| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Terry Fox Laboratory, British Columbia Cancer Agency, and Departments of
Microbiology and Immunology, and
Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada;
Department of Molecular Cell Biology, Institute for Microbial Diseases, Osaka University, Osaka, Japan; and
¶ Department of Molecular and Cell Biology and Cancer Research Laboratory, University of California, Berkeley, CA 94720
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Adult mouse NK cells express both the Ly49 family and the CD94/NKG2
heterodimers. As many as six of these receptors can be coexpressed on
individual adult NK cells in various combinations
(15, 16, 17, 18, 19). The receptor expression is generally stochastic,
although the activating Ly49D and Ly49H receptors appear to show
nonstochastic expression patterns (20). The diverse
receptor repertoires of adult mouse NK cells are thought to enable the
NK cell population as a whole to recognize subtle changes in MHC class
I expression on target cells while maintaining self-tolerance. Unlike
adult NK cells, most fetal and neonatal NK cells express CD94/NKG2 but
not Ly49 receptors, with the only exception being Ly49E, which appears
to be expressed on fetal NK cells (21, 22). As the mouse
matures, NK cells begin to acquire Ly49 receptors while CD94/NKG2
positive NK cells decline to 
50% of the population (5, 15, 16, 23). Recent studies have examined how NK cells acquire Ly49
receptors following transfer of NK cell subsets or NK progenitors into
irradiated hosts (5). The acquisition of Ly49 receptors by
developing NK cells during their differentiation from bone marrow
progenitors in vitro has also been examined (19, 24, 25).
These studies have demonstrated that the acquisition of Ly49 receptors
is a stochastic but nonrandom event, although the precise order of
individual Ly49 being acquired appears to vary according to the culture
system and detection method used in these studies.
In contrast to the acquisition of Ly49 receptors, relatively little is known about how CD94/NKG2 receptors are acquired by developing NK cells. During differentiation of adult bone marrow progenitors into functional NK cells in vitro, CD94 and NKG2 gene expression precedes the expression of the Ly49 family (16, 18, 19, 24). Among different NKG2 genes, adult NK cells seem to predominantly express the NKG2A gene (1, 12). Single-cell RT-PCR analysis also indicates that the frequency of CD94 and NKG2A coexpression in individual adult NK cells is much higher than those of CD94 and NKG2C or NKG2E (26). Fetal NK cells also express CD94/NKG2 receptors and are inhibited by MHC class I on target cells, suggesting that CD94/NKG2A may be responsible for the maintenance of self-tolerance in fetal NK cells (18, 19, 22, 27). Similarly, NK cell clones generated from fetal thymus also express various CD94/NKG2 receptors in a stochastic manner and differentially recognize MHC class I-deficient targets (21).
This study was undertaken to determine the acquisition pattern of CD94/NKG2 receptors in the NK cell developmental pathway through the use of an embryonic stem (ES) cell culture system. In this system, ES cells are induced to differentiate into the hemopoietic lineage, then they further differentiate into cells expressing markers of the lymphoid lineage that finally become cells displaying NK cell phenotypes and functions. Analysis of developing NK cells in this culture system shows that they acquire CD94/NKG2 receptor gene expression in an orderly manner.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mAbs to CD34, CD2, CD3, CD4, CD8, DX-5, CD127, CD132, CD44,
CD122, CD117, and H-2Kb were purchased from BD
PharMingen (San Diego, CA). The hybridomas 2.4G2 (anti-FcR
),
M1/69.16.11.HL (anti-heat stable Ag), 7D4 (anti-IL-2Ra),
HO-13-4 (anti-Thy1.2), anti-LFA-1(TIB213), and anti-Mac-1
(TIB218) were obtained from the American Type Culture Collection
(Manassas, VA) and were purified from the hybridoma culture
supernatants. The anti-murine ICAM-1 (CD54) mAb YN1/1.7.4 has been
described (28). The mAb 4D11 has been previously described
(29), and the 4E5 mAb was a kind gift from Dr. V. Kumar
(University of Chicago, Chicago, IL). Biotinylated anti-murine CD94
(18d3) and FITC-labeled anti-murine NKG2 (20d5) have been described
(1). Secondary Abs were purchased from Jackson
Laboratories (Mississauga, Canada). For all cell stainings and
sortings, cells were first preincubated with 2.4G2 supernatant followed
by primary mAbs. All incubations were performed on ice for 30 min and
stained cells were subsequently analyzed on a FACSCaliber (BD
Biosciences, Mississauga, Canada) equipped with the CellQuest software
(BD Biosciences). For cell sorting, a FACStarPlus was used.
For the analysis of ES-derived NK (ES-NK) cells, dead cells, and the
stroma OP9 cells were excluded by the forward and wide angle scatter
gates, and the efficiency of the gating was confirmed by the expression
of Kb on all ES-NK cells thus analyzed.
RT-PCR analysis of NK cell-associated genes
The amplification of total cDNA from a limiting number of cells
or single cells was based on a method previously described
(15). Gene expression of NK markers and receptors were
analyzed by subjecting the amplified total cDNA derived from each cell
to a second round of PCR using elongase or platinum Taq DNA
polymerase (Life Technologies, Burlington, Canada) as described. The
following primers were used: NKR-P1A (sense) CCCTGCTCACCAGTTCAG,
(antisense) CCATAACCCACATAGTTGCTC; granzyme A (sense)
TTGACTGCTGCCCACTGTAAC, (antisense) ATCGGCGATCTCCACACTTC; granzyme B
(sense) GATATGTGGGGGCTTCCTTA, (antisense) CTCACACTCCCGATCCTTCTG;
perforin (sense) AGGTTCCTGAGGCCTGACCGC, (antisense)
ACCGATGCTGACCTGGGCCTC; Ly49B (sense) ATCGTACTTTACATACTTCCAAGATG,
(antisense) GCTTCTGCTCTGTTAAGTCTGTTG; Ly49I (sense)
ATGAGTGAGCCAGAGGTTACTTAC, (antisense) CTTTAACTCTGGTTGGAAAGTTAATC;
CD94 (sense) TTTCTTGATGGTTACTTTGGGAGTT, (antisense)
AAACGCTTTTGCTTGGACTGTA; NKG2A (sense) CGAAGCAAAGGCACAGA,
(antisense) ATGGCACAGTTACATTCATCAT; NKG2C (sense)
GCTGAACTGAAGAAGCAGATCC, (antisense) TGGGGAATTTACACTTACAAAG; NKG2E
(sense) ATAAACCACAGTCTATCTTCAGCA, (antisense) same as for NKG2C; NKG2D
(sense) GAGATGAGCAAATGCCATAA, (antisense) TAGCCCTCTCTTGAGGAAA. The
PCR were performed with an initial denaturation at 94°C followed
by 35 cycles of 94°C for 30 s, 55°C for 1 min, 72°C for 1
min, with a final 7 min extension at 72°C. The PCR products were
transferred onto ZetaProbe membranes (Bio-Rad, Mississauga, Canada) and
analyzed by standard Southern blot hybridization. The following probes
were used for Southern hybridization: NKR-P1A, CAGCTGTGCTGGGCTCATC;
granzyme A, TCAACATCACTGTCATAGACAG; granzyme B, AGAGGACTAGAGCTGTGAGG;
perforin, CACAGTAGAGTGTCCGATGTA; CD94, AACAATTGCACTGATGCCCAA;
NKG2A/C, TCCTTCGGAAGGGCAGAGGTCA; NKG2E,
CAAACTTATGCTCTTTGTCCA; NKG2D, GAGTCCTTGCTATAGCCTTG; 
-actin,
CAAGTGCTTCTAGGCGGACTGT. Probes for Ly49B and Ly49I were previously
described (15, 30, 31). The oligonucleotides were
32P-labeled using terminal transferase and
hybridized at 58°C to Southern blots. After hybridization, the blots
were washed in 3 x SSC, 1% SDS. The filters were exposed to
x-ray films at -70°C overnight. Although the PCR for NKG2E also
amplified NKG2A cDNA, the oligoprobe detected only NKG2E in Southern
blot analysis, enabling specific detection of individual NKG2 gene
expression. All other PCR primers specifically amplified the
appropriate cDNA. RT-PCR analyses were done in blind.
In vitro ES culture system
The ES cell line R1 was maintained on gelatin-coated tissue culture flasks in the presence of DMEM containing 15% FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 10 ng/ml of leukemia inhibitory factor and 100 µM monothioglycerol (Sigma-Aldrich, Oakville, Canada). The protocol for the differentiation of ES cells into NK cells was divided into three stages. In the first stage, ES cells were trypsinized, resuspended in IMDM, and added to methylcellulose media containing 15% FBS, 2 mM L-glutamine, 150 µM monothioglycerol, 40 ng/ml stem cell factor (SCF), and 20 ng/ml vascular endothelial growth factor and dispensed at a concentration of 350 cells/ml into 35-mm petri dishes (StemCell Technologies, Vancouver, Canada). The plated cells were incubated at 37°C and 5% CO2 for 8 days. To harvest, cells (now in clusters) were washed to remove methylcellulose agar and then trypsinized. Although in trypsin solution, the cells were made into a single-cell suspension by passing them through a 21-gauge 11/2-inch needle three times. Subsequently, the cells were stained with anti-CD34-FITC mAb and sorted on the FACStarplus for isolation of CD34+ cells. In the second stage, the CD34+ cells were seeded onto the OP9 stroma in six-well plates at a concentration of 104 cells/well and cultured for 7 days with 30 ng/ml IL-6, IL-7 (10% of hybridoma supernatant), 40 ng/ml SCF, and 100 ng/ml Flt3-ligand. After the first 3 days of incubation, half the media was removed and fresh medium containing the same growth factors was added. After another 2 days, the cells were trypsinized, vigorously pipetted, washed, and transferred to a new culture of OP9 stroma. In the third stage of the culture protocol, the growth factor medium was replaced with fresh medium containing 1000 U/ml IL-2, 20 ng/ml IL-15, 20 ng/ml IL-18, and 1 ng/ml IL-12. The developing ES cells were incubated in this cytokine mixture for 7 days, with a transfer onto new OP9 layers after the first 3 days of incubation. On day 8, differentiated ES cells were harvested by vigorous pipetting for analysis. For some experiments, ES-NK cells were further expanded by culturing for additional 2 days with IL-2, IL-12, and IL-15 without OP9 layers. The growth factors and cytokines SCF, Flt3-ligand, IL-6, and IL-2 were purified by an in-house facility (Terry Fox Laboratory, Vancouver, Canada). Vascular endothelial growth factor, IL-15, IL-18, and IL-12 were purchased from R&D Systems (Minneapolis, MN).
LAK cells
IL-2-activated splenic NK cells from 129S1/SvImJ (129/SvJ) mice were generated as described (32). Flow cytometric analysis of the cells showed that >95% of the cells were DX5+CD3-.
NK cytotoxicity assay
For specific lysis of target cells, the standard
51Cr-release assay was performed as previously
described (32). Target cells used were YAC-1, A20, K562,
721.221, C1498, and Con A blasts. For Con A blast generation,
splenocytes were obtained from C57BL/6,
2m-/-, and
Tap-1-/- mice 2 days before the cytotoxicity
assay. The cells were treated with 2 µg/ml Con A (Sigma-Aldrich) and
allowed to incubate for 2 days at 37°C and 5%
CO2 before being labeled with
51Cr.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The differentiation protocol to generate NK cells from ES cells
(R1 from 129/SvJ mouse) was divided into three stages, each one
associated with the addition of specific cytokines (details described
in Materials and Methods). In the first stage, ES
cells differentiated to form embryoid bodies that contained hemopoietic
progenitorcells expressing CD34. In the second stage, sorted
CD34+ cells differentiated into cells resembling
common lymphoid progenitors that expressed c-kit, IL-7R
(CD127), the common chain (CD132), IL-2R (CD25), low Thy1.2
(CD90), and high CD44 and CD24 (Fig. 1
).
In the third stage, these cells were cultured in the presence of a
combination of IL-2, IL-12, IL-15, and IL-18. The resulting product of
this differentiation system was a population of cells that resembled NK
cells. The M-CSF-deficient OP9 stromal cell line previously shown to
support in vitro lymphopoiesis of bone marrow and ES cells (19, 24, 33, 34, 35, 36) seemed essential for the generation of NK cells from
ES cells. In the absence of OP9 in the second and the third stages, no
NK cells were generated. Flow cytometric analyses showed that the ES-NK
cells expressed CD16, CD2, LFA-1 (CD11a/CD18), ICAM-1 (CD54), and Mac-1
(CD11b/CD18), but not CD3, CD4, or CD8 (Fig. 2A). The majority of the cells
did not express DX5, a pan NK cell marker. This surface phenotype of
ES-NK cells was very similar to that of IL-2-stimulated adult 129 mouse
splenic NK (LAK) cells (Fig. 2B), with the exception of CD2
and DX5, which were detected on most LAK cells but not on most ES-NK
cells. Transcripts for the NK-associated proteins NKR-P1A, granzymes A
and B, and perforin were detected by RT-PCR (Fig. 2C),
indicating that the cells derived from the ES differentiation system
were of the NK lineage.
|
|
D, ES-NK cells killed the
prototypic mouse NK target YAC-1 as well as the lymphoma line A20 and,
to a lesser extent, the C1498 lymphoma cell line. They did not kill the
human cell lines 721.221 and K562. These cells may lack the proper
activation ligands for ES-NK cells. The specificity of ES-NK
cytotoxicity (Fig. 2D, left panel) was similar to
that of adult 129 mouse LAK cells (Fig. 2D, right
panel). More importantly, ES-NK cells, like adult 129 LAK cells,
were able to distinguish between MHC class I-positive (C57BL/6) vs
class I-negative
(2m-/- or
Tap-1-/-) lymphoblasts and lysed only the
latter (Fig. 2E). These results indicate that the NK cells
generated from our in vitro ES culture system are capable of killing
some tumor cell lines and MHC class I-deficient, but not normal,
lymphoblasts.
Cytokine production is another important function of NK cells. To
examine whether the ES-NK cells were capable of producing cytokines,
they were stained for intracellular IFN- and analyzed by flow
cytometry according to a method previously described (37).
Results (data not shown) indicated that the ES-NK cells do produce
IFN-.
Expression and functions of MHC class I-specific NK cell receptors on ES-derived NK cells
Anti-Ly49 mAbs 4E5 and 4D11 that have been shown to recognize
Ly49R, O, V, and Ly49G2 and T of 129/SvJ origin, respectively,
(38) as well as anti-CD94 (18d3) and anti-NKG2
(20d5) mAbs, were used to detect the expression of MHC class I-specific
receptors on ES-NK cells. Flow cytometric analysis showed that most
ES-NK cells expressed CD94/NKG2, but not Ly49 receptors (Fig. 3A). By contrast, large
proportions of LAK cells generated from adult 129 mouse spleen
expressed Ly49 at high levels (Fig. 3B). The expression of
these receptors was also examined by RT-PCR. ES-NK cells contained
transcripts for CD94, NKG2A, NKG2C, NKG2E, NKG2D, and DAP12 (Fig. 3C). Using Ly49 consensus primers, RT-PCR products that
hybridized to a mixture of Ly49 cDNA probes were detected by Southern
blot analysis. However, the PCR products were not detectable by
ethidium bromide staining of agarose gel. Therefore, the amount of Ly49
cDNA amplified by the consensus primers appeared to be very low. It
should be noted that the consensus primers readily amplified all known
Ly49 (except Ly49B) from the splenocytes of the C57BL/6 mouse and
multiple Ly49 from 129/SvJ spleen cells (data not shown). When specific
primers for Ly49I, O, and P were used, transcripts for all three genes
were detected by Southern blot, but not by ethidium bromide staining of
the gel. The sizes of the PCR products for Ly49O and P were smaller
than expected and they seemed truncated (data not shown). Only the PCR
product of the expected size for Ly49I was detected by Southern blot
analysis. The PCR-amplified Ly49I cDNA was subsequently cloned an
sequenced to confirm that it was indeed Ly49I (data not shown). Ly49B
transcripts were also detected when Ly49B-specific primers were used.
Full-length Ly49B cDNA clones from the ES-derived cells were
subsequently isolated and sequenced (GenBank accession no. AF395446).
These results suggest that the ES-NK cells resemble fetal NK cells that
have been reported to express high levels of CD94 and NKG2, but not a
significant level of Ly49 receptors.
|
D), was sensitive to
ES-NK killing, whereas the RMA/Qa-1b
transfectants were resistant (Fig. 3E). Therefore, CD94/NKG2
on ES-NK cells are functional and capable of recognizing
Qa-1b on target cells and inhibiting
cytotoxicity. Although ES-NK cells expressed transcripts for both the
inhibitory CD94/NKG2A and potentially stimulatory CD94/NKG2C and
CD94/NKG2E, the inhibitory receptor seemed dominant. CD94/NKG2 expression in individual ES-NK cells
The above results showed that almost all ES-NK cells expressed
CD94/NKG2 receptors and contained transcripts for CD94 and all known
NKG2 genes. To determine whether different receptors were coexpressed
on ES-NK cells, individual ES-NK cells were directly sorted into
microtiter wells by flow cytometer, and the expression of individual
receptor genes in each cell was determined by single-cell RT-PCR. The
validity of this method was first confirmed with cloned cDNA. All the
PCR specifically amplified appropriate cDNA with the exception of PCR
for NKG2E that partially amplified NKG2A cDNA as well (Fig. 4A, left panel).
However, Southern blot analysis with specific oligonucleotide probes
specifically detected the individual genes (Fig. 4A,
right panel). The single-cell RT-PCR method was applied to
analyze three different cell populations. Flow cytometric analysis
showed that CD4+ splenic T cells do not express a
detectable level of CD94/NKG2 (Fig. 4B, right
panel), and no cells among 20 tested by single-cell RT-PCR were
positive for NKG2 gene expression (Fig. 4B, left
panel). Three cells were positive for CD94 mRNA.
Approximately 45% of freshly isolated splenic NK cells were found to
be CD94/NKG2+ by flow cytometry, whereas similar
percentages of positive cells were detected by single-cell RT-PCR. As
previously reported, most CD94/NKG2+ splenic NK
cells express NKG2A mRNA, but not NKG2C or NKG2E mRNA.
CD3+NK1.1+ cells in bone
marrow also expressed CD94/NKG2. However, unlike splenic NK cells, mRNA
for NKG2C and NKG2E is more frequently expressed in these cells than
that for NKG2A. The frequency of bone marrow NKT cells coexpressing
transcripts for CD94 and NKG2 was comparable to that expressing the
protein products, as determined by flow cytometry. Overall, these
results show close correlation between the frequency of CD94/NKG2
expressing cells determined by flow cytometry and that determined by
single-cell RT-PCR. The same method was applied to ES-NK cells. ES-NK
cells cultured with OP9 were further incubated for 2 additional days
with IL-2, 1L-12, 1L-15, and IL-18 in the absence of OP9 and
individually sorted for the RT-PCR. The results revealed that most
ES-NK cells coexpressed CD94, NKG2A, NKG2C, and NKG2E mRNA, whereas
25% expressed NKG2D mRNA (Fig. 4C). Only 2% of the cells
expressed Ly49B or Ly49I mRNA (data not shown).
|
Having verified that the ES-NK cells expressed functional
CD94/NKG2, we examined how these receptors were acquired. Cells at
different stages of development were obtained from the ES-NK
differentiation protocol and assessed for expression of CD94 and NKG2.
This was achieved by collecting the cells on days 0, 6, 8, 10, and 14
of the culture system, day 0 being the day CD34+
cells were isolated from embryoid body. Cells on day 6 likely represent
common lymphoid progenitors as discussed above. On day 7, cytokines
were switched from a mixture of IL-6, IL-7, SCF, and Flt3-ligand to a
mixture of IL-2, -12, -15, and -18 to induce differentiation of
lymphoid progenitors into the NK cell lineage. The expression of NK
cell receptors was determined by flow cytometry and RT-PCR. For
semiquantitative detection of the individual receptor transcripts,
increasing numbers (1, 10, 100, and 1000) of cells were sorted and used
for RT-PCR. CD94 transcripts were detected as early as day 0 of the
ES-NK differentiation pathway (Fig. 5A). The first NKG2 transcript
observed was NKG2D, an activating receptor that is significantly
divergent from the rest of the NKG2 family. It was followed by NKG2A
and E on day 8, and finally by NKG2C on day 10 (Fig. 5A).
Although NKG2A and NKG2E mRNA could be detected on the same day, the
level of NKG2E expression was considerably lower than that of NKG2A
(data not shown). The amount of transcripts detected for all genes
gradually increased with time. By FACS analyses, both CD94 and
NKG2gradually increased over time after the addition of IL-15 to the
culture system (Fig. 5B). These results were reproducible in
four separate experiments.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The detection of CD94 and NKG2D transcripts in CD34+ cells in embryoid bodies and the putative common lymphoid precursor cells, respectively, suggests that the expression of these genes may be regulated differently from that of other NKG2 genes. It also suggests that the expression of these genes may not be restricted to the NK cell lineage, but may be more widely distributed in the hemopoietic lineages. The expression of NKG2A, C, and E genes was rapidly initiated by IL-15 and their expression, both at the mRNA and the protein levels, increased in the subsequent culture period of 7–9 days. IL-15 and the OP9 stroma cells appear to be critical for this culture system. In the absence of IL-15 or OP9, no NK cells were generated. In contrast, IL-12 and IL-18 were not essential for the expression of CD94/NKG2, but seemed to enhance the cytotoxicity of ES-NK cells. Although most ES-NK cells coexpressed all the CD94 and NKG2 mRNA, the inhibitory CD94/NKG2A receptor seemed dominant over the possible stimulatory CD94/NKG2C and CD94/NKG2E receptors as demonstrated by the inhibition of cytotoxicity mediated by Qa-1b on target cells. ES-NK cells can kill MHC class I-deficient, but not normal, Con A blasts suggesting that CD94/NKG2A is responsible for the self-tolerance of ES-NK cells. Thus, induction of NKG2A at an early point during NK cell differentiation ensures that developing NK cells remain self-tolerant.
ES-NK cells resemble fetal NK cells in many ways. Both express CD94/NKG2 but not Ly49, and they also differentially kill MHC class I-deficient cells. Toomey et al. (21) generated NK cell clones from fetal thymus in the presence of IL-2 and IL-4. Although they all contained CD94 and NKG2 transcripts, the Qa-1b receptor protein was detected on some, but not all, fetal NK clones. Single-cell analysis of those clones suggested that the acquisition of the Qa-1b receptor on fetal NK cells is stochastic. In contrast to the NK clones generated from fetal thymus, almost all ES-NK cells expressed the CD94/NKG2 proteins, consistent with the CD94/NKG2 expression pattern of fetal NK cells (22). Currently, no mAbs are available to differentially detect individual CD94/NKG2 heterodimers, and it remains to be determined whether the CD94 and NKG2 mRNA detected in most ES-NK cells encode functional proteins. However, the frequencies of cells expressing these mRNA determined by single-cell RT-PCR in other cell populations thus far tested are very similar to the percentages of cells positively stained with anti-CD94/NKG2 mAb. Therefore, most ES-NK cells may coexpress all CD94/NKG2 receptors, and thus, the acquisition of CD94/NKG2 receptors by ES-NK cells appears to be nonstochastic. The expression of NKG2 genes in NK progenitors seems to be initiated by IL-15 and follow a predetermined order of expression. Whether the chromosomal locations of the genes influence the order of individual NKG2 expression is currently unknown. In both humans and mice, the Cd94 gene is most centromeric followed by Nkg2d, Nkg2e, Nkg2c, and Nkg2a (1, 45). Although Ly49E has been reported to be expressed on fetal NK cells from B6 mice (22, 46), transcripts for Ly49E were not detected in ES-NK cells by RT-PCR. The sequence of 129 Ly49E cDNA is almost identical with that of B6 origin, and it should be amplified by PCR using the consensus primers in this study. It is still unknown why Ly49E transcripts are not detected in our studies. Ly49B transcripts were previously detected in immature NK cells generated from adult mouse bone marrow progenitors in vitro (19). The sequence of Ly49B is divergent from those of other Ly49, and the gene is distantly located from the Ly49 gene cluster. The sequence of Ly49B cDNA from 129 mice indicates that it is highly conserved in the two strains. It remains to be determined whether Ly49B plays a role in NK cell differentiation.
In bone marrow cell culture systems described by Roth et al.
(24) and Williams et al. (19), stromal cells
were required for the induction of Ly49. In the absence of stromal
cells, bone marrow progenitor cells isolated from adult C57BL/6 mice
differentiated into NK1.1+ cells that were
cytotoxic but lacking Ly49 expression (47). However,
coculturing with the OP9 stromal cell line yielded 50%
Ly49+ NK cells, the majority of them acquiring
Ly49C/I and Ly49G receptors. In the ES cell system, Ly49 receptors were
undetectable on developing NK cells despite being cocultured almost the
entire period on OP9 stromal cells. It has recently been reported that
fetal liver hematopoiesis has a different developmental capacity than
that of adult bone marrow hematopoiesis despite both having the ability
to generate lymphoid cells (19, 48). In this case, the
common lymphoid progenitor in adult bone marrow was found to be more
restricted in its differentiation potential, suggesting a switch in
mechanisms regulating development from fetal to adult life. It was
proposed that the variable expression of Pax-5, a myeloid-suppressing
transcription factor, was responsible for that switch. It seems likely
that the ES cell culture system in this study mimics the fetal, but not
adult, NK cell differentiation pathway.
Nakayama et al. (43) reported an in vitro method to generate LAK cells from ES cells in which CD34+ embryoid body cells were also enriched as differentiation intermediates. From their method, two types of LAK cells were obtained, both of which were cytotoxic in response to IL-2. However, there were differences between them in terms of their cytotoxic capabilities and specificities. Also, there did not appear to be a controlled preference for generating one type of LAK over the other. One of the main differences between the culture system described by Nakayama et al. (43) and that described in this study was the cytokines used. Based on studies showing the importance of IL-15 and Flt3-ligand in the bone marrow microenvironment (24, 49), these cytokines were added to our developing ES cultures. Because Nakayama et al. (43) did not analyze their ES-derived LAK cells for the expression of MHC class I-specific receptors, a detailed comparison cannot be made between those cells and the ES-NK cells described in this study.
For CD94/NKG2, their order of expression reflects one of the models proposed by D. H. Raulet (23) describing how individual NK cells obtain a proper balance of activating and inhibitory signals. According to this model, individual NK cells first express inhibitory receptors, and once sufficient expression is obtained to prevent autoaggression, expression of activating receptors is initiated. There is also evidence suggesting that activating receptors for non-MHC self-ligands are expressed at the earliest stages of receptor acquisition. Their expression subsequently drives the expression of the MHC-specific receptors, beginning with the inhibitory and followed by the activating receptors. The NKG2 acquisition pattern observed in developing ES-NK cells appear to fit this description. Expression of NKG2D, a non-MHC-specific activating receptor, occurred very early in ES-NK development and preceded the expression of all the other NKG2 genes. The next receptor expressed was NKG2A, which is inhibiting and MHC-specific, followed by NKG2E and finally NKG2C, both of which are MHC-specific activating molecules. Even though the ES-NK results seem to conform to this model, further investigation is required to fully understand how these genes are developmentally regulated.
Future experiments using the culture method to generate NK cells from ES cells described in this study will be very useful for examining and identifying molecular events and genes that regulate NK cell differentiation and receptor acquisition. In addition, these future studies will also be important in evaluating the precise role of CD94/NKG2 in the NK developmental process.
|
Footnotes |
|---|
2 R.H.L. and M.M. contributed equally to this work.
3 Address correspondence and reprint requests to: Dr. Fumio Takei, Terry Fox Laboratory, 601 West 10th Avenue, Vancouver, British Columbia, Canada, V5Z 1L3. E-mail address: ftakei{at}bccancer.bc.ca
4 Abbreviations used in this paper: ITIM, immunoreceptor tyrosine-based inhibitory motif; ES, embryonic stem; SCF, stem cell factor; ES-NK, ES-derived NK.
Received for publication August 27, 2001. Accepted for publication March 13, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production and cytotoxicity of IL-2-activated murine NK cells are differentially regulated by MHC class I molecules. J. Immunol. 163:6488.This article has been cited by other articles:
|
|
 |
|
  E. M. Mace, S. J. Monkley, D. R. Critchley, and F. Takei A Dual Role for Talin in NK Cell Cytotoxicity: Activation of LFA-1-Mediated Cell Adhesion and Polarization of NK Cells J. Immunol., January 15, 2009; 182(2): 948 - 956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Gays, J. G. Aust, D. M. Reid, J. Falconer, N. Toyama-Sorimachi, P. R. Taylor, and C. G. Brooks Ly49B Is Expressed on Multiple Subpopulations of Myeloid Cells J. Immunol., November 1, 2006; 177(9): 5840 - 5851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Iizuka, T. Kaifu, A. Nakamura, M. Obinata, and T. Takai Establishment and Functional Characterization of Novel Natural Killer Cell Lines Derived from a Temperature-Sensitive SV40 Large T Antigen Transgenic Mouse J. Biochem., August 1, 2006; 140(2): 255 - 265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Rogers, A. Rouhi, F. Takei, and D. L. Mager A Role for DNA Hypomethylation and Histone Acetylation in Maintaining Allele-Specific Expression of Mouse NKG2A in Developing and Mature NK Cells J. Immunol., July 1, 2006; 177(1): 414 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Olsen, D. L. Stachura, and M. J. Weiss Designer blood: creating hematopoietic lineages from embryonic stem cells Blood, February 15, 2006; 107(4): 1265 - 1275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Woll, C. H. Martin, J. S. Miller, and D. S. Kaufman Human Embryonic Stem Cell-Derived NK Cells Acquire Functional Receptors and Cytolytic Activity J. Immunol., October 15, 2005; 175(8): 5095 - 5103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nguyen, N. Dhedin, J.-P. Vernant, M. Kuentz, A. A. Jijakli, N. Rouas-Freiss, E. D. Carosella, A. Boudifa, P. Debre, and V. Vieillard NK-cell reconstitution after haploidentical hematopoietic stem-cell transplantations: immaturity of NK cells and inhibitory effect of NKG2A override GvL effect Blood, May 15, 2005; 105(10): 4135 - 4142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Regunathan, Y. Chen, D. Wang, and S. Malarkannan NKG2D receptor-mediated NK cell function is regulated by inhibitory Ly49 receptors Blood, January 1, 2005; 105(1): 233 - 240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. LaBonte, E. I. Choi, and N. L. Letvin Molecular Determinants Regulating the Pairing of NKG2 Molecules with CD94 for Cell Surface Heterodimer Expression J. Immunol., June 1, 2004; 172(11): 6902 - 6912. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-W. Lin, Y.-H. Chen, Y.-C. Chuang, T.-Y. Liu, and S.-M. Hsu CD94 transcripts imply a better prognosis in nasal-type extranodal NK/T-cell lymphoma Blood, October 1, 2003; 102(7): 2623 - 2631. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
