|
|
||||||||




Departments of
*
Bacteriology and
Gynecology, Yokohama City University School of Medicine, Yokohama, Japan;
Department of Molecular Biology, Nagoya City University School of Medicine, Nagoya, Japan; and
Center for Biologic Evaluation and Research/Food and Drug Administration, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In the present study, we confirmed that plasmid DNA administered to pregnant mice can reach the fetus through the placenta. This was true both of DNA vaccines encoding the env and gag genes of HIV-1 as well as those encoding the influenza virus hemagglutinin (HA),3 matrix (M), and nucleoprotein (NP) genes. Analysis of the immune response of offspring whose mothers were immunized with the influenza DNA vaccine indicates that these progenies had enhanced level of protection against the same virus infection.
| Materials and Methods |
|---|
|
|
|---|
We used 6- to 10-wk-old BALB/c female mice purchased from Japan SLC (Shizuoka, Japan). All mice were allowed free access to sterile food and water.
Viral protein expression plasmids and Abs
pCMV160IIIB encoding the env gene of HIV-1 strain IIIB has been described in detail in our previous report (10). pCMVgag was constructed from the gag gene of HIV-1 strain IIIB using the same plasmid vector of pCMV160IIIB plasmid. In addition, a plasmid DNA preparation used in the present study contained liposomes (11).
A pME18S-M expression plasmid was constructed with the pME18S
expression vector into which M region cDNA from influenza virus strain
A/PR/8/34 (H1N1) had been inserted (12). pME18S empty
vector was used as a control plasmid for A/PR/8/34 challenge. The
expression of the proteins was confirmed by Western blot analysis
(9). DNA vaccines of NP (A/pCMV-V1NP) and HA (V1J-HA(PR8))
(13, 14) genes of the A/PR/8/34 strain
(15, 16, 17) were kind gifts from J. J. Donelly and D.
Montgomery, Merck Research Laboratory (West Point, PA). Anti-HA (C 179)
and anti-M1 mAbs (mAb, C111) were purchased from Takara Biomedicals
(Kyoto, Japan). To confirm that plasmid DNA was transferred through the
placenta, a lacZ expression plasmid containing a chicken
-actin promoter was also used.
Virus
Mouse-adapted influenza A/PR/8/34 (H1N1) viruses were used in this study. Viruses were harvested from infected Maudin-Darby canine kidney cells and titrated according to the plaque formation method.
DNA immunization
Mothers were injected i.v. with DNA vaccine before or after
coitus. Preparations containing various doses of the DNA vaccine were
encapsulated into liposomes (11). Briefly, a mixture of
3
-[N'-(N'-dimethylaminoethane) carbamoyl]
cholesterol and dioleoylphosphatidylethanolamine in chloroform was
dried, vacuum desicated, resuspended in sterile HEPES buffer (pH 7.4),
and used for the cationic liposomes. Before administration, an
appropriate amount of DNA in 0.15 mol PBS (pH 7.2) was mixed with the
liposome solution at a volume ratio of 17:3. The pregnant mice were
i.v. administered the DNA vaccine or empty vector on various days after
postconception (p.c.) to assess immunogenicity. Six weeks after birth,
their offspring were injected i.m. in gastrocnemius muscles with 2050
µg of the same expression plasmid or the empty vector. For the
influenza virus challenge experiment, 50 µg each of plasmids
expressing influenza HA and NP protein was administered into pregnant
mice by i.v. route. The same amount of DNA plasmids were
administered to offspring by intranasal route.
Slot blot analysis
The conventional method for detecting DNA was performed using slot-blot analysis described elsewhere (9).
Fluorescence in situ hybridization (FISH) analysis
FISH analysis was performed essentially according to the method of El-Naggar et al. (18). A 564-bp HIV env region fragment (nt 15692133) amplified from pCMV160IIIB plasmid (10) was labeled with digoxigenin-11-dUTP by nick translation and used for a hybridization probe. The tissue samples were taken from mice to which 50 µg HIV plasmid pCMV160IIIB (10) or influenza plasmid V1J-HA(PR8) (14, 15) with liposomes was administered and sliced to prepare histological examination. The samples, which were deparaffinized in xylene and ethanol, were denatured and hybridized with digoxigenin-labeled probes using previously described method (18). After hybridization, the slides were washed and stained with an antidigoxigenin rhodamine (a red fluorochrome; Boehringer Mannheim, Mannheim, Germany). The slides were counterstained with 4,6-diamino-2-phenylindole dihydrochloride. Images were made with a Nikon SA fluo-rescence microscope (Nikon, Tokyo, Japan) and a charge-coupled device camera interfaced with a Cyto Vision (Applied Imaging, Sunderland, U.K.).
