| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institute of Cell, Animal and Population Biology, University of Edinburgh, Edinburgh, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Macrophages, activated by pro-inflammatory cytokines such as IFN-
,
are critical in combating infection with intracellular microorganisms
(11). In contrast, the type 2 cytokines IL-4 and IL-13 can
activate macrophages toward a down-regulatory phenotype
(12, 13, 14). Such cells, termed alternatively activated
macrophages (AAM
)7
may have immunoregulatory functions (12), but their real
purpose and range of activities in vivo is not known. One possibility
is that AAM dampen Th1- or Th2-mediated tissue-damaging responses
during infection with extracellular parasites (15, 16, 17) and
in allergic disease (18).
In a murine model of filarial infection, the human nematode parasite
Brugia malayi is surgically implanted into the peritoneal
cavity of mice (15, 16, 19, 20) where the recruitment of
both AAM and eosinophils occurs. In this paper we present evidence
for a link between the differentiation of AAM in response to this
nematode parasite and the recruitment of eosinophils to the site of
infection. Remarkably, we show that a cytokine homolog secreted by the
nematode parasite (Bm macrophage migration inhibitory factor
(MIF)-1) is involved in activating macrophages and is sufficient for
the recruitment of eosinophils.
Mammalian MIF was the first cytokine discovered (21) and is involved in septic shock (22) and counteracting glucocorticoid action (23). Interestingly, homologs of this cytokine have been identified in B. malayi (24) that share with human MIF a chemotactic activity for monocyte/macrophages. An unusual feature of MIF proteins is their enzymatic activity (25).8 In human MIF, mutation of the conserved N-terminal proline to glycine substantially ablates both catalytic and cytokine activity (26). We now show that a B. malayi homolog of MIF (Bm-MIF-1) induces eosinophil recruitment in vivo when injected into the peritoneal cavity of mice and that mutation of the conserved proline residue eliminates this activity. We also find that Bm-MIF-1 increases the transcription rate of a gene encoding a novel eosinophil chemotactic factor (ECF-L), also known as Ym1 (27, 28). Gene expression analysis demonstrates that Ym1/ECF-L represents over 9% of the total transcripts in macrophages recruited to the site of B. malayi infection. Importantly, Ym1 has been demonstrated to have chemotactic activity for eosinophils both in vitro and in vivo (28). These findings demonstrate an important link between macrophage activation and eosinophil chemotaxis and they suggest that Ym1 may be an important new player in helminth driven inflammatory processes.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to 8-wk-old CBA/Ca or C57BL/6 males were used for B. malayi implantation. Both male and female BALB/c mice were used for the injection of Bm-MIF-1 or LPS in vivo. C57BL/6 IL-4-deficient (IL-4-/-) breeding pairs were purchased from B & K Universal (North Humberside, U.K.) with permission of the Institute of Genetics (University of Cologne, Cologne, Germany). C57BL/6 IL-5-deficient (IL-5-/-) mice (29) were the kind gift of Dr. M. Kopf (Basel Institute for Immunology, Basel, Switzerland). All mice were bred in-house.
In vivo mouse models
B. malayi adult parasites were obtained from infected jirds purchased from TRS Laboratories (Athens, GA). Adult worms were removed from the peritoneal cavity of jirds, washed in RPMI, and six live adult B. malayi females were surgically implanted into the peritoneal cavity of the mice. After the experimental period, mice were euthanized by cardiac puncture, and peritoneal exudate cells (PEC) were harvested by thorough washing of the peritoneal cavity with 15 ml of RPMI. For analysis of Bm-MIF activity in vivo, 1 µg of purified, LPS-free recombinant Bm-MIF-1 and Bm-MIF-1G were injected i.p. into mice three times a week for 3 wk (nine injections) 3 days after the final injection the PEC cells were harvested as described above.
