The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abraham, C.
Right arrow Articles by Miller, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abraham, C.
Right arrow Articles by Miller, J.
The Journal of Immunology, 2001, 167: 5193-5201.
Copyright © 2001 by The American Association of Immunologists

Molecular Mechanisms of IL-2 Gene Regulation Following Costimulation Through LFA-11

Clara Abraham* and Jim Miller2,{dagger}

Departments of * Medicine and {dagger} Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The integrin LFA-1 serves as an accessory molecule in T cell activation. In addition to its well-known role as an adhesion molecule, LFA-1 can contribute to T cell activation and up-regulation of IL-2 gene expression. However, the specific mechanisms by which LFA-1 influences T cell activation have not been elucidated. Therefore, we examined the impact of LFA-1:ICAM-1 interactions on transcriptional and posttranscriptional IL-2 gene regulation, using a costimulation-negative cell line transfected with MHC class II alone, or in combination with ICAM-1 or B7-1. IL-2 transcription was assessed utilizing transgenic mice expressing an IL-2 promoter luciferase reporter construct crossed to DO11.10 TCR-transgenic mice, and IL-2 mRNA stability was evaluated by real-time RT-PCR. Comparison of naive and previously activated T cells demonstrates a dramatic increase in IL-2-luciferase transcription in activated T cells that can, in part, be attributed to downstream signaling events. Costimulation through LFA-1 enhances transcription of the transgenic reporter construct across a wide Ag dose range, but does not affect IL-2 mRNA stability. In contrast, CD28 costimulation is clearly mediated through up-regulation of IL-2 transcription and through enhancement of mRNA stability. These results indicate that the primary pathway whereby engagement of LFA-1 through its ligand ICAM-1 up-regulates IL-2 gene expression is through enhanced IL-2 transcription, in the absence of any effect on IL-2 mRNA stabilization.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Accessory molecules play a role in the process of Ag recognition through two important functions: 1) enhancing adhesion of the T cell to the APC, allowing for more efficient TCR engagement, and 2) providing costimulation of T cells by transducing intracellular signals distinct from those mediated through the TCR. A number of accessory molecules have been identified that can function in adhesion and/or costimulation. One such accessory molecule is LFA-1 ({alpha}L/{beta}2 or CD11a/CD18) (1), a member of the integrin family. LFA-1 is a well-established adhesion molecule that plays an important role in extravasation of leukocytes into inflamed tissue (2, 3, 4). Moreover, LFA-1-mediated adhesion can facilitate Ag presentation to T cells, especially in situations of low affinity TCR:MHC:peptide interaction (5, 6), and by enabling adequate duration of antigenic stimulation (7). In addition to the known role of LFA-1 in T cell adhesion, LFA-1 can also provide costimulation to T cells (8, 9, 10). We and others have assessed the role of LFA-1 in T cell activation by gene transfer of class II and ICAM-1 into costimulation-negative cell lines (11, 12, 13). It was found that Ag presentation by transfectants expressing class II and ICAM-1 can induce IL-2 secretion and proliferation in naive T cells, whereas transfectants expressing only class II cannot. Furthermore, in naive CD4+ T cells the requirement for LFA-1:ICAM-1 interactions could not be compensated for by increasing the class II:peptide ligand density 10,000-fold (14). Similar results have been found in some, but not all, CD8+ T cell systems (15, 16). These results argue that coligation of TCR and LFA-1 can have a qualitative (costimulatory) as well as a quantitative (adhesive) effect on T cell activation.

The mechanisms of the LFA-1:ICAM-1 qualitative effect on T cell activation have yet to be elucidated. There is evidence that integrins can transduce signals in nonlymphoid cells (17). In T lymphocytes, coligation of LFA-1 and CD3 can lead to a sustained intracellular calcium response, increased inositol phospholipid hydrolysis, association with DNAX accessory molecule-1 and increased focal adhesion kinase, proline-rich tryosine kinase 2, c-Jun N-terminal kinase (JNK),3 phosphatidylinositol 3-kinase (PI3K), and extracellular signal-related kinase-2 activity (18, 19, 20, 21, 22, 23, 24, 25). Alternatively, LFA-1 may mediate costimulatory activity through reorganization of the actin cytoskeleton or organization of the immunological synapse (19, 26, 27, 28, 29). In either case, LFA-1 costimulation ultimately leads to enhanced secretion of IL-2. IL-2 is not transcribed in resting T cells, but IL-2 mRNA can be detected as early as 30 min after T cell activation. The engagement of the classic T cell costimulatory molecule, CD28, in particular in the presence of PMA, has been found to result in enhanced transcription of the IL-2 gene in human T cells (30, 31, 32, 33, 34). The t1/2 of IL-2 mRNA is approximately 30 min; however, upon stabilization of the message with engagement of CD28, the t1/2 of IL-2 mRNA increases to 5 h (35, 36, 37), allowing for increased IL-2 secretion and effective T cell expansion. The effect of LFA-1:ICAM-1 interactions in the context of MHC class II:peptide:TCR engagement on IL-2 gene transcription and mRNA stability is not clearly defined.

Work in our laboratory has demonstrated that stimulation of naive DO11.10 CD4+ T cells through the TCR and either CD28 or LFA-1, but not through the TCR alone, results in IL-2 mRNA, as measured by RT-PCR (11). This ultimately results in the secretion of IL-2 and efficient entry of T cells into the cell cycle. However, it was not clear whether the ability of LFA-1 to promote IL-2 gene expression was mediated through enhanced IL-2 transcription, IL-2 mRNA stabilization, or a combination of the two. In this study, we address the role of LFA-1 in IL-2 gene expression by stimulation of CD4+ T cells from DO11.10 TCR-transgenic mice with APC generated from cell lines transfected with costimulatory ligands. This system has the advantage of maintaining fluidity on both sides of the membrane during natural receptor-ligand interactions, and of isolating the contributions of individual accessory molecules to T cell activation. Our results indicate that the primary pathway whereby engagement of LFA-1 through its ligand ICAM-1 up-regulates IL-2 gene expression is through enhanced IL-2 transcription, in the absence of any effect on IL-2 mRNA stabilization.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells

A panel of transfectants in the fibrosarcoma cell line, 6132-PRO (Pro) expressing I-Ad alone (ProAd), or in combination with ICAM-1 (ProAd-ICAM) or B7-1 (ProAd-B7) has been previously described (11, 14, 38, 39). In some experiments, Pro cells expressing I-Ad covalently linked to OVA323–339 (ProAd/OVA), or in combination with ICAM-1 (ProAd/OVA-ICAM) are used (14). Transgenic mice expressing the murine IL-2 promoter region (positions -590 to +40 bp) upstream of the luciferase gene (40) (kindly provided by J. Hanke, Pfizer, Groton, CT) were crossed to DO11.10 TCR-transgenic mice (41). IL-2 promoter/luciferase transgenic mice were screened by PCR with primers to luciferase (forward primer, ATGGAAGACGCCAAAAACATAAAGAAAGGC; reverse primer, TTCATACTGTTGAGCAATTCACGTTCATTA). The CD4+ T cells were purified from lymph nodes of DO11.10 TCR-transgenic mice or IL-2 promoter/luciferase transgenic x DO11.10 TCR-transgenic mice (denoted by IL-2 luc/DO11.10) by negative selection using a mixture of anti-CD8 mAb (2.43) and anti-class II mAbs (M5/114), followed by lysis with rabbit complement (Accurate Chemical, Westbury, NY) and removal of residual Ab-bound cells by incubation with an equal number of sheep anti-rat Ab-coated Dynabeads (Dynal, Oslo, Norway). The efficacy of the CD4+ T cell purification was monitored by lack of proliferation to 2.5 µg/ml Con A (Sigma-Aldrich, St. Louis, MO) and by flow cytometry. All cell lines were maintained in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS, 2 mM glutamine, 0.1 mM nonessential amino acids, 40 µg/ml gentamicin, and 50 µM 2-ME. G418 (200 µg/ml) and/or MXH (6 µg/ml mycophenolic acid, 250 µg/ml xanthine, and 15 µg/ml hypoxanthine) were added to the culture medium for maintenance of the transfectants. DO11.10 or IL-2 luc/DO11.10 TCR-transgenic activated CD4+ T cells were maintained by weekly passage with irradiated BALB/cJ (The Jackson Laboratory, Bar Harbor, ME) splenocytes, 0.2 µg/ml OVA323–339 peptide, and 10 U/ml human rIL-2 (R&D Systems, Minneapolis, MN) with a maximum of two to three passages in culture, and then used in assays 7–21 days after stimulation.

Flow cytometry

Expression of transfected molecules was determined by flow cytometry using the anti-class II mAb MKD6, the anti-ICAM-1 mAb YN-1.7.1, and the anti-B7-1 mAb 16-10A1. T cells were phenotyped with a biotinylated mAb, KJ1-26 (42), directed against the TCR clonotype expressed by DO11.10 T cells. Abs were obtained from American Type Culture Collection (Manassas, VA), except biotinylated KJ1-26, which was kindly provided by T. Barrett (Northwestern University, Chicago, IL).

T cell proliferation and cytokine secretion

For T cell stimulation of naive CD4+ T cells with Pro cell transfectants, 5 x 104 T cells were incubated with 5 x 104 mitomycin C (Sigma-Aldrich)-treated transfectants and various concentrations of Ag in a 96-well flat-bottom plate. At 48 h, supernatants were assayed for IL-2 secretion by capture ELISA, or [3H]thymidine was added to the cultures during the last 18 h of a 72-h assay. In other experiments, Ficoll-purified activated CD4+ T cells were stimulated either with Pro cell transfectants or with anti-CD3 mAb (145-2C11; 1 µg/ml; kindly provided by J. Bluestone, University of California, San Francisco, CA) in the presence or absence of anti-CD28 mAb (PV1; 5 µg/ml; kindly provided by C. June, University of Pennsylvania, Philadelphia, PA), anti-CD11a mAb (I21/7.7; 5 µg/ml; kindly provided by T. Owens, McGill University, Montreal, Canada), or an isotype control Armenian hamster anti-trinitrophenol (TNP) mAb (A19-3; 5 µg/ml; BD PharMingen, San Diego, CA). Other anti-LFA-1 Abs were screened for efficacy of costimulation: the anti-CD11a mAbs 2D7, M17/4 (BD PharMingen), and M17/5.2 (American Type Culture Collection); and the anti-CD18 mAbs C71/16, M18/2 (BD PharMingen), and 2E6 (American Type Culture Collection). The Abs were immobilized onto 96-well flat-bottom plates by incubation in PBS at 4°C overnight. Plates were rinsed twice with PBS. Ficoll-purified T cells (5 x 104) were plated onto Ab-coated plates or cocultured with an equal number of Pro cell transfectants, and cytokine production from supernatants at 24 h was determined by capture ELISA (BD PharMingen).

T cell transfections

An IL-2 promoter reporter construct was produced and generously provided by L. Zuckerman utilizing the pGL2 basic vector (Promega, Madison, WI). A 378-bp SacI/BspHI fragment of the IL-2 promoter was subcloned into pGL2-basic vector. Activated DO11.10 CD4+ T cells were Ficoll-purified and transfected with the reporter construct by electroporation. The transfected T cells were incubated with 10 U of human rIL-2 (R&D Systems) in DMEM medium for 48 h, and then 2 x 106 T cells were stimulated with an equal number of the Pro cell transfectants in the presence of Ag and analyzed for luciferase activity 16 h later.

Luciferase assay

Naive (10 x 106) or Ficoll-purified activated (2 x 106) IL-2 luc/DO11.10 CD4+ T cells were incubated with an equal number of Pro cell transfectants and various concentrations of Ag in six-well flat-bottom plates for 16 h. In other experiments, T cells were stimulated with anti-CD3 mAb in the presence or absence of anti-CD28 mAb or with PMA (10 ng/ml; Sigma-Aldrich) plus ionomycin (0.5 µM; Sigma-Aldrich). Cell extracts were prepared according to the manufacturer’s instructions (Promega) with lysis in cell lysis buffer. Samples were assayed for luciferase activity using a Monolight luminometer (Analytical Luminescence Laboratory, Ann Arbor, MI) (kindly provided by H. Singh, University of Chicago, Chicago, IL).

RNA preparation and real-time RT-PCR

For total IL-2 RNA measurements, Ficoll-purified activated DO11.10 CD4+ T cells, 1 x 106 T cells were incubated with 1 x 106 Pro cell transfectants with Ag in a six-well flat-bottom plate. In other experiments, 1 x 106 T cells were stimulated with plate-bound anti-CD3 mAb in the presence or absence of anti-CD28 mAb, anti-CD11a mAb, or an Armenian hamster isotype control, anti-TNP mAb, as described above. RNA was isolated utilizing TRIzol (Life Technologies), according to the manufacturer’s instructions. Residual DNA was eliminated with DNase I treatment (Promega). RNA was reverse transcribed to cDNA, and the level of IL-2 mRNA was determined by real-time PCR using the predeveloped TaqMan probe and primers to IL-2 (Applied Biosystems, Foster City, CA) on the Prism 7700 (Applied Biosystems). The 18-s endogenous control (Applied Biosystems) was used to normalize RNA. The {Delta}{Delta}CT method for relative quantitation was utilized as per Applied Biosystems, and the IL-2 mRNA level in absence of Ag was used as the calibrator. In some cases, RNA stabilization was assessed through addition of 5 µg/ml actinomycin (Sigma-Aldrich) or 0.5 µg/ml cyclosporine (Calbiochem, San Diego, CA) to the T cell assays with harvesting of RNA at designated time points.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Enhanced transcription of the IL-2 reporter transgene in activated vs naive CD4+ T cells

To address the role of LFA-1:ICAM-1 interactions in the regulation of IL-2 gene expression upon T cell activation, we first examined its role in the regulation of IL-2 transcription. We utilized transgenic mice expressing the murine IL-2 promoter region (positions -590 to +40 bp) upstream of the luciferase gene (40) crossed to the DO11.10 TCR-transgenic mouse (denoted as IL-2 luc/DO11.10). To identify the specific role of costimulation, naive IL-2 luc/DO11.10 CD4+ T cells were stimulated with transfected cell lines that express class II, I-Ad, alone (ProAd), or in combination with the ligand for LFA-1, ICAM-1 (ProAd-ICAM), or the ligand for CD28, B7-1 (ProAd-B7) (11, 14, 38, 39). In this study, we refer to naive CD4+ T cells as freshly isolated CD4+ T cells with the recognition that there is a small percentage of previously activated T cells in this population that will generally contain a rearranged endogenous TCR {alpha}-chain (43). Pro cell transfectants induce proliferation and IL-2 secretion in naive CD4+ T cells from the IL-2 luc/DO11.10 mice in an analogous pattern, as we have described with naive CD4+ T cells from DO11.10 mice (Fig. 1Go; see Refs. 11 and 14). However, transcription from the IL-2-luciferase transgene is detectable only upon stimulation with ProAd-B7 at maximal doses of Ag (Fig. 2GoA). Naive CD4+ IL-2 luc/DO11.10 T cells do secrete IL-2 (Fig. 1GoB) upon stimulation with ProAd-ICAM, albeit at very low levels. These results raise the potential caveat that the transgene might not accurately reflect the transcriptional activity of the endogenous IL-2 gene.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 1. Proliferative responses upon costimulation through either B7-1 or ICAM-1 in IL-2 luc/DO11.10 lymph node CD4+ T cells. ProAd (triangles), ProAd-B7 (squares), or ProAd-ICAM (circles) were cocultured with CD4+ lymph node T cells purified from IL-2 luc/DO11.10 TCR-transgenic mice in the presence of increasing concentrations of OVA peptide. A, Thymidine incorporation was measured during the last 18 h of a 72-h assay. B, Supernatants were collected at 48 h and assayed for IL-2 secretion by ELISA.

 


View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 2. Transcription from the IL-2-luciferase transgene is representative of endogenous IL-2 expression. Purified CD4+ lymph node T cells from IL-2 luc/DO11.10 mice were assayed directly (naive) or after in vitro priming with Ag (activated). A, Naive (10 x 106) or activated (2 x 106) T cells were cocultured with an equal number of ProAd, ProAd-B7, or ProAd-ICAM cells in the presence of maximal doses of OVA peptide (20 µg/ml). At 16 h, cells were lysed and assayed for luciferase activity. Note that the difference between naive and activated T cells is underrepresented because in these experiments 5-fold more naive T cells were added to the assay than were activated T cells. B, Naive (1 x 106) or activated (1 x 106) T cells were cocultured with an equal number of ProAd, ProAd-B7, or ProAd-ICAM cells in the presence of maximal doses of OVA peptide (20 µg/ml). At peak IL-2 mRNA levels (naive cells at 2 h; activated cells at 4 h), cells were assayed for IL-2 mRNA, as measured by real-time RT-PCR. Normalization is to cells cocultured in the absence of Ag. C, An IL-2 promoter luciferase construct (IL-2 promoter/SV40 3' UTR) was transiently transfected into activated DO11.10 CD4+ T cell lines, and T cells were then stimulated at 48 h with an equal number of ProAd, ProAd-B7, or ProAd-ICAM in the presence of maximal doses of OVA peptide (20 µg/ml). After 16 h, the cells were lysed and assessed for luciferase activity. Normalization is to cells cocultured in the absence of Ag.

 
To address this concern, we determined whether the IL-2-luciferase response correlated with the induction of endogenous IL-2 mRNA. Activated T cells are significantly more responsive than naive T cells to Ag presented by ProAd, ProAd-ICAM, and ProAd-B7 cells. IL-2-luciferase transcription and IL-2 mRNA from activated T cells were detectable after Ag stimulation by ProAd and enhanced when costimulation was provided by either LFA-1 (ProAd-ICAM) or CD28 (ProAd-B7) (Fig. 2Go, A and B). Importantly, the pattern of expression of endogenous IL-2 mRNA in naive and activated CD4+ IL-2 luc/DO11.10 T cells (Fig. 2GoB) stimulated under different costimulatory conditions correlates well with the pattern seen in IL-2-luciferase expression in the IL-2 luc/DO11.10 mice (Fig. 2GoA). As further confirmation that expression of the transgenic reporter construct is not modulated by flanking sequences at the integration site, we found that transient transfection of an independent IL-2 reporter construct into activated DO11.10 CD4+ T cells generated a similar pattern of luciferase expression (Fig. 2GoC). Therefore, the luciferase activity in IL-2 luc/DO11.10 mice is a good indicator of IL-2 transcriptional activity, and the transgenic mice are useful for studying the effect of CD28 and LFA-1 on IL-2 transcription.

The enhanced strength of signal and costimulation independence observed in the activated compared with the naive IL-2 luc/DO11.10 CD4+ T cells (Fig. 2Go, A and B) could be secondary to improved adhesion of the activated T cells to APC, or to an inherent increased ability of the activated T cells to transduce signals that lead to IL-2 production. We therefore compared transcriptional activity in naive vs activated CD4+ T cells utilizing methods independent of the adhesion characteristics of the T cells. Enhanced transcription of the IL-2-luciferase transgene in naive vs activated T cells was observed when the T cells were stimulated with plate-bound anti-CD3/anti-CD28, bypassing cell surface adhesion (Fig. 3GoA). Of note, however, is that the level of costimulation detected through anti-CD28 is not as great as through natural ligand interactions (Fig. 2GoA). These results indicate that the difference in response between naive T cells and activated T cells cannot be attributed to a diminished ability of naive T cells to form cell:cell conjugates. Furthermore, this difference was also seen when the T cells were stimulated with PMA/ionomycin, bypassing proximal signaling events (Fig. 3GoB). Therefore, the increased response in activated T cells appears to be due, at least in part, to an increased sensitivity of downstream signaling events or changes in transcriptional regulation.



View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 3. Stimulation of naive and activated IL-2 luc/DO11.10 CD4+ T cells is independent of cell-cell interactions. Naive (10 x 106) or activated (2 x 106 in A; 10 x 106 in B) IL-2 luc/DO11.10 CD4+ T cells, as described in Fig. 2Go, were stimulated with plate-bound anti-CD3 alone or in combination with anti-CD28 (each at 10 µg/ml) (A) or PMA (10 ng/ml) plus ionomycin (0.5 µM) (B). T cells were lysed at 16 h, and luciferase activity was measured with normalization to background activity of T cells alone.

 
Both CD28 and LFA-1 costimulation can enhance IL-2 transcription

The decreased costimulation dependence for IL-2 secretion and luciferase activity in the activated T cells provides an advantage in our ability to analyze IL-2 transcription in this system. Stimulation of the activated T cells with ProAd alone can be used as the baseline from which to assess additional CD28- or LFA-1-mediated effects on IL-2 expression above and beyond that observed through TCR stimulation alone. To evaluate the effect of LFA-1:ICAM-1 interactions on IL-2 production in activated CD4+ T cells, IL-2 secretion, IL-2 mRNA production, and IL-2-luciferase expression were measured in an Ag dose response. Ag presentation by ProAd does induce expression from the IL-2-luciferase reporter construct, and this level of expression is enhanced by costimulation through LFA-1 across the dose response (Fig. 4GoA). To verify that the LFA-1-mediated enhanced IL-2-luciferase transcription did not simply reflect a shift in the dose response, we utilized Pro cell transfectants that express I-Ad covalently linked to the OVA323–339 peptide in the absence (ProAd/OVA) or presence of ICAM-1 (ProAd/OVA-ICAM) (14). These cells present 100-fold more functional class II:peptide complexes than can be presented when ProAd is loaded with maximal concentrations of exogenous OVA peptide (14). ProAd/OVA-ICAM-stimulated CD4+ IL-2 luc/DO11.10 T cells increase the maximum response of IL-2 reporter luciferase activity in comparison to that with ProAd/OVA stimulation (Fig. 4GoB). Thus, LFA-1 costimulation can enhance IL-2 transcription even at supraoptimal peptide doses. Similar effects of LFA-1 costimulation were seen when expression from the endogenous IL-2 gene was monitored (Fig. 4Go, C and D). As the relative level of IL-2 transcriptional activity correlated well with the level of IL-2 mRNA and IL-2 secretion, the ability of LFA-1 to promote IL-2 transcription may account for the ability of LFA-1 to costimulate T cell proliferation.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 4. IL-2 secretion and transcription in activated CD4+ T cells upon stimulation through B7-1 or ICAM-1. A, C, and D, Activated CD4+ lymph node T cells from IL-2 luc/DO11.10 TCR-transgenic mice were stimulated by ProAd (triangles), ProAd-B7 (squares), and ProAd-ICAM (circles) in the presence of increasing doses of OVA peptide. A, Cells were lysed at 16 h, and luciferase activity was measured. In B, activated T cells were stimulated with ProAd/OVA or ProAd/OVA-ICAM for 16 h and then assayed for luciferase activity. C, RNA was isolated from the cells 4 h after stimulation, and IL-2 mRNA was measured utilizing real-time RT-PCR. D, Supernatants were assayed for IL-2 secretion at 24 h by ELISA. A–C, Normalization was to background activity of APC plus T cells in the absence of Ag. Efficacy of cyclosporine was assessed by comparison of IL-2 mRNA levels in the absence and presence of cyclosporine. While evaluating the role of costimulation in the regulation of IL-2 expression under various conditions, greater than 10 experiments were performed and, in comparison with TCR stimulation alone, the relative increase upon LFA-1 costimulation ranges from ~2- to 5-fold in IL-2 secretion, ~2- to 20-fold in IL-2 mRNA, and ~1.5- to 10-fold in IL-2 transcription. The lower range of increase in magnitude for IL-2 secretion in comparison with IL-2 mRNA is consistent with IL-2 consumption. In comparison, CD28 costimulation results in a relative increase of ~15- to 150-fold in IL-2 secretion, ~10- to 100-fold in IL-2 mRNA, and ~2- to 10-fold in IL-2 transcription.

 
CD28 costimulation can also enhance expression of the IL-2-luciferase construct (Fig. 4GoA). In general, CD28 was 2- to 3-fold more effective than LFA-1 at enhancing IL-2-luciferase transcription, and 10- to 20-fold more effective at inducing IL-2 secretion. However, in some experiments, LFA-1 and CD28 costimulation induced equivalent levels of IL-2 transcription, but CD28 still induced a substantial increase in IL-2 secretion over that observed with LFA-1. Thus, CD28-mediated enhanced IL-2 transcription alone cannot account for the ability of CD28 to promote IL-2 production. This is most evident in Fig. 4Go at high doses of Ag in ProAd-B7-costimulated T cells, where IL-2 transcription plateaus, while IL-2 mRNA and IL-2 secretion continue to increase. The data support the important role of CD28 costimulation in regulating IL-2 production through enhanced mRNA stability (see below).

CD28, but not LFA-1, costimulation induces IL-2 mRNA stability

The enhanced IL-2 transcription upon LFA-1 costimulation clearly contributes to increased IL-2 mRNA; however, IL-2 gene expression is also regulated posttranscriptionally. As the predominant posttranscriptional regulation of IL-2 expression is through stabilization of IL-2 mRNA, we assessed the effect of LFA-1 stimulation on the t1/2 of IL-2 mRNA. Activated DO11.10 CD4+ T cells were incubated with the Pro cell transfectants in the presence or absence of Ag for 4 h. Actinomycin or cyclosporine was then added to block IL-2 transcription, and levels of IL-2 mRNA were determined at various time points. Actinomycin is traditionally used to inhibit transcription for purposes of studying mRNA stability; however, IL-2 mRNA has been found to be stabilized upon incubation with actinomycin (44). Initially, we performed the IL-2 mRNA stabilization experiments with actinomycin, but we also found artificial stabilization of IL-2 mRNA (data not shown). Therefore, the majority of experiments were conducted utilizing cyclosporine. Cyclosporine blocks IL-2 transcription by inhibiting calcineurin-dependent nuclear localization of NF-AT (45), and therefore has been used to specifically study IL-2 mRNA stabilization (46). In activated DO11.10 CD4+ T cells, stimulation with ProAd-ICAM did not result in stabilization of IL-2 mRNA compared with TCR stimulation alone. On occasion, ProAd-ICAM-stimulated T cells demonstrated a more rapid decline in IL-2 mRNA t1/2 in comparison with ProAd-stimulated T cells (Fig. 5GoA). Under these same conditions, stimulation with ProAd-B7 did increase the t1/2 of IL-2 mRNA to 4–6 h (Fig. 5Go, A and B), corroborating the known ability of CD28 to mediate IL-2 mRNA stabilization (35, 37, 46, 47). These results indicate that LFA-1 costimulation does not mediate stabilization of IL-2 mRNA in DO11.10 CD4+ T cells.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 5. IL-2 mRNA stabilization in activated DO11.10 CD4+ T cells upon stimulation through B7-1 or ICAM-1. Activated CD4+ lymph node T cells from DO11.10 TCR-transgenic were stimulated with ProAd (triangles), ProAd-B7 (squares), or ProAd-ICAM (circles) in the presence of maximal doses of OVA peptide (20 µg/ml). Cyclosporine (0.5 µg/ml) was added at 4-h poststimulation (at peak IL-2 mRNA levels), and relative IL-2 mRNA was measured at the time points indicated by real-time RT-PCR. A and B, Two separate experiments with measurements over different time courses. The fold increase in IL-2 mRNA is compared with levels in the absence of Ag, and normalization is to the level of IL-2 mRNA at the time of cyclosporine addition (time 0) in T cells stimulated with each of the Pro cell transfectants.

 
In contrast to our results, stimulation of LFA-1 in combination with anti-TCR stimulation in human T cells has been reported to stabilize the mRNA for a number of proteins, including IL-2 (48, 49). To resolve this discrepancy, we evaluated LFA-1-mediated effects on IL-2 mRNA stability under a number of different activation conditions. The inability of LFA-1 to stabilize IL-2 mRNA in the activated DO11.10 CD4+ T cells was not Ag dose-dependent, as both suboptimal (low Ag dose) and supraoptimal (using ProAd/OVA and ProAd/OVA-ICAM transfectants) TCR signals did not reveal enhanced IL-2 mRNA stability through LFA-1 costimulation (data not shown). The lack of IL-2 mRNA detected in ProAd-stimulated naive DO11.10 CD4+ T cells (Fig. 2GoB) does not allow for detection of LFA-1-mediated IL-2 mRNA stabilization relative to TCR stimulation in this population. Therefore, we evaluated IL-2 mRNA expression in T cells stimulated under conditions that inhibit Th cell differentiation (50). IL-2 mRNA is detected upon stimulation through the TCR alone in these Th precursor (Thp) cells, but IL-2 mRNA stabilization upon additional LFA-1 stimulation was not detected (data not shown). The mRNA of a number of other cytokines, such as IFN-{gamma}, also contain AU-rich elements and are regulated through mRNA stabilization. ProAd-ICAM-stimulated DO11.10 CD4+ T cells did not demonstrate stabilization of IFN-{gamma} mRNA, while stabilization of IFN-{gamma} mRNA did occur upon stimulation of the T cells with ProAd-B7 (data not shown). Finally, we tested whether the differences in our results from recently published results (48, 49) in the ability of LFA-1 to mediate mRNA stabilization may be secondary to differences in stimulation technique (natural ligand interactions vs Ab stimulation). A number of human anti-LFA-1 Abs have agonist activity, which has not been found to be the case with the murine anti-LFA-1 Abs. Therefore, we tested various anti-LFA-1 Abs for costimulatory activity. Only one of those examined, I21/7.7, enhanced IL-2 secretion upon coincubation with anti-CD3 mAb. Activated DO11.10 CD4+ T cells were stimulated with anti-CD3 mAb in combination with either anti-CD28 mAb or anti-CD11a mAb, and IL-2 mRNA stabilization was evaluated. Both anti-CD28 mAb and anti-CD11a mAb stimulation of activated CD4+ T cells resulted in enhanced IL-2 mRNA levels (Fig. 6GoA) and IL-2 secretion (data not shown) over that of anti-CD3 mAb stimulation alone. However, while anti-CD28 mAb stimulation stabilized IL-2 mRNA, anti-CD11a mAb stimulation did not (Fig. 6GoB). Of note is that the costimulation provided by Ab cross-linking through either CD28 or LFA-1, as measured by IL-2 mRNA levels, is not enhanced to the same degree as that observed upon natural ligand interactions. Therefore, in the context of a murine system utilizing natural ligands and cell-cell interactions, LFA-1:ICAM-1 interactions allow for enhanced IL-2 mRNA expression and subsequent enhanced IL-2 secretion through up-regulation of IL-2 transcription in the absence of IL-2 mRNA stabilization.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 6. IL-2 mRNA stabilization in activated DO11.10 CD4+ T cells upon stimulation through anti-CD28 or anti-LFA-1. Activated T cells from DO11.10 TCR-transgenic mice were stimulated with plate-bound anti-CD3 (2C11-145) and either anti-CD28 (PV-1), anti-CD11a (I21/7.7), or an isotype control Armenian hamster anti-TNP (A19-3) mAb. A, Fold increase in IL-2 mRNA levels at 3 h poststimulation, as compared with levels in the absence of Ab. B, Cyclosporine (0.5 µg/ml) was added at 3 h poststimulation (peak IL-2 mRNA response upon Ab stimulation), and relative IL-2 mRNA was measured at the time points indicated by real-time RT-PCR. The fold increase in IL-2 mRNA is compared with levels in the absence of Ab, and normalization is to the level of IL-2 mRNA at the time of cyclosporine addition (time 0). I21/7.7 was selected as the most effective mAb for T cell costimulation of IL-2 expression, as measured by IL-2 ELISA after screening a panel of anti-LFA-1 Abs (anti-CD11a mAbs 2D7, M17/4, M17/5.2, and I21/7.7; and anti-CD18 mAbs C71/16, M18/2, and 2E6).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The dependence of naive and activated CD4+ T cells on IL-2 for full activation and expansion points to IL-2 gene regulation as an essential juncture in effective T cell activation. Checkpoints of this regulation include transcriptional, posttranscriptional, and translational mechanisms (46, 51, 52). Various signals, including those through TCR stimulation alone, might result in activation of certain transcription factors necessary for IL-2 transcription, but ultimately IL-2 secretion requires the cooperative binding of a number of transcription factors to enable IL-2 transcription (53), along with adequate IL-2 mRNA t1/2. In this study, we have used transgenic mice expressing a reporter construct under the regulation of the IL-2 promoter, and analysis of IL-2 mRNA kinetics, to study the influence of LFA-1 on IL-2 gene regulation. In T cells containing the IL-2-luciferase reporter transgene, LFA-1 costimulates an enhanced level of IL-2-luciferase transcription that can account for the LFA-1-mediated costimulation of endogenous IL-2 expression. Furthermore, the enhanced level of endogenous IL-2 mRNA expression in primary murine T cells upon costimulation through LFA-1 is not mediated by stabilization of IL-2 mRNA, as opposed to what is observed upon costimulation through CD28. Therefore, we find that LFA-1:ICAM-1 interactions in activated DO11.10 CD4+ T cells influence IL-2 expression through transcriptional mechanisms, in the absence of mRNA stabilization.

The increased sensitivity to Ag dose, decreased costimulation dependence, and enhanced magnitude of effector responses by activated CD4+ T cells compared with naive T cells has been well described (7, 54, 55, 56, 57). Despite the decreased costimulation dependence in activated IL-2 luc/DO11.10 CD4+ T cells, LFA-1:ICAM-1 interactions consistently enhance IL-2 transcription compared with the engagement of the TCR alone. Therefore, as observed in naive CD4+ T cells (11, 13, 14), LFA-1 does effectively costimulate activated T cells. The mechanism of these altered characteristics of effector T cells, in comparison with those of naive T cells, is not yet understood. Considerations have included the preferential selection of T cells utilizing a higher affinity TCR, an increased precursor frequency of signaling molecules, or a more efficient arrangement of these molecules, as has been described in the case of the targeting of Lck to the CD8 coreceptor in the case of CD8+ T cells (57). Our data demonstrate that the differential magnitude of response in naive vs activated T cells was maintained upon PMA/ionomycin stimulation, suggesting that downstream signals and/or transcriptional regulation play a significant role in this differential response.

The lack of detectable luciferase activity upon stimulation of naive CD4+ T cells from IL-2 luc/DO11.10 mice with ProAd-ICAM was initially surprising because endogenous IL-2 mRNA is readily detectable by RT-PCR (11) and real-time RT-PCR (data not shown) in the same T cells. Although the IL-2-luciferase transgene contains the dominant proximal enhancer sequence, it lacks the locus control region that provides for integration site-independent expression (58). Therefore, expression of this transgene relies on integration into a site that is accessible in T cells. However, low levels of IL-2-luciferase transcription in the naive CD4+ T cells appear to be a threshold-related phenomenon, not an artifact of flanking regions at the integration site of the transgene. The increased levels of transcription detected in activated CD4+ T cells from IL-2 luc/DO11.10 mice are consistently observed under different costimulation conditions, with anti-CD3/anti-CD28, and with PMA/ionomycin. Furthermore, the level of IL-2-luciferase expression demonstrates analogous regulation to that of endogenous IL-2. Therefore, the IL-2 luc/DO11.10 mice serve as a useful system to better define the kinetics and dose-response characteristics of IL-2 gene expression through LFA-1 stimulation.

The interaction of LFA-1 with ICAM-1 in DO11.10 CD4+ T cells mediates the up-regulation of IL-2 mRNA relative to TCR stimulation alone by transcriptional regulation in the absence of IL-2 mRNA stabilization. We have considered two possible mechanisms that might account for the ability of LFA-1 to regulate IL-2 gene transcription. First, LFA-1 itself might initiate a signaling pathway that, along with signals generated from the interaction of the TCR with its ligand, provides for T cell activation. There is much evidence that integrins can transduce important biological signals, and this role has been well documented in nonlymphoid cells (for reviews, see Refs. 17, 59 , and 60). A number of these signals, such as Vav (61), JNK (37, 62), and JAB1 (63), can functionally cooperate to enable IL-2 gene expression. However, in T cells, LFA-1 engagement has not been clearly associated with a distinct intracellular signaling pathway. There is evidence that coligation of LFA-1 and TCR can lead to a sustained intracellular calcium response, increased inositol phopholipid hydrolysis, and association with DNAX accessory molecule-1; increased focal adhesion kinase, proline-rich tryosine kinase 2, JNK, PI3K, and extracellular signal-related kinase-2 activity (18, 19, 20, 21, 22, 23, 24, 25); and recruitment of protein kinase C-{theta} to the immunological synapse.4 Differential signals transduced through LFA-1 and CD28 most likely contribute to the difference in IL-2 transcription levels, as well as the differential ability to stabilize IL-2 mRNA. These differences have not been defined, although PI3K activity demonstrates a differential response in CD8+ T cells to the two modes of costimulation (21). Whether the enhanced responses upon LFA-1 engagement result from increased signals mediated through the TCR complex or independent signals transduced through LFA-1 and, if so, how these LFA-1-mediated signals are integrated with TCR signaling pathways have not been clearly established.

Second, LFA-1 may function in the structural organization of the adhesion complex between T cells and APC, termed the immunological synapse or supramolecular activation cluster. LFA-1 segregates into the outer perimeter of the adhesion complex, while TCR and engaged MHC:peptide complexes, as well as other molecules, segregate into a small central subdomain of the cell:cell contact region (27, 28). In fact, class II:peptide and LFA-1:ICAM-1 interactions in a lipid bilayer system are sufficient to allow for the formation of the immunological synapse (28). The focal concentration of TCR within the adhesion complex might facilitate serial engagement of the TCR on a limited number of MHC:peptide complexes (64) and/or might allow for more efficient lateral interactions that ultimately lead to ligand-induced multimerization of the TCR (65). The level of TCR oligomerization could alter the magnitude and quality of TCR signaling (66, 67, 68). Given the association of LFA-1 with the cytoskeleton (69, 70, 71, 72, 73, 74) and its enhanced recruitment into lipid rafts (75), LFA-1 may be contributing to the assembly and organization of these various Ag receptors, coreceptors, and adhesion and signaling molecules within immunological synapse (26),4 which ultimately contributes to T cell activation. These functions of LFA-1 may play a role in the recruitment of the TCR and associated signal-transducing molecules to lipid rafts upon T cell activation (76, 77, 78, 79, 80), which, in turn, influence subsequent signaling events, such as a sustained calcium signal (19). Finally, the ability of LFA-1 to reorganize the actin cytoskeleton in the context of TCR engagement has been reported to be a form of anchorage dependence, enabling G1 to S phase transition with subsequent IL-2 secretion (24).

We have also found that CD28 costimulation can enhance IL-2-luciferase transcription. In previous studies, the ability of CD28 to enhance IL-2 transcription has been somewhat controversial. This pathway has been best established in human T cells, where CD28 costimulation targets a response element (CD28RE) within the proximal IL-2 enhancer that binds AP-1 and NF-{kappa}B (30, 31, 32, 81, 82). The ability of CD28 to enhance JNK activity and induce AP-1 and NF-{kappa}B activation is consistent with its role in up-regulation of IL-2 transcription through the CD28RE (83, 84, 85, 86, 87). However, in most studies, transcriptional activity from this site is only detectable when CD28 costimulation is supplemented with PMA. Furthermore, most of the data have been generated in Jurkat T cell tumor lines. In one study of normal human T cells, CD28 costimulation did increase expression of a transfected IL-2-luciferase reporter construct, but mutation of the CD28RE had little effect on transcriptional activity (33). In murine Th1 clones, stable transfection of an IL-2 reporter construct has not supported a role for CD28 costimulation in IL-2 transcription (36, 88). Finally, recent results from transgenic mice expressing green fluorescent protein inserted into the IL-2 locus have shown that anti-CD28 can costimulate anti-CD3-mediated induction of green fluorescent protein expression in freshly isolated T cells (89). Our results using the IL-2-luciferase construct and following endogenous IL-2 mRNA expression clearly demonstrate that CD28:B7-1 interactions enhance IL-2 transcription during Ag stimulation of primary murine T cells.

In addition to transcriptional regulation, IL-2 expression is also controlled by posttranscriptional mechanisms, most notably mRNA stabilization. We have found that costimulation through LFA-1 does not stabilize IL-2 mRNA in DO11.10-activated CD4+ T cells. In contrast, two recent reports have indicated that LFA-1 costimulation of human T cells can mediate stabilization of several mRNA molecules, including IL-2 (48, 49). Most of our understanding of the mechanism of IL-2 mRNA stability comes from studies of CD28 costimulation (35, 37, 47, 62). The rapid degradation of unstable mRNA molecules is mediated by AU-rich regions in the 3' untranslated region (UTR). CD28-mediated stabilization of IL-2 mRNA is dependent on sequences in the 5' UTR and the coding region as well as the 3' UTR (36, 37). Within the IL-2 3' UTR there are several clusters of AU-rich elements, and JNK-mediated stabilization requires the first cluster of four AUUUA pentameric regions (37). In contrast, in the case of urokinase plasminogen-activating receptor mRNA, LFA-1 activation is able to modulate the effects of a destabilizing nonameric AU-rich sequence in the 3' UTR (48). Finally, two RNA-binding proteins, nucleolin and YB-1, bind to the 5' UTR in human IL-2 to mediate JNK-induced stabilization (62). However, it is not clear whether IL-2 mRNA stability is regulated the same in murine and human T cells. Although CD28-mediated IL-2 mRNA stability is thought to be transmitted through JNK in human Jurkat T cells (37), JNK is not required for CD28-mediated costimulation of T cell activation and IL-2 production in mice (90). Although we cannot exclude technical differences, such as the nature of the stimulatory Abs or the responding T cells used, these results raise the possibility that differences in the signaling pathways and RNA-binding proteins, as well as structural difference in the IL-2 gene, may contribute to the differences in regulation of human vs murine IL-2 mRNA.


   Acknowledgments
 
We thank Lisa Sevilla, Christine Guo, and Marisa Alegre for helpful discussions, and Jeff Hanke, Terry Barrett, Jeff Bluestone, Carl June, Trevor Owens, and Linda Zuckerman for providing reagents.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant AI48237 (to J.M). C.A. was supported by a grant from the American Digestive Health Foundation and the Gastro-Intestinal Research Foundation Associate Board. Back

2 Address correspondence and reprint requests to Dr. Jim Miller, Molecular Genetics and Cell Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637. E-mail address: jmiller{at}midway.uchicago.edu Back

3 Abbreviations used in this paper: JNK, c-Jun N-terminal kinase; CD28RE, CD28 response element; PI3K, phosphatidylinositol 3-kinase; TNP, trinitrophenol; UTR, untranslated region. Back

4 C. E. Sedwick, K. Blaine, and J. Miller. Focusing of PKC{theta} in the c-SMAC and activation of NF-{kappa}B is mediated by CD28 costimulation. Submitted for publication. Back

Received for publication June 8, 2001. Accepted for publication September 5, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kurzinger, K., T. Reynolds, R. N. Germain, D. Davignon, E. Martz, T. A. Springer. 1981. A novel LFA-1: cellular distribution, quantitative expression, and structure. J. Immunol. 127:596.[Abstract]
  2. Lub, M., Y. van Kooyk, C. G. Figdor. 1995. Ins and outs of LFA-1. Immunol. Today 16:479.[Medline]
  3. Randolph, G., M. Furie. 1996. Mononuclear phagocytes egress from an in vitro model of the vascular wall by migrating across endothelium in the basal to apical direction: role of intercellular adhesion molecule 1 and the CD11/CD18 integrins. J. Exp. Med. 183:451.[Abstract/Free Full Text]
  4. Warnock, R., S. Askari, E. Butcher, U. von Andrian. 1998. Molecular mechanisms of lymphocyte homing to peripheral lymph nodes. J. Exp. Med. 187:205.[Abstract/Free Full Text]
  5. Kuhlman, P., V. T. Moy, B. A. Lollo, A. A. Brian. 1991. The accessory function of murine intercellular adhesion molecule-1 in T lymphocyte activation: contributions of adhesion and coactivation. J. Immunol. 146:1773.[Abstract]
  6. Bachmann, M. F., K. McKall-Faienza, R. Schmits, D. Bouchard, J. Beach, D. E. Speiser, T. W. Mak, P. S. Ohashi. 1997. Distinct roles for LFA-1 and CD28 during activation of naive T cells: adhesion versus costimulation. Immunity 7:549.[Medline]
  7. Iezzi, G., K. Karjalainen, A. Lanzavecchia. 1998. The duration of antigenic stimulation determines the fate of naive and effector T cells. Immunity 8:89.[Medline]
  8. Van Seventer, G. A., Y. Shimizu, K. J. Horgan, S. Shaw. 1990. The LFA-1 ligand ICAM-1 provides an important costimulatory signal for TCR-mediated activation of resting T cells. J. Immunol. 144:4579.[Abstract]
  9. Van Seventer, G. A., W. Newman, Y. Shimizu, T. B. Nutman, Y. Tanaka, K. J. Horgan, T. V. Gopal, E. Ennis, D. O’Sullivan, H. Grey, S. Shaw. 1991. Analysis of T cell stimulation by superantigen plus major histocompatibility complex class II molecules or by CD3 monoclonal antibody: costimulation by purified adhesion ligands VCAM-1, ICAM-1, but not ELAM-1. J. Exp. Med. 174:901.[Abstract/Free Full Text]
  10. Gaglia, J. L., E. A. Greenfield, A. Mattoo, A. H. Sharpe, G. J. Freeman, V. K. Kuchroo. 2000. Intercellular adhesion molecule 1 is critical for activation of CD28-deficient T cells. J. Immunol. 165:6091.[Abstract/Free Full Text]
  11. Zuckerman, L. A., L. Pullen, J. Miller. 1998. Functional consequences of costimulation by ICAM-1 on IL-2 gene expression and T cell activation. J. Immunol. 160:3259.[Abstract/Free Full Text]
  12. Dubey, C., M. Croft, S. L. Swain. 1995. Costimulatory requirements of naive CD4+ T cells: intercellular adhesion molecule 1 or B7-1 can costimulate naive CD4 T cell activation but both are required for optimum response. J. Immunol. 155:45.[Abstract]
  13. Cai, Z., H. Kishimoto, A. Brunmark, M. R. Jackson, P. A. Peterson, J. Sprent. 1997. Requirements for peptide-induced T cell receptor down-regulation on naive CD8+ T cells. J. Exp. Med. 185:641.[Abstract/Free Full Text]
  14. Abraham, C., J. Griffith, J. Miller. 1999. The dependence for leukocyte function-associated antigen-1/ICAM-1 interactions in T cell activation cannot be overcome by expression of high density TCR ligand. J. Immunol. 162:4399.[Abstract/Free Full Text]
  15. Shier, P., K. Ngo, W.-P. Fung-Leung. 1999. Defective CD8+ T cell activation and cytolytic function in the absence of LFA-1 cannot be restored by increased TCR signaling. J. Immunol. 163:4826.[Abstract/Free Full Text]
  16. Goldstein, J. S., T. Chen, M. Brunswick, H. Mostowsky, S. Kozlowski. 1998. Purified MHC class I and peptide complexes activate naive CD8+ T cells independently of the CD28/B7 LFA-1/intercellular adhesion molecule 1 costimulatory interactions. J. Immunol. 160:3180.[Abstract/Free Full Text]
  17. Giancotti, F. G., E. Ruoslahti. 1999. Integrin signaling. Science 285:1028.[Abstract/Free Full Text]
  18. Van Seventer, G. A., E. Bonvini, H. Yamada, A. Conti, S. Stringfellow, C. H. June, S. Shaw. 1992. Costimulation of TCR/CD3-mediated activation of resting human CD4+ T cells by leukocyte function-associated antigen-1 ligand intercellular adhesion molecule-1 involves prolonged inositol phopholipid hydrolysis and sustained increase of intracellular Ca2+ levels. J. Immunol. 149:3872.[Abstract]
  19. Wülfing, C., M. Sjaastad, M. Davis. 1998. Visualizing the dynamics of T cell activation: ICAM-1 migrates rapidly to the T cell/B cell interface and acts to sustain calcium levels. Proc. Natl. Acad. Sci. USA 95:6302.[Abstract/Free Full Text]
  20. Rovere, P., L. Inverardi, J. R. Bender, R. Pardi. 1996. Feedback modulation of ligand-engaged {alpha}L/{beta}2 leukocyte integrin (LFA-1) by cyclic AMP-dependent protein kinase. J. Immunol. 156:2273.[Abstract]
  21. Ni, H. T., M. J. Deeths, W. Li, D. L. Mueller, M. F. Mescher. 1999. Signaling pathways activated by leukocyte function-associated antigen-1-dependent costimulation. J. Immunol. 162:5183.[Abstract/Free Full Text]
  22. Rodriguez-Fernandez, J. L., M. Gomez, A. Luque, N. Hogg, F. Sanchez-Madrid, C. Cabanas. 1999. The interaction of activated integrin lymphocyte function-associated antigen 1 with ligand intercellular adhesion molecule 1 induces activation and redistribution of focal adhesion kinase and proline-rich tyrosine kinase 2 in T lymphocytes. Mol. Biol. Cell 10:1891.[Abstract/Free Full Text]
  23. Tabassam, F. H., H. Umehara, J. Y. Huang, S. Gouda, T. Kono, T. Okazaki, J. M. van Seventer, N. Domae. 1999. {beta}2-integrin, LFA-1, and TCR/CD3 synergistically induce tyrosine phophorylation of focal adhesion kinase (pp125(FAK)) in PHA-activated T cells. Cell. Immunol. 193:179.[Medline]
  24. Geginat, J., G. Bossi, J. R. Bender, R. Pardi. 1999. Anchorage dependence of mitogen-induced G1 to S transition in primary T lymphocyes. J. Immunol. 162:5085.[Abstract/Free Full Text]
  25. Shibuya, K., L. L. Lanier, J. H. Phillips, H. D. Ochs, K. Shimizu, E. Nakayama, H. Nakauchi, A. Shibuya. 1999. Physical and functional association of LFA-1 with DNAM-1 adhesion molecule. Immunity 11:615.[Medline]
  26. Wülfing, C., M. M. Davis. 1998. A receptor/cytoskeletal movement triggered by costimulation during T cell activation. Science 282:2266.[Abstract/Free Full Text]
  27. Monks, C. R. F., B. A. Freiberg, H. Kupfer, N. Sciaky, A. Kupfer. 1998. Three-dimensional segregation of supramolecular activation clusters in T cells. Nature 395:82.[Medline]
  28. Grakoui, A., S. K. Bromley, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen, M. L. Dustin. 1999. The immunological synapse: a molecular machine controlling T cell activation. Science 285:221.[Abstract/Free Full Text]
  29. Dustin, M. L., J. A. Cooper. 2000. The immunological synapse and the actin cytoskeleton: molecular hardware for T cell signaling. Nat. Immun. 1:23.
  30. Fraser, J. D., B. A. Irving, G. R. Crabtree, A. Weiss. 1991. Regulation of interleukin-2 gene enhancer activity by the T cell accessory molecule CD28. Science 251:313.[Abstract/Free Full Text]
  31. Lai, J.-H., G. Horvath, J. Subleski, J. Bruder, P. Ghosh, T.-H. Tan. 1995. RelA is a potent transcriptional activator of the CD28 response element within the interleukin 2 promoter. Mol. Cell. Biol. 15:4260.[Abstract]
  32. Shapiro, V. S., K. E. Truitt, J. B. Imboden, A. Weiss. 1997. CD28 mediates transcriptional up-regulation of the interleukin-2 (IL-2) promoter through a composite element containing the CD28RE and NF-IL-2B AP-1 sites. Mol. Cell. Biol. 17:4051.[Abstract]
  33. Hughes, C. C. W., J. S. Pober. 1996. Transcriptional regulation of the interleukin-2 gene in normal human peripheral blood T cells. J. Biol. Chem. 271:5369.[Abstract/Free Full Text]
  34. Butscher, W. G., C. Powers, M. Olives, C. Vinson, K. Gardner. 1998. Coordinate transactivation of the interleukin-2 CD28 response element by c-Rel and ATF-1/CREB2. J. Biol. Chem. 273:552.[Abstract/Free Full Text]
  35. Lindsten, T., C. H. June, J. A. Ledmetter, G. Stella, C. B. Thompson. 1989. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244:339.[Abstract/Free Full Text]
  36. Umlauf, S. W., B. Beverly, O. Lantz, R. H. Schwartz. 1995. Regulation of interleukin 2 gene expression by CD28 costimulation in mouse T-cell clones: both nuclear and cytoplasmic RNAs are regulated with complex kinetics. Mol. Cell. Biol. 15:3197.[Abstract]
  37. Chen, C.-Y., F. Del Gatto-Konczak, Z. Wu, M. Karin. 1998. Stabilization of interleukin-2 mRNA by the c-Jun NH2-terminal kinase pathway. Science 280:1945.[Abstract/Free Full Text]
  38. Zuckerman, L. A., A. J. Sant, J. Miller. 1995. Identification of a unique costimulatory activity for murine Th1 T cell clones. J. Immunol. 154:4503.[Abstract]
  39. Jenks, S. A., J. Miller. 1999. Inhibition of IL-4 responses after T cell priming in the context of LFA-1 costimulation is not reversed by restimulation in the presence of CD28 costimulation. J. Immunol. 164:72.[Abstract/Free Full Text]
  40. Brunner, M. C., C. A. Chambers, F. K.-M. Chan, J. Hanke, A. Winoto, J. P. Allison. 1999. CTLA-4-mediated inhibition of early events of T cell proliferation. J. Immunol. 162:5813.[Abstract/Free Full Text]
  41. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+ TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  42. Haskins, K., R. Kubo, J. White, M. Pigeon, J. Kappler, P. Marrack. 1983. The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J. Exp. Med. 157:1149.[Abstract/Free Full Text]
  43. Lee, W. T., J. Cole-Calkins, N. E. Street. 1996. Memory T cell development in the absence of specific antigen priming. J. Immunol. 157:5300.[Abstract]
  44. Shaw, J., K. Meerovitch, R. C. Bleackley, V. Paetkau. 1988. Mechanisms regulating the level of IL-2 mRNA in T lymphocytes. J. Immunol. 140:2243.[Abstract]
  45. Kiani, A., A. Rao, J. Aramburu. 2000. Manipulating immune responses with immunosuppressive agents that target NFAT. Immunity 12:359.[Medline]
  46. Powell, J. D., J. A. Ragheb, S. Kitagawa-Sakakida, R. H. Schwartz. 1998. Molecular regulation of interleukin-2 expression by CD28 co-stimulation and anergy. Immunol. Rev. 165:287.[Medline]
  47. Ragheb, J. A., M. Deen, R. H. Schwartz. 1999. CD28-mediated regulation of mRNA stability requires sequences within the coding region of the IL-2 mRNA. J. Immunol. 163:120.[Abstract/Free Full Text]
  48. Wang, G. J., M. Collinge, F. Blasi, R. Pardi, J. R. Bender. 1998. Posttranscriptional regulation of urokinase plasminogen activator receptor messenger RNA levels by leukocyte integrin engagement. Proc. Natl. Acad. Sci. USA 95:6296.[Abstract/Free Full Text]
  49. Geginat, J., B. Clissi, M. Moro, P. Dellabona, J. R. Bender, R. Pardi. 2000. CD28 and LFA-1 contribute to cyclosporin A-resistant T cell growth by stabilizing the IL-2 mRNA through distinct signaling pathways. Eur. J. Immunol. 30:1136.[Medline]
  50. Sad, S., T. R. Mosmann. 1994. Single IL-2-secreting precursor CD4 T cell can develop into either Th1 or Th2 cytokine secretion phenoytpe. J. Immunol. 153:3514.[Abstract]
  51. Umlauf, S. W., B. Beverly, S.-M. Kang, K. Brorson, A.-C. Tran, R. H. Schwartz. 1993. Molecular regulation of the IL-2 gene: rheostatic control of the immune system. Immunol. Rev. 1993:177.
  52. Jain, J., C. Loh, A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333.[Medline]
  53. Garrity, P. A., D. Chen, E. V. Rothenberg, B. J. Wold. 1994. Interleukin-2 transcription is regulated in vivo at the level of coordinated binding of both constitutive and regulated factors. Mol. Cell. Biol. 14:2159.[Abstract/Free Full Text]
  54. Fischer, H., A. Gjörloff, G. Hedlund, H. Hedman, E. Lundgren, T. Kalland, H. O. Sjögren, M. Dohlsten. 1992. Stimulation of human naive and memory Th cells with bacterial superantigen: naive CD4+45RA T cells require a costimulatory signal mediated through the LFA-1/intercellular adhesion molecule-1 pathway. J. Immunol. 148:1993.[Abstract]
  55. Croft, M.. 1994. Activation of naive, memory and effector T cells. Curr. Opin. Immunol. 6:431.[Medline]
  56. Dubey, C., M. Croft, S. L. Swain. 1996. Naive and effector CD4 T cells differ in their requirements for TCR versus costimulatory signals. J. Immunol. 157:3280.[Abstract]
  57. Bachmann, M. F., A. Gallimore, S. Linkert, V. Cerundolo, A. Lanzavecchia, M. Kopf, A. Viola. 1999. Developmental regulation of Lck targeting to the CD8 coreceptor controls signaling in naive and memory T cells. J. Exp. Med. 189:1521.[Abstract/Free Full Text]
  58. Yui, M. A., G. Hernández-Hoyos, E. V. Rothenberg. 2001. A new regulatory region of the IL-2 locus that confers position-independent transgene expression. J. Immunol. 166:1730.[Abstract/Free Full Text]
  59. Dedhar, S., G. E. Hannigan. 1996. Integrin cytoplasmic interactions and bidirectional transmembrane signalling. Curr. Opin. Cell Biol. 8:657.[Medline]
  60. Parsons, J. T.. 1996. Integrin-mediated signalling: regulation by protein tyrosine kinases and small GTP-binding proteins. Curr. Opin. Cell Biol. 8:146.[Medline]
  61. Wu, J., D. G. Motto, G. A. Koretzky, A. Weiss. 1996. Vav and SLP-76 interact and functionally cooperate in IL-2 gene activation. Immunity 4:593.[Medline]
  62. Chen, C.-Y., R. Gherzi, J. S. Andersen, G. Gaietta, K. Jürchott, H.-D. Royer, M. Mann, M. Karin. 2000. Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev. 14:1236.[Abstract/Free Full Text]
  63. Bianchi, E., S. Denti, A. Granata, G. Bossi, J. Geginat, A. Villa, L. Rogge, R. Pardi. 2000. Integrin LFA-1 interacts with the transcriptional co-activator JAB1 to modulate AP-1 activity. Nature 404:617.[Medline]
  64. Valitutti, S., A. Lanzavecchia. 1997. Serial triggering of TCRs: a basis for the sensitivity and specificity of antigen recognition. Immunol. Today 18:299.[Medline]
  65. Reich, Z., J. J. Boniface, D. S. Lyons, N. Borochov, E. J. Wachtel, M. M. Davis. 1997. Ligand-specific oligomerization of T-cell receptor molecules. Nature 387:617.[Medline]
  66. Germain, R. N.. 1997. T-cell signaling: the importance of receptor clustering. Curr. Biol. 7:R640.[Medline]
  67. Boniface, J. J., J. D. Rabinowitz, C. Wülfing, J. Hampl, R. M. Kantor, C. Beeson, H. M. McConnell, M. M. Davis. 1998. Initiation of signal transduction through the T cell receptor requires the peptide multivalent engagement of MHC ligands. Immunity 9:459.[Medline]
  68. Alam, S. M., G. M. Davies, C. M. Lin, T. Zal, W. Nasholds, S. C. Jameson, K. A. Hogquist, N. R. J. Gascoigne, P. J. Travers. 1999. Qualitative and quantitative differences in T cell receptor binding of agonist and antagonist ligands. Immunity 10:227.[Medline]
  69. Lub, M., Y. van Kooyk, S. J. van Vliet, C. G. Figdor. 1997. Dual role of the actin cytoskeleton in regulating cell adhesion mediated by the integrin lymphocyte function-associated molecule-1. Mol. Biol. Cell 8:341.[Abstract]
  70. Pavalko, F. M., S. M. LaRoche. 1993. Activation of human neutrophils induces an interaction between the integrin {beta}2-subunit (CD18) and the actin-binding protein {alpha}-actinin. J. Immunol. 151:3795.[Abstract]
  71. Sharma, C. P., R. M. Ezzell, M. A. Arnaout. 1995. Direct interaction of filamin (ABP-280) with the {beta}2-integrin subunit CD18. J. Immunol. 154:3461.[Abstract]
  72. Pardi, R., L. Inverardi, C. Rugarli, J. R. Bender. 1992. Antigen-receptor complex stimulation triggers protein kinase C-dependent CD11a/CD18-cytoskeleton association in T lymphocytes. J. Cell Biol. 116:1211.[Abstract/Free Full Text]
  73. Peter, K., T. E. O’Toole. 1995. Modulation of cell adhesion by changes in {alpha}L{beta}2 (LFA-1, CD11a/CD18) cytoplasmic domain/cytoskeleton interaction. J. Exp. Med. 181:315.[Abstract/Free Full Text]
  74. Pardi, R., G. Bossi, L. Inverardi, E. Rovida, J. R. Bender. 1995. Conserved regions in the cytoplasmic domains of the leukocyte integrin {alpha}L{beta}2 are involved in endoplasmic reticulum retention, dimerization, and cytoskeletal association. J. Immunol. 155:1252.[Abstract]
  75. Krauss, K., P. Altevogt. 1999. Integrin leukocyte function-associated antigen-1-mediated cell binding can be activated by clustering of membrane rafts. J. Biol. Chem. 274:36921.[Abstract/Free Full Text]
  76. Xavier, R., T. Brennan, Q. Li, C. McCormack, B. Seed. 1998. Membrane compartmentation is required for efficient T cell activation. Immunity 8:723.[Medline]
  77. Zhang, W., R. P. Trible, L. E. Samelson. 1998. LAT palmitoylation: its essential role in membrane microdomain targeting and tyrosine phosphorylation during T cell activation. Immunity 9:239.[Medline]
  78. Montixi, C., C. Langlet, A.-M. Bernard, J. Thimonier, C. Dubois, M.-A. Wurbel, J.-P. Chauvin, M. Pierres, H.-T. He. 1998. Engagement of T cell receptor triggers its recruitment to low-density detergent-insoluble membrane domains. EMBO J. 17:5334.[Medline]
  79. Moran, M., M. C. Miceli. 1998. Engagement of GPI-linked CD48 contributes to TCR signals and cytoskeletal reorganization: a role for lipid rafts in T cell activation. Immunity 9:787.[Medline]
  80. Viola, A., S. Schroeder, Y. Sakakibara, A. Lanzavecchia. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680.[Abstract/Free Full Text]
  81. McGuire, K. L., M. Iacobelli. 1997. Involvement of Rel, Fos, and Jun proteins in binding activity to the IL-2 promoter CD28 response element/AP-1 sequence in human T cells. J. Immunol. 159:1319.[Abstract]
  82. Maggirwar, S. B., E. W. Harhaj, S. C. Sun. 1997. Regulation of the interleukin-2 CD28-responsive element by NF-ATp and various NF-{kappa}B/Rel transcription factors. Mol. Cell. Biol. 17:2605.[Abstract]
  83. Rincón, M., R. A. Flavell. 1994. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J. 13:4370.[Medline]
  84. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, Y. Ben-Neriah. 1994. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77:727.[Medline]
  85. Kempiak, S. J., T. S. Hiura, A. E. Nel. 1999. The Jun kinase cascade is reponsible for activating the CD28 response element of the IL-2 promoter: proof of cross-talk with the I{kappa}B kinase cascade. J. Immunol. 162:3176.[Abstract/Free Full Text]
  86. Khoshnan, A., S. J. Kempiak, B. L. Bennett, D. Bae, W. Xu, A. M. Manning, C. H. June, A. E. Nel. 1999. Primary human CD4+ T cells contain heterogeneous I{kappa}B kinase complexes: role in activation of the IL-2 promoter. J. Immunol. 163:5444.[Abstract/Free Full Text]
  87. Kane, L. P., P. G. Andres, K. C. Howland, A. K. Abbas, A. Weiss. 2001. Akt provides the CD28 costimulatory signal for up-regulation of IL-2 and IFN-{gamma} but not Th2 cytokines. Nat. Immunol. 2:37.[Medline]
  88. Kitagawa-Sakakida, S., R. H. Schwartz. 1996. Multifactor cis-dominant negative regulation of IL-2 gene expression in anergized T cells. J. Immunol. 157:2328.[Abstract]
  89. Naramura, M., R.-J. Hu, H. Gu. 1998. Mice with a fluorescent marker for interleukin 2 gene activation. Immunity 9:209.[Medline]
  90. Dong, C., D. D. Yang, C. Tournier, A. J. Whitmarsh, J. Xu, R. J. Davis, R. A. Flavell. 2000. JNK is required for effector T-cell function but not for T-cell activation. Nature 405:91.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
B. Graf, T. Bushnell, and J. Miller
LFA-1-Mediated T Cell Costimulation through Increased Localization of TCR/Class II Complexes to the Central Supramolecular Activation Cluster and Exclusion of CD45 from the Immunological Synapse
J. Immunol., August 1, 2007; 179(3): 1616 - 1624.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Marski, A. L. Ye, and C. Abraham
CD18 Is Required for Intestinal T Cell Responses at Multiple Immune Checkpoints
J. Immunol., February 15, 2007; 178(4): 2104 - 2112.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Sanchez-Lockhart and J. Miller
Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription.
J. Immunol., April 15, 2006; 176(8): 4778 - 4784.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Marski, S. Kandula, J. R. Turner, and C. Abraham
CD18 Is Required for Optimal Development and Function of CD4+CD25+ T Regulatory Cells
J. Immunol., December 15, 2005; 175(12): 7889 - 7897.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Parameswaran, R. Suresh, V. Bal, S. Rath, and A. George
Lack of ICAM-1 on APCs during T Cell Priming Leads to Poor Generation of Central Memory Cells
J. Immunol., August 15, 2005; 175(4): 2201 - 2211.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Blank, I. Brown, A. K. Kacha, M. A. Markiewicz, and T. F. Gajewski
ICAM-1 Contributes to but Is Not Essential for Tumor Antigen Cross-Priming and CD8+ T Cell-Mediated Tumor Rejection In Vivo
J. Immunol., March 15, 2005; 174(6): 3416 - 3420.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Sanchez-Lockhart, E. Marin, B. Graf, R. Abe, Y. Harada, C. E. Sedwick, and J. Miller
Cutting Edge: CD28-Mediated Transcriptional and Posttranscriptional Regulation of IL-2 Expression Are Controlled through Different Signaling Pathways
J. Immunol., December 15, 2004; 173(12): 7120 - 7124.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Kandula and C. Abraham
LFA-1 on CD4+ T Cells Is Required for Optimal Antigen-Dependent Activation In Vivo
J. Immunol., October 1, 2004; 173(7): 4443 - 4451.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
F. V. Rivas, J. P. O'Keefe, M.-L. Alegre, and T. F. Gajewski
Actin Cytoskeleton Regulates Calcium Dynamics and NFAT Nuclear Duration
Mol. Cell. Biol., February 15, 2004; 24(4): 1628 - 1639.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
S. C. Barlow, H. Xu, C. T. Weaver, J. R. Lindsey, T. R. Schoeb, and D. C. Bullard
Development of dermatitis in CD18-deficient PL/J mice is not dependent on bacterial flora, and requires both CD4+ and CD8+ T lymphocytes
Int. Immunol., February 1, 2004; 16(2): 345 - 351.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
T. O. Yarovinsky, M. M. Monick, and G. W. Hunninghake
Integrin Receptors Are Crucial for the Restimulation of Activated T Lymphocytes
Am. J. Respir. Cell Mol. Biol., May 1, 2003; 28(5): 607 - 615.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Kaburagi, M. Hasegawa, T. Nagaoka, Y. Shimada, Y. Hamaguchi, K. Komura, E. Saito, K. Yanaba, K. Takehara, T. Kadono, et al.
The Cutaneous Reverse Arthus Reaction Requires Intercellular Adhesion Molecule 1 and L-Selectin Expression
J. Immunol., March 15, 2002; 168(6): 2970 - 2978.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abraham, C.
Right arrow Articles by Miller, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abraham, C.
Right arrow Articles by Miller, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS