| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Section of Rheumatology, Department of Internal Medicine, Yale University School of Medicine, New Haven, CT 06520;
Department of Entomology, Connecticut Agricultural Experiment Station, New Haven, CT 06504;
Wadsworth Center, New York State Department of Health, Albany, NY 12201; and
L2 Diagnostics, New Haven, CT 06530
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
WN virus infection has been studied in several animals, including mice, rats, hamsters, and monkeys, thereby facilitating studies on immunity (15, 16, 17, 18, 19, 20, 21, 22). WN virus causes a systemic murine infection and invades the CNS, resulting in death within 1–2 wk (15, 23). Infection of C3H/He, CD-1, BALB/c, Swiss, and C.B.-17 SCID mice has been documented, and, for the most part, all the animals suffer fatal infection (15, 23, 24). Strains of WN virus that lack neuroinvasiveness have been developed, and infection of CD-1 mice with these attenuated variants is sufficient to afford protection against challenge with WN virus (15, 23). Studies of related viruses may also provide some insight into the Ags that elicit immunity against WN virus. The Ab response to the envelope (E) protein of several flaviviruses, including dengue virus and Japanese encephalitis virus, may either contribute to immunity or potentially exacerbate disease (25, 26, 27, 28, 29, 30, 31). Infection of hamsters or macaques with dengue virus or Japanese encephalitis virus is partially protective against WN virus infection, and some mAbs to the WN virus E protein have neutralizing activity in vitro (16, 19, 23, 32, 33). Moreover, the i.m. injection of DNA encoding the WN virus premembrane and E proteins afforded immunity against WN virus infection (34). Therefore, the WN virus E protein could potentially serve as a candidate Ag for a WN virus vaccine.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RNA was extracted from passage 2 of WN virus isolate 2741 from Culex pipiens cultivated in Vero cells at 37°C (6). Infected Vero cells (106) were scraped from the bottom of a T25 culture flask and centrifuged at 4500 x g for 10 min, and the supernatant was discarded. RNA was extracted from the pellet using RNeasy (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The RNA (3 µg) was resuspended in a final volume of 40 µl RNase-free water. RT-PCR was used to amplify the gene encoding the E protein, using the Superscript one-step RT-PCR system (Life Technologies, Gaithersburg, MD). Sixty nanograms of RNA was used as the template. The 5' primer sequence was TTCAACTGCCTTGGAATGAGC, and the 3' primer sequence was AGCGTGCACGTTCACGGGAGAG. A total of 1503 nucleotides were amplified under the following conditions: 45 min at 50°C for cDNA synthesis and then 30 cycles with 1 min at 94°C for denaturation, annealing at 60°C for 1 min, and extension at 72°C for 1.5 min. The resulting DNA fragment was separated by electrophoresis on a 1% agarose gel, excised, and purified.
The E protein was expressed as recombinant fusion proteins in two Escherichia coli systems. The PCR product was first subcloned into the pBAD/ThioFusion expression vector (Invitrogen, Carlsbad, CA). The cloning reaction products were transformed into E. coli (One-Shot Top 10 competent cells, Invitrogen). Positive transformants were identified by PCR. The recombinant E protein was then expressed with thioredoxin (16 kDa) fused to the amino-terminus and a carboxyl-terminal polyhistidine tag to facilitate purification. Cells were harvested by centrifugation at 4000 x g for 20 min and then lysed by overnight freezing at -20°C and subsequent sonication for 5 min. The cell lysate was then centrifuged at 4°C for 15 min at 4000 x g, and the recombinant fusion protein was purified from the supernatant fraction. ThioBond resin (Invitrogen) was used to purify the recombinant protein according to the manufacturer’s instructions. Fifty micrograms of recombinant fusion protein was purified from each 250-ml culture of bacteria. Thioredoxin control protein was expressed in E. coli from the pBAD vector and was purified from lysed cells in an identical manner. The recombinant E protein-thioredoxin fusion protein and recombinant thioredoxin were used to generate antisera in mice.