Characterization of PEC populations
Cytocentrifuge preparations of 1 x 105 cells were made using a Shandon Cytospin (Thermo Shandon, Pittsburgh, PA). Cytospins were air dried, fixed in methanol, and stained with DiffQuik (Dade, Unterschleissheim, Germany) and examined with a Nikon Microphot-FX microscope (Nikon, Melville, NY). Before magnetic bead cell purification, PEC were passed through a 70-µm cell strainer and were purified by centrifugation over Histopaque (Sigma-Aldrich, St. Louis, MO) to remove any microfilariae. PEC were then sorted with MS+ or VS+ columns according to the manufacturer’s instructions (Miltenyi Biotec, Auburn, CA). F4/80+ cells were purified with biotin-conjugated F4/80 (rat IgG2b; Caltag Laboratories, Burlingame, CA) and streptavidin microbeads (Miltenyi Biotec).
cDNA library construction and express sequence tag analysis
Total RNA was extracted (with RNAstat60; Ambion, Austin, TX) from purified F4/80+ macrophages from the PEC of B. malayi-implanted IL-5-deficient mice. cDNA was synthesized from total RNA and was unidirectionally cloned into the pCMV-Script plasmid vector, using the cDNA library construction kit from Stratagene (La Jolla, CA). Single clones from the unamplified library were randomly picked, and the cDNA inserts were amplified using vector primers T3 (AATTAACCCTCACTAAAGGG) and T7 (CGGGATATCACTCAGCATAATG). Inserts were sequenced using the 5' vector primer SAC (GGGAACAAAAGCTGGAG) and ABI Big DYE terminators (PerkinElmer/Cetus, Norwalk, CT). Sequencing reactions were analyzed using an ABI 377 automated sequencer (PerkinElmer/Cetus, Norwalk, CT). The sequences were edited manually with vector (SeqEd; Applied Biosystems, Foster City, CA) and poor 3' sequence removed. The edited sequences were sent to the National Center for Biotechnology Information for Blastn analysis against GenBank sequences (nr) and the expressed sequence tag (EST) database (dbest). Blastx analysis was also conducted against GenBank sequences (nr).
RT-PCR
For RT-PCR, first-strand cDNA was produced with oligo-dT primers
from total RNA using the GeneAmp RT-PCR kit (Applied Biosystems).
Ym1-specific primers (Ym1-For, TGG GGG ATC CG T ACC AGC TGA
TGT GCT ACT (64–82); Ym1-Rev, GTA AAG GAT CC T CAA TAA
GGG CCC TTG CA 1197–1182(1197–1182)) were used to amplify from the first-strand
cDNA. The Ym1 primers have an 18-bp overlap with the 5' and 3' end of
the target gene and an 11-bp overhang containing restriction sites
designed for a different purpose (overhanging nucleotides are in
italics). As a control, we used primers for 
-actin (-actin-F,
TGGAATCCTGTGGCATCCATGAAAC and -actin-R,
TAAAACGCAGCTCAGTAACAGTCCG). PCR conditions were as follows: 94°C for
3 min, 35 cycles of 20 s at 94°C, 30 s 55°C, and 90
s at 72°C resulting in a 1506-bp amplicon for Ym1 and 348-bp for
-actin. For real-time PCR (Light Cycler; Roche Diagnostic Systems,
Somerville, NJ), PCR on first-strand cDNA was performed using the SYBR
green kit (Roche Diagnostic Systems) with a second pair of Ym1-specific
primers (Ym1 -FLC, TCACAGGTCTGGCAATTCTTCTG; Ym1
-RLC, TTTGTCCTTAGGAGGGCTTCCTCG), resulting in a
437-bp product. The -actin primers shown above were also used for
-actin mRNA determination by real-time PCR.
Bm-MIF-1
Recombinant Bm-MIF-1 and Bm-MIF-1G were prepared as described elsewhere.8 Briefly, native and mutant proteins were expressed in E. coli using pET29 (Novagen, Madison, WI) with a C-terminal His-tag allowing purification to >97% homogeneity. Endotoxin was removed by phase separation using Triton X-114 (30) and was determined to be LPS free by a commercial assay (E-Toxate; Sigma-Aldrich). Control experiments with LPS were performed with LPS E. coli Serotype 026:B6 (Sigma-Aldrich).