RT-PCR
Total RNA was isolated using TRIzol (Life Technologies, Grand
Island, NY) by means of previously described methods (19, 20). Briefly, quick frozen samples were thawed and extensively
treated with DNase. Then RNA was converted to cDNA using a GeneAmp RNA
PCR kit (PerkinElmer, Norwalk, CT). The total RNA was reverse
transcribed with random hexamers and Moloney murine leukemia virus
reverse transcriptase. As a control experiment, we tested RNase
treatment before reverse transcription. For detecting the
HIV-1 env gene, cDNA was amplified in a 30-cycle
PCR using primers GGAGCAGCAGGAAGCACTAT and TCCCTGCCTAACTCTA. The
primers for nested PCR were TGCTGAGGGCTATGA and
GCCTCCTACTATCATTATG. For detecting
-actin gene, the primers
TGGAATCCTGTGGCATCCATGAAAC and TAAAACGCAGCTCAGTAACAGTCCG were
used.
Recombinant proteins and peptides
The DNA fragments encoding almost the full length of the influenza M and NP genes were amplified from pME18S-M and A/pCMV-V1NP by PCR. The PCR products were inserted into pGEX-3X (Pharmacia Biotech, Uppsala, Sweden) by directional cloning. pGEX-M and pGEX-NP were transformed into Escherichia coli JM 101. Purified influenza M gene product and NP protein were obtained using a bacterial expression system. Recombinant gp160 from HIV-1IIIB was obtained from MicroGene System (Meriden, CT). HGP30 peptide (YCVHQRIEIKDTKEALDKIEEEQNKSKKKA) was used for detection of the HIV-1 gag immune response (21, 22); and influenza M1 peptide (KAVKLYRKLKRE) was used as an Ag for ELISA. We also included mice that were i.m. injected inactivated influenza A/PR/8/34 as a control Ag. For the CTL assay, we used HIV-1 V3 peptide (RGPGRAFVTI) (23) to synthesize the Ag as well as the peptide ALVEADVA of sperm whale myoglobin (24) as a control peptide.
Delayed-type hypersensitivity (DTH) response
Seven days after i.m. immunization with 20 µg of the same expression plasmids as received by their mothers, a total of 25 µl of PBS containing 5 µg of gp160, HGP-30 peptide, influenza M gene product, or heat-killed A/PR/8/34 virus was injected into the right footpad of immunized offspring. After 24 h, the extent of footpad swelling was measured by previously described method (25).
ELISA
ELISA was used for titration of serum Ag-specific IgG, IgG1,
IgG2a, and IgM responses. Offspring of both immunized and nonimmunized
mothers were bled at 7 days after i.m. immunization with various DNA
vaccines, as described elsewhere (26). A total of 10
µg/ml gp160 protein, HGP-30 peptide, rNP protein, M1 synthetic
peptides, or heat-killed A/PR/8/34 virus was coated on 96-well
microplates (Nunc, Roskilde, Denmark); after blocking with 3% BSA in
PBS, serially diluted antisera were added and incubated at 37°C for
2 h. Peroxidase-conjugated goat anti-mouse IgG (Organon
Teknika, West Chester, PA) was used as the secondary Ab; then the
plates were stained with 3,3',5,5'-tetramethylbenzine (DAKO,
Carpenteria, CA). For Ag-specific IgG1, IgG2a, and IgM responses,
HRP-coupled anti-mouse IgG1, IgG2a, or IgM (Organon Teknika) was
used as the secondary Ab. Specific Ab titers were expressed as the
reciprocal value of the final dilution, which gave an OD
(A415) of
0.2 OD units compared
with each preimmunized sample.
