L. Riley
CTLA-4 and PD-1 Receptors Inhibit T-Cell Activation by Distinct Mechanisms
Mol. Cell. Biol.,
November 1, 2005;
25(21):
9543 - 9553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Madrenas, L. A. Chau, W. A. Teft, P. W. Wu, J. Jussif, M. Kasaian, B. M. Carreno, and V. Ling
Conversion of CTLA-4 from Inhibitor to Activator of T Cells with a Bispecific Tandem Single-Chain Fv Ligand
J. Immunol.,
May 15, 2004;
172(10):
5948 - 5956.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Siu, B. M. Carreno, and J. Madrenas
TCR subunit specificity of CTLA-4-mediated signaling
J. Leukoc. Biol.,
December 1, 2003;
74(6):
1102 - 1107.
[Abstract]
[Full Text]
|
 |
|