The Journal of Immunology, 2001, 167: 5193-5201.
Copyright © 2001 by The American Association of Immunologists
Molecular Mechanisms of IL-2 Gene Regulation Following Costimulation Through LFA-11
Clara Abraham* and
Jim Miller2,
Departments of
*
Medicine and
Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637
 |
Abstract
|
|---|
The integrin LFA-1 serves as an accessory molecule in T cell
activation. In addition to its well-known role as an adhesion molecule,
LFA-1 can contribute to T cell activation and up-regulation of IL-2
gene expression. However, the specific mechanisms by which LFA-1
influences T cell activation have not been elucidated. Therefore, we
examined the impact of LFA-1:ICAM-1 interactions on transcriptional and
posttranscriptional IL-2 gene regulation, using a
costimulation-negative cell line transfected with MHC class II alone,
or in combination with ICAM-1 or B7-1. IL-2 transcription was assessed
utilizing transgenic mice expressing an IL-2 promoter luciferase
reporter construct crossed to DO11.10 TCR-transgenic mice, and IL-2
mRNA stability was evaluated by real-time RT-PCR. Comparison of naive
and previously activated T cells demonstrates a dramatic increase in
IL-2-luciferase transcription in activated T cells that can, in part,
be attributed to downstream signaling events. Costimulation through
LFA-1 enhances transcription of the transgenic reporter construct
across a wide Ag dose range, but does not affect IL-2 mRNA stability.
In contrast, CD28 costimulation is clearly mediated through
up-regulation of IL-2 transcription and through enhancement of mRNA
stability. These results indicate that the primary pathway whereby
engagement of LFA-1 through its ligand ICAM-1 up-regulates IL-2 gene
expression is through enhanced IL-2 transcription, in the absence of
any effect on IL-2 mRNA stabilization.
 |
Introduction
|
|---|
Accessory
molecules play a role in the process of Ag recognition through two
important functions: 1) enhancing adhesion of the T cell to the APC,
allowing for more efficient TCR engagement, and 2) providing
costimulation of T cells by transducing intracellular signals distinct
from those mediated through the TCR. A number of accessory molecules
have been identified that can function in adhesion and/or
costimulation. One such accessory molecule is LFA-1
(
L/
2 or CD11a/CD18)
(1), a member of the integrin family. LFA-1 is a
well-established adhesion molecule that plays an important role in
extravasation of leukocytes into inflamed tissue (2, 3, 4).
Moreover, LFA-1-mediated adhesion can facilitate Ag presentation to T
cells, especially in situations of low affinity TCR:MHC:peptide
interaction (5, 6), and by enabling adequate duration of
antigenic stimulation (7). In addition to the known role
of LFA-1 in T cell adhesion, LFA-1 can also provide costimulation to T
cells (8, 9, 10). We and others have assessed the role of
LFA-1 in T cell activation by gene transfer of class II and ICAM-1 into
costimulation-negative cell lines (11, 12, 13). It was found
that Ag presentation by transfectants expressing class II and ICAM-1
can induce IL-2 secretion and proliferation in naive T cells, whereas
transfectants expressing only class II cannot. Furthermore, in naive
CD4+ T cells the requirement for LFA-1:ICAM-1
interactions could not be compensated for by increasing the class
II:peptide ligand density 10,000-fold (14). Similar
results have been found in some, but not all,
CD8+ T cell systems (15, 16). These
results argue that coligation of TCR and LFA-1 can have a qualitative
(costimulatory) as well as a quantitative (adhesive) effect on T cell
activation.
The mechanisms of the LFA-1:ICAM-1 qualitative effect on T cell
activation have yet to be elucidated. There is evidence that integrins
can transduce signals in nonlymphoid cells (17). In T
lymphocytes, coligation of LFA-1 and CD3 can lead to a sustained
intracellular calcium response, increased inositol phospholipid
hydrolysis, association with DNAX accessory molecule-1 and
increased focal adhesion kinase, proline-rich tryosine kinase 2, c-Jun
N-terminal kinase
(JNK),3
phosphatidylinositol 3-kinase (PI3K), and extracellular signal-related
kinase-2 activity (18, 19, 20, 21, 22, 23, 24, 25). Alternatively, LFA-1 may
mediate costimulatory activity through reorganization of the actin
cytoskeleton or organization of the immunological synapse (19, 26, 27, 28, 29). In either case, LFA-1 costimulation ultimately leads to
enhanced secretion of IL-2. IL-2 is not transcribed in resting T cells,
but IL-2 mRNA can be detected as early as 30 min after T cell
activation. The engagement of the classic T cell costimulatory
molecule, CD28, in particular in the presence of PMA, has been found to
result in enhanced transcription of the IL-2 gene in human T cells
(30, 31, 32, 33, 34). The t1/2 of
IL-2 mRNA is approximately 30 min; however, upon stabilization of the
message with engagement of CD28, the
t1/2 of IL-2 mRNA increases to 5
h (35, 36, 37), allowing for increased IL-2 secretion and
effective T cell expansion. The effect of LFA-1:ICAM-1 interactions in
the context of MHC class II:peptide:TCR engagement on IL-2 gene
transcription and mRNA stability is not clearly defined.
Work in our laboratory has demonstrated that stimulation of naive
DO11.10 CD4+ T cells through the TCR and either
CD28 or LFA-1, but not through the TCR alone, results in IL-2 mRNA, as
measured by RT-PCR (11). This ultimately results in the
secretion of IL-2 and efficient entry of T cells into the cell cycle.
However, it was not clear whether the ability of LFA-1 to promote IL-2
gene expression was mediated through enhanced IL-2 transcription, IL-2
mRNA stabilization, or a combination of the two. In this study, we
address the role of LFA-1 in IL-2 gene expression by stimulation of
CD4+ T cells from DO11.10 TCR-transgenic mice
with APC generated from cell lines transfected with costimulatory
ligands. This system has the advantage of maintaining fluidity on both
sides of the membrane during natural receptor-ligand interactions, and
of isolating the contributions of individual accessory molecules to T
cell activation. Our results indicate that the primary pathway whereby
engagement of LFA-1 through its ligand ICAM-1 up-regulates IL-2 gene
expression is through enhanced IL-2 transcription, in the absence of
any effect on IL-2 mRNA stabilization.
 |
Materials and Methods
|
|---|
Cells
A panel of transfectants in the fibrosarcoma cell line, 6132-PRO
(Pro) expressing I-Ad alone (ProAd), or in
combination with ICAM-1 (ProAd-ICAM) or B7-1 (ProAd-B7) has been
previously described (11, 14, 38, 39). In some
experiments, Pro cells expressing I-Ad covalently
linked to OVA323339 (ProAd/OVA), or in
combination with ICAM-1 (ProAd/OVA-ICAM) are used (14).
Transgenic mice expressing the murine IL-2 promoter region (positions
-590 to +40 bp) upstream of the luciferase gene (40)
(kindly provided by J. Hanke, Pfizer, Groton, CT) were crossed to
DO11.10 TCR-transgenic mice (41). IL-2 promoter/luciferase
transgenic mice were screened by PCR with primers to luciferase
(forward primer, ATGGAAGACGCCAAAAACATAAAGAAAGGC; reverse primer,
TTCATACTGTTGAGCAATTCACGTTCATTA). The CD4+ T cells
were purified from lymph nodes of DO11.10 TCR-transgenic mice or IL-2
promoter/luciferase transgenic x DO11.10 TCR-transgenic mice
(denoted by IL-2 luc/DO11.10) by negative selection using a mixture of
anti-CD8 mAb (2.43) and anti-class II mAbs (M5/114), followed
by lysis with rabbit complement (Accurate Chemical, Westbury, NY) and
removal of residual Ab-bound cells by incubation with an equal number
of sheep anti-rat Ab-coated Dynabeads (Dynal, Oslo, Norway). The
efficacy of the CD4+ T cell purification was
monitored by lack of proliferation to 2.5 µg/ml Con A (Sigma-Aldrich,
St. Louis, MO) and by flow cytometry. All cell lines were maintained in
DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS,
2 mM glutamine, 0.1 mM nonessential amino acids, 40 µg/ml gentamicin,
and 50 µM 2-ME. G418 (200 µg/ml) and/or MXH (6 µg/ml mycophenolic
acid, 250 µg/ml xanthine, and 15 µg/ml hypoxanthine) were added to
the culture medium for maintenance of the transfectants. DO11.10 or
IL-2 luc/DO11.10 TCR-transgenic activated CD4+ T
cells were maintained by weekly passage with irradiated BALB/cJ (The
Jackson Laboratory, Bar Harbor, ME) splenocytes, 0.2 µg/ml
OVA323339 peptide, and 10 U/ml human rIL-2 (R&D
Systems, Minneapolis, MN) with a maximum of two to three passages in
culture, and then used in assays 721 days after stimulation.
Flow cytometry
Expression of transfected molecules was determined by flow
cytometry using the anti-class II mAb MKD6, the anti-ICAM-1 mAb
YN-1.7.1, and the anti-B7-1 mAb 16-10A1. T cells were phenotyped
with a biotinylated mAb, KJ1-26 (42), directed against the
TCR clonotype expressed by DO11.10 T cells. Abs were obtained from
American Type Culture Collection (Manassas, VA), except biotinylated
KJ1-26, which was kindly provided by T. Barrett (Northwestern
University, Chicago, IL).
T cell proliferation and cytokine secretion
For T cell stimulation of naive CD4+ T
cells with Pro cell transfectants, 5 x 104
T cells were incubated with 5 x 104
mitomycin C (Sigma-Aldrich)-treated transfectants and various
concentrations of Ag in a 96-well flat-bottom plate. At 48 h,
supernatants were assayed for IL-2 secretion by capture ELISA, or
[3H]thymidine was added to the cultures during
the last 18 h of a 72-h assay. In other experiments,
Ficoll-purified activated CD4+ T cells were
stimulated either with Pro cell transfectants or with anti-CD3 mAb
(145-2C11; 1 µg/ml; kindly provided by J. Bluestone, University of
California, San Francisco, CA) in the presence or absence of
anti-CD28 mAb (PV1; 5 µg/ml; kindly provided by C. June,
University of Pennsylvania, Philadelphia, PA), anti-CD11a mAb
(I21/7.7; 5 µg/ml; kindly provided by T. Owens, McGill University,
Montreal, Canada), or an isotype control Armenian hamster
anti-trinitrophenol (TNP) mAb (A19-3; 5 µg/ml; BD PharMingen,
San Diego, CA). Other anti-LFA-1 Abs were screened for efficacy of
costimulation: the anti-CD11a mAbs 2D7, M17/4 (BD PharMingen), and
M17/5.2 (American Type Culture Collection); and the anti-CD18 mAbs
C71/16, M18/2 (BD PharMingen), and 2E6 (American Type Culture
Collection). The Abs were immobilized onto 96-well flat-bottom plates
by incubation in PBS at 4°C overnight. Plates were rinsed twice with
PBS. Ficoll-purified T cells (5 x 104) were
plated onto Ab-coated plates or cocultured with an equal number of Pro
cell transfectants, and cytokine production from supernatants at
24 h was determined by capture ELISA (BD PharMingen).
T cell transfections
An IL-2 promoter reporter construct was produced and generously
provided by L. Zuckerman utilizing the pGL2 basic vector (Promega,
Madison, WI). A 378-bp SacI/BspHI fragment of the
IL-2 promoter was subcloned into pGL2-basic vector. Activated DO11.10
CD4+ T cells were Ficoll-purified and transfected
with the reporter construct by electroporation. The transfected T cells
were incubated with 10 U of human rIL-2 (R&D Systems) in DMEM medium
for 48 h, and then 2 x 106 T cells
were stimulated with an equal number of the Pro cell transfectants in
the presence of Ag and analyzed for luciferase activity 16 h
later.
Luciferase assay
Naive (10 x 106) or Ficoll-purified
activated (2 x 106) IL-2 luc/DO11.10
CD4+ T cells were incubated with an equal number
of Pro cell transfectants and various concentrations of Ag in six-well
flat-bottom plates for 16 h. In other experiments, T cells were
stimulated with anti-CD3 mAb in the presence or absence of
anti-CD28 mAb or with PMA (10 ng/ml; Sigma-Aldrich) plus ionomycin
(0.5 µM; Sigma-Aldrich). Cell extracts were prepared according to the
manufacturers instructions (Promega) with lysis in cell lysis buffer.
Samples were assayed for luciferase activity using a Monolight
luminometer (Analytical Luminescence Laboratory, Ann Arbor, MI)
(kindly provided by H. Singh, University of Chicago, Chicago,
IL).
RNA preparation and real-time RT-PCR
For total IL-2 RNA measurements, Ficoll-purified activated
DO11.10 CD4+ T cells, 1 x
106 T cells were incubated with 1 x
106 Pro cell transfectants with Ag in a six-well
flat-bottom plate. In other experiments, 1 x
106 T cells were stimulated with plate-bound
anti-CD3 mAb in the presence or absence of anti-CD28 mAb,
anti-CD11a mAb, or an Armenian hamster isotype control,
anti-TNP mAb, as described above. RNA was isolated utilizing TRIzol
(Life Technologies), according to the manufacturers instructions.
Residual DNA was eliminated with DNase I treatment (Promega). RNA was
reverse transcribed to cDNA, and the level of IL-2 mRNA was determined
by real-time PCR using the predeveloped TaqMan probe and primers to
IL-2 (Applied Biosystems, Foster City, CA) on the Prism 7700 (Applied
Biosystems). The 18-s endogenous control (Applied Biosystems) was used
to normalize RNA. The 
CT method for
relative quantitation was utilized as per Applied Biosystems, and the
IL-2 mRNA level in absence of Ag was used as the calibrator. In some
cases, RNA stabilization was assessed through addition of 5 µg/ml
actinomycin (Sigma-Aldrich) or 0.5 µg/ml cyclosporine (Calbiochem,
San Diego, CA) to the T cell assays with harvesting of RNA at
designated time points.
 |
Results
|
|---|
Enhanced transcription of the IL-2 reporter transgene in activated
vs naive CD4+ T cells
To address the role of LFA-1:ICAM-1 interactions in the regulation
of IL-2 gene expression upon T cell activation, we first examined its
role in the regulation of IL-2 transcription. We utilized transgenic
mice expressing the murine IL-2 promoter region (positions -590 to +40
bp) upstream of the luciferase gene (40) crossed to the
DO11.10 TCR-transgenic mouse (denoted as IL-2 luc/DO11.10). To identify
the specific role of costimulation, naive IL-2 luc/DO11.10
CD4+ T cells were stimulated with transfected
cell lines that express class II, I-Ad, alone
(ProAd), or in combination with the ligand for LFA-1, ICAM-1
(ProAd-ICAM), or the ligand for CD28, B7-1 (ProAd-B7) (11, 14, 38, 39). In this study, we refer to naive
CD4+ T cells as freshly isolated
CD4+ T cells with the recognition that there is a
small percentage of previously activated T cells in this population
that will generally contain a rearranged endogenous TCR
-chain
(43). Pro cell transfectants induce proliferation and IL-2
secretion in naive CD4+ T cells from the IL-2
luc/DO11.10 mice in an analogous pattern, as we have described with
naive CD4+ T cells from DO11.10 mice (Fig. 1
; see Refs. 11 and
14). However, transcription from the IL-2-luciferase
transgene is detectable only upon stimulation with ProAd-B7 at maximal
doses of Ag (Fig. 2
A). Naive
CD4+ IL-2 luc/DO11.10 T cells do secrete IL-2
(Fig. 1
B) upon stimulation with ProAd-ICAM, albeit at very
low levels. These results raise the potential caveat that the transgene
might not accurately reflect the transcriptional activity of the
endogenous IL-2 gene.

View larger version (12K):
[in this window]
[in a new window]
|
FIGURE 1. Proliferative responses upon costimulation through either B7-1 or
ICAM-1 in IL-2 luc/DO11.10 lymph node CD4+ T cells. ProAd
(triangles), ProAd-B7 (squares), or ProAd-ICAM (circles) were
cocultured with CD4+ lymph node T cells purified from IL-2
luc/DO11.10 TCR-transgenic mice in the presence of increasing
concentrations of OVA peptide. A, Thymidine
incorporation was measured during the last 18 h of a 72-h assay.
B, Supernatants were collected at 48 h and assayed
for IL-2 secretion by ELISA.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
FIGURE 2. Transcription from the IL-2-luciferase transgene is representative of
endogenous IL-2 expression. Purified CD4+ lymph node T
cells from IL-2 luc/DO11.10 mice were assayed directly (naive) or after
in vitro priming with Ag (activated). A, Naive (10
x 106) or activated (2 x 106) T cells
were cocultured with an equal number of ProAd, ProAd-B7, or ProAd-ICAM
cells in the presence of maximal doses of OVA peptide (20 µg/ml). At
16 h, cells were lysed and assayed for luciferase activity. Note
that the difference between naive and activated T cells is
underrepresented because in these experiments 5-fold more naive T cells
were added to the assay than were activated T cells. B,
Naive (1 x 106) or activated (1 x
106) T cells were cocultured with an equal number of ProAd,
ProAd-B7, or ProAd-ICAM cells in the presence of maximal doses of OVA
peptide (20 µg/ml). At peak IL-2 mRNA levels (naive cells at 2
h; activated cells at 4 h), cells were assayed for IL-2 mRNA, as
measured by real-time RT-PCR. Normalization is to cells cocultured in
the absence of Ag. C, An IL-2 promoter luciferase
construct (IL-2 promoter/SV40 3' UTR) was transiently transfected into
activated DO11.10 CD4+ T cell lines, and T cells were then
stimulated at 48 h with an equal number of ProAd, ProAd-B7, or
ProAd-ICAM in the presence of maximal doses of OVA peptide (20
µg/ml). After 16 h, the cells were lysed and assessed for
luciferase activity. Normalization is to cells cocultured in the
absence of Ag.
|
|
To address this concern, we determined whether the IL-2-luciferase
response correlated with the induction of endogenous IL-2 mRNA.
Activated T cells are significantly more responsive than naive T cells
to Ag presented by ProAd, ProAd-ICAM, and ProAd-B7 cells.
IL-2-luciferase transcription and IL-2 mRNA from activated T cells were
detectable after Ag stimulation by ProAd and enhanced when
costimulation was provided by either LFA-1 (ProAd-ICAM) or CD28
(ProAd-B7) (Fig. 2
, A and B). Importantly, the
pattern of expression of endogenous IL-2 mRNA in naive and activated
CD4+ IL-2 luc/DO11.10 T cells (Fig. 2
B) stimulated under different costimulatory conditions
correlates well with the pattern seen in IL-2-luciferase
expression in the IL-2 luc/DO11.10 mice (Fig. 2
A). As
further confirmation that expression of the transgenic reporter
construct is not modulated by flanking sequences at the integration
site, we found that transient transfection of an independent IL-2
reporter construct into activated DO11.10 CD4+ T
cells generated a similar pattern of luciferase expression (Fig. 2
C). Therefore, the luciferase activity in IL-2 luc/DO11.10
mice is a good indicator of IL-2 transcriptional activity, and the
transgenic mice are useful for studying the effect of CD28 and LFA-1 on
IL-2 transcription.
The enhanced strength of signal and costimulation
independence observed in the activated compared with the naive IL-2
luc/DO11.10 CD4+ T cells (Fig. 2
, A
and B) could be secondary to improved adhesion of the
activated T cells to APC, or to an inherent increased ability of the
activated T cells to transduce signals that lead to IL-2 production. We
therefore compared transcriptional activity in naive vs activated
CD4+ T cells utilizing methods independent of the
adhesion characteristics of the T cells. Enhanced transcription of the
IL-2-luciferase transgene in naive vs activated T cells was observed
when the T cells were stimulated with plate-bound
anti-CD3/anti-CD28, bypassing cell surface adhesion (Fig. 3
A). Of note, however, is that
the level of costimulation detected through anti-CD28 is not as
great as through natural ligand interactions (Fig. 2
A).
These results indicate that the difference in response between naive T
cells and activated T cells cannot be attributed to a diminished
ability of naive T cells to form cell:cell conjugates. Furthermore,
this difference was also seen when the T cells were stimulated with
PMA/ionomycin, bypassing proximal signaling events (Fig. 3
B). Therefore, the increased response in activated T cells
appears to be due, at least in part, to an increased sensitivity of
downstream signaling events or changes in transcriptional
regulation.

View larger version (11K):
[in this window]
[in a new window]
|
FIGURE 3. Stimulation of naive and activated IL-2 luc/DO11.10 CD4+ T
cells is independent of cell-cell interactions. Naive (10 x
106) or activated (2 x 106 in
A; 10 x 106 in B) IL-2
luc/DO11.10 CD4+ T cells, as described in Fig. 2 , were
stimulated with plate-bound anti-CD3 alone or in combination with
anti-CD28 (each at 10 µg/ml) (A) or PMA (10 ng/ml)
plus ionomycin (0.5 µM) (B). T cells were lysed at
16 h, and luciferase activity was measured with normalization to
background activity of T cells alone.
|
|
Both CD28 and LFA-1 costimulation can enhance IL-2 transcription
The decreased costimulation dependence for IL-2 secretion and
luciferase activity in the activated T cells provides an advantage in
our ability to analyze IL-2 transcription in this system. Stimulation
of the activated T cells with ProAd alone can be used as the baseline
from which to assess additional CD28- or LFA-1-mediated effects on IL-2
expression above and beyond that observed through TCR stimulation
alone. To evaluate the effect of LFA-1:ICAM-1 interactions on IL-2
production in activated CD4+ T cells, IL-2
secretion, IL-2 mRNA production, and IL-2-luciferase expression were
measured in an Ag dose response. Ag presentation by ProAd does induce
expression from the IL-2-luciferase reporter construct, and this level
of expression is enhanced by costimulation through LFA-1 across the
dose response (Fig. 4
A). To
verify that the LFA-1-mediated enhanced IL-2-luciferase transcription
did not simply reflect a shift in the dose response, we utilized Pro
cell transfectants that express I-Ad covalently
linked to the OVA323339 peptide in the absence
(ProAd/OVA) or presence of ICAM-1 (ProAd/OVA-ICAM) (14).
These cells present 100-fold more functional class II:peptide complexes
than can be presented when ProAd is loaded with maximal concentrations
of exogenous OVA peptide (14). ProAd/OVA-ICAM-stimulated
CD4+ IL-2 luc/DO11.10 T cells increase the
maximum response of IL-2 reporter luciferase activity in comparison to
that with ProAd/OVA stimulation (Fig. 4
B). Thus, LFA-1
costimulation can enhance IL-2 transcription even at supraoptimal
peptide doses. Similar effects of LFA-1 costimulation were seen when
expression from the endogenous IL-2 gene was monitored (Fig. 4
, C and D). As the relative level of IL-2
transcriptional activity correlated well with the level of IL-2 mRNA
and IL-2 secretion, the ability of LFA-1 to promote IL-2 transcription
may account for the ability of LFA-1 to costimulate T cell
proliferation.

View larger version (23K):
[in this window]
[in a new window]
|
FIGURE 4. IL-2 secretion and transcription in activated CD4+ T cells
upon stimulation through B7-1 or ICAM-1. A,
C, and D, Activated CD4+
lymph node T cells from IL-2 luc/DO11.10 TCR-transgenic mice were
stimulated by ProAd (triangles), ProAd-B7 (squares), and ProAd-ICAM
(circles) in the presence of increasing doses of OVA peptide.
A, Cells were lysed at 16 h, and luciferase
activity was measured. In B, activated T cells were
stimulated with ProAd/OVA or ProAd/OVA-ICAM for 16 h and then
assayed for luciferase activity. C, RNA was isolated
from the cells 4 h after stimulation, and IL-2 mRNA was measured
utilizing real-time RT-PCR. D, Supernatants were assayed
for IL-2 secretion at 24 h by ELISA. AC,
Normalization was to background activity of APC plus T cells in the
absence of Ag. Efficacy of cyclosporine was assessed by comparison of
IL-2 mRNA levels in the absence and presence of cyclosporine.
While evaluating the role of costimulation in the regulation of IL-2
expression under various conditions, greater than 10 experiments were
performed and, in comparison with TCR stimulation alone, the relative
increase upon LFA-1 costimulation ranges from 2- to 5-fold in IL-2
secretion, 2- to 20-fold in IL-2 mRNA, and 1.5- to 10-fold in
IL-2 transcription. The lower range of increase in magnitude for IL-2
secretion in comparison with IL-2 mRNA is consistent with IL-2
consumption. In comparison, CD28 costimulation results in a relative
increase of 15- to 150-fold in IL-2 secretion, 10- to 100-fold in
IL-2 mRNA, and 2- to 10-fold in IL-2 transcription.
|
|
CD28 costimulation can also enhance expression of the IL-2-luciferase
construct (Fig. 4
A). In general, CD28 was 2- to 3-fold more
effective than LFA-1 at enhancing IL-2-luciferase transcription, and
10- to 20-fold more effective at inducing IL-2 secretion. However, in
some experiments, LFA-1 and CD28 costimulation induced equivalent
levels of IL-2 transcription, but CD28 still induced a substantial
increase in IL-2 secretion over that observed with LFA-1. Thus,
CD28-mediated enhanced IL-2 transcription alone cannot account for the
ability of CD28 to promote IL-2 production. This is most evident in
Fig. 4
at high doses of Ag in ProAd-B7-costimulated T cells, where IL-2
transcription plateaus, while IL-2 mRNA and IL-2 secretion continue to
increase. The data support the important role of CD28 costimulation in
regulating IL-2 production through enhanced mRNA stability (see
below).
CD28, but not LFA-1, costimulation induces IL-2 mRNA stability
The enhanced IL-2 transcription upon LFA-1 costimulation clearly
contributes to increased IL-2 mRNA; however, IL-2 gene expression is
also regulated posttranscriptionally. As the predominant
posttranscriptional regulation of IL-2 expression is through
stabilization of IL-2 mRNA, we assessed the effect of LFA-1 stimulation
on the t1/2 of IL-2 mRNA. Activated
DO11.10 CD4+ T cells were incubated with the Pro
cell transfectants in the presence or absence of Ag for 4 h.
Actinomycin or cyclosporine was then added to block IL-2 transcription,
and levels of IL-2 mRNA were determined at various time points.
Actinomycin is traditionally used to inhibit transcription for purposes
of studying mRNA stability; however, IL-2 mRNA has been found to be
stabilized upon incubation with actinomycin (44).
Initially, we performed the IL-2 mRNA stabilization experiments with
actinomycin, but we also found artificial stabilization of IL-2 mRNA
(data not shown). Therefore, the majority of experiments were conducted
utilizing cyclosporine. Cyclosporine blocks IL-2 transcription by
inhibiting calcineurin-dependent nuclear localization of NF-AT
(45), and therefore has been used to specifically study
IL-2 mRNA stabilization (46). In activated DO11.10
CD4+ T cells, stimulation with ProAd-ICAM did not
result in stabilization of IL-2 mRNA compared with TCR stimulation
alone. On occasion, ProAd-ICAM-stimulated T cells demonstrated a more
rapid decline in IL-2 mRNA t1/2 in
comparison with ProAd-stimulated T cells (Fig. 5
A). Under these same
conditions, stimulation with ProAd-B7 did increase the
t1/2 of IL-2 mRNA to 46 h (Fig. 5
, A and B), corroborating the known ability of CD28
to mediate IL-2 mRNA stabilization (35, 37, 46, 47). These
results indicate that LFA-1 costimulation does not mediate
stabilization of IL-2 mRNA in DO11.10 CD4+ T
cells.

View larger version (13K):
[in this window]
[in a new window]
|
FIGURE 5. IL-2 mRNA stabilization in activated DO11.10 CD4+ T cells
upon stimulation through B7-1 or ICAM-1. Activated CD4+
lymph node T cells from DO11.10 TCR-transgenic were stimulated with
ProAd (triangles), ProAd-B7 (squares), or ProAd-ICAM (circles) in the
presence of maximal doses of OVA peptide (20 µg/ml). Cyclosporine
(0.5 µg/ml) was added at 4-h poststimulation (at peak IL-2 mRNA
levels), and relative IL-2 mRNA was measured at the time points
indicated by real-time RT-PCR. A and B,
Two separate experiments with measurements over different time courses.
The fold increase in IL-2 mRNA is compared with levels in the absence
of Ag, and normalization is to the level of IL-2 mRNA at the time of
cyclosporine addition (time 0) in T cells stimulated with each of the
Pro cell transfectants.
|
|
In contrast to our results, stimulation of LFA-1 in combination with
anti-TCR stimulation in human T cells has been reported to
stabilize the mRNA for a number of proteins, including IL-2 (48, 49). To resolve this discrepancy, we evaluated LFA-1-mediated
effects on IL-2 mRNA stability under a number of different activation
conditions. The inability of LFA-1 to stabilize IL-2 mRNA in the
activated DO11.10 CD4+ T cells was not Ag
dose-dependent, as both suboptimal (low Ag dose) and supraoptimal
(using ProAd/OVA and ProAd/OVA-ICAM transfectants) TCR signals did not
reveal enhanced IL-2 mRNA stability through LFA-1 costimulation (data
not shown). The lack of IL-2 mRNA detected in ProAd-stimulated naive
DO11.10 CD4+ T cells (Fig. 2
B) does
not allow for detection of LFA-1-mediated IL-2 mRNA stabilization
relative to TCR stimulation in this population. Therefore, we
evaluated IL-2 mRNA expression in T cells stimulated under conditions
that inhibit Th cell differentiation (50). IL-2 mRNA is
detected upon stimulation through the TCR alone in these Th precursor
(Thp) cells, but IL-2 mRNA stabilization upon additional LFA-1
stimulation was not detected (data not shown). The mRNA of a number of
other cytokines, such as IFN-
, also contain AU-rich elements and are
regulated through mRNA stabilization. ProAd-ICAM-stimulated DO11.10
CD4+ T cells did not demonstrate stabilization of
IFN-
mRNA, while stabilization of IFN-
mRNA did occur upon
stimulation of the T cells with ProAd-B7 (data not shown). Finally, we
tested whether the differences in our results from recently published
results (48, 49) in the ability of LFA-1 to mediate mRNA
stabilization may be secondary to differences in stimulation technique
(natural ligand interactions vs Ab stimulation). A number of human
anti-LFA-1 Abs have agonist activity, which has not been found to
be the case with the murine anti-LFA-1 Abs. Therefore, we tested
various anti-LFA-1 Abs for costimulatory activity. Only one of
those examined, I21/7.7, enhanced IL-2 secretion upon coincubation with
anti-CD3 mAb. Activated DO11.10 CD4+ T cells
were stimulated with anti-CD3 mAb in combination with either
anti-CD28 mAb or anti-CD11a mAb, and IL-2 mRNA stabilization
was evaluated. Both anti-CD28 mAb and anti-CD11a mAb
stimulation of activated CD4+ T cells resulted in
enhanced IL-2 mRNA levels (Fig. 6
A) and IL-2 secretion (data
not shown) over that of anti-CD3 mAb stimulation alone. However,
while anti-CD28 mAb stimulation stabilized IL-2 mRNA,
anti-CD11a mAb stimulation did not (Fig. 6
B). Of note is
that the costimulation provided by Ab cross-linking through either CD28
or LFA-1, as measured by IL-2 mRNA levels, is not enhanced to the same
degree as that observed upon natural ligand interactions. Therefore, in
the context of a murine system utilizing natural ligands and cell-cell
interactions, LFA-1:ICAM-1 interactions allow for enhanced IL-2 mRNA
expression and subsequent enhanced IL-2 secretion through up-regulation
of IL-2 transcription in the absence of IL-2 mRNA stabilization.

View larger version (12K):
[in this window]
[in a new window]
|
FIGURE 6. IL-2 mRNA stabilization in activated DO11.10 CD4+ T cells
upon stimulation through anti-CD28 or anti-LFA-1. Activated T
cells from DO11.10 TCR-transgenic mice were stimulated with plate-bound
anti-CD3 (2C11-145) and either anti-CD28 (PV-1), anti-CD11a
(I21/7.7), or an isotype control Armenian hamster anti-TNP (A19-3)
mAb. A, Fold increase in IL-2 mRNA levels at 3 h
poststimulation, as compared with levels in the absence of Ab.
B, Cyclosporine (0.5 µg/ml) was added at 3 h
poststimulation (peak IL-2 mRNA response upon Ab stimulation), and
relative IL-2 mRNA was measured at the time points indicated by
real-time RT-PCR. The fold increase in IL-2 mRNA is compared with
levels in the absence of Ab, and normalization is to the level of IL-2
mRNA at the time of cyclosporine addition (time 0). I21/7.7 was
selected as the most effective mAb for T cell costimulation of IL-2
expression, as measured by IL-2 ELISA after screening a panel of
anti-LFA-1 Abs (anti-CD11a mAbs 2D7, M17/4, M17/5.2, and
I21/7.7; and anti-CD18 mAbs C71/16, M18/2, and 2E6).
|
|
 |
Discussion
|
|---|
The dependence of naive and activated CD4+ T
cells on IL-2 for full activation and expansion points to IL-2 gene
regulation as an essential juncture in effective T cell activation.
Checkpoints of this regulation include transcriptional,
posttranscriptional, and translational mechanisms (46, 51, 52). Various signals, including those through TCR stimulation
alone, might result in activation of certain transcription factors
necessary for IL-2 transcription, but ultimately IL-2 secretion
requires the cooperative binding of a number of transcription factors
to enable IL-2 transcription (53), along with adequate
IL-2 mRNA t1/2. In this study, we have
used transgenic mice expressing a reporter construct under the
regulation of the IL-2 promoter, and analysis of IL-2 mRNA kinetics, to
study the influence of LFA-1 on IL-2 gene regulation. In T cells
containing the IL-2-luciferase reporter transgene, LFA-1 costimulates
an enhanced level of IL-2-luciferase transcription that can account for
the LFA-1-mediated costimulation of endogenous IL-2 expression.
Furthermore, the enhanced level of endogenous IL-2 mRNA expression in
primary murine T cells upon costimulation through LFA-1 is not mediated
by stabilization of IL-2 mRNA, as opposed to what is observed upon
costimulation through CD28. Therefore, we find that LFA-1:ICAM-1
interactions in activated DO11.10 CD4+ T cells
influence IL-2 expression through transcriptional mechanisms, in the
absence of mRNA stabilization.
The increased sensitivity to Ag dose, decreased costimulation
dependence, and enhanced magnitude of effector responses by activated
CD4+ T cells compared with naive T cells has been
well described (7, 54, 55, 56, 57). Despite the decreased
costimulation dependence in activated IL-2 luc/DO11.10
CD4+ T cells, LFA-1:ICAM-1 interactions
consistently enhance IL-2 transcription compared with the engagement of
the TCR alone. Therefore, as observed in naive
CD4+ T cells (11, 13, 14), LFA-1
does effectively costimulate activated T cells. The mechanism of these
altered characteristics of effector T cells, in comparison with those
of naive T cells, is not yet understood. Considerations have included
the preferential selection of T cells utilizing a higher affinity TCR,
an increased precursor frequency of signaling molecules, or a more
efficient arrangement of these molecules, as has been described in the
case of the targeting of Lck to the CD8 coreceptor in the case of
CD8+ T cells (57). Our data
demonstrate that the differential magnitude of response in naive vs
activated T cells was maintained upon PMA/ionomycin stimulation,
suggesting that downstream signals and/or transcriptional regulation
play a significant role in this differential response.
The lack of detectable luciferase activity upon stimulation of naive
CD4+ T cells from IL-2 luc/DO11.10 mice with
ProAd-ICAM was initially surprising because endogenous IL-2 mRNA is
readily detectable by RT-PCR (11) and real-time RT-PCR
(data not shown) in the same T cells. Although the IL-2-luciferase
transgene contains the dominant proximal enhancer sequence, it lacks
the locus control region that provides for integration site-independent
expression (58). Therefore, expression of this transgene
relies on integration into a site that is accessible in T cells.
However, low levels of IL-2-luciferase transcription in the naive
CD4+ T cells appear to be a threshold-related
phenomenon, not an artifact of flanking regions at the integration site
of the transgene. The increased levels of transcription detected in
activated CD4+ T cells from IL-2 luc/DO11.10 mice
are consistently observed under different costimulation conditions,
with anti-CD3/anti-CD28, and with PMA/ionomycin. Furthermore,
the level of IL-2-luciferase expression demonstrates analogous
regulation to that of endogenous IL-2. Therefore, the IL-2 luc/DO11.10
mice serve as a useful system to better define the kinetics and
dose-response characteristics of IL-2 gene expression through LFA-1
stimulation.
The interaction of LFA-1 with ICAM-1 in DO11.10
CD4+ T cells mediates the up-regulation of IL-2
mRNA relative to TCR stimulation alone by transcriptional regulation in
the absence of IL-2 mRNA stabilization. We have considered two possible
mechanisms that might account for the ability of LFA-1 to regulate IL-2
gene transcription. First, LFA-1 itself might initiate a signaling
pathway that, along with signals generated from the interaction of the
TCR with its ligand, provides for T cell activation. There is much
evidence that integrins can transduce important biological signals, and
this role has been well documented in nonlymphoid cells (for reviews,
see Refs. 17, 59 , and 60). A number of these
signals, such as Vav (61), JNK (37, 62), and
JAB1 (63), can functionally cooperate to enable IL-2 gene
expression. However, in T cells, LFA-1 engagement has not been clearly
associated with a distinct intracellular signaling pathway. There is
evidence that coligation of LFA-1 and TCR can lead to a sustained
intracellular calcium response, increased inositol phopholipid
hydrolysis, and association with DNAX accessory molecule-1;
increased focal adhesion kinase, proline-rich tryosine kinase 2, JNK,
PI3K, and extracellular signal-related kinase-2 activity
(18, 19, 20, 21, 22, 23, 24, 25); and recruitment of protein kinase C-
to the
immunological synapse.4 Differential signals transduced
through LFA-1 and CD28 most likely contribute to the difference in IL-2
transcription levels, as well as the differential ability to stabilize
IL-2 mRNA. These differences have not been defined, although PI3K
activity demonstrates a differential response in
CD8+ T cells to the two modes of costimulation
(21). Whether the enhanced responses upon LFA-1 engagement
result from increased signals mediated through the TCR complex or
independent signals transduced through LFA-1 and, if so, how these
LFA-1-mediated signals are integrated with TCR signaling pathways have
not been clearly established.
Second, LFA-1 may function in the structural organization of the
adhesion complex between T cells and APC, termed the immunological
synapse or supramolecular activation cluster. LFA-1 segregates into the
outer perimeter of the adhesion complex, while TCR and engaged
MHC:peptide complexes, as well as other molecules, segregate into a
small central subdomain of the cell:cell contact region (27, 28). In fact, class II:peptide and LFA-1:ICAM-1 interactions in
a lipid bilayer system are sufficient to allow for the formation of the
immunological synapse (28). The focal concentration of TCR
within the adhesion complex might facilitate serial engagement of the
TCR on a limited number of MHC:peptide complexes (64)
and/or might allow for more efficient lateral interactions that
ultimately lead to ligand-induced multimerization of the TCR
(65). The level of TCR oligomerization could alter the
magnitude and quality of TCR signaling (66, 67, 68). Given the
association of LFA-1 with the cytoskeleton (69, 70, 71, 72, 73, 74) and
its enhanced recruitment into lipid rafts (75), LFA-1 may
be contributing to the assembly and organization of these various Ag
receptors, coreceptors, and adhesion and signaling molecules within
immunological synapse (26),4 which
ultimately contributes to T cell activation. These functions of LFA-1
may play a role in the recruitment of the TCR and associated
signal-transducing molecules to lipid rafts upon T cell activation
(76, 77, 78, 79, 80), which, in turn, influence subsequent signaling
events, such as a sustained calcium signal (19). Finally,
the ability of LFA-1 to reorganize the actin cytoskeleton in the
context of TCR engagement has been reported to be a form of anchorage
dependence, enabling G1 to S phase transition
with subsequent IL-2 secretion (24).
We have also found that CD28 costimulation can enhance IL-2-luciferase
transcription. In previous studies, the ability of CD28 to enhance IL-2
transcription has been somewhat controversial. This pathway has been
best established in human T cells, where CD28 costimulation targets a
response element (CD28RE) within the proximal IL-2 enhancer that binds
AP-1 and NF-
B (30, 31, 32, 81, 82). The ability of CD28 to
enhance JNK activity and induce AP-1 and NF-
B activation is
consistent with its role in up-regulation of IL-2 transcription through
the CD28RE (83, 84, 85, 86, 87). However, in most studies,
transcriptional activity from this site is only detectable when CD28
costimulation is supplemented with PMA. Furthermore, most of the data
have been generated in Jurkat T cell tumor lines. In one study of
normal human T cells, CD28 costimulation did increase expression of a
transfected IL-2-luciferase reporter construct, but mutation of the
CD28RE had little effect on transcriptional activity (33).
In murine Th1 clones, stable transfection of an IL-2 reporter construct
has not supported a role for CD28 costimulation in IL-2 transcription
(36, 88). Finally, recent results from transgenic mice
expressing green fluorescent protein inserted into the IL-2
locus have shown that anti-CD28 can costimulate
anti-CD3-mediated induction of green fluorescent protein expression
in freshly isolated T cells (89). Our results using the
IL-2-luciferase construct and following endogenous IL-2 mRNA expression
clearly demonstrate that CD28:B7-1 interactions enhance IL-2
transcription during Ag stimulation of primary murine T cells.
In addition to transcriptional regulation, IL-2 expression is also
controlled by posttranscriptional mechanisms, most notably mRNA
stabilization. We have found that costimulation through LFA-1 does not
stabilize IL-2 mRNA in DO11.10-activated CD4+ T
cells. In contrast, two recent reports have indicated that LFA-1
costimulation of human T cells can mediate stabilization of several
mRNA molecules, including IL-2 (48, 49). Most of our
understanding of the mechanism of IL-2 mRNA stability comes from
studies of CD28 costimulation (35, 37, 47, 62). The rapid
degradation of unstable mRNA molecules is mediated by AU-rich regions
in the 3' untranslated region (UTR). CD28-mediated stabilization
of IL-2 mRNA is dependent on sequences in the 5' UTR and the coding
region as well as the 3' UTR (36, 37). Within the IL-2 3'
UTR there are several clusters of AU-rich elements, and JNK-mediated
stabilization requires the first cluster of four AUUUA pentameric
regions (37). In contrast, in the case of urokinase
plasminogen-activating receptor mRNA, LFA-1 activation is able to
modulate the effects of a destabilizing nonameric AU-rich sequence in
the 3' UTR (48). Finally, two RNA-binding proteins,
nucleolin and YB-1, bind to the 5' UTR in human IL-2 to mediate
JNK-induced stabilization (62). However, it is not clear
whether IL-2 mRNA stability is regulated the same in murine and human T
cells. Although CD28-mediated IL-2 mRNA stability is thought to be
transmitted through JNK in human Jurkat T cells (37), JNK
is not required for CD28-mediated costimulation of T cell activation
and IL-2 production in mice (90). Although we cannot
exclude technical differences, such as the nature of the stimulatory
Abs or the responding T cells used, these results raise the possibility
that differences in the signaling pathways and RNA-binding proteins, as
well as structural difference in the IL-2 gene, may contribute to the
differences in regulation of human vs murine IL-2 mRNA.
 |
Acknowledgments
|
|---|
We thank Lisa Sevilla, Christine Guo, and Marisa Alegre for helpful
discussions, and Jeff Hanke, Terry Barrett, Jeff Bluestone, Carl June,
Trevor Owens, and Linda Zuckerman for providing reagents.
 |
Footnotes
|
|---|
1 This work was supported by National Institutes of Health Grant AI48237 (to J.M). C.A. was supported by a grant from the American Digestive Health Foundation and the Gastro-Intestinal Research Foundation Associate Board. 
2 Address correspondence and reprint requests to Dr. Jim Miller, Molecular Genetics and Cell Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637. E-mail address: jmiller{at}midway.uchicago.edu 
3 Abbreviations used in this paper: JNK, c-Jun N-terminal kinase; CD28RE, CD28 response element; PI3K, phosphatidylinositol 3-kinase; TNP, trinitrophenol; UTR, untranslated region. 
4 C. E. Sedwick, K. Blaine, and J. Miller. Focusing of PKC
in the c-SMAC and activation of NF-
B is mediated by CD28 costimulation. Submitted for publication. 
Received for publication June 8, 2001.
Accepted for publication September 5, 2001.
 |
References
|
|---|
-
Kurzinger, K., T. Reynolds, R. N. Germain, D. Davignon, E. Martz, T. A. Springer. 1981. A novel LFA-1: cellular distribution, quantitative expression, and structure. J. Immunol. 127:596.[Abstract]
-
Lub, M., Y. van Kooyk, C. G. Figdor. 1995. Ins and outs of LFA-1. Immunol. Today 16:479.[Medline]
-
Randolph, G., M. Furie. 1996. Mononuclear phagocytes egress from an in vitro model of the vascular wall by migrating across endothelium in the basal to apical direction: role of intercellular adhesion molecule 1 and the CD11/CD18 integrins. J. Exp. Med. 183:451.[Abstract/Free Full Text]
-
Warnock, R., S. Askari, E. Butcher, U. von Andrian. 1998. Molecular mechanisms of lymphocyte homing to peripheral lymph nodes. J. Exp. Med. 187:205.[Abstract/Free Full Text]
-
Kuhlman, P., V. T. Moy, B. A. Lollo, A. A. Brian. 1991. The accessory function of murine intercellular adhesion molecule-1 in T lymphocyte activation: contributions of adhesion and coactivation. J. Immunol. 146:1773.[Abstract]
-
Bachmann, M. F., K. McKall-Faienza, R. Schmits, D. Bouchard, J. Beach, D. E. Speiser, T. W. Mak, P. S. Ohashi. 1997. Distinct roles for LFA-1 and CD28 during activation of naive T cells: adhesion versus costimulation. Immunity 7:549.[Medline]
-
Iezzi, G., K. Karjalainen, A. Lanzavecchia. 1998. The duration of antigenic stimulation determines the fate of naive and effector T cells. Immunity 8:89.[Medline]
-
Van Seventer, G. A., Y. Shimizu, K. J. Horgan, S. Shaw. 1990. The LFA-1 ligand ICAM-1 provides an important costimulatory signal for TCR-mediated activation of resting T cells. J. Immunol. 144:4579.[Abstract]
-
Van Seventer, G. A., W. Newman, Y. Shimizu, T. B. Nutman, Y. Tanaka, K. J. Horgan, T. V. Gopal, E. Ennis, D. OSullivan, H. Grey, S. Shaw. 1991. Analysis of T cell stimulation by superantigen plus major histocompatibility complex class II molecules or by CD3 monoclonal antibody: costimulation by purified adhesion ligands VCAM-1, ICAM-1, but not ELAM-1. J. Exp. Med. 174:901.[Abstract/Free Full Text]
-
Gaglia, J. L., E. A. Greenfield, A. Mattoo, A. H. Sharpe, G. J. Freeman, V. K. Kuchroo. 2000. Intercellular adhesion molecule 1 is critical for activation of CD28-deficient T cells. J. Immunol. 165:6091.[Abstract/Free Full Text]
-
Zuckerman, L. A., L. Pullen, J. Miller. 1998. Functional consequences of costimulation by ICAM-1 on IL-2 gene expression and T cell activation. J. Immunol. 160:3259.[Abstract/Free Full Text]
-
Dubey, C., M. Croft, S. L. Swain. 1995. Costimulatory requirements of naive CD4+ T cells: intercellular adhesion molecule 1 or B7-1 can costimulate naive CD4 T cell activation but both are required for optimum response. J. Immunol. 155:45.[Abstract]
-
Cai, Z., H. Kishimoto, A. Brunmark, M. R. Jackson, P. A. Peterson, J. Sprent. 1997. Requirements for peptide-induced T cell receptor down-regulation on naive CD8+ T cells. J. Exp. Med. 185:641.[Abstract/Free Full Text]
-
Abraham, C., J. Griffith, J. Miller. 1999. The dependence for leukocyte function-associated antigen-1/ICAM-1 interactions in T cell activation cannot be overcome by expression of high density TCR ligand. J. Immunol. 162:4399.[Abstract/Free Full Text]
-
Shier, P., K. Ngo, W.-P. Fung-Leung. 1999. Defective CD8+ T cell activation and cytolytic function in the absence of LFA-1 cannot be restored by increased TCR signaling. J. Immunol. 163:4826.[Abstract/Free Full Text]
-
Goldstein, J. S., T. Chen, M. Brunswick, H. Mostowsky, S. Kozlowski. 1998. Purified MHC class I and peptide complexes activate naive CD8+ T cells independently of the CD28/B7 LFA-1/intercellular adhesion molecule 1 costimulatory interactions. J. Immunol. 160:3180.[Abstract/Free Full Text]
-
Giancotti, F. G., E. Ruoslahti. 1999. Integrin signaling. Science 285:1028.[Abstract/Free Full Text]
-
Van Seventer, G. A., E. Bonvini, H. Yamada, A. Conti, S. Stringfellow, C. H. June, S. Shaw. 1992. Costimulation of TCR/CD3-mediated activation of resting human CD4+ T cells by leukocyte function-associated antigen-1 ligand intercellular adhesion molecule-1 involves prolonged inositol phopholipid hydrolysis and sustained increase of intracellular Ca2+ levels. J. Immunol. 149:3872.[Abstract]
-
Wülfing, C., M. Sjaastad, M. Davis. 1998. Visualizing the dynamics of T cell activation: ICAM-1 migrates rapidly to the T cell/B cell interface and acts to sustain calcium levels. Proc. Natl. Acad. Sci. USA 95:6302.[Abstract/Free Full Text]
-
Rovere, P., L. Inverardi, J. R. Bender, R. Pardi. 1996. Feedback modulation of ligand-engaged
L/
2 leukocyte integrin (LFA-1) by cyclic AMP-dependent protein kinase. J. Immunol. 156:2273.[Abstract]
-
Ni, H. T., M. J. Deeths, W. Li, D. L. Mueller, M. F. Mescher. 1999. Signaling pathways activated by leukocyte function-associated antigen-1-dependent costimulation. J. Immunol. 162:5183.[Abstract/Free Full Text]
-
Rodriguez-Fernandez, J. L., M. Gomez, A. Luque, N. Hogg, F. Sanchez-Madrid, C. Cabanas. 1999. The interaction of activated integrin lymphocyte function-associated antigen 1 with ligand intercellular adhesion molecule 1 induces activation and redistribution of focal adhesion kinase and proline-rich tyrosine kinase 2 in T lymphocytes. Mol. Biol. Cell 10:1891.[Abstract/Free Full Text]
-
Tabassam, F. H., H. Umehara, J. Y. Huang, S. Gouda, T. Kono, T. Okazaki, J. M. van Seventer, N. Domae. 1999.
2-integrin, LFA-1, and TCR/CD3 synergistically induce tyrosine phophorylation of focal adhesion kinase (pp125(FAK)) in PHA-activated T cells. Cell. Immunol. 193:179.[Medline]
-
Geginat, J., G. Bossi, J. R. Bender, R. Pardi. 1999. Anchorage dependence of mitogen-induced G1 to S transition in primary T lymphocyes. J. Immunol. 162:5085.[Abstract/Free Full Text]
-
Shibuya, K., L. L. Lanier, J. H. Phillips, H. D. Ochs, K. Shimizu, E. Nakayama, H. Nakauchi, A. Shibuya. 1999. Physical and functional association of LFA-1 with DNAM-1 adhesion molecule. Immunity 11:615.[Medline]
-
Wülfing, C., M. M. Davis. 1998. A receptor/cytoskeletal movement triggered by costimulation during T cell activation. Science 282:2266.[Abstract/Free Full Text]
-
Monks, C. R. F., B. A. Freiberg, H. Kupfer, N. Sciaky, A. Kupfer. 1998. Three-dimensional segregation of supramolecular activation clusters in T cells. Nature 395:82.[Medline]
-
Grakoui, A., S. K. Bromley, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen, M. L. Dustin. 1999. The immunological synapse: a molecular machine controlling T cell activation. Science 285:221.[Abstract/Free Full Text]
-
Dustin, M. L., J. A. Cooper. 2000. The immunological synapse and the actin cytoskeleton: molecular hardware for T cell signaling. Nat. Immun. 1:23.
-
Fraser, J. D., B. A. Irving, G. R. Crabtree, A. Weiss. 1991. Regulation of interleukin-2 gene enhancer activity by the T cell accessory molecule CD28. Science 251:313.[Abstract/Free Full Text]
-
Lai, J.-H., G. Horvath, J. Subleski, J. Bruder, P. Ghosh, T.-H. Tan. 1995. RelA is a potent transcriptional activator of the CD28 response element within the interleukin 2 promoter. Mol. Cell. Biol. 15:4260.[Abstract]
-
Shapiro, V. S., K. E. Truitt, J. B. Imboden, A. Weiss. 1997. CD28 mediates transcriptional up-regulation of the interleukin-2 (IL-2) promoter through a composite element containing the CD28RE and NF-IL-2B AP-1 sites. Mol. Cell. Biol. 17:4051.[Abstract]
-
Hughes, C. C. W., J. S. Pober. 1996. Transcriptional regulation of the interleukin-2 gene in normal human peripheral blood T cells. J. Biol. Chem. 271:5369.[Abstract/Free Full Text]
-
Butscher, W. G., C. Powers, M. Olives, C. Vinson, K. Gardner. 1998. Coordinate transactivation of the interleukin-2 CD28 response element by c-Rel and ATF-1/CREB2. J. Biol. Chem. 273:552.[Abstract/Free Full Text]
-
Lindsten, T., C. H. June, J. A. Ledmetter, G. Stella, C. B. Thompson. 1989. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244:339.[Abstract/Free Full Text]
-
Umlauf, S. W., B. Beverly, O. Lantz, R. H. Schwartz. 1995. Regulation of interleukin 2 gene expression by CD28 costimulation in mouse T-cell clones: both nuclear and cytoplasmic RNAs are regulated with complex kinetics. Mol. Cell. Biol. 15:3197.[Abstract]
-
Chen, C.-Y., F. Del Gatto-Konczak, Z. Wu, M. Karin. 1998. Stabilization of interleukin-2 mRNA by the c-Jun NH2-terminal kinase pathway. Science 280:1945.[Abstract/Free Full Text]
-
Zuckerman, L. A., A. J. Sant, J. Miller. 1995. Identification of a unique costimulatory activity for murine Th1 T cell clones. J. Immunol. 154:4503.[Abstract]
-
Jenks, S. A., J. Miller. 1999. Inhibition of IL-4 responses after T cell priming in the context of LFA-1 costimulation is not reversed by restimulation in the presence of CD28 costimulation. J. Immunol. 164:72.[Abstract/Free Full Text]
-
Brunner, M. C., C. A. Chambers, F. K.-M. Chan, J. Hanke, A. Winoto, J. P. Allison. 1999. CTLA-4-mediated inhibition of early events of T cell proliferation. J. Immunol. 162:5813.[Abstract/Free Full Text]
-
Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+ TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
-
Haskins, K., R. Kubo, J. White, M. Pigeon, J. Kappler, P. Marrack. 1983. The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J. Exp. Med. 157:1149.[Abstract/Free Full Text]
-
Lee, W. T., J. Cole-Calkins, N. E. Street. 1996. Memory T cell development in the absence of specific antigen priming. J. Immunol. 157:5300.[Abstract]
-
Shaw, J., K. Meerovitch, R. C. Bleackley, V. Paetkau. 1988. Mechanisms regulating the level of IL-2 mRNA in T lymphocytes. J. Immunol. 140:2243.[Abstract]
-
Kiani, A., A. Rao, J. Aramburu. 2000. Manipulating immune responses with immunosuppressive agents that target NFAT. Immunity 12:359.[Medline]
-
Powell, J. D., J. A. Ragheb, S. Kitagawa-Sakakida, R. H. Schwartz. 1998. Molecular regulation of interleukin-2 expression by CD28 co-stimulation and anergy. Immunol. Rev. 165:287.[Medline]
-
Ragheb, J. A., M. Deen, R. H. Schwartz. 1999. CD28-mediated regulation of mRNA stability requires sequences within the coding region of the IL-2 mRNA. J. Immunol. 163:120.[Abstract/Free Full Text]
-
Wang, G. J., M. Collinge, F. Blasi, R. Pardi, J. R. Bender. 1998. Posttranscriptional regulation of urokinase plasminogen activator receptor messenger RNA levels by leukocyte integrin engagement. Proc. Natl. Acad. Sci. USA 95:6296.[Abstract/Free Full Text]
-
Geginat, J., B. Clissi, M. Moro, P. Dellabona, J. R. Bender, R. Pardi. 2000. CD28 and LFA-1 contribute to cyclosporin A-resistant T cell growth by stabilizing the IL-2 mRNA through distinct signaling pathways. Eur. J. Immunol. 30:1136.[Medline]
-
Sad, S., T. R. Mosmann. 1994. Single IL-2-secreting precursor CD4 T cell can develop into either Th1 or Th2 cytokine secretion phenoytpe. J. Immunol. 153:3514.[Abstract]
-
Umlauf, S. W., B. Beverly, S.-M. Kang, K. Brorson, A.-C. Tran, R. H. Schwartz. 1993. Molecular regulation of the IL-2 gene: rheostatic control of the immune system. Immunol. Rev. 1993:177.
-
Jain, J., C. Loh, A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333.[Medline]
-
Garrity, P. A., D. Chen, E. V. Rothenberg, B. J. Wold. 1994. Interleukin-2 transcription is regulated in vivo at the level of coordinated binding of both constitutive and regulated factors. Mol. Cell. Biol. 14:2159.[Abstract/Free Full Text]
-
Fischer, H., A. Gjörloff, G. Hedlund, H. Hedman, E. Lundgren, T. Kalland, H. O. Sjögren, M. Dohlsten. 1992. Stimulation of human naive and memory Th cells with bacterial superantigen: naive CD4+45RA T cells require a costimulatory signal mediated through the LFA-1/intercellular adhesion molecule-1 pathway. J. Immunol. 148:1993.[Abstract]
-
Croft, M.. 1994. Activation of naive, memory and effector T cells. Curr. Opin. Immunol. 6:431.[Medline]
-
Dubey, C., M. Croft, S. L. Swain. 1996. Naive and effector CD4 T cells differ in their requirements for TCR versus costimulatory signals. J. Immunol. 157:3280.[Abstract]
-
Bachmann, M. F., A. Gallimore, S. Linkert, V. Cerundolo, A. Lanzavecchia, M. Kopf, A. Viola. 1999. Developmental regulation of Lck targeting to the CD8 coreceptor controls signaling in naive and memory T cells. J. Exp. Med. 189:1521.[Abstract/Free Full Text]
-
Yui, M. A., G. Hernández-Hoyos, E. V. Rothenberg. 2001. A new regulatory region of the IL-2 locus that confers position-independent transgene expression. J. Immunol. 166:1730.[Abstract/Free Full Text]
-
Dedhar, S., G. E. Hannigan. 1996. Integrin cytoplasmic interactions and bidirectional transmembrane signalling. Curr. Opin. Cell Biol. 8:657.[Medline]
-
Parsons, J. T.. 1996. Integrin-mediated signalling: regulation by protein tyrosine kinases and small GTP-binding proteins. Curr. Opin. Cell Biol. 8:146.[Medline]
-
Wu, J., D. G. Motto, G. A. Koretzky, A. Weiss. 1996. Vav and SLP-76 interact and functionally cooperate in IL-2 gene activation. Immunity 4:593.[Medline]
-
Chen, C.-Y., R. Gherzi, J. S. Andersen, G. Gaietta, K. Jürchott, H.-D. Royer, M. Mann, M. Karin. 2000. Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev. 14:1236.[Abstract/Free Full Text]
-
Bianchi, E., S. Denti, A. Granata, G. Bossi, J. Geginat, A. Villa, L. Rogge, R. Pardi. 2000. Integrin LFA-1 interacts with the transcriptional co-activator JAB1 to modulate AP-1 activity. Nature 404:617.[Medline]
-
Valitutti, S., A. Lanzavecchia. 1997. Serial triggering of TCRs: a basis for the sensitivity and specificity of antigen recognition. Immunol. Today 18:299.[Medline]
-
Reich, Z., J. J. Boniface, D. S. Lyons, N. Borochov, E. J. Wachtel, M. M. Davis. 1997. Ligand-specific oligomerization of T-cell receptor molecules. Nature 387:617.[Medline]
-
Germain, R. N.. 1997. T-cell signaling: the importance of receptor clustering. Curr. Biol. 7:R640.[Medline]
-
Boniface, J. J., J. D. Rabinowitz, C. Wülfing, J. Hampl, R. M. Kantor, C. Beeson, H. M. McConnell, M. M. Davis. 1998. Initiation of signal transduction through the T cell receptor requires the peptide multivalent engagement of MHC ligands. Immunity 9:459.[Medline]
-
Alam, S. M., G. M. Davies, C. M. Lin, T. Zal, W. Nasholds, S. C. Jameson, K. A. Hogquist, N. R. J. Gascoigne, P. J. Travers. 1999. Qualitative and quantitative differences in T cell receptor binding of agonist and antagonist ligands. Immunity 10:227.[Medline]
-
Lub, M., Y. van Kooyk, S. J. van Vliet, C. G. Figdor. 1997. Dual role of the actin cytoskeleton in regulating cell adhesion mediated by the integrin lymphocyte function-associated molecule-1. Mol. Biol. Cell 8:341.[Abstract]
-
Pavalko, F. M., S. M. LaRoche. 1993. Activation of human neutrophils induces an interaction between the integrin
2-subunit (CD18) and the actin-binding protein
-actinin. J. Immunol. 151:3795.[Abstract]
-
Sharma, C. P., R. M. Ezzell, M. A. Arnaout. 1995. Direct interaction of filamin (ABP-280) with the
2-integrin subunit CD18. J. Immunol. 154:3461.[Abstract]
-
Pardi, R., L. Inverardi, C. Rugarli, J. R. Bender. 1992. Antigen-receptor complex stimulation triggers protein kinase C-dependent CD11a/CD18-cytoskeleton association in T lymphocytes. J. Cell Biol. 116:1211.[Abstract/Free Full Text]
-
Peter, K., T. E. OToole. 1995. Modulation of cell adhesion by changes in
L
2 (LFA-1, CD11a/CD18) cytoplasmic domain/cytoskeleton interaction. J. Exp. Med. 181:315.[Abstract/Free Full Text]
-
Pardi, R., G. Bossi, L. Inverardi, E. Rovida, J. R. Bender. 1995. Conserved regions in the cytoplasmic domains of the leukocyte integrin
L
2 are involved in endoplasmic reticulum retention, dimerization, and cytoskeletal association. J. Immunol. 155:1252.[Abstract]
-
Krauss, K., P. Altevogt. 1999. Integrin leukocyte function-associated antigen-1-mediated cell binding can be activated by clustering of membrane rafts. J. Biol. Chem. 274:36921.[Abstract/Free Full Text]
-
Xavier, R., T. Brennan, Q. Li, C. McCormack, B. Seed. 1998. Membrane compartmentation is required for efficient T cell activation. Immunity 8:723.[Medline]
-
Zhang, W., R. P. Trible, L. E. Samelson. 1998. LAT palmitoylation: its essential role in membrane microdomain targeting and tyrosine phosphorylation during T cell activation. Immunity 9:239.[Medline]
-
Montixi, C., C. Langlet, A.-M. Bernard, J. Thimonier, C. Dubois, M.-A. Wurbel, J.-P. Chauvin, M. Pierres, H.-T. He. 1998. Engagement of T cell receptor triggers its recruitment to low-density detergent-insoluble membrane domains. EMBO J. 17:5334.[Medline]
-
Moran, M., M. C. Miceli. 1998. Engagement of GPI-linked CD48 contributes to TCR signals and cytoskeletal reorganization: a role for lipid rafts in T cell activation. Immunity 9:787.[Medline]
-
Viola, A., S. Schroeder, Y. Sakakibara, A. Lanzavecchia. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680.[Abstract/Free Full Text]
-
McGuire, K. L., M. Iacobelli. 1997. Involvement of Rel, Fos, and Jun proteins in binding activity to the IL-2 promoter CD28 response element/AP-1 sequence in human T cells. J. Immunol. 159:1319.[Abstract]
-
Maggirwar, S. B., E. W. Harhaj, S. C. Sun. 1997. Regulation of the interleukin-2 CD28-responsive element by NF-ATp and various NF-
B/Rel transcription factors. Mol. Cell. Biol. 17:2605.[Abstract]
-
Rincón, M., R. A. Flavell. 1994. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J. 13:4370.[Medline]
-
Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, Y. Ben-Neriah. 1994. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77:727.[Medline]
-
Kempiak, S. J., T. S. Hiura, A. E. Nel. 1999. The Jun kinase cascade is reponsible f