Cytokine ELISPOT assay
The cytokine ELISPOT assay was performed with minor
modifications, as previously described (26, 27). Briefly,
96-well microplates (MAIPS4510; Millipore, Bedford, MA) were coated
with anti-mouse IFN-
rat mAb (BD PharMingen, San Diego, CA), and
after adding cells isolated from the spleen 7 days after immunization,
plates were incubated in a 5% CO2 atmosphere at
37°C with or without 10 µg/ml V3 peptide. After a 48-h culture,
plates were washed and incubated again for 1 h with biotinylated
anti-mouse IFN-
mAb (BD PharMingen). Then, after peroxidase
staining, the spots in each well were counted, using the dilution to
calculate the total number of cytokine-secreting cells utilizing a
computer-assisted video image system (Zeiss, Oberkochen, Germany).
HIV-1-specific CTL response
Mother mice that received pCMV160IIIB were immunized with 50 µg of the same plasmid with liposomes, and spleen cells were collected. The details of the CTL assay have been described previously (28). We also obtained spleen cells from offspring whose mothers were injected with the empty vector. Then 1 x 106 lymphoid cells were restimulated in vitro in the presence of the same amount of irradiated (30 Gy) syngenic spleen cells with 5 µg/ml HIV-1 V3 peptide RGPGRAFVTI (29, 30), a known CTL epitope of HIV-1IIIB. After a 5-day culture, the cytotoxic activity of these spleen cells was measured by a 6-h 51Cr release assay using V3 or myoglobin peptide-pulsed target P815 (H-2d) cells.
Virus challenge
Under light diethylether anesthesia, the offspring were simultaneously infected with virus at day 10 after immunization with the same plasmid DNA as that administered to their mothers. Five lethal doses (LD50) of influenza A/PR/8/34 (H1N1) in 30 µl of PBS were administered by the intratracheal route using a 24-gauge stainless steel animal feeding tube (Popper & Sons, New York, NY). The mortality rate was determined after 20 days.
Statistical analysis
Statistical analysis for comparison of two groups was conducted using an unpaired t test or one-way factorial ANOVA for distribution parameters. Significance was defined as p < 0.05 in both analyses.
| Results |
|---|
|
|
|---|
Initial studies examined whether DNA plasmids could be transmitted
through the placenta of pregnant mice. To evaluate plasmid uptake and
expression in fetal tissue, a plasmid expressing the lacZ
gene was used. To increase the uptake of this plasmid, it was liposome
encapsulated before i.v. delivery (7). Tissues from
newborn mice from mothers injected with the lacZ plasmid and
liposomes 9.5 days p.c. showed strong expression of that gene (Fig. 1
). Of particular interest was the
intense staining in the umbilical region of the fetuses.
|
|
The offspring of mice vaccinated while pregnant with one of
several different DNA plasmids were immunized at 6 wk of age with the
same plasmid. Ab titers among offspring of vaccinated mothers were
significantly higher than those of mothers injected with vector alone
(Table I
). Improved Ab responses were
seen for a variety of epitopes encoded by HIV-1 and influenza genes.
The Ab titers of mice at 6 wk of age whose mothers received plasmid DNA
were below 2 when we tested ELISA using each corresponding Ag (data not
shown). The timing of maternal DNA vaccination on the immune response
of offspring was then examined. Mothers were immunized either 2 wk
before being mated, or at various periods p.c. At 6 wk postbirth, the
offspring were vaccinated and their Ab response was tested after 7
days. Vaccination before mating had no effect on the immune response of
the litter (Table II
). By comparison,
significantly Ag-specific responses were observed in the offspring of
mice vaccinated from 5 to 18 days p.c. In general, the later
vaccination was delayed p.c., the stronger the immune response mounted
by the immunized offspring.
|
|
|
|
was observed.
|
|
To examine the immunoprotective effect of maternal vaccination
with a DNA vaccine against influenza virus, offspring were immunized
with 50 µg of the same vaccine at 6 wk of age. Seven days later, they
were challenged with influenza virus A/PR/8/34. Whereas few normal mice
survived challenge, >70% of the offspring of vaccinated mothers
survived (Fig. 4
).