To increase the solubility and yield of recombinant protein, a
different expression vector was used, and the hydrophobic distal
carboxyl-terminal region of the E protein was removed from the fusion
protein. The nucleotides encoding the initial 80% of the gene (nt
1–1218) encoding the E protein were amplified by PCR using primers
flanked by EcoRI and PstI restriction enzyme
digestion sites to facilitate subcloning. The primers were
5'-GAATTCTTCAACTGCCTTGGAATGAGC-3' and
5'-CTGCAGTTATTTGCCAATGCTGCTTCC-3'. The DNA fragment was then
digested with EcoRI and PstI and inserted into
the pMAL-c2X vector (pMAL protein fusion and purification system, New
England Biolabs, Beverly, MA), downstream of the E. coli
malE gene that encodes maltose-binding protein (MBP). This
resulted in the expression of a recombinant fusion protein (MBP-E).
Transformed cells (DH5
, Life Technologies) were grown to a
concentration of 2 x 108 cells/ml.
Isopropyl-D-thiogalactopyranoside was added
(final concentration, 0.3 mM), and the culture was incubated at 37°C
for 4 h. Cells were harvested by centrifugation at 4000 x
g for 20 min and then lysed by overnight freezing at 20°C
and subsequent sonication for 10 min. Expression in E. coli
produced a soluble 82-kDa fusion protein (MBP-E) on a Coomassie
blue-stained SDS-PAGE gel, and the MBP-E protein was then purified
using a maltose affinity column according to the manufacturer’s
instructions (New England Biolabs). Three milligrams of protein was
purified from a 250-ml cell culture. Recombinant MBP (control) was
expressed and purified in an identical fashion. The recombinant MBP-E
protein was used in the immunoblot studies to detect Abs in patient
sera and in the active immunization studies.
Immunoblot, IFA, and ELISA
Recombinant MBP-E and MBP (control) proteins were boiled in
SDS-PAGE sample buffer (Bio-Rad, Hercules, CA) containing 2% 
-ME.
The proteins (2 µg/gel) were separated by SDS-PAGE (10% gel) and
transferred to nitrocellulose membranes using a semidry electrotransfer
apparatus (Fisher Scientific, Pittsburgh, PA). The nitrocellulose
membranes were then probed with sera from individuals with confirmed WN
virus infection or sera from normal persons. The patient sera were from
cases of WN virus infection in the New York City area. All patient sera
tested in this West Nile ELISA were collected in the convalescent stage
of infection, from 1 to 8 mo after the onset of illness. Diagnosis of
WN virus infection was based upon clinical history, serologic testing
including a positive IFA, capture IgM ELISA, or a 4-fold increase in WN
virus-specific neutralization activity in the convalescent sera,
performed at the Centers for Disease Control or the New York State
Department of Health. The membranes were incubated with sera (1/100
dilution) at room temperature for 1 h, followed by three washes in
TBST. An alkaline phosphatase-conjugated goat anti-human IgG
(Sigma, St. Louis, MO) at a dilution of 1/1000 was then used to detect
the primary Ab. Blots were developed with nitro blue tetrazolium and
5-bromo-4-chloro-3 indolyl phosphate from Kirkegaard & Perry
(Gaithersburg, MD).
Indirect immunofluorescence (IFA) and ELISA were used to detect Abs specific for WN virus or an E protein peptide. IFA was performed using WN virus-infected Vero cells that had been fixed to glass slides with 2% paraformaldehyde containing 0.1% Triton X-100 in PBS. To first block nonspecific binding, the fixed cells were incubated with PBS containing 2% BSA at room temperature for 1 h. Sera (1/10 to 1/640 dilution) from mice immunized with recombinant Ag or mice infected with WN virus were applied for 1 h at room temperature. The cells were then washed three times with PBS with Tween 20 (PBST). Goat anti-mouse IgG-FITC conjugate was then applied at a dilution of 1/2500 (Kirkegaard & Perry Laboratories) for 1 h at room temperature. After another washing in PBST, the slides were mounted and examined using a confocal microscope (x400 magnification).
To further identify Abs specific for the WN virus E protein, a peptide corresponding to the E protein aa 288–301 (CRVKMEKLQLKGTT) was synthesized. This protein was chosen because an examination of the E protein structure suggests that this region may be surface exposed and therefore accessible to Ab; certainly many other epitopes could have similar properties. As a control, a peptide that contained the same amino acids in a random sequence (CQLLMREVKTGTKK) was also generated. Peptides were prepared on a Rainin Symphony (Woburn, MA) instrument (50 µmol scale), purified by reverse phase HPLC, and analyzed by MALDI mass spectroscopy. The peptide synthesis, purification, and analysis were performed by the Keck Foundation Biotechnology Resource Laboratory at Yale University (New Haven, CT). The peptides were conjugated to the carrier protein using Imject maleimide-activated OVA. Microtiter plates were coated with conjugated peptide overnight at 4°C at 100 ng/well in coating buffer (0.015 M Na2CO3, 0.03 M NaHCO3, and 0.003 M NaN3, pH 9.6). Sera from immunized mice were diluted from 1/50 to 1/10,000 in PBS with 2% BSA, added to the duplicate wells, and incubated for 1 h at room temperature. Plates were washed three times with PBST. Alkaline phosphatase-conjugated goat anti-mouse IgG at a dilution of 1/1,000 in PBST (Sigma) was added for 1 h at room temperature. After washing three times with PBST, color was developed with p-nitrophenyl phosphate for 10 min and read at an adsorbance of 405 nm using a spectrophotometer.
Neutralization assay
Serum samples were heat inactivated by incubation in a 56°C water bath for 30 min and were serially diluted in PBS with 5% gelatin from 1/10 to 1/2560. WN virus was diluted in PBS with 5% gelatin so that the final concentration was 100 PFU/well. We then mixed 75 µl virus with 75 µl serum in a 96-well plate at 37°C for 1 h. Aliquots of serum-virus mixture were inoculated onto confluent monolayers of Vero cells in a six-well tissue culture plate. The cells were incubated at 37°C for 1 h, and the plates were shaken every 15 min. The agarose overlay was then added. The overlay was prepared by mixing equal volumes of a solution consisting of 100 ml 2x MEM (Life Technologies) with sterile 2% agarose. Both solutions were placed in a 40°C water bath for 1 h before adding the overlay. The cells were incubated for 4 days at 37°C in a humidified 5% CO2-air mixture. A second overlay with an additional 4% neutral red was added on day 5. Virus plaques were counted 12 h later.
Infection and immunization
Groups of five C3H/HeN mice were challenged with an i.p. inoculation (100 µl) of between 106 and 10-2 PFU of WN virus isolate 2741. The WN virus isolate was stored at -70°C, and serial 10-fold dilutions of the virus were prepared in PBS with 0.5% glucose, 30% rabbit serum, antibiotics, and antimycotics. Mice were monitored daily for morbidity, including lethargy, loss of appetite, disorientation, and difficulty in moving. The time of death, usually 6–10 days, was recorded. All surviving mice were euthanized at 15 days after inoculation and examined for infection by culture of selected tissues or PCR. Ten percent suspensions of brain tissue sections were prepared in 1.5 ml PBS by triturating with a mortar and pestle. Alundum was added to facilitate homogenization of the tissue. Suspensions were centrifuged at 520 x g for 10 min. Supernatant was then passed through a 0.22-µm filter, and 100 µl was added to a monolayer of Vero cells (107 cells/T25 flask). Cells were grown and examined for cytopathologic effect.
C3H/HeN mice were immunized with 20 µg recombinant E protein (fused
to either thioredoxin or MBP) or control Ag (recombinant thioredoxin or
MBP) in 200 µl CFA in the back, and they were then boosted with 20
µg Ag in 200 µl IFA at 2 and 4 wk. Ten days after the final
immunization, mice were phlebotomized, and the E protein antisera were
stored at -20°C until use. In the passive immunization studies, mice
were intradermally injected with 150 µl antiserum (diluted 1/5
in PBS) pooled from five mice that had been actively immunized with E
protein. A group of mice was also given thioredoxin antisera (control).
The animals were challenged with WN virus (
101
or 106 PFU) 24 h after the Ab transfer. In
the active immunization studies, mice were challenged with WN virus 10
days after the final immunization.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, A and B). Sera from all six individuals with
confirmed WN virus infection had Abs that bound to the recombinant E
protein in immunoblot (Fig. 1C, lanes 13–18), demonstrating
that the E protein was recognized during WN virus infection.
|
). Mice administered as little as
100 PFU also uniformly died within 10 days,
demonstrating the virulence of the 2741 WN virus isolate. Lower doses
of virus were not sufficient to consistently infect the mice, as virus
was not evident in any of the animals that survived at 2 wk. These data
demonstrated that a level of 100 PFU, as
determined in a Vero cell PFU assay, was sufficient to kill the
majority of the animals (approximate LD50).
|
C. At 10 days following the
final boost, the animals were phlebotomized, and the sera were pooled
and examined for Abs specific for the WN virus. Abs in the murine sera
(1/10 to 1/160 dilution) reacted with WN virus-infected Vero cells in
indirect immunofluorescence, indicating that the Abs to the recombinant
E protein recognized the native virus (Fig. 3A). Moreover,
the antisera (1/100 dilution) reacted with a peptide that was specific
for the E protein (Fig. 3B) in ELISA. Abs were readily
detected at a sera dilution of up to 1/1000 (not shown). These data
show that mice developed a strong humoral response to the recombinant E
protein.
|
A). Control mice were
administered antisera to the carrier protein. Four of five control
animals died after 2 wk, while only one of five mice immunized with E
protein antisera died (p < 0.05). All the
living mice were euthanized on day 15; WN virus was not recovered from
any of the animals by culture or PCR. Two additional experiments
yielded similar results. These studies demonstrate the protective
effect of E protein antisera against murine WN virus infection.
|
B). WN virus was not detected
by culture or PCR in any of the surviving animals. Identical results
were obtained in a subsequent study. The protective effect of
vaccination could be overcome by increasing the viral dose, because
five of five vaccinated animals died when 106 PFU
WN virus was used as the challenge inocula. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although WN virus infection in mice has some similarities with human disease, such as neuroinvasion, it remains to be determined whether E protein vaccination will be effective in other experimental model systems and in humans. Furthermore, although WN virus isolates in the U.S. have demonstrated striking genetic similarities, vaccination with recombinant E protein against diverse isolates can be examined (6, 7). The current studies were conducted using i.p. inoculation with WN virus, and the efficacy of protection may be dependent upon both the challenge dose of virus and the route of viral inoculation. Subsequent studies using mosquito-borne transmission will also help assess whether protection against vector-borne disease is effective, thereby accounting for the viral dose during mosquito transmission and the influence of the vector on pathogen transmission. Finally, epidemiological and ecological studies on WN virus in the U.S. over the next few years will determine the overall risk of acquiring WN virus infection and subsequent encephalitis, and whether a vaccine-based approach toward disease prevention is warranted.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Erol Fikrig, 608 Laboratory of Clinical Investigation, Section of Rheumatology, Department of Internal Medicine, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520-8031. E-mail address: erol.fikrig{at}yale.edu
3 Abbreviations used in this paper: WN, West Nile; E, envelope; MBP, maltose-binding protein.
Received for publication May 31, 2001. Accepted for publication August 31, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  L. A. Magnarelli, S. L. Bushmich, J. F. Anderson, M. Ledizet, and R. A. Koski Serum antibodies to West Nile virus in naturally exposed and vaccinated horses J. Med. Microbiol., September 1, 2008; 57(9): 1087 - 1093. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Oliphant, G. E. Nybakken, S. K. Austin, Q. Xu, J. Bramson, M. Loeb, M. Throsby, D. H. Fremont, T. C. Pierson, and M. S. Diamond Induction of Epitope-Specific Neutralizing Antibodies against West Nile Virus J. Virol., November 1, 2007; 81(21): 11828 - 11839. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Schepp-Berglind, M. Luo, D. Wang, J. A. Wicker, N. U. Raja, B. D. Hoel, D. H. Holman, A. D. T. Barrett, and J. Y. Dong Complex Adenovirus-Mediated Expression of West Nile Virus C, PreM, E, and NS1 Proteins Induces both Humoral and Cellular Immune Responses Clin. Vaccine Immunol., September 1, 2007; 14(9): 1117 - 1126. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-S. Choi, Y.-J. Ko, J.-J. Nah, Y.-J. Kim, S.-Y. Kang, K.-J. Yoon, and Y.-S. Joo Monoclonal Antibody-Based Competitive Enzyme-Linked Immunosorbent Assay for Detecting and Quantifying West Nile Virus-Neutralizing Antibodies in Horse Sera Clin. Vaccine Immunol., February 1, 2007; 14(2): 134 - 138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Samuel and M. S. Diamond Pathogenesis of West Nile Virus Infection: a Balance between Virulence, Innate and Adaptive Immunity, and Viral Evasion J. Virol., October 1, 2006; 80(19): 9349 - 9360. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Wang, Y. Gao, E. Scully, C. T. Davis, J. F. Anderson, T. Welte, M. Ledizet, R. Koski, J. A. Madri, A. Barrett, et al. {gamma}{delta} T Cells Facilitate Adaptive Immunity against West Nile Virus Infection in Mice J. Immunol., August 1, 2006; 177(3): 1825 - 1832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Town, D. Jeng, L. Alexopoulou, J. Tan, and R. A. Flavell Microglia Recognize Double-Stranded RNA via TLR3 J. Immunol., March 15, 2006; 176(6): 3804 - 3812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. H. Gould, J. Sui, H. Foellmer, T. Oliphant, T. Wang, M. Ledizet, A. Murakami, K. Noonan, C. Lambeth, K. Kar, et al. Protective and Therapeutic Capacity of Human Single-Chain Fv-Fc Fusion Proteins against West Nile Virus J. Virol., December 1, 2005; 79(23): 14606 - 14613. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Shirato, H. Miyoshi, A. Goto, Y. Ako, T. Ueki, H. Kariwa, and I. Takashima Viral envelope protein glycosylation is a molecular determinant of the neuroinvasiveness of the New York strain of West Nile virus J. Gen. Virol., December 1, 2004; 85(12): 3637 - 3645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tilgner and P.-Y. Shi Structure and Function of the 3' Terminal Six Nucleotides of the West Nile Virus Genome in Viral Replication J. Virol., August 1, 2004; 78(15): 8159 - 8171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Wong, V. L. Demarest, R. H. Boyle, T. Wang, M. Ledizet, K. Kar, L. D. Kramer, E. Fikrig, and R. A. Koski Detection of Human Anti-Flavivirus Antibodies with a West Nile Virus Recombinant Antigen Microsphere Immunoassay J. Clin. Microbiol., January 1, 2004; 42(1): 65 - 72. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang, M. Lobigs, E. Lee, and A. Mullbacher CD8+ T Cells Mediate Recovery and Immunopathology in West Nile Virus Encephalitis J. Virol., December 15, 2003; 77(24): 13323 - 13334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Wang, E. Scully, Z. Yin, J. H. Kim, S. Wang, J. Yan, M. Mamula, J. F. Anderson, J. Craft, and E. Fikrig IFN-{gamma}-Producing {gamma}{delta} T Cells Help Control Murine West Nile Virus Infection J. Immunol., September 1, 2003; 171(5): 2524 - 2531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Diamond, B. Shrestha, A. Marri, D. Mahan, and M. Engle B Cells and Antibody Play Critical Roles in the Immediate Defense of Disseminated Infection by West Nile Encephalitis Virus J. Virol., February 15, 2003; 77(4): 2578 - 2586. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