Statistical analysis
Statistical analysis was performed using PRISM (GraphPad
Software, San Diego, CA). The nonparametric Mann-Whitney test was used
to determine measured differences between groups of mice
(n < 30), and the 
2 test was
used to determine significant differences between the number of mice
that up-regulate Ym1 after treatment.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Implantation of B. malayi filarial parasites into the
peritoneal cavity of mice leads to dramatic recruitment of inflammatory
cells, with a 5- to 10-fold increase in total cell numbers by 3 wk
postinfection (20). Within this population, the
predominant cell types are macrophages and eosinophils, the latter
having increased by 40-fold in the implanted mice. To determine the
kinetics of recruitment, we studied the development of peritoneal cell
populations over 21 days after exposure to B. malayi. After
an initial drop in the first 2 days, the total number of cells
increased steadily, reaching maximum levels at 2–3 wk (Fig. 1
A). Mast cells disappeared
within 24 h of implantation by which time there was a striking but
short-lived neutrophilia (Fig. 1B). In contrast, eosinophil
infiltration was observed slightly later, peaking at 7 days after
implantation and remaining stable until the experiment was terminated
at 21 days. As with total cell numbers, macrophage numbers steadily
increased in the first 2 wk (from 1.67 x
106 ± 0.81 x 106 on
day 0 to 5.12 x 106 ± 0.86 x
106 on day 14) and then remained high for the
duration of the experiment (6.57 x 106 ± 3.54 on day 21;
Fig. 1, A and B).
|
, C and D) for 3 wk
before recovering the PEC. Significantly fewer eosinophils were
recruited into the peritoneal cavity of
IL-4-/-,whereas, as expected, eosinophil
recruitment was virtually absent in IL-5-/-
mice. These data show that eosinophil recruitment in this model is
dependent not only on IL-5, but is also partly dependent on host
IL-4.
Characterization of gene expression in AAM
Peritoneal macrophages recruited by B. malayi profoundly suppress cellular proliferation through a contact-dependent mechanism (16). This suppressive phenotype is entirely dependent on the presence of host IL-4 (20). To explore the molecular basis of the IL-4-dependent phenotype, we constructed a cDNA library from purified F4/80+ macrophages, for EST sequencing of randomly selected clones. Macrophages were taken from parasite-implanted IL-5-/- mice, which possess identical suppressive function to implanted wild-type mice (16), as an additional precaution to exclude any eosinophil contribution to the cDNA library.
A total of 252 clones were sequenced from the 5' end to provide a
snapshot of the abundant genes expressed by these suppressive
macrophages (Table I). Among the genes
highly represented in the library is arginase I, which counteracts the
nitric oxide synthesis pathway in macrophages and is induced by Th2
cytokines (31). This finding supports our classification
of B. malayi-recruited macrophages as AAM. The abundant
expression of a novel cysteine-rich protein (PMNG1) by in vivo-derived
AAM is of significant interest and is the subject of ongoing
investigation in the laboratory. However, the most striking finding was
the extremely high representation of a gene of unknown function
submitted to the database as Ym1 (27), which accounted for
9.1% of the cDNA clones in this library. In a recent series of
studies, Owhashi et al. (32, 33) isolated an ECF produced
by CD8+ T lymphocytes (ECF-L) after infection
with Schistosoma japonicum and Toxocara canis.
This factor was biochemically purified and was shown by direct protein
sequencing to be Ym1 (28). These investigators then
isolated the cDNA clone and demonstrated that both native and
recombinant ECF-L/Ym1 was chemotactic for eosinophils in vitro and in
vivo (28).
|
The discovery that a novel ECF accounted for a startlingly high
proportion of the genes expressed in peritoneal macrophages of
nematode-implanted mice was highly provocative. We confirmed this
finding by an independent RT-PCR analysis (Fig. 2). In resident PECs from control mice,
Ym1 was routinely detected at a low, basal level. In comparison,
implantation of mice with parasites resulted in the dramatic
up-regulation of Ym1 expression in PECs after a period of 3 wk (Fig. 2A). This result was observed in every individual mouse of
either sex (n = 10) analyzed by RT-PCR. Using real-time
PCR, we estimated that Ym1 is up-regulated by >10,000-fold as a result
of parasite implantation (Fig. 2B) and is even more
abundantly expressed than -actin, which is consistent with our
preliminary EST analysis.
|
A). This was expected as Ym1 was
originally observed in a cDNA library of
IL-5-/- origin. In the absence of IL-5,
eosinophils fail to mobilize from the bone marrow and therefore even
with abundant Ym1 produced, eosinophils would not be recruited
(34). More significantly, we found that
F4/80+ macrophages from
IL-4-/- mice also showed the same up-regulation
of Ym1 (Fig. 2A) despite reduced eosinophil recruitment. In
IL-4 -/- mice, the failure to make a
full-fledged Th2 response may lead to reduced numbers of IL-5-producing
Th2 cells and thus reduced eosinophilia. This data demonstrates that
induction of Ym1 in this setting is independent of IL-4 or IL-5, but it
does not rule out a requirement for type 2 cytokines such as IL-13. Bm-MIF-1 induces up-regulation of Ym1
B. malayi has been recently shown to secrete homologs of the human cytokine MIF (24) that actively stimulate human monocytes and macrophages. Therefore, we asked whether Bm-MIF-1 could be responsible for the Ym1 induction seen in macrophages from implanted mice. To mimic the long-term effect of parasite secretions, we gave nine i.p. injections of endotoxin-free Bm-MIF-1 over a period of 3 wk. Both mammalian and parasite MIFs display cytokine activity and an unusual enzyme specificity, dopachrome tautomerase (25, 35, 36). Both activities are dependent upon the N-terminal proline residue. Therefore, we tested a mutant form of Bm-MIF-1, in which the proline has been altered to glycine (Bm-MIF-1G) and lacks biological activity.8 We treated two control groups with corresponding volumes of sterile PBS or LPS (0.1 U/injection). Three days after the last injection, the animals were sacrificed and the cells recruited to, or resident in, the peritoneal cavity were processed for RT-PCR analysis.
As shown in Fig. 3A and Table II, Bm-MIF-1 induced Ym1 (11
of 16 mice), whereas in the PBS-treated mice, Ym1 was only detected at
a basal level. Interestingly, Bm-MIF-1G only induced Ym1 in
2 of 16 mice. From this result, it appeared that the biological
activity, dependent upon an intact N-terminal proline, was responsible
for the induction of Ym1. Also shown in Table II, LPS was not effective
at inducing Ym1 in treated mice. To ensure that Ym1 was up-regulated in
macrophages and that the increased transcript levels were not the
result of increased macrophage numbers, PECs were pooled from each
group and the F4/80+ cells were purified with
immunomagnetic beads for RT-PCR analysis. F4/80+
cells from Bm-MIF-1-injected mice expressed high levels of
Ym1 (Fig. 3A).
|
|
-actin mRNA
content in all the samples (Fig. 3B), we detected a
significant increase in the level of Ym1 transcript in mice treated
with Bm-MIF-1 (mean 610.6 ± 1088) vs
Bm-MIF-1G-treated mice (mean 4.498 ± 2.871) or
PBS-treated mice (mean 0.7753 ± 0.9562; Fig. 3C).
Nearly identical results were obtained with
F4/80+ cells purified from pooled PECs (data not
shown). Interestingly, MIF-1G-treated mice showed a slight but
significant increase in Ym1 transcription, consistent with the data
showing that 2 of 16 MIF-1G-treated mice had up-regulated Ym1 (Table II). This indicates that the 1G mutation does not completely remove all
functional activity. We have seen similar residual activity in MIF-1G
when analyzing cytokine activity.8
It is of interest to note that 100% of parasite-exposed mice induced
Ym1, whereas 30% of mice exposed to Bm-MIF-1 failed to
induce this molecule (Table II). The results obtained with i.p.
injection of BmMIF are likely to differ from the live parasite
experiments because the live implanted parasites release native
Bm-MIF continuously over the 3 weeks of the duration of the
experiment. The nine injections given to the mice over the same period
may only partially mimic the live implant situation. We thus examined
whether the 3-wk treatment course with Bm-MIF-1 is required
for effective induction of Ym1. We treated mice with a single 10-µg
dose or three 1-µg doses spread over 1 week. The single injection of
a high dose of Bm-MIF-1 had no effect, whereas the three
consecutive injections did induce Ym1 (data not shown). Again, neither
PBS nor Bm-MIF-1G induced Ym1. A single high dose of LPS (10
U) also did not induce Ym1 (data not shown). This suggests that Ym1
induction requires the continuous release of Bm-MIF-1 as
would be found during live infection, and may explain the failure of
some Bm-MIF-injected mice to induce Ym1 transcription. In
addition, other components secreted by the live parasites may reinforce
the effects of Bm-MIF-1. Unsurprisingly, Bm-MIF-1
alone does not reproduce all the effects of parasite implantation
(i.e., recruited macrophages are not suppressive), arguing strongly
that the parasite is producing other immune modulatory factors.
Bm-MIF-1 induces recruitment of eosinophils
Assuming that Ym1 gene transcription reflects protein levels, and
with the knowledge that Ym1 (ECF-L) can recruit eosinophils in vitro as
well as in vivo (28), we asked whether there was any
relationship between recruitment of eosinophils to the peritoneal
cavity and the induction of Ym1 gene expression by Bm-MIF-1.
We thus examined stained cytospins of cells derived from the peritoneal
cavity of mice treated with PBS, Bm-MIF-1, or
Bm-MIF-1G, and we assessed the percentage of eosinophil
granulocytes. Fig. 4 shows that the 3-wk
treatment of mice with Bm-MIF-1 led to an average increase
of 
3-fold in the number of peritoneal eosinophils compared with PBS-
or Bm-MIF-1G-treated mice (p =
0.0001). It is noteworthy that although the 1-wk treatment with
Bm-MIF-1 effectively induced Ym1, these mice did not display
any increased eosinophil recruitment (data not shown). Without
understanding more about both MIF and Ym1 function (and their
receptors), it is difficult to directly assess the reasons for this. It
may be that early in the inflammatory process there is insufficient
expression of Ym1 receptors, or a lack of other key players (cells or
soluble mediators) that are essential to the recruitment process.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Ym1 is highly homologous to a family of chitinases (37)
found in bacteria, plants, and mammals. These molecules may have
evolved as a first-line defense against chitin-bearing pathogens such
as fungi, but they may also play a role in anti-helminth immunity,
as chitin-related carbohydrates are present in larval and egg stages
(38). Sequence comparison between Ym1 and active
chitinases suggests that Ym1 may no longer possess chitinase activity
due to the replacement of an acidic residue in the active site
(28, 37). However, even in the absence of chitinase
activity, Ym1 may still have the ability to bind carbohydrate
structures. Such a carbohydrate-binding activity may be the key to
eosinophil chemotaxis, as it has been shown that ecalectin, a lectin
with affinity for -galactosides, is also selectively and potently
chemotactic for eosinophils (39). Because neither
chitinases nor lectins are related to other known ECFs, it will be
interesting to study the molecular mechanism of chemoattraction in
detail.
Ym1 has also been described in three other contexts, each associated with pathological conditions in the lung. Guo et al. (40) found that crystals in the lungs of viable moth-eaten mice (mev/mev) are composed of Ym1 protein. These crystals were found in the cytoplasm of alveolar macrophages and are thought to be similar to the Charcot-Leyden crystals in humans associated with eosinophil-rich inflammation of the lungs. In a model system of vaccination with the helminth parasite, Schistosoma mansoni, protein crystals were found in the pulmonary macrophages of infected mice along with significant numbers of eosinophils (41). By amino-terminal sequencing, these protein crystals were recently identified as Ym1 (R. A. Wilson, unpublished observations). The potential role for Ym1 in the pathology of pulmonary diseases is further highlighted by a recent study of murine pulmonary Cryptococcus neoformans infection that suggests that Ym1-containing protein crystals are responsible for significant cellular damage (42). Interestingly, in both schistosome vaccination and cryptococcal infection, significant eosinophilia can occur in the absence of a dominant type 2 immune response. This is consistent with our finding that Ym1 up-regulation is IL-4 independent.
Taken together, the findings thus far suggest that Ym1 is an abundant molecule associated with eosinophil recruitment, lung pathology, and type 2 cytokine environments. Interestingly, two human homologs of Ym1 with unknown function, chitotriosidase and human cartilage gp39, are expressed in activated macrophages (43). Chitotriosidase is highly induced in patients with Gaucher’s disease (44), whereas both chitotriosidase and human cartilage gp39 are expressed in macrophages from atherosclerotic lesions (45). It is particularly interesting to note that human chitotriosidase may be relevant to lymphatic filariasis. In a recent study in South India (46), filarial-infected individuals were significantly more likely than uninfected individuals to have the HH variant of the CHIT1 gene—a genotype that leads to decreased activity and levels of chitotriosidase, suggesting this molecule may be involved in host protection. In the context of lung pathology, the most closely related Ym1 homolog (68% identity) is a gene, TSA1902, which is expressed specifically in the lung (47). Functions for these human homologs remain unknown and thus our studies may provide insight into the role of these highly expressed human genes.
The relationship of MIF to eosinophil recruitment is highly provocative. Mammalian MIF is strongly associated with type 1 pro-inflammatory conditions (22), whereas the role of nematode MIF in parasite infection remains to be elucidated. Mammalian MIF has not been reported to have eosinophil recruitment activity (directly or indirectly), although interestingly it is produced by human eosinophils (48), raising the possibility of a positive feedback loop. We are currently investigating whether this is a yet undiscovered function for MIF, which we have identified by studying the parasite homolog. Our data strongly suggest that macrophages provide a crucial link between parasitic infections and eosinophil chemotaxis. Because the production of MIF-like enzymatic activity has been demonstrated in a variety of nematode parasites (35), Ym1 induction by parasite-secreted MIF and subsequent eosinophil recruitment to the tissues could be a widely spread mechanism accounting at least partially for the well-known phenomenon of tissue eosinophilia in parasitic infections. Although each of these events has been demonstrated in isolation, we have not yet shown a direct link between BmMIF, YM1 induction, and recruitment of eosinophils. Future studies with neutralizing Abs will be required to find out whether these are the critical cascade of events that occur during infection. Further, to understand the sequence of events more thoroughly, we will need a far clearer picture of both MIF and Ym1 function. What is the receptor for Ym1? What factors, in addition to MIF, induce Ym1 expression? What levels of Ym1 protein are required for eosinophil recruitment? Are Ym1 crystals purely a pathological outcome or are they part of the normal inflammatory processes?
This work raises the possibility that MIF and/or Ym1 are important components in Th2-mediated pathology in general and, as such, could be relevant to chronic inflammatory conditions such as asthma. Finally, as the role of eosinophils in parasite infection remains unresolved, it is intriguing to consider the evolutionary rationale behind the production of MIF by filarial parasites. In secreting this cytokine mimic, the parasite may be directly responsible for high-level eosinophil recruitment, suggesting that eosinophils may, under some circumstances, function to benefit rather than destroy the parasite.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 F.H.F. and P.L. contributed equally to this work.
3 Current address: ACRC Scientific Office, Domagkstrasse 3, D-48149 Muenster, Germany.
4 Current address: Department of Molecular and Cell Biology, Howard Hughes Medical Institute, LSA 415, University of California, Berkeley, CA 94720-3200.
5 Current address: College Of Veterinary Medicine, Cornell University, Ithaca, NY 14850.
6 Address correspondence and reprint requests to Dr. Judith E. Allen, Institute of Cell, Animal and Population Biology, West Mains Road, University of Edinburgh, Edinburgh EH9 3JT, U.K. E-mail address: j.allen{at}ed.ac.uk
7 Abbreviations used in this paper: AAM, alternatively activated macrophages; MIF, macrophage migration inhibitory factor; Bm-MIF-1, Brugia malayi homolog of MIF; MIF-1G, Bm-MIF-1 with N-terminal proline altered to glycine; ECF, eosinophil chemotactic factor; PEC, peritoneal exudate cells; EST, expressed sequence tag.
8 X. Zang, P. Taylor, J. M. Wang, D. J. Meyer, A. L. Scott, M. D. Walkinshaw, and R. M. Maizels. Functional homologues of human macrophage migration inhibitory factor (MIF) from the parasitic nematode Brugia malayi: conservation of activity and crystal structure. Submitted for publication.
Received for publication May 17, 2001. Accepted for publication August 20, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Eur. J. Immunol. 24:1441.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S. Donnelly, C. M. Stack, S. M. O'Neill, A. A. Sayed, D. L. Williams, and J. P. Dalton Helminth 2-Cys peroxiredoxin drives Th2 responses through a mechanism involving alternatively activated macrophages FASEB J, November 1, 2008; 22(11): 4022 - 4032. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. S. King, A. M. Knorn, C. Ohnmacht, and D. Voehringer Accumulation of Effector CD4 T Cells during Type 2 Immune Responses Is Negatively Regulated by Stat6 J. Immunol., January 15, 2008; 180(2): 754 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Loke, I. Gallagher, M. G. Nair, X. Zang, F. Brombacher, M. Mohrs, J. P. Allison, and J. E. Allen Alternative Activation Is an Innate Response to Injury That Requires CD4+ T Cells to be Sustained during Chronic Infection J. Immunol., September 15, 2007; 179(6): 3926 - 3936. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Cho, B. F. Jones, J. J. Vermeire, L. Leng, L. DiFedele, L. M. Harrison, H. Xiong, Y.-K. A. Kwong, Y. Chen, R. Bucala, et al. Structural and Functional Characterization of a Secreted Hookworm Macrophage Migration Inhibitory Factor (MIF) That Interacts with the Human MIF Receptor CD74 J. Biol. Chem., August 10, 2007; 282(32): 23447 - 23456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Voehringer, N. van Rooijen, and R. M. Locksley Eosinophils develop in distinct stages and are recruited to peripheral sites by alternatively activated macrophages J. Leukoc. Biol., June 1, 2007; 81(6): 1434 - 1444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. D. Augustijn, R. Kleemann, J. Thompson, T. Kooistra, C. E. Crawford, S. E. Reece, A. Pain, A. H. G. Siebum, C. J. Janse, and A. P Waters Functional Characterization of the Plasmodium falciparum and P. berghei Homologues of Macrophage Migration Inhibitory Factor Infect. Immun., March 1, 2007; 75(3): 1116 - 1128. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. Nair, K. J. Guild, and D. Artis Novel Effector Molecules in Type 2 Inflammation: Lessons Drawn from Helminth Infection and Allergy J. Immunol., August 1, 2006; 177(3): 1393 - 1399. [Full Text] [PDF]
|
|
|
|
 |
|
 N. M. El-Sayed, P. J. Myler, G. Blandin, M. Berriman, J. Crabtree, G. Aggarwal, E. Caler, H. Renauld, E. A. Worthey, C. Hertz-Fowler, et al. Comparative Genomics of Trypanosomatid Parasitic Protozoa Science, July 15, 2005; 309(5733): 404 - 409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Ivens, C. S. Peacock, E. A. Worthey, L. Murphy, G. Aggarwal, M. Berriman, E. Sisk, M.-A. Rajandream, E. Adlem, R. Aert, et al. The Genome of the Kinetoplastid Parasite, Leishmania major Science, July 15, 2005; 309(5733): 436 - 442. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Loke, X. Zang, L. Hsuan, R. Waitz, R. M. Locksley, J. E. Allen, and J. P. Allison Inducible costimulator is required for type 2 antibody isotype switching but not T helper cell type 2 responses in chronic nematode infection PNAS, July 12, 2005; 102(28): 9872 - 9877. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Donnelly, S. M. O'Neill, M. Sekiya, G. Mulcahy, and J. P. Dalton Thioredoxin Peroxidase Secreted by Fasciola hepatica Induces the Alternative Activation of Macrophages Infect. Immun., January 1, 2005; 73(1): 166 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. Nair, I. J. Gallagher, M. D. Taylor, P. Loke, P. S. Coulson, R. A. Wilson, R. M. Maizels, and J. E. Allen Chitinase and Fizz Family Members Are a Generalized Feature of Nematode Infection with Selective Upregulation of Ym1 and Fizz1 by Antigen-Presenting Cells Infect. Immun., January 1, 2005; 73(1): 385 - 394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Beiting, S. K. Bliss, D. H. Schlafer, V. L. Roberts, and J. A. Appleton Interleukin-10 Limits Local and Body Cavity Inflammation during Infection with Muscle-Stage Trichinella spiralis Infect. Immun., June 1, 2004; 72(6): 3129 - 3137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Spencer, L. Shultz, and T. V. Rajan T Cells Are Required for Host Protection against Brugia malayi but Need Not Produce or Respond to Interleukin-4 Infect. Immun., June 1, 2003; 71(6): 3097 - 3106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rodriguez-Sosa, L. E. Rosas, J. R. David, R. Bojalil, A. R. Satoskar, and L. I. Terrazas Macrophage Migration Inhibitory Factor Plays a Critical Role in Mediating Protection against the Helminth Parasite Taenia crassiceps Infect. Immun., March 1, 2003; 71(3): 1247 - 1254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zang, P. Taylor, J. M. Wang, D. J. Meyer, A. L. Scott, M. D. Walkinshaw, and R. M. Maizels Homologues of Human Macrophage Migration Inhibitory Factor from a Parasitic Nematode. GENE CLONING, PROTEIN ACTIVITY, AND CRYSTAL STRUCTURE J. Biol. Chem., November 8, 2002; 277(46): 44261 - 44267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Noel, G. Hassanzadeh, G. Raes, B. Namangala, I. Daems, L. Brys, F. Brombacher, P. D. Baetselier, and A. Beschin Infection Stage-Dependent Modulation of Macrophage Activation in Trypanosoma congolense-Resistant and |
recruited
by B. malayi1