|
|
| Discussion |
|---|
|
|
|---|
-galactosidase-encoding plasmid allowed for the
direct identification of protein expression in neonates. Although
protein levels were low (they were undetectable by Western blot
analysis), clear detection of multiple organs and intense staining of
the placenta were consistent with transplacental migration of the
plasmid. Second, RT-PCR allowed identification of mRNA encoded by the
DNA vaccine in fetal tissues, especially those from mothers injected
after day 9.5 p.c. DNA vaccination in the precoital period or
before day 3 of pregnancy did not result in detectable fetal
transmission of the plasmid, presumably due to immaturity of the
placenta at this early stage (Table II
-galactosidase plasmid can be transmitted through the placenta to
the fetus in mice. Of particular importance, we established that such
transplacental transfer influences the recipients subsequent capacity
to mount an immune response against the plasmid-encoded Ag. This was
manifested both by improved humoral and cellular immunity (Tables I-V)
and higher levels of pathogen-specific protection (Fig. 4These studies were also performed to test the hypothesis that the administration of a DNA vaccine during pregnancy may induce Ag-specific tolerance in the offspring, as suggested by the clonal selection theory of Burnet (2, 3, 31). Although pregnant mice were immunized with various doses of several different DNA vaccines, we found that immunity, but not tolerance, was elicited in the fetus (Tables I-IV). Using this technique, we did not observe Ag-specific immune tolerance in progeny, as reported by Mor et al. (32). This could reflect our use of a different plasmid (Mor detected tolerance following neonatal immunization with a plasmid encoding the circumsporozoite protein of malaria), or the very limited amount of plasmid actually transferred transplacentally. Indeed, Ichino et al. (7) demonstrated that neonatal tolerance was dose dependent, and could be reliably induced only when >10 µg plasmid was injected into newborn mice. This is consistent with other reports showing that low dose Ag can induce immune responsiveness, while high dose immunization can induce tolerance in young recipients (8, 33, 34), which might be supporting Burnets theory that high levels of neonatal Ag can trigger clonal deletion (3, 7).
When offspring of vaccinated mothers were immunized at 6 wk of age with
the same DNA vaccine, they manifested significant anamnestic responses
(Table III
). Reimmunization was required, however, since transplacental
transport of plasmid alone did not trigger strong immune responses in
the newborn, nor provide adequate protection from infection (Fig. 4
and
Table VI
). Yet reexposure of these mice to vaccine at 6 wk of age
elicited a strong, protective immune response, characterized by
Ag-specific Ab, CTL, and cytokine responses. The administration of DNA
vaccine into amniotic fluid induced a high level of protective immunity
(35).
We used liposomes throughout our studies, because we could observe high
levels of immune responses (Table I
and Fig. 4
) when we added liposomes
as an adjuvant. The same observation was reported previously
(9).
Results indicate that the transmission of serum IgG from immunized
mothers to offspring seems not to have a major influence on the
production of specific Ab at 6 wk of age. A lack of maternal
contribution to the DTH response of offspring is particularly evident
(Table IV
). Thus, while we cannot rule out the possibility that some
maternal contribution persisted, only following direct immunization of
offspring at 6 wk of age was clear evidence of improved protective
immunity observed (Table VI
). However, in the present study, when DNA
vaccine was given to mothers, Ag-specific acquired immunity was induced
in their offspring. Therefore, this method may be effective in the
prevention of pertussis, hepatitis, and various other infections
occurring in infants as well as animals.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenji Okuda, Department of Bacteriology, Yokohama City University School of Medicine, 3-9 Fukuura Kanazawa-ku, Yokohama 236-0004 Japan. E-mail address: kokuda{at}med.yokohama-cu.ac.jp ![]()
3 Abbreviations used in this paper: HA, hemagglutinin; DTH, delayed-type hypersensitivity; FISH, fluorescence in situ hybridization; M, matrix; NP, nucleoprotein; p.c., postconception. ![]()
Received for publication May 21, 2001. Accepted for publication August 31, 2001.
| References |
|---|
|
|
|---|
antibody. Immunology 92:111.[Medline]
spots in response to peptide antigens. J. Immunol. Methods 203:141.[Medline]
This article has been cited by other articles:
![]() |
K. Someya, K.-Q. Xin, K. Matsuo, K. Okuda, N. Yamamoto, and M. Honda A Consecutive Priming-Boosting Vaccination of Mice with Simian Immunodeficiency Virus (SIV) gag/pol DNA and Recombinant Vaccinia Virus Strain DIs Elicits Effective Anti-SIV Immunity J. Virol., September 15, 2004; 78(18): 9842 - 9853. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |