| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
*
Medicine and
Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
L/
2 or CD11a/CD18)
(1), a member of the integrin family. LFA-1 is a
well-established adhesion molecule that plays an important role in
extravasation of leukocytes into inflamed tissue (2, 3, 4).
Moreover, LFA-1-mediated adhesion can facilitate Ag presentation to T
cells, especially in situations of low affinity TCR:MHC:peptide
interaction (5, 6), and by enabling adequate duration of
antigenic stimulation (7). In addition to the known role
of LFA-1 in T cell adhesion, LFA-1 can also provide costimulation to T
cells (8, 9, 10). We and others have assessed the role of
LFA-1 in T cell activation by gene transfer of class II and ICAM-1 into
costimulation-negative cell lines (11, 12, 13). It was found
that Ag presentation by transfectants expressing class II and ICAM-1
can induce IL-2 secretion and proliferation in naive T cells, whereas
transfectants expressing only class II cannot. Furthermore, in naive
CD4+ T cells the requirement for LFA-1:ICAM-1
interactions could not be compensated for by increasing the class
II:peptide ligand density 10,000-fold (14). Similar
results have been found in some, but not all,
CD8+ T cell systems (15, 16). These
results argue that coligation of TCR and LFA-1 can have a qualitative
(costimulatory) as well as a quantitative (adhesive) effect on T cell
activation. The mechanisms of the LFA-1:ICAM-1 qualitative effect on T cell activation have yet to be elucidated. There is evidence that integrins can transduce signals in nonlymphoid cells (17). In T lymphocytes, coligation of LFA-1 and CD3 can lead to a sustained intracellular calcium response, increased inositol phospholipid hydrolysis, association with DNAX accessory molecule-1 and increased focal adhesion kinase, proline-rich tryosine kinase 2, c-Jun N-terminal kinase (JNK),3 phosphatidylinositol 3-kinase (PI3K), and extracellular signal-related kinase-2 activity (18, 19, 20, 21, 22, 23, 24, 25). Alternatively, LFA-1 may mediate costimulatory activity through reorganization of the actin cytoskeleton or organization of the immunological synapse (19, 26, 27, 28, 29). In either case, LFA-1 costimulation ultimately leads to enhanced secretion of IL-2. IL-2 is not transcribed in resting T cells, but IL-2 mRNA can be detected as early as 30 min after T cell activation. The engagement of the classic T cell costimulatory molecule, CD28, in particular in the presence of PMA, has been found to result in enhanced transcription of the IL-2 gene in human T cells (30, 31, 32, 33, 34). The t1/2 of IL-2 mRNA is approximately 30 min; however, upon stabilization of the message with engagement of CD28, the t1/2 of IL-2 mRNA increases to 5 h (35, 36, 37), allowing for increased IL-2 secretion and effective T cell expansion. The effect of LFA-1:ICAM-1 interactions in the context of MHC class II:peptide:TCR engagement on IL-2 gene transcription and mRNA stability is not clearly defined.
Work in our laboratory has demonstrated that stimulation of naive DO11.10 CD4+ T cells through the TCR and either CD28 or LFA-1, but not through the TCR alone, results in IL-2 mRNA, as measured by RT-PCR (11). This ultimately results in the secretion of IL-2 and efficient entry of T cells into the cell cycle. However, it was not clear whether the ability of LFA-1 to promote IL-2 gene expression was mediated through enhanced IL-2 transcription, IL-2 mRNA stabilization, or a combination of the two. In this study, we address the role of LFA-1 in IL-2 gene expression by stimulation of CD4+ T cells from DO11.10 TCR-transgenic mice with APC generated from cell lines transfected with costimulatory ligands. This system has the advantage of maintaining fluidity on both sides of the membrane during natural receptor-ligand interactions, and of isolating the contributions of individual accessory molecules to T cell activation. Our results indicate that the primary pathway whereby engagement of LFA-1 through its ligand ICAM-1 up-regulates IL-2 gene expression is through enhanced IL-2 transcription, in the absence of any effect on IL-2 mRNA stabilization.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A panel of transfectants in the fibrosarcoma cell line, 6132-PRO (Pro) expressing I-Ad alone (ProAd), or in combination with ICAM-1 (ProAd-ICAM) or B7-1 (ProAd-B7) has been previously described (11, 14, 38, 39). In some experiments, Pro cells expressing I-Ad covalently linked to OVA323–339 (ProAd/OVA), or in combination with ICAM-1 (ProAd/OVA-ICAM) are used (14). Transgenic mice expressing the murine IL-2 promoter region (positions -590 to +40 bp) upstream of the luciferase gene (40) (kindly provided by J. Hanke, Pfizer, Groton, CT) were crossed to DO11.10 TCR-transgenic mice (41). IL-2 promoter/luciferase transgenic mice were screened by PCR with primers to luciferase (forward primer, ATGGAAGACGCCAAAAACATAAAGAAAGGC; reverse primer, TTCATACTGTTGAGCAATTCACGTTCATTA). The CD4+ T cells were purified from lymph nodes of DO11.10 TCR-transgenic mice or IL-2 promoter/luciferase transgenic x DO11.10 TCR-transgenic mice (denoted by IL-2 luc/DO11.10) by negative selection using a mixture of anti-CD8 mAb (2.43) and anti-class II mAbs (M5/114), followed by lysis with rabbit complement (Accurate Chemical, Westbury, NY) and removal of residual Ab-bound cells by incubation with an equal number of sheep anti-rat Ab-coated Dynabeads (Dynal, Oslo, Norway). The efficacy of the CD4+ T cell purification was monitored by lack of proliferation to 2.5 µg/ml Con A (Sigma-Aldrich, St. Louis, MO) and by flow cytometry. All cell lines were maintained in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS, 2 mM glutamine, 0.1 mM nonessential amino acids, 40 µg/ml gentamicin, and 50 µM 2-ME. G418 (200 µg/ml) and/or MXH (6 µg/ml mycophenolic acid, 250 µg/ml xanthine, and 15 µg/ml hypoxanthine) were added to the culture medium for maintenance of the transfectants. DO11.10 or IL-2 luc/DO11.10 TCR-transgenic activated CD4+ T cells were maintained by weekly passage with irradiated BALB/cJ (The Jackson Laboratory, Bar Harbor, ME) splenocytes, 0.2 µg/ml OVA323–339 peptide, and 10 U/ml human rIL-2 (R&D Systems, Minneapolis, MN) with a maximum of two to three passages in culture, and then used in assays 7–21 days after stimulation.
Flow cytometry
Expression of transfected molecules was determined by flow cytometry using the anti-class II mAb MKD6, the anti-ICAM-1 mAb YN-1.7.1, and the anti-B7-1 mAb 16-10A1. T cells were phenotyped with a biotinylated mAb, KJ1-26 (42), directed against the TCR clonotype expressed by DO11.10 T cells. Abs were obtained from American Type Culture Collection (Manassas, VA), except biotinylated KJ1-26, which was kindly provided by T. Barrett (Northwestern University, Chicago, IL).
T cell proliferation and cytokine secretion
For T cell stimulation of naive CD4+ T cells with Pro cell transfectants, 5 x 104 T cells were incubated with 5 x 104 mitomycin C (Sigma-Aldrich)-treated transfectants and various concentrations of Ag in a 96-well flat-bottom plate. At 48 h, supernatants were assayed for IL-2 secretion by capture ELISA, or [3H]thymidine was added to the cultures during the last 18 h of a 72-h assay. In other experiments, Ficoll-purified activated CD4+ T cells were stimulated either with Pro cell transfectants or with anti-CD3 mAb (145-2C11; 1 µg/ml; kindly provided by J. Bluestone, University of California, San Francisco, CA) in the presence or absence of anti-CD28 mAb (PV1; 5 µg/ml; kindly provided by C. June, University of Pennsylvania, Philadelphia, PA), anti-CD11a mAb (I21/7.7; 5 µg/ml; kindly provided by T. Owens, McGill University, Montreal, Canada), or an isotype control Armenian hamster anti-trinitrophenol (TNP) mAb (A19-3; 5 µg/ml; BD PharMingen, San Diego, CA). Other anti-LFA-1 Abs were screened for efficacy of costimulation: the anti-CD11a mAbs 2D7, M17/4 (BD PharMingen), and M17/5.2 (American Type Culture Collection); and the anti-CD18 mAbs C71/16, M18/2 (BD PharMingen), and 2E6 (American Type Culture Collection). The Abs were immobilized onto 96-well flat-bottom plates by incubation in PBS at 4°C overnight. Plates were rinsed twice with PBS. Ficoll-purified T cells (5 x 104) were plated onto Ab-coated plates or cocultured with an equal number of Pro cell transfectants, and cytokine production from supernatants at 24 h was determined by capture ELISA (BD PharMingen).
T cell transfections
An IL-2 promoter reporter construct was produced and generously provided by L. Zuckerman utilizing the pGL2 basic vector (Promega, Madison, WI). A 378-bp SacI/BspHI fragment of the IL-2 promoter was subcloned into pGL2-basic vector. Activated DO11.10 CD4+ T cells were Ficoll-purified and transfected with the reporter construct by electroporation. The transfected T cells were incubated with 10 U of human rIL-2 (R&D Systems) in DMEM medium for 48 h, and then 2 x 106 T cells were stimulated with an equal number of the Pro cell transfectants in the presence of Ag and analyzed for luciferase activity 16 h later.
Luciferase assay
Naive (10 x 106) or Ficoll-purified activated (2 x 106) IL-2 luc/DO11.10 CD4+ T cells were incubated with an equal number of Pro cell transfectants and various concentrations of Ag in six-well flat-bottom plates for 16 h. In other experiments, T cells were stimulated with anti-CD3 mAb in the presence or absence of anti-CD28 mAb or with PMA (10 ng/ml; Sigma-Aldrich) plus ionomycin (0.5 µM; Sigma-Aldrich). Cell extracts were prepared according to the manufacturer’s instructions (Promega) with lysis in cell lysis buffer. Samples were assayed for luciferase activity using a Monolight luminometer (Analytical Luminescence Laboratory, Ann Arbor, MI) (kindly provided by H. Singh, University of Chicago, Chicago, IL).
RNA preparation and real-time RT-PCR
For total IL-2 RNA measurements, Ficoll-purified activated
DO11.10 CD4+ T cells, 1 x
106 T cells were incubated with 1 x
106 Pro cell transfectants with Ag in a six-well
flat-bottom plate. In other experiments, 1 x
106 T cells were stimulated with plate-bound
anti-CD3 mAb in the presence or absence of anti-CD28 mAb,
anti-CD11a mAb, or an Armenian hamster isotype control,
anti-TNP mAb, as described above. RNA was isolated utilizing TRIzol
(Life Technologies), according to the manufacturer’s instructions.
Residual DNA was eliminated with DNase I treatment (Promega). RNA was
reverse transcribed to cDNA, and the level of IL-2 mRNA was determined
by real-time PCR using the predeveloped TaqMan probe and primers to
IL-2 (Applied Biosystems, Foster City, CA) on the Prism 7700 (Applied
Biosystems). The 18-s endogenous control (Applied Biosystems) was used
to normalize RNA. The 
CT method for
relative quantitation was utilized as per Applied Biosystems, and the
IL-2 mRNA level in absence of Ag was used as the calibrator. In some
cases, RNA stabilization was assessed through addition of 5 µg/ml
actinomycin (Sigma-Aldrich) or 0.5 µg/ml cyclosporine (Calbiochem,
San Diego, CA) to the T cell assays with harvesting of RNA at
designated time points.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To address the role of LFA-1:ICAM-1 interactions in the regulation
of IL-2 gene expression upon T cell activation, we first examined its
role in the regulation of IL-2 transcription. We utilized transgenic
mice expressing the murine IL-2 promoter region (positions -590 to +40
bp) upstream of the luciferase gene (40) crossed to the
DO11.10 TCR-transgenic mouse (denoted as IL-2 luc/DO11.10). To identify
the specific role of costimulation, naive IL-2 luc/DO11.10
CD4+ T cells were stimulated with transfected
cell lines that express class II, I-Ad, alone
(ProAd), or in combination with the ligand for LFA-1, ICAM-1
(ProAd-ICAM), or the ligand for CD28, B7-1 (ProAd-B7) (11, 14, 38, 39). In this study, we refer to naive
CD4+ T cells as freshly isolated
CD4+ T cells with the recognition that there is a
small percentage of previously activated T cells in this population
that will generally contain a rearranged endogenous TCR -chain
(43). Pro cell transfectants induce proliferation and IL-2
secretion in naive CD4+ T cells from the IL-2
luc/DO11.10 mice in an analogous pattern, as we have described with
naive CD4+ T cells from DO11.10 mice (Fig. 1
; see Refs. 11 and
14). However, transcription from the IL-2-luciferase
transgene is detectable only upon stimulation with ProAd-B7 at maximal
doses of Ag (Fig. 2A). Naive
CD4+ IL-2 luc/DO11.10 T cells do secrete IL-2
(Fig. 1B) upon stimulation with ProAd-ICAM, albeit at very
low levels. These results raise the potential caveat that the transgene
might not accurately reflect the transcriptional activity of the
endogenous IL-2 gene.
|
|
, A and B). Importantly, the
pattern of expression of endogenous IL-2 mRNA in naive and activated
CD4+ IL-2 luc/DO11.10 T cells (Fig. 2B) stimulated under different costimulatory conditions
correlates well with the pattern seen in IL-2-luciferase
expression in the IL-2 luc/DO11.10 mice (Fig. 2A). As
further confirmation that expression of the transgenic reporter
construct is not modulated by flanking sequences at the integration
site, we found that transient transfection of an independent IL-2
reporter construct into activated DO11.10 CD4+ T
cells generated a similar pattern of luciferase expression (Fig. 2C). Therefore, the luciferase activity in IL-2 luc/DO11.10
mice is a good indicator of IL-2 transcriptional activity, and the
transgenic mice are useful for studying the effect of CD28 and LFA-1 on
IL-2 transcription.
The enhanced strength of signal and costimulation
independence observed in the activated compared with the naive IL-2
luc/DO11.10 CD4+ T cells (Fig. 2, A
and B) could be secondary to improved adhesion of the
activated T cells to APC, or to an inherent increased ability of the
activated T cells to transduce signals that lead to IL-2 production. We
therefore compared transcriptional activity in naive vs activated
CD4+ T cells utilizing methods independent of the
adhesion characteristics of the T cells. Enhanced transcription of the
IL-2-luciferase transgene in naive vs activated T cells was observed
when the T cells were stimulated with plate-bound
anti-CD3/anti-CD28, bypassing cell surface adhesion (Fig. 3A). Of note, however, is that
the level of costimulation detected through anti-CD28 is not as
great as through natural ligand interactions (Fig. 2A).
These results indicate that the difference in response between naive T
cells and activated T cells cannot be attributed to a diminished
ability of naive T cells to form cell:cell conjugates. Furthermore,
this difference was also seen when the T cells were stimulated with
PMA/ionomycin, bypassing proximal signaling events (Fig. 3B). Therefore, the increased response in activated T cells
appears to be due, at least in part, to an increased sensitivity of
downstream signaling events or changes in transcriptional
regulation.
|
The decreased costimulation dependence for IL-2 secretion and
luciferase activity in the activated T cells provides an advantage in
our ability to analyze IL-2 transcription in this system. Stimulation
of the activated T cells with ProAd alone can be used as the baseline
from which to assess additional CD28- or LFA-1-mediated effects on IL-2
expression above and beyond that observed through TCR stimulation
alone. To evaluate the effect of LFA-1:ICAM-1 interactions on IL-2
production in activated CD4+ T cells, IL-2
secretion, IL-2 mRNA production, and IL-2-luciferase expression were
measured in an Ag dose response. Ag presentation by ProAd does induce
expression from the IL-2-luciferase reporter construct, and this level
of expression is enhanced by costimulation through LFA-1 across the
dose response (Fig. 4A). To
verify that the LFA-1-mediated enhanced IL-2-luciferase transcription
did not simply reflect a shift in the dose response, we utilized Pro
cell transfectants that express I-Ad covalently
linked to the OVA323–339 peptide in the absence
(ProAd/OVA) or presence of ICAM-1 (ProAd/OVA-ICAM) (14).
These cells present 100-fold more functional class II:peptide complexes
than can be presented when ProAd is loaded with maximal concentrations
of exogenous OVA peptide (14). ProAd/OVA-ICAM-stimulated
CD4+ IL-2 luc/DO11.10 T cells increase the
maximum response of IL-2 reporter luciferase activity in comparison to
that with ProAd/OVA stimulation (Fig. 4B). Thus, LFA-1
costimulation can enhance IL-2 transcription even at supraoptimal
peptide doses. Similar effects of LFA-1 costimulation were seen when
expression from the endogenous IL-2 gene was monitored (Fig. 4, C and D). As the relative level of IL-2
transcriptional activity correlated well with the level of IL-2 mRNA
and IL-2 secretion, the ability of LFA-1 to promote IL-2 transcription
may account for the ability of LFA-1 to costimulate T cell
proliferation.
|
A). In general, CD28 was 2- to 3-fold more
effective than LFA-1 at enhancing IL-2-luciferase transcription, and
10- to 20-fold more effective at inducing IL-2 secretion. However, in
some experiments, LFA-1 and CD28 costimulation induced equivalent
levels of IL-2 transcription, but CD28 still induced a substantial
increase in IL-2 secretion over that observed with LFA-1. Thus,
CD28-mediated enhanced IL-2 transcription alone cannot account for the
ability of CD28 to promote IL-2 production. This is most evident in
Fig. 4 at high doses of Ag in ProAd-B7-costimulated T cells, where IL-2
transcription plateaus, while IL-2 mRNA and IL-2 secretion continue to
increase. The data support the important role of CD28 costimulation in
regulating IL-2 production through enhanced mRNA stability (see
below). CD28, but not LFA-1, costimulation induces IL-2 mRNA stability
The enhanced IL-2 transcription upon LFA-1 costimulation clearly
contributes to increased IL-2 mRNA; however, IL-2 gene expression is
also regulated posttranscriptionally. As the predominant
posttranscriptional regulation of IL-2 expression is through
stabilization of IL-2 mRNA, we assessed the effect of LFA-1 stimulation
on the t1/2 of IL-2 mRNA. Activated
DO11.10 CD4+ T cells were incubated with the Pro
cell transfectants in the presence or absence of Ag for 4 h.
Actinomycin or cyclosporine was then added to block IL-2 transcription,
and levels of IL-2 mRNA were determined at various time points.
Actinomycin is traditionally used to inhibit transcription for purposes
of studying mRNA stability; however, IL-2 mRNA has been found to be
stabilized upon incubation with actinomycin (44).
Initially, we performed the IL-2 mRNA stabilization experiments with
actinomycin, but we also found artificial stabilization of IL-2 mRNA
(data not shown). Therefore, the majority of experiments were conducted
utilizing cyclosporine. Cyclosporine blocks IL-2 transcription by
inhibiting calcineurin-dependent nuclear localization of NF-AT
(45), and therefore has been used to specifically study
IL-2 mRNA stabilization (46). In activated DO11.10
CD4+ T cells, stimulation with ProAd-ICAM did not
result in stabilization of IL-2 mRNA compared with TCR stimulation
alone. On occasion, ProAd-ICAM-stimulated T cells demonstrated a more
rapid decline in IL-2 mRNA t1/2 in
comparison with ProAd-stimulated T cells (Fig. 5A). Under these same
conditions, stimulation with ProAd-B7 did increase the
t1/2 of IL-2 mRNA to 4–6 h (Fig. 5, A and B), corroborating the known ability of CD28
to mediate IL-2 mRNA stabilization (35, 37, 46, 47). These
results indicate that LFA-1 costimulation does not mediate
stabilization of IL-2 mRNA in DO11.10 CD4+ T
cells.
|
B) does
not allow for detection of LFA-1-mediated IL-2 mRNA stabilization
relative to TCR stimulation in this population. Therefore, we
evaluated IL-2 mRNA expression in T cells stimulated under conditions
that inhibit Th cell differentiation (50). IL-2 mRNA is
detected upon stimulation through the TCR alone in these Th precursor
(Thp) cells, but IL-2 mRNA stabilization upon additional LFA-1
stimulation was not detected (data not shown). The mRNA of a number of
other cytokines, such as IFN-
, also contain AU-rich elements and are
regulated through mRNA stabilization. ProAd-ICAM-stimulated DO11.10
CD4+ T cells did not demonstrate stabilization of
IFN- mRNA, while stabilization of IFN- mRNA did occur upon
stimulation of the T cells with ProAd-B7 (data not shown). Finally, we
tested whether the differences in our results from recently published
results (48, 49) in the ability of LFA-1 to mediate mRNA
stabilization may be secondary to differences in stimulation technique
(natural ligand interactions vs Ab stimulation). A number of human
anti-LFA-1 Abs have agonist activity, which has not been found to
be the case with the murine anti-LFA-1 Abs. Therefore, we tested
various anti-LFA-1 Abs for costimulatory activity. Only one of
those examined, I21/7.7, enhanced IL-2 secretion upon coincubation with
anti-CD3 mAb. Activated DO11.10 CD4+ T cells
were stimulated with anti-CD3 mAb in combination with either
anti-CD28 mAb or anti-CD11a mAb, and IL-2 mRNA stabilization
was evaluated. Both anti-CD28 mAb and anti-CD11a mAb
stimulation of activated CD4+ T cells resulted in
enhanced IL-2 mRNA levels (Fig. 6A) and IL-2 secretion (data
not shown) over that of anti-CD3 mAb stimulation alone. However,
while anti-CD28 mAb stimulation stabilized IL-2 mRNA,
anti-CD11a mAb stimulation did not (Fig. 6B). Of note is
that the costimulation provided by Ab cross-linking through either CD28
or LFA-1, as measured by IL-2 mRNA levels, is not enhanced to the same
degree as that observed upon natural ligand interactions. Therefore, in
the context of a murine system utilizing natural ligands and cell-cell
interactions, LFA-1:ICAM-1 interactions allow for enhanced IL-2 mRNA
expression and subsequent enhanced IL-2 secretion through up-regulation
of IL-2 transcription in the absence of IL-2 mRNA stabilization.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The increased sensitivity to Ag dose, decreased costimulation dependence, and enhanced magnitude of effector responses by activated CD4+ T cells compared with naive T cells has been well described (7, 54, 55, 56, 57). Despite the decreased costimulation dependence in activated IL-2 luc/DO11.10 CD4+ T cells, LFA-1:ICAM-1 interactions consistently enhance IL-2 transcription compared with the engagement of the TCR alone. Therefore, as observed in naive CD4+ T cells (11, 13, 14), LFA-1 does effectively costimulate activated T cells. The mechanism of these altered characteristics of effector T cells, in comparison with those of naive T cells, is not yet understood. Considerations have included the preferential selection of T cells utilizing a higher affinity TCR, an increased precursor frequency of signaling molecules, or a more efficient arrangement of these molecules, as has been described in the case of the targeting of Lck to the CD8 coreceptor in the case of CD8+ T cells (57). Our data demonstrate that the differential magnitude of response in naive vs activated T cells was maintained upon PMA/ionomycin stimulation, suggesting that downstream signals and/or transcriptional regulation play a significant role in this differential response.
The lack of detectable luciferase activity upon stimulation of naive CD4+ T cells from IL-2 luc/DO11.10 mice with ProAd-ICAM was initially surprising because endogenous IL-2 mRNA is readily detectable by RT-PCR (11) and real-time RT-PCR (data not shown) in the same T cells. Although the IL-2-luciferase transgene contains the dominant proximal enhancer sequence, it lacks the locus control region that provides for integration site-independent expression (58). Therefore, expression of this transgene relies on integration into a site that is accessible in T cells. However, low levels of IL-2-luciferase transcription in the naive CD4+ T cells appear to be a threshold-related phenomenon, not an artifact of flanking regions at the integration site of the transgene. The increased levels of transcription detected in activated CD4+ T cells from IL-2 luc/DO11.10 mice are consistently observed under different costimulation conditions, with anti-CD3/anti-CD28, and with PMA/ionomycin. Furthermore, the level of IL-2-luciferase expression demonstrates analogous regulation to that of endogenous IL-2. Therefore, the IL-2 luc/DO11.10 mice serve as a useful system to better define the kinetics and dose-response characteristics of IL-2 gene expression through LFA-1 stimulation.
The interaction of LFA-1 with ICAM-1 in DO11.10
CD4+ T cells mediates the up-regulation of IL-2
mRNA relative to TCR stimulation alone by transcriptional regulation in
the absence of IL-2 mRNA stabilization. We have considered two possible
mechanisms that might account for the ability of LFA-1 to regulate IL-2
gene transcription. First, LFA-1 itself might initiate a signaling
pathway that, along with signals generated from the interaction of the
TCR with its ligand, provides for T cell activation. There is much
evidence that integrins can transduce important biological signals, and
this role has been well documented in nonlymphoid cells (for reviews,
see Refs. 17, 59 , and 60). A number of these
signals, such as Vav (61), JNK (37, 62), and
JAB1 (63), can functionally cooperate to enable IL-2 gene
expression. However, in T cells, LFA-1 engagement has not been clearly
associated with a distinct intracellular signaling pathway. There is
evidence that coligation of LFA-1 and TCR can lead to a sustained
intracellular calcium response, increased inositol phopholipid
hydrolysis, and association with DNAX accessory molecule-1;
increased focal adhesion kinase, proline-rich tryosine kinase 2, JNK,
PI3K, and extracellular signal-related kinase-2 activity
(18, 19, 20, 21, 22, 23, 24, 25); and recruitment of protein kinase C-
to the
immunological synapse.4 Differential signals transduced
through LFA-1 and CD28 most likely contribute to the difference in IL-2
transcription levels, as well as the differential ability to stabilize
IL-2 mRNA. These differences have not been defined, although PI3K
activity demonstrates a differential response in
CD8+ T cells to the two modes of costimulation
(21). Whether the enhanced responses upon LFA-1 engagement
result from increased signals mediated through the TCR complex or
independent signals transduced through LFA-1 and, if so, how these
LFA-1-mediated signals are integrated with TCR signaling pathways have
not been clearly established.
Second, LFA-1 may function in the structural organization of the adhesion complex between T cells and APC, termed the immunological synapse or supramolecular activation cluster. LFA-1 segregates into the outer perimeter of the adhesion complex, while TCR and engaged MHC:peptide complexes, as well as other molecules, segregate into a small central subdomain of the cell:cell contact region (27, 28). In fact, class II:peptide and LFA-1:ICAM-1 interactions in a lipid bilayer system are sufficient to allow for the formation of the immunological synapse (28). The focal concentration of TCR within the adhesion complex might facilitate serial engagement of the TCR on a limited number of MHC:peptide complexes (64) and/or might allow for more efficient lateral interactions that ultimately lead to ligand-induced multimerization of the TCR (65). The level of TCR oligomerization could alter the magnitude and quality of TCR signaling (66, 67, 68). Given the association of LFA-1 with the cytoskeleton (69, 70, 71, 72, 73, 74) and its enhanced recruitment into lipid rafts (75), LFA-1 may be contributing to the assembly and organization of these various Ag receptors, coreceptors, and adhesion and signaling molecules within immunological synapse (26),4 which ultimately contributes to T cell activation. These functions of LFA-1 may play a role in the recruitment of the TCR and associated signal-transducing molecules to lipid rafts upon T cell activation (76, 77, 78, 79, 80), which, in turn, influence subsequent signaling events, such as a sustained calcium signal (19). Finally, the ability of LFA-1 to reorganize the actin cytoskeleton in the context of TCR engagement has been reported to be a form of anchorage dependence, enabling G1 to S phase transition with subsequent IL-2 secretion (24).
We have also found that CD28 costimulation can enhance IL-2-luciferase
transcription. In previous studies, the ability of CD28 to enhance IL-2
transcription has been somewhat controversial. This pathway has been
best established in human T cells, where CD28 costimulation targets a
response element (CD28RE) within the proximal IL-2 enhancer that binds
AP-1 and NF-
B (30, 31, 32, 81, 82). The ability of CD28 to
enhance JNK activity and induce AP-1 and NF-B activation is
consistent with its role in up-regulation of IL-2 transcription through
the CD28RE (83, 84, 85, 86, 87). However, in most studies,
transcriptional activity from this site is only detectable when CD28
costimulation is supplemented with PMA. Furthermore, most of the data
have been generated in Jurkat T cell tumor lines. In one study of
normal human T cells, CD28 costimulation did increase expression of a
transfected IL-2-luciferase reporter construct, but mutation of the
CD28RE had little effect on transcriptional activity (33).
In murine Th1 clones, stable transfection of an IL-2 reporter construct
has not supported a role for CD28 costimulation in IL-2 transcription
(36, 88). Finally, recent results from transgenic mice
expressing green fluorescent protein inserted into the IL-2
locus have shown that anti-CD28 can costimulate
anti-CD3-mediated induction of green fluorescent protein expression
in freshly isolated T cells (89). Our results using the
IL-2-luciferase construct and following endogenous IL-2 mRNA expression
clearly demonstrate that CD28:B7-1 interactions enhance IL-2
transcription during Ag stimulation of primary murine T cells.
In addition to transcriptional regulation, IL-2 expression is also controlled by posttranscriptional mechanisms, most notably mRNA stabilization. We have found that costimulation through LFA-1 does not stabilize IL-2 mRNA in DO11.10-activated CD4+ T cells. In contrast, two recent reports have indicated that LFA-1 costimulation of human T cells can mediate stabilization of several mRNA molecules, including IL-2 (48, 49). Most of our understanding of the mechanism of IL-2 mRNA stability comes from studies of CD28 costimulation (35, 37, 47, 62). The rapid degradation of unstable mRNA molecules is mediated by AU-rich regions in the 3' untranslated region (UTR). CD28-mediated stabilization of IL-2 mRNA is dependent on sequences in the 5' UTR and the coding region as well as the 3' UTR (36, 37). Within the IL-2 3' UTR there are several clusters of AU-rich elements, and JNK-mediated stabilization requires the first cluster of four AUUUA pentameric regions (37). In contrast, in the case of urokinase plasminogen-activating receptor mRNA, LFA-1 activation is able to modulate the effects of a destabilizing nonameric AU-rich sequence in the 3' UTR (48). Finally, two RNA-binding proteins, nucleolin and YB-1, bind to the 5' UTR in human IL-2 to mediate JNK-induced stabilization (62). However, it is not clear whether IL-2 mRNA stability is regulated the same in murine and human T cells. Although CD28-mediated IL-2 mRNA stability is thought to be transmitted through JNK in human Jurkat T cells (37), JNK is not required for CD28-mediated costimulation of T cell activation and IL-2 production in mice (90). Although we cannot exclude technical differences, such as the nature of the stimulatory Abs or the responding T cells used, these results raise the possibility that differences in the signaling pathways and RNA-binding proteins, as well as structural difference in the IL-2 gene, may contribute to the differences in regulation of human vs murine IL-2 mRNA.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jim Miller, Molecular Genetics and Cell Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637. E-mail address: jmiller{at}midway.uchicago.edu
3 Abbreviations used in this paper: JNK, c-Jun N-terminal kinase; CD28RE, CD28 response element; PI3K, phosphatidylinositol 3-kinase; TNP, trinitrophenol; UTR, untranslated region.
4 C. E. Sedwick, K. Blaine, and J. Miller. Focusing of PKC in the c-SMAC and activation of NF-B is mediated by CD28 costimulation. Submitted for publication.
Received for publication June 8, 2001. Accepted for publication September 5, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
L/2 leukocyte integrin (LFA-1) by cyclic AMP-dependent protein kinase. J. Immunol. 156:2273.[Abstract]
2-integrin, LFA-1, and TCR/CD3 synergistically induce tyrosine phophorylation of focal adhesion kinase (pp125(FAK)) in PHA-activated T cells. Cell. Immunol. 193:179.[Medline]
2-subunit (CD18) and the actin-binding protein -actinin. J. Immunol. 151:3795.[Abstract]
2-integrin subunit CD18. J. Immunol. 154:3461.[Abstract]
L2 (LFA-1, CD11a/CD18) cytoplasmic domain/cytoskeleton interaction. J. Exp. Med. 181:315.L2 are involved in endoplasmic reticulum retention, dimerization, and cytoskeletal association. J. Immunol. 155:1252.[Abstract]
B/Rel transcription factors. Mol. Cell. Biol. 17:2605.[Abstract]
2- to 5-fold in IL-2
secretion, 